KR102182999B1 - Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same - Google Patents

Abstract

The present invention provides a recombinant influenza A virus, a method for preparing the same, and a vaccine composition against H5 serotype influenza A virus belonging to clade 2.3.4.4B including the same. The present invention can contribute to disease control through a protective effect against the outbreak of H5 serotype highly pathogenic avian influenza introduced from abroad or occurring in Korea by manufacturing a recombinant vaccine that exhibits a protective effect against highly pathogenic avian influenza virus. In addition, the vaccine composition is not only weak pathogenicity and excellent safety because the highly pathogenic gene in the HA segment is removed, but also has excellent proliferation in egg (egg) and protective ability in chickens.

Description

Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same} Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same}

The present invention relates to a vaccine composition against recombinant influenza A virus and H5 serotype influenza A virus belonging to clade 2.3.4.4B comprising the same.

Influenza Virus is an RNA virus belonging to Family Orthomyxoviridae, and its serotypes are classified into three types: A, B, and C. Among them, B-type and C-type infections have been confirmed only in humans, and A-type infection has been confirmed in humans, horses, pigs, and other mammals as well as various types of poultry and wild birds.

The serotypes of influenza A virus are classified according to the types of two proteins on the surface of the virus, hemagglutinin (HA) and neuraminidase (NA), and 144 types (HA 16) according to the serotype. Species, NA 9 species). HA is responsible for attaching viruses to somatic cells, and NA allows viruses to penetrate into cells.

Avian influenza viruses (AIV) are all viruses belonging to type A, and according to the hemagglutinin (HA) and neuraminidase (NA) genes in the outer membrane of the virus, HA is divided into 16 types and NA is divided into 9 types. It is characterized by a variety of serotypes and no cross-protection between different serotypes. Among the various serotypes of AIV, highly pathogenic avian influenza (HPAI) that has occurred to date was all attributed to H5 or H7 serotypes. The first scientifically confirmed highly pathogenic avian influenza (HPAI) was caused by the H5N1 type avian influenza virus that occurred in Scotland in 1959. Since then, in countries around the world, the H5 serotype or H7 serotype of the AIV subtype. HPAI occurred.

In Korea, since the first occurrence in 2003, it has occurred every year from 2014. In particular, from November 2016 to June 2017, a total of 419 cases of HPAI of two types (H5N6, H5N8) occurred (H5N6: 343 cases, H5N8: 76 cases), resulting in 3,800 cases. Astronomical direct and indirect expenses were required, such as killing 10,000 animals, causing the largest damage ever. This had an enormous impact on not only the domestic poultry industry but also related industries due to shrinking consumption. In addition, HPAI has been continuously occurring in Southeast Asia, which is geographically close to Korea, from 2004 to the present. In particular, cases of human infection caused by H5N1 type HPAI continue to appear in Thailand and Vietnam, which is a concern. HPAI has a policy of eradication through killing of infected animals in most countries, including Korea, excluding Mexico and Italy, which use avian influenza vaccines. However, even in Korea, if HPAI occurs at all times, direct and indirect expenses such as compensation for killing, circulatory infection of the human body, and environmental problems have made it impossible to insist on killing policy as in the past. Therefore, while trying to eradicate and prevent recurrence of HPAI, there is a need to develop a vaccine that shows a protective effect against HPAI in case of an emergency that cannot be controlled by killing alone.

Among the vaccines for preventing avian influenza, it is almost impossible to develop a live virus vaccine due to the nature of a virus that is easily mutated, and the vaccines developed to date can be largely divided into dead poison vaccines and genetically modified vaccines. In Italy and Hong Kong in 2003, the outbreak of highly pathogenic avian influenza was prolonged and spread across the country, and the avian influenza prevention vaccine was combined with the selective killing policy.At present, in Italy and Hong Kong, the use of avian influenza vaccine is highly pathogenic avian influenza. It is receiving positive reviews that it was effective in controlling. The vaccines that received positive evaluations in Italy (serum type A/H7N1) and Hong Kong (serum type A/H5N1) are all dead poison vaccines, with heterogeneous serotype viruses with the same HA type but different NA types (serum type A/H7N3, Serotype A/H5N2) was prepared to differentiate it from field infections during antibody testing. However, this dead venom vaccine cannot differentiate between vaccine antibodies and outdoor infectious antibodies by the Agar Gel Precipitation (AGP) test, which is the standard diagnostic method for type A avian influenza, and the fluorescent antibody method for discriminating NA type is a large-scale antibody. The biggest drawback is that it is not suitable for monitoring inspection. In addition, the currently developed dead poison vaccine can reduce the amount of virus excreted in the feces during highly pathogenic avian influenza infection, but it is evaluated that it does not completely prevent the spread of the disease.

The avian influenza vaccines developed to date include an inactivated oil vaccine (Intervet Mexico, Mexico) against the H5N2 serotype in use in Mexico and a recombinant vaccine against the H5 serotype (H5 recombinant) using fowlpox virus as a vector. fowl pox-vectored AI vaccine; Merial Select, USA). However, as described above, various serotypes exist for avian influenza, and because different serotypes cannot be protected, highly pathogenic vaccine strains that exhibit high protection against serotypes prevalent in Asia since 2003 and have high safety during the vaccine manufacturing process are used. There is a need to develop a vaccine used.

The present inventors have made intensive research efforts to develop a recombinant vaccine against highly pathogenic influenza A virus. As a result, the present invention was completed by preparing an attenuated influenza A virus by deleting the tetrapeptide in HA that confers the pathogenicity of the highly pathogenic influenza A virus and examining its high stability, immunity and vaccine efficacy.

Accordingly, it is an object of the present invention to provide a method for preparing H5N8 type recombinant influenza A virus.

Another object of the present invention is to provide an H5N8 type recombinant influenza A virus.

Another object of the present invention is to provide a method for preparing H5N6 recombinant influenza A virus.

Another object of the present invention is to provide an H5N6 recombinant influenza A virus.

Another object of the present invention is to provide a vaccine composition against H5 serotype influenza A virus.

According to one aspect of the present invention, the present invention provides a method for preparing H5N8 type recombinant influenza A virus comprising the following steps:

(a) H5N8 highly pathogenic influenza A virus-derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 1 and H5N8 highly pathogenic influenza A virus-derived NA (neuraminidase) consisting of the nucleotide sequence of SEQ ID NO: 2 were cloned into a vector, respectively, and recombinant plasmids Manufacturing a;

(b) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (respectively consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8) non-structural protein) to prepare a recombinant plasmid by cloning each vector;

(c) transfecting the recombinant plasmid of steps (a) and (b) into a packaging cell; And

(d) obtaining H5N8 type recombinant influenza A virus from the culture supernatant of the packaging cells.

The present inventors have made intensive research efforts to develop a recombinant vaccine against highly pathogenic influenza A virus. As a result, an attenuated influenza A virus was prepared by deleting the tetra peptide in HA that confers the pathogenicity of the highly pathogenic influenza A virus, and its high stability, immunity and vaccine efficacy were investigated.

The term "avian influenza" as used herein refers to an acute infectious disease of birds caused by infection with avian influenza virus. The causative agent of the avian influenza is influenza A virus.

In the present specification, the term'influenza A virus' is a virus that causes highly infectious respiratory diseases, commonly referred to as'flu' that occurs in animals and humans, and has an envelope having a fragmented genome consisting of a single-stranded negative RNA fragment. It means RNA virus.

In the present specification, the term'recombinant influenza A virus' refers to a virus in which the RNA fragment of the influenza A virus has been recombined using gene recombination technology. For example, it is a virus containing genetic material produced by the combination of RNA fragments of at least two donor viruses (high pathogenic influenza A virus and low pathogenic influenza A virus).

In the present specification, the term'highly pathogenic influenza A virus' refers to (i) inoculation to 8 susceptible chickens aged 4-8 weeks and dying 6 or more (75%) within 10 days; (Ii) Intravenous pathogenicity (IVPI, 10 number of 4-8 week old susceptible chickens) intravenously inoculated with virus, and the clinical symptoms and mortality of chickens were checked at 24 hour intervals for 10 days, respiratory symptoms and depression. , Diarrhea, cyanosis of the outer skin or clefts, swelling of the head, and the severity of neurological symptoms were recorded as a score, and the sum of each symptom multiplied by the symptom value divided by 100) was 1.2 or higher; (Iii) In the case of H5 or H7 type, which is low pathogenicity in chickens, it means the case where the amino acid sequence of the HA protein segment is determined to be similar to high pathogenicity.

In the present specification, the term'low pathogenic influenza A virus' is more than highly pathogenic influenza A virus, when (i) 2 or less (25%) deaths within 10 days after inoculation to 8 susceptible chickens aged 4-8 weeks; (Ii) the intravenous pathogenicity index is less than 1.2; (Iii) In the case of H5 or H7 type, which is low pathogenicity in chickens, the amino acid sequence of the HA protein segment is determined to be different from the highly pathogenicity.

As used herein, the term'H5N8 type influenza A virus' refers to an influenza A virus in which the antigen characteristic of the HA protein, which is the surface protein of the influenza A virus, is H5 type and the antigen characteristic of the NA protein is N8.

The method for preparing the H5N8 type recombinant influenza A virus of the present invention will be described step by step.

Step (a): Preparation of recombinant plasmids each containing HA and NA of highly pathogenic influenza A virus

First, HA (hemagglutinin) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1 and NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2 were cloned into a vector, respectively, and a recombinant plasmid was prepared. To manufacture.

In the present specification, the term'nucleotide sequence' is interpreted as including a nucleotide sequence exhibiting substantial identity to the nucleotide sequence in addition to the above-mentioned sequence. The above substantial identity is at least 80% when the nucleotide sequence of the present invention and any other sequence are aligned to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. It means a nucleotide sequence that exhibits homology, more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv. Appl. Math. 2:482 (1981) ; Needleman and Wunsch, J. Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al. , Nuc. Acids Res. 16:10881-90 (1988); Huang et al. , Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al. , Meth. Mol. Biol. 24:307-31 (1994). NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. , J. Mol. Biol. 215:403-10(1990)) can be accessed from NCBI (National Center for Biological Information), etc., and blastp, blasm, and It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLAST can be accessed through the BLAST page of the ncbi website. The sequence homology comparison method using this program can be found on the BLAST help page of the ncbi website.

The recombinant plasmid of step (a) contains HA consisting of the nucleotide sequence of SEQ ID NO: 1 derived from the H5N8 type highly pathogenic influenza A virus and NA consisting of the nucleotide sequence of SEQ ID NO: 2.

According to an embodiment of the present invention, the H5N8 highly pathogenic influenza A virus is A/chicken/Korea/Gimje2/2017 (H5N8) belonging to clade 2.3.4.4B.

According to the nomenclature of the influenza virus [subtype/originate host/isolated area/separation order/year of isolation (HA type, NA type)], the A/chicken/Korea/Gimje2/2017(H5N8) host chickens with influenza A virus. It is a virus isolated in 2017 from Gimje, Korea, and means having antigenic types of H5 and N8.

In the present specification, "clade" is a criterion for classifying a group of H5 influenzas based on phylogenetic characterization and sequence homology of the HA gene of H5 influenza, and each clade is an expert of WHO/OIE/FAO Defined by group.

The HA derived from the H5N8 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1 is an HA in which a highly pathogenic inducing gene has been deleted.

According to an embodiment of the present invention, the HA derived from the H5N8 highly pathogenic influenza A virus is an HA in which Lys-Arg-Arg-Lys (KRRK) is deleted located at the carboxy terminal region of HA1 constituting HA.

HA of influenza A virus is a surface glycoprotein, and when influenza A virus is introduced into cells, it plays a role of interacting with specific receptors on the cell surface. The HA is composed of subunits of HA1 and HA2, and an amino acid sequence (Arg-Arg-Arg-Lys-Lys, RRRKK) that induces high pathogenicity of influenza A virus is present at the carboxyl terminal region of HA1.

The present invention attenuates the highly pathogenic influenza A virus by deleting the highly pathogenic inducing site of the HA1 site of the influenza A virus.

The H5N8 type highly pathogenic influenza A virus-derived NA consisting of the nucleotide sequence of SEQ ID NO: 2 is an influenza A virus surface glycoprotein, and between the host cell receptor and the virus particle so that the virus proliferated from the infected cell is released and infects new cells. It serves to break the bond.

The HA consisting of the nucleotide sequence of SEQ ID NO: 1 derived from the H5N8 highly pathogenic influenza A virus and the NA consisting of the nucleotide sequence of SEQ ID NO: 2 are cloned into a vector to prepare a recombinant plasmid.

As used herein, the term'vector' is a linear or circular DNA molecule composed of a fragment encoding a polypeptide of interest operably linked to an additional fragment provided for transcription of the vector. Such additional fragments include promoter and terminator sequences. The vector also includes one or more origins of replication, one or more selection markers, and the like. Vectors are generally derived from plasmid or viral DNA, or contain elements of both.

According to an embodiment of the present invention, the vector is a v2pHW vector.

The v2pHW vector (Korea Patent Registration No. 10-1323582) is a pHW2000 vector (Hoffmann E et al. Proc Natl Acad Sci USA 2000 23;97(11):6108-13) human PolI promoter of Vero cells (monkey derived) It is a vector substituted with the derived PolI promoter.

According to one embodiment of the present invention, the recombinant plasmid is composed of a first recombinant plasmid containing HA and a second recombinant plasmid containing NA.

Step (b): Preparation of recombinant plasmids each containing PB2, PB1, PA, NP, M and NS of the low pathogenic influenza A virus

Next, PB2, PB1, PA, NP, M, and NS derived from the hypopathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8, were cloned into a vector to prepare a recombinant plasmid.

The recombinant plasmid of step (b) contains PB2, PB1, PA, NP, M, and NS, respectively, consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 derived from the low pathogenic influenza A virus.

In one embodiment of the present invention, the low pathogenic influenza A virus is A/PR/8/34 (H1N1).

PB2, PB1, PA, NP, M and NS derived from the hypopathogenic influenza A virus, each consisting of the nucleotide sequence of SEQ ID NO: 3 to 8 of the hypopathic influenza A virus, were cloned into a vector to prepare a recombinant plasmid.

According to an embodiment of the present invention, the recombinant plasmid is a third recombination plasmid comprising PB2, a fourth recombination plasmid comprising PB1, a fifth recombination plasmid comprising PA, a sixth recombination plasmid comprising NP, M It consists of a seventh recombinant plasmid containing and an eighth recombinant plasmid containing NS.

Step (c): Transfection into packaging cells

Next, the first to eighth recombinant plasmids of steps (a) and (b) are transfected into the packaging cells.

In the present specification, the term'packaging cell' refers to a cell capable of producing a recombinant virus through a non-viral transfection method. For example, the packaging cell is a recombinant H5N8 type influenza A in which HA, NA, PB2, PB1, PA, NP, M and NS proteins expressed from the transfected first to eighth recombination plasmids are assembled. It can produce viruses.

According to one embodiment of the present invention, the packaging cells are one or more cells selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells.

According to a specific embodiment of the present invention, the packaging cell is a 293T cell.

Step (d): Obtaining H5N8 type recombinant influenza A virus

Finally, H5N8-type recombinant influenza A virus was obtained from the culture supernatant of the packaging cells.

According to another aspect of the present invention, the present invention provides (i) HA (hemagglutinin) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1;

(Ii) NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2; And

(iii) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8) non-structural protein), H5N8 type recombinant influenza A virus [rgAIV_Gimje2(H5N8)] comprising the genome of 8 negative-sense ssRNAs is provided.

Since the H5N8-type recombinant influenza A virus of the present invention is almost the same as the content of the method for producing the H5N8-type recombinant influenza A virus described above, the descriptions in common between the two are omitted in order to avoid excessive complexity of the present specification.

According to another aspect of the present invention, the present invention provides (i) HA (hemagglutinin) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1; (Ii) NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2; And (iii) low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS, each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8 It provides a vaccine composition against H5 serotype influenza A virus, including H5N8 type recombinant influenza A virus, comprising the genome of eight negative-sense ssRNAs of (non-structural protein).

According to one embodiment of the present invention, the H5 serotype influenza A virus is an H5N8 type influenza A virus belonging to clade 2.3.4.4B.

In the present specification, the term'vaccine composition' refers to a composition that positively affects the immune response of a subject. The vaccine composition provides the subject with an enhanced systemic or local immune response triggered by a cellular immune response, such as a Cytotoxic T Lymphocyte (CTL) or a humoral immune response, such as an antibody. Targets of the vaccine composition include birds, humans, dogs, horses, pigs, cats, etc., but are not limited thereto.

The vaccine composition of the present invention comprises a pharmaceutically effective amount of the recombinant H5N8 type influenza A virus of the present invention. The vaccine composition may additionally include a pharmaceutically acceptable carrier. The term "pharmaceutically effective amount" as used herein refers to an amount sufficient to achieve prophylactic, alleviating or therapeutic efficacy against a disease or pathological condition caused by a virus. Pharmaceutically acceptable carriers that can be included in the composition of the present invention are commonly used in formulation, and are lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, silicic acid. Calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It is not. The composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). The vaccine composition of the present invention may contain other components such as stabilizers, excipients, other pharmaceutically acceptable compounds or any other antigens or portions thereof. Vaccines can be in the form of freeze-dried preparations or suspensions, all of which are common in the field of vaccine production.

The dosage form of the vaccine composition of the present invention may be in the form of an enteric coating unit, intraperitoneal, intramuscular or subcutaneous inoculation, aerosol spray, oral or intranasal use. It is also possible to administer as drinking water or edible pellets. The vaccine composition of the present invention can also be delivered as a single vaccine by expressing immunomodulatory molecules such as heterologous antigens and cytokines in the same recombinant, as a "cocktail" comprising two or more viral vectors having different foreign genes or adjuvants. Can be administered. As used herein, the term "adjuvant" generally refers to any substance that increases the body fluid or cellular immune response to an antigen (eg, alum, Freund's complete adjuvant, Freund's incomplete adjuvant, LPS, poly IC , poly AU, etc.).

According to another aspect of the present invention, the present invention provides a method for preparing H5N6 type recombinant influenza A virus comprising the following steps:

(a) H5N6 type highly pathogenic influenza A virus-derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 9 and H5N6 type highly pathogenic influenza A virus-derived NA (neuraminidase) consisting of the nucleotide sequence of SEQ ID NO: 10 were cloned into a vector, respectively, and recombinant plasmids Manufacturing a;

(b) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (non) consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8 -structural protein) to prepare a recombinant plasmid by cloning each vector;

(c) transfecting the recombinant plasmid of steps (a) and (b) into a packaging cell; And

(d) obtaining H5N6 type recombinant influenza A virus from the culture supernatant of the packaging cells.

As used herein, the term'H5N6 type influenza A virus' refers to an influenza A virus in which the antigen characteristic of the HA protein, which is the surface protein of the influenza A virus, is H5 type and the antigen characteristic of the NA protein is N6.

According to an embodiment of the present invention, the H5N6 highly pathogenic influenza A virus is A/duck/Korea/H35/2017 (H5N6) belonging to clade 2.3.4.4B.

According to the nomenclature of influenza virus [subtype/originate host/isolated area/separation order/year of isolation (HA type, NA type)], the A/duck/Korea/H35/2017(H5N6) is an influenza A virus and hosts ducks. It is a virus isolated in 2017 in Korea and means having antigenic types of H5 and N6.

The HA derived from the H5N6 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9 is an HA in which a highly pathogenic inducing gene has been deleted.

According to one embodiment of the present invention, the HA derived from the H5N6 type highly pathogenic influenza A virus is an HA in which Lys-Arg-Arg-Lys (KRRK) is deleted located at the carboxy terminal region of HA1 constituting HA.

According to another aspect of the present invention, the present invention provides (i) HA (hemagglutinin) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9;

(Ii) NA (neuraminidase) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10; And

(iii) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8) non-structural protein), H5N6 type recombinant influenza A virus [rgAIV_H35(H5N6)] including the genome of 8 negative-sense ssRNAs is provided.

According to another aspect of the present invention, the present invention provides (i) HA (hemagglutinin) derived from H5N6 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9; (Ii) NA (neuraminidase) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10; And (iii) low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8 It provides a vaccine composition against H5 serotype influenza A virus, including H5N6 type recombinant influenza A virus, comprising the genome of eight negative-sense ssRNAs of (non-structural protein).

According to one embodiment of the present invention, the H5 serotype influenza A virus is an H5N6 type influenza A virus belonging to clade 2.3.4.4B.

The method for preparing the H5N6 type recombinant influenza A virus of the present invention, the vaccine composition against the H5N6 type recombinant influenza A virus and the H5 serotype influenza A virus is almost the same as the contents of the previously described H5N8 type recombinant influenza A virus, so the two are common Contents are omitted in order to avoid excessive complexity of the present specification.

The present invention provides a recombinant influenza A virus, a method for preparing the same, and a vaccine composition against H5 serotype influenza A virus belonging to clade 2.3.4.4B including the same. The present invention can contribute to disease control through a protective effect against the outbreak of H5 serotype highly pathogenic avian influenza introduced from abroad or occurring in Korea by manufacturing a recombinant vaccine that exhibits a protective effect against highly pathogenic avian influenza virus. In addition, the vaccine composition is not only weak pathogenicity and excellent safety because the highly pathogenic gene in the HA segment is removed, but also has excellent proliferation in egg (egg) and protective ability in chickens.

1A shows images 72 hours after inoculation of chicken fetuses inoculated with the A/chicken/Korea/Gimje2/2017(H5N8) (left) and rgAIV_Gimje2 (H5N8) vaccine strains (right).
1B shows images 72 hours after inoculation of chicken fetuses inoculated with A/duck/Korea/H35/2017 (H5N6) (left) and rgAIV_H35 (H5N6) vaccine strains (right).
Figure 2a shows the percentage survival for 14 days after challenge vaccination of A/chicken/Korea/Gimje2/2017 (H5N8) of SPF chickens without or without vaccination of the rgAIV_Gimje2(H5N8) vaccine line.
Figure 2b shows the percentage survival for 14 days after challenge vaccination of A/duck/Korea/H35/2017 (H5N6) of SPF chickens without or without vaccination of the rgAIV_H35(H5N6) vaccine line.
3A shows HI titers for 15 weeks after vaccination with rgAIV_Gimje2(H5N8) vaccine.
Figure 3b shows the HI titer for 15 weeks after vaccination with rgAIV_H35(H5N6) vaccination.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Throughout the present specification, "%" used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol) %.

Example

Example 1. Preparation of attenuated H5N8 type recombinant influenza A virus vaccine

1-1. Removal of HA gene (H5) of H5N8 type highly pathogenic influenza A virus

RNA was extracted from the A/chicken/Korea/Gimje2/2017(H5N8) influenza virus using an RNA extration kit (iNtRON, Korea). In order to remove the highly pathogenic gene (KRRK) in the segmental region of the HA segment, two segments were amplified using overlapping primers shown in Table 1 below, and then the HA gene through PCR using these two segments. Was amplified (PCR conditions: 94°C for 30 seconds, 57°C for 1 minute, 72°C for 4 minutes/35 times), and used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number HA1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGG 11 H26-MuCl-H5R CCTCTTGTTTCTCTTTGAGGACTATTTCTGAGCCC 12 H26-MuCl-H5F CTCAAAGAGAAACAAGAGGACTATTTGGAGCTATA 13 NS-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTG 14

1-2. Amplification of gene NA(N8) of H5N8 highly pathogenic influenza A virus

After cDNA was produced by performing the experiment in the same manner as in Example 1-1, NA (N8) was amplified through PCR using the terminal primers shown in Table 2 below (PCR conditions: 94°C for 30 seconds, 57°C 1 minute, 72° C. 2 minutes/35 times), and was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number N1-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGAG 15 N1-1413R GGGCCGCCGGGTTATTAGTAGAAACAAGGAGT 16

1-3. Vector cloning of H5N8 highly pathogenic influenza A virus

The genes HA and NA amplified by PCR in Examples 1-1 and 1-2 were conjugated to v2pHW (KCDC) with an In-Fusion HD Cloning kit (Takara, USA), and then E. coli (stella competent). cells), and then culture amplification for 18 hours in a 37℃ shaking incubator using LB broth (Bioscience, Korea), and then purified with Plasmid DNA Purification Kit (iNtRON, Korea) to obtain HA and NA Got the gene.

1-4. Vector cloning of hypopathogenic influenza A/PR/8/34 (H1N1) strain

In the A/PR/8/34 (H1N1) virus (ATCC, USA), the PB2, PB1, PA, NP, M, and NS genes were shown in the following table by performing an experiment in the same manner as in Examples 1-1 to 1-3. After amplification through PCR using the specific primers shown in 3 (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), v2pHW (KCDC) In-Fusion HD Cloning kit (Takara , U.S.), transformed using E. coli, stella competent cells, and amplified culture for 18 hours in a shaking incubator at 37°C using LB broth (Bioscience, Korea). Purified with Plasmid DNA purification Kit (iNtRON, Korea) to obtain PB2, PB1, PA, NP, M and NS genes.

Primer name Base sequence (5'->3') Sequence number Phw-PB2-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGTC 17 Phw-PB2-2341R GGGCCGCCGGGTTATTAGTAGAAACAAGGTCG 18 Phw-PB1-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGCA 19 Phw-PB1-2341R GGGCCGCCGGGTTATTAGTAGAAACAAGGCAT 20 Phw-PA-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGTA 21 Phw-PA-2233R GGGCCGCCGGGTTATTAGTAGAAACAAGGTAC 22 Phw-NP-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGT 23 Phw-NP-1565R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTA 24 Phw-M-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGTA 25 Phw-M-1027R GGGCCGCCGGGTTATTAGTAGAAACAAGGTAG 26 Phw-NS-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGT 27 Phw-NS-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTG 28

1-5. Production of attenuated H5N8 type recombinant influenza A virus

The plasmids obtained in Examples 1-3 and 1-4 were cultured in 293T cells at 37° C. and 5% CO ₂ , and 0.5 ul of each plasmid was Lipofectamin LTX and Plus Reagent (Lipofectamin LTX and Plus Reagent. , Invitrogen, USA) 48 hours after inoculation (transfection), the supernatant was inoculated into a 10-day-old specific pathogen free (SPF) incubated egg (10 ^5.0 EID ₅₀ /0.1 ml) and attenuated recombinant H5N8 serotype Virus strains (hereinafter referred to as rgAIV_Gimje2 (H5N8)) were obtained (deposit: Animal and Plant Quarantine Agency, deposit date March 28, 2018).

Example 2. Preparation of attenuated H5N6 recombinant influenza A virus vaccine

2-1. Removal of HA gene (H5) of H5N6 type highly pathogenic influenza A virus

RNA was extracted from the A/duck/Korea/H35/2017 (H5N6) influenza virus using an RNA extration kit (iNtRON, Korea). In order to remove the highly pathogenic gene (KRRK) in the segmental region of the HA segment, two segments were amplified using the overlapping primers shown in Table 1, and then the HA gene through PCR using these two segments. Was amplified (PCR conditions: 94°C for 30 seconds, 57°C for 1 minute, 72°C for 4 minutes/35 times), and used as a material for the following experiment.

2-2. Amplification of gene NA(N6) of H5N8 highly pathogenic influenza A virus

After cDNA was produced by performing the experiment in the same manner as in Example 2-1, NA (N6) was amplified through PCR using primers at the ends shown in Table 4 below (PCR conditions: 94°C for 30 seconds, 57°C 1 minute, 72° C. 2 minutes/35 times), and was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number N6-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGTGAAAATG 29 N6-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTGTTTT 30

2-3. Vector cloning of H5N6 highly pathogenic influenza A virus

The genes HA and NA amplified by PCR in Examples 2-1 and 2-2 were conjugated to v2pHW (KCDC) with an In-Fusion HD Cloning kit (Takara, USA), and then E. coli (stella competent). cells), and then culture amplification for 18 hours in a 37℃ shaking incubator using LB broth (Bioscience, Korea), and then purified with Plasmid DNA Purification Kit (iNtRON, Korea) to obtain HA and NA Got the gene.

2-4. Vector cloning of hypopathogenic influenza A/PR/8/34 (H1N1) strain

In the A/PR/8/34 (H1N1) virus (ATCC, USA), the PB2, PB1, PA, NP, M, NS genes were shown in the table above by performing an experiment in the same manner as in Examples 2-1 to 2-3. After amplification through PCR using the specific primers shown in 3 (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), v2pHW (KCDC) In-Fusion HD Cloning kit (Takara , U.S.), transformed using E. coli, stella competent cells, and amplified culture for 18 hours in a shaking incubator at 37°C using LB broth (Bioscience, Korea). Purified with Plasmid DNA purification Kit (iNtRON, Korea) to obtain PB2, PB1, PA, NP, M and NS genes.

2-5. Production of attenuated H5N6 recombinant influenza A virus

The plasmids obtained in Examples 2-3 and 2-4 were cultured in 293T cells at 37° C. and 5% CO ₂ , and 0.5 ul of each plasmid was Lipofectamin LTX and Plus Reagent (Lipofectamin LTX and Plus Reagent. , Invitrogen, USA) 48 hours after inoculation (transfection), the supernatant was inoculated into a 10-day-old specific pathogen free (SPF) incubated egg (10 ^5.0 EID ₅₀ /0.1 ml) and attenuated recombinant H5N6 serotype Virus strains (hereinafter referred to as rgAIV_H35 (H5N6)) were obtained (deposit: Animal and Plant Quarantine Agency, deposit date March 28, 2018).

Example 3. Preparation method of Zadok vaccine

RgAIV_Gimje2 (H5N8) stock obtained in Examples 1 and 2 (deposit institution: Korea Veterinary Culture Collection, KVCC, deposit date: March 28, 2018, deposit number: VR1800010) and rgAIV_H35 (H5N6) stock (deposit institution: Korea Veterinary Culture Collection, KVCC, deposit date: March 28, 2018, deposit number: VR1800018) are inoculated into 100 10-day-old SPF hatching eggs, respectively, and incubated in an incubator at 37°C for 72 hours. The hatched eggs cultured for 72 hours were refrigerated at 4° C. for 6 hours to obtain urine. After the obtained urine water was concentrated to 1/10, the concentrated virus was inactivated at 4°C for 12 hours with 0.01% formalin.

Experimental example

Experimental Example 1. Verification of the presence of highly pathogenic genes in the HA segment

In order to verify the removal of the HA gene of rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) obtained in Examples 1 and 2, an experiment was performed as follows.

1-1. Verification by genetic analysis

Highly pathogenic avian influenza has a highly pathogenic gene (RRRKK: AGA AGA AGA AAA AAG) in the segment of the HA protein, which infects the whole body organs and causes fatal diseases in poultry. To develop a vaccine against this, RRRKK is removed from the segment of the HA protein. Attenuated vaccine strains should be developed.

The HA gene was amplified by PCR from the rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine strains according to the experimental method of Example 1-1, cloned into v2pHW vector, and then Briddye Terminaor v3.1 Cycle Sequencing Kit (Bionics, Korea) ) Was obtained with the Applied Biosystems 3730XL DNA Analyzer, and then highly pathogenic gene removal was confirmed using the CLC program (USA).

As a result of the experiment, it was confirmed that the highly pathogenic gene KRRK was removed from the rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine lines as shown in Tables 5 and 6 below.

Virus stock Amino acid sequence A/chicken/Korea/Gimje2/2017(H5N8) PLREKRRKR/GLF rgAIV_Gimje2(H5N8) PQRETR/GLF

Virus stock Amino acid sequence A/duck/Korea/H35/2017(H5N6) PLREKRRKR/GLF rgAIV_H35(H5N6) PQRETR/GLF

1-2. Inoculated into 10-day-old hatching eggs and verified

When a highly pathogenic avian influenza virus, which has a highly pathogenic gene RRRKK, is inoculated into a 10-day-old hatching egg, the fetus dies and blood vessels are not visible when egg eggs are lit.

The highly pathogenic avian influenza virus and the attenuated rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine strains obtained in Examples 1 and 2 were inoculated into 10-day-old hatching eggs, respectively, and 72 hours later, using a light to determine the status of the fetus. It was black.

As shown in FIGS. 1A and 1B, hatching eggs inoculated with highly pathogenic avian influenza virus showed little blood vessels because they were blackened with a lamp, whereas hatched eggs inoculated with attenuated rgAIV_Gimje2 (H5N8) or rgAIV_H35 (H5N6) vaccine lines. As the fetus did not die, clear blood vessels could be confirmed.

Experimental Example 2. Vaccine strain safety and immunity verification

In order to confirm the safety and immunity of the vaccine obtained in Example 3 against H5N8 type or H5N6 type highly pathogenic avian influenza virus, an experiment was performed as follows using SPF chickens.

2-1. Safety test of rgAIV_Gimje2(H5N8) vaccine strain

Since SPF chicken is a vaccine developed for use as an actual target animal, it was used for the efficacy test of H5N8 type highly pathogenic avian influenza vaccine. 1 ml (500 ul/dose) rgAIV_Gimje2 (H5N8) avian influenza vaccine antigen (10 ^9.0 EID ₅₀ /0.1 ml) was inoculated to 10 numbers of 6-week-old SPF chickens biceps muscle. Serum was obtained 2 weeks after inoculation, and the antibody titer was verified by hemagglutination inhibition (HI). Ten SPF chickens used as a control group were inoculated with physiological saline for efficacy comparison.

As a result, as shown in Table 7 below, all 10 SPF chickens vaccinated with the vaccine had a hemagglutination inhibitory titer (HI) titer of 2 ⁷ or more, and did not show special clinical symptoms such as death and weight loss. I could confirm.

No. Vaccination object Control HI titer Dead water/Vaccination water HI titer Dead water/Vaccination water One 8 0/10 <1 0/10 2 9 <1 3 9 <1 4 4 <1 5 9 <1 6 10 <1 7 8 <1 8 11 <1 9 10 <1 10 9 <1

2-2. Safety test of rgAIV_H35(H5N6) vaccine strain

As a result of conducting an experiment on the safety of the rgAIV_H35 (H5N6) vaccine strain in the same manner as in Experimental Example 2-1, as shown in Table 8 below, all 10 SPF chickens that received the vaccine had hemagglutination inhibitory titers (HI). It was confirmed that the titer was 2 ⁷ or more, and did not show any special clinical symptoms such as death or weight loss.

No. Vaccination object Control HI titer Dead water/Vaccination water HI titer Dead water/Vaccination water One 6 0/10 <1 0/10 2 4 <1 3 9 <1 4 7 <1 5 9 <1 6 6 <1 7 9 <1 8 6 <1 9 8 <1 10 8 <1

Experimental Example 3. Validation of efficacy of vaccine strain

In order to verify the efficacy of the rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine antigens obtained in Example 3, an experiment was performed as follows.

Ten 6-week-old SPF chickens were vaccinated with 1 ml of rgAIV_Gimje2(H5N8) or rgAIV_H35(H5N6) avian influenza vaccine antigen (10 ^9.0 EID ₅₀ /0.1 ml) in the biceps of the right leg, and not vaccinated after 3 weeks. 10 ⁶ Egg Infectious doses (EID ₅₀ ) were inoculated with the control group through the nose to determine survival for 14 days.

3-1. Histological viral titer validation for rgAIV_Gimje2(H5N8)

According to the experimental method of Experimental Example 3, 10 ⁶ Egg Infectious dose (EID ₅₀ ) was injected through the nose and on the 3rd and 5th days, swabs were performed from the experimental group and the control group using a swab to obtain viral titer (log ₁₀ EID ₅₀ / 0, 1 ml) was measured.

Group Sample The number of virus discharged/lived.
(Virus titer, log ₁₀ TCID ₅₀ /0.1ml, mean ± standard deviation) Survival/Total 3 days later 5 days later 7 days later 10 days later 14 days later Vaccination Throat 0/10 0/10 0/10 0/10 0/10 10/10 Total excretion 0/10 0/10 0/10 0/10 0/10 Control Throat 4/4
(3.9±0.5) 2/4
(3.3±0.7) 1/4
(2.7) 0/1 0/1 1/10 Total excretion 2/4
(1.5±0.4) 3/4
(3.5±1.2) 1/4
(3.3) 0/1 0/1

As a result, the experimental group receiving the rgAIV_Gimje2 (H5N8) vaccine antigen (zapox vaccine) did not detect highly pathogenic H5N8 avian influenza virus in the pharyngeal swab sample, whereas the control group confirmed that high titer virus was detected in the pharyngeal swab sample. (Table 9).

Therefore, it was confirmed that the rgAIV_Gimje2(H5N8) dead venom vaccine of the present invention exhibits excellent protection against the highly pathogenic influenza virus of type H5N8.

3-2. Histological viral titer validation for rgAIV_H35(H5N6)

According to the experimental method of Experimental Example 3, the virus titer (log ₁₀ EID ₅₀ /0,1) was performed by swabs from the experimental group and the control group on the 3rd and 5th days after nasal inoculation with 10 ⁶ Egg Infectious dose (EID50). ml) was measured.

Group Sample The number of virus discharged/lived.
(Virus titer, log ₁₀ TCID ₅₀ /0.1ml, mean ± standard deviation) Survival/Total 3 days later 5 days later 7 days later 10 days later 14 days later Vaccination Throat 0/10 0/10 0/10 0/10 0/10 10/10 Total excretion 0/10 0/10 0/10 0/10 0/10 Control Throat Our company Our company Our company Our company Our company 0/10 Total excretion Our company Our company Our company Our company Our company

As a result, the experimental group receiving the rgAIV_H35 (H5N6) vaccine antigen (zapox vaccine) did not detect highly pathogenic H5N6 avian influenza virus in the pharyngeal swab sample, whereas the control group confirmed that a high titer virus was detected in the pharyngeal swab sample. (Table 10).

Therefore, it was confirmed that the rgAIV_H35 (H5N6) dead venom vaccine of the present invention exhibits excellent protection against highly pathogenic influenza viruses of type H5N6.

Experimental Example 4. Immunogenicity Verification of Vaccine Line

Since SPF chicken is a vaccine developed for use as an actual target animal, it was used for the efficacy test of a highly pathogenic H5N8 avian influenza vaccine. Inoculated with 1 ml (500 ul/dose) rgAIV_Gimje2 (H5N8) or rgAIV_H35 (H5N6) avian influenza vaccine antigen in the biceps muscle of 10 6-week-old SPF chickens, serum was obtained for 15 weeks, and antibody titer changes were hemagglutination It was verified by inhibition (HI, hemagglutination inhibition).

The World Organization for Animal Health (OIE) is setting standards to prevent mortality as well as reduce virus emissions if the HI titer is 2 ⁷ or higher in poultry.

4-1. Measure the titer of rgAIV_Gimje2(H5N8)

As shown in the experimental results of FIG. 3A, it was confirmed that the antibody maintained a high titer of 2 ⁷ or more until 15 weeks after vaccination with rgAIV_Gimje2 (H5N8) (Table 11 and FIG. 3A). 'Wpv' in Table 11 means'weeks post vaccination'.

- 2 wpv 3 wpv 8 wpv 12 wpv 16 wpv 20wpv 24wpv Titer 9.9 11.4 10.4 9.8 9.8 7.8 7.4

4-2. Measure the titer of rgAIV_H35 (H5N6)

As shown in the experimental results of Fig. 3b, it was confirmed that the antibody maintains a high titer of 2 ⁷ or more until 15 weeks after vaccination of rgAIV_H35(H5N6) (Table 12 and Fig. 3b).

- 2 wpv 3 wpv 8 wpv 12 wpv 16 wpv 20wpv 24wpv Titer 8.6 10.0 9.1 8.1 7.7 7.8 7.9

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same <130> PN180377 <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 1733 <212> RNA <213> Influenza A virus <400> 1 ttcactctgt caaaatggag aacatagtgc ttcttcttgc aatagttagc cttgttaaag 60 gtgatcagat ttgcattggt taccatgcaa acaactcgac agagcaagtt gacacgataa 120 tggaaaagaa cgtcactgtt acacatgccc aagacatact ggaaaaaaca cacaacggga 180 agctctgcga tctaaatggg gtgaagcctc tgattttaaa ggattgtagt gtagctggat 240 ggctcctcgg aaactcaatg tgcgacgaat tcatcagagt gccggaatgg tcttacatag 300 tggagagggc taacccagct aatgacctct gttacccagg gagcctcaat gactatgaag 360 aactgaaaca cctgttgagc agaataaatc attttgagaa gattctgatc atccccaaga 420 gttcttggcc caatcatgaa acatcattag gggtgagcgc agcttgtcca taccagggaa 480 cgccctcctt tttcagaaat gtggtatggc ttatcaaaaa gaacgatgca tacccaacaa 540 taaagataag ctacaataat accaatcggg aagatctctt gatactgtgg gggattcatc 600 attccaacaa tgcagaagag cagacaaatc tctataagaa cccaaccacc tatatttcag 660 ttggaacatc aacattaaac cagagattgg taccaaaaat ggctactaga tcccaagtaa 720 acgggcaacg gggaagaatg gacttcttct ggacaatttt aaaaccgaat gatgcaatcc 780 acttcgagag taatggaaat ttcattgctc cagaatatgc atacaaaatt gtcaagaaag 840 gggactcaac aattatgaaa agtgaagtgg aatatggcca ctgcaacacc aaatgtcaaa 900 ccccagtagg agcgataaac tctagtatgc cattccacaa tatacatcct ctcaccatcg 960 gggaatgccc caaatatgtg aagtcaaaca agttggtcct tgcgactggg ctcagaaata 1020 gtcctcaaag agaaacaaga ggactatttg gagctatagc aggttttata gagggaggat 1080 ggcagggaat ggttgatggt tggtatgggt accaccatag caatgagcag ggaagtgggt 1140 acgctgcaga caaagaatcc acccaaaagg caatagatgg agttaccaat aaggtcaact 1200 cgatcattga caaaatgaac actcaatttg aggcagttgg aagggagttt aataacttag 1260 aaaggaggat agagaatttg aacaagaaaa tggaagacgg attcctagat gtctggacct 1320 ataatgctga acttctagtt ctcatggaaa acgagaggac tctagatttc catgactcaa 1380 atgtcaagaa cctttacgac aaagccagac tgcagcttag ggataatgca aaggagctgg 1440 gtaacggttg tttcgagttc tatcacaaat gtgataatga atgtatggaa agtgtgagaa 1500 atgggacgta tgactaccct cagtattcag aagaagcaag attaaaaaga gaagaaataa 1560 gcggagtgaa attagaatca ataggaactt accaaatact gtcaatttat tcaacagtgg 1620 cgagttccct agcactggca atcatggtgg ctggtctatc tttatggatg tgctccaatg 1680 ggtcgttaca gtgcagaatt tgcatttaaa tttgtgagct cagattgtag tta 1733 <210> 2 <211> 1413 <212> RNA <213> Influenza A virus <400> 2 atgaatccaa atcagaaaat agtgaccgtt ggctccattt cattagggtt ggttgtattc 60 aatgttctac tgcatgccgt gagcatcata ttaatggtgt tagccctggg gaaaagtgaa 120 aacaatggaa tctgcaaggg aactatagta agggaatata atgaaacagt taggatagag 180 aaagtgactc aatggtacaa tactagtgta gtcgaatatg taccgcattg gaacgagggc 240 gcttatataa ataacaccga accaatatgt gatgtcaagg gctttgcacc tttttccaag 300 gacaacggga taagagttgg ctccagggga catatttttg tcataaggga gcctttcgtc 360 tcttgttcac ctgtagagtg cagaactttc ttcctcactc agggagctct actcaatgac 420 aaacactcaa atggaacagt gaaggataga agcccattca gaactctcat gagtgtcgaa 480 gtgggtcaat cacccaatgt atatcaagca aggtttgaag ctgtagcatg gtcagcaaca 540 gcctgtcatg atggcaagaa atggatgacg attggtgtaa cagggccaga ttctaaagca 600 gtagcagtag tccattacgg aggggtgcct actgatgttg ttaactcctg ggcgggagat 660 atattaagga ctcaggagtc atcttgtact tgcattcaag gtaattgtta ttgggtaatg 720 actgacggtc cagccaatag acaggcgcag tatagaatat acaaagcaaa tcaaggcaaa 780 ataattgacc aaacagatgt cagctttagt ggaggacata ttgaggaatg ttcttgttat 840 ccaaatgatg gtaaagtgga atgcgtgtgt agagacaact ggacgggaac taacaggcct 900 gtgctagtca tttcgcctga tctctcttac agggttgggt atttatgtgc aggattgccc 960 agtgacactc caagagggga agatgctcaa tttgtcggtt catgcactag tcccatggga 1020 aatcagggat atggcgtaaa aggtttcggg tttcgacagg gaactgatgt gtgggtgggg 1080 cggacaatta gtcgaacctc caggtcaggg tttgaaataa taaggataaa gaatggttgg 1140 acgcagacaa gcaaagaaca gattagaagg caggtggttg ttgataattt gaattggtcg 1200 ggatacagtg ggtctttcac tttaccagta gaattgtctg ggaggggatg tttagtcccc 1260 tgtttttggg tcgaaatgat cagaggcagg ccagaagaaa gaacaatctg gacctctagt 1320 agctccattg taatgtgtgg agttgatcat gaaattgccg attggtcatg gcacgatgga 1380 gctattcttc cctttgacat cgataagatg taa 1413 <210> 3 <211> 2313 <212> RNA <213> Influenza A virus <400> 3 tcaattatat tcaatatgga aagaataaaa gaactaagaa atctaatgtc gcagtctcgc 60 acccgcgaga tactcacaaa aaccaccgtg gaccatatgg ccataatcaa gaagtacaca 120 tcaggaagac aggagaagaa cccagcactt aggatgaaat ggatgatggc aatgaaatat 180 ccaattacag cagacaagag gataacggaa atgattcctg agagaaatga gcaaggacaa 240 actttatgga gtaaaatgaa tgatgccgga tcagaccgag tgatggtatc accactggct 300 gtgacatggt ggaataggaa tggaccaata acaaatacag ttcattatcc aaaaatctac 360 aaaacttatt ttgaaagagt cgaaaggcta aagcatggaa cctttggccc tgtccatttt 420 agaaaccaag tcaaaatacg tcggagagtt gacataaatc ctggtcatgc agatctcagt 480 gccaaggagg cacaggatgt aatcatggaa gttgttttcc ctaacgaagt gggagccagg 540 atactaacat cggaatcgca actaacgata accaaagaga agaaagaaga actccaggat 600 tgcaaaattt ctcctttgat ggttgcatac atgttggaga gagaactggt ccgcaaaacg 660 agattcctcc cagtggctgg tggaacaagc agtgtgtaca ttgaagtgtt gcatttgact 720 caaggaacat gctgggaaca gatgtatact ccaggagggg aagtgaggaa tgatgatgtt 780 gatcaaagct tgattattgc tgctaggaac atagtgagaa gagctgcagt atcagcagat 840 ccactagcat ctttattgga gatgtgccac agcacacaga ttggtggaat taggatggta 900 gacatcctta ggcagaaccc aacagaagag caagccgtgg atatatgcaa ggctgcaatg 960 ggactgagaa ttagctcatc cttcagtttt ggtggattca catttaagag aacaagcgga 1020 tcatcagtca agagagagga agaggtgctt acgggcaatc ttcaaacatt gaagataaga 1080 gtgcatgagg gatatgaaga gttcacaatg gttgggagaa gagcaacagc catactcaga 1140 aaagcaacca ggagattgat tcagctgata gtgagtggga gagacgaaca gtcgattgcc 1200 gaagcaataa ttgtggccat ggtattttca caagaggatt gtatgataaa agcagtcaga 1260 ggtgatctga atttcgtcaa tagggcgaat cagcgattga atcctatgca tcaactttta 1320 agacattttc agaaggatgc gaaagtgctt tttcaaaatt ggggagttga acctatcgac 1380 aatgtgatgg gaatgattgg gatattgccc gacatgactc caagcatcga gatgtcaatg 1440 agaggagtga gaatcagcaa aatgggtgta gatgagtact ccagcacgga gagggtagtg 1500 gtgagcattg accgtttttt gagaatccgg gaccaacgag gaaatgtact actgtctccc 1560 gaggaggtca gtgaaacaca gggaacagag aaactgacaa taacttactc atcgtcaatg 1620 atgtgggaga ttaatggtcc tgaatcagtg ttggtcaata cctatcaatg gatcatcaga 1680 aactgggaaa ctgttaaaat tcagtggtcc cagaacccta caatgctata caataaaatg 1740 gaatttgaac catttcagtc tttagtacct aaggccatta gaggccaata cagtgggttt 1800 gtaagaactc tgttccaaca aatgagggat gtgcttggga catttgatac cgcacagata 1860 ataaaacttc ttcccttcgc agccgctcca ccaaagcaaa gtagaatgca gttctcctca 1920 tttactgtga atgtgagggg atcaggaatg agaatacttg taaggggcaa ttctcctgta 1980 ttcaactata acaaggccac gaagagactc acagttctcg gaaaggatgc tggcacttta 2040 actgaagacc cagatgaagg cacagctgga gtggagtccg ctgttctgag gggattcctc 2100 attctgggca aagaggacaa gagatatggg ccagcactaa gcatcaatga actgagcaac 2160 cttgcgaaag gagagaaggc taatgtgcta attgggcaag gagacgtggt gttggtaatg 2220 aaacggaaac gggactctag catacttact gacagccaga cagcgaccaa aagaattcgg 2280 atggccatca attagtgtcg aatagtttaa aaa 2313 <210> 4 <211> 2313 <212> RNA <213> Influenza A virus <400> 4 gcaaaccatt tgaatggatg tcaatccgac cttacttttc ttaaaagtgc cagcacaaaa 60 tgctataagc acaactttcc cttatactgg agaccctcct tacagccatg ggacaggaac 120 aggatacacc atggatactg tcaacaggac acatcagtac tcagaaaagg gaagatggac 180 aacaaacacc gaaactggag caccgcaact caacccgatt gatgggccac tgccagaaga 240 caatgaacca agtggttatg cccaaacaga ttgtgtattg gaggcgatgg ctttccttga 300 ggaatcccat cctggtattt ttgaaaactc gtgtattgaa acgatggagg ttgttcagca 360 aacacgagta gacaagctga cacaaggccg acagacctat gactggactc taaatagaaa 420 ccaacctgct gcaacagcat tggccaacac aatagaagtg ttcagatcaa atggcctcac 480 ggccaatgag tctggaaggc tcatagactt ccttaaggat gtaatggagt caatgaacaa 540 agaagaaatg gggatcacaa ctcattttca gagaaagaga cgggtgagag acaatatgac 600 taagaaaatg ataacacaga gaacaatggg taaaaagaag cagagattga acaaaaggag 660 ttatctaatt agagcattga ccctgaacac aatgaccaaa gatgctgaga gagggaagct 720 aaaacggaga gcaattgcaa ccccagggat gcaaataagg gggtttgtat actttgttga 780 gacactggca aggagtatat gtgagaaact tgaacaatca gggttgccag ttggaggcaa 840 tgagaagaaa gcaaagttgg caaatgttgt aaggaagatg atgaccaatt ctcaggacac 900 cgaactttct ttcaccatca ctggagataa caccaaatgg aacgaaaatc agaatcctcg 960 gatgtttttg gccatgatca catatatgac cagaaatcag cccgaatggt tcagaaatgt 1020 tctaagtatt gctccaataa tgttctcaaa caaaatggcg agactgggaa aagggtatat 1080 gtttgagagc aagagtatga aacttagaac tcaaatacct gcagaaatgc tagcaagcat 1140 cgatttgaaa tatttcaatg attcaacaag aaagaagatt gaaaaaatcc gatcgctctt 1200 aatagagggg actgcatcat tgagccctgg aatgatgatg ggcatgttca atatgttaag 1260 cactgtatta ggcgtctcca tcctgaatct tggacaaaag agatacacca agactactta 1320 ctggtgggat ggtcttcaat cctctgacga ttttgctctg attgtgaatg cacccaatca 1380 tgaagggatt caagccggag tcgacaggtt ttatcgaacc tgtaagctac ttggaatcaa 1440 tatgagcaag aaaaagtctt acataaacag aacaggtaca tttgaattca caagtttttt 1500 ctatcgttat gggtttgttg ccaatttcag catggagctt cccagttttg gggtgtctgg 1560 gatcaacgag tcagcggaca tgagtattgg agttactgtc atcaaaaaca atatgataaa 1620 caatgatctt ggtccagcaa cagctcaaat ggcccttcag ttgttcatca aagattacag 1680 gtacacgtac cgatgccata gaggtgacac acaaatacaa acccgaagat catttgaaat 1740 aaagaaactg tgggagcaaa cccgttccaa agctggactg ctggtctccg acggaggccc 1800 aaatttatac aacattagaa atctccacat tcctgaagtc tgcctaaaat gggaattgat 1860 ggatgaggat taccaggggc gtttatgcaa cccactgaac ccatttgtca gccataaaga 1920 aattgaatca atgaacaatg cagtgatgat gccagcacat ggtccagcca aaaacatgga 1980 gtatgatgct gttgcaacaa cacactcctg gatccccaaa agaaatcgat ccatcttgaa 2040 tacaagtcaa agaggagtac ttgaggatga acaaatgtac caaaggtgct gcaatttatt 2100 tgaaaaattc ttccccagca gttcatacag aagaccagtc gggatatcca gtatggtgga 2160 ggctatggtt tccagagccc gaattgatgc acggattgat ttcgaatctg gaaggataaa 2220 gaaagaagag ttcactgaga tcatgaagat ctgttccacc attgaagagc tcagacggca 2280 aaaatagtga atttagcttg tccttcatga aaa 2313 <210> 5 <211> 2206 <212> RNA <213> Influenza A virus <400> 5 gtactgatcc aaaatggaag attttgtgcg acaatgcttc aatccgatga ttgtcgagct 60 tgcggaaaaa acaatgaaag agtatgggga ggacctgaaa atcgaaacaa acaaatttgc 120 agcaatatgc actcacttgg aagtatgctt catgtattca gattttcact tcatcaatga 180 gcaaggcgag tcaataatcg tagaacttgg tgatccaaat gcacttttga agcacagatt 240 tgaaataatc gagggaagag atcgcacaat ggcctggaca gtagtaaaca gtatttgcaa 300 cactacaggg gctgagaaac caaagtttct accagatttg tatgattaca aggagaatag 360 attcatcgaa attggagtaa caaggagaga agttcacata tactatctgg aaaaggccaa 420 taaaattaaa tctgagaaaa cacacatcca cattttctcg ttcactgggg aagaaatggc 480 cacaaaggca gactacactc tcgatgaaga aagcagggct aggatcaaaa ccagactatt 540 caccataaga caagaaatgg ccagcagagg cctctgggat tcctttcgtc agtccgagag 600 aggagaagag acaattgaag aaaggtttga aatcacagga acaatgcgca agcttgccga 660 ccaaagtctc ccgccgaact tctccagcct tgaaaatttt agagcctatg tggatggatt 720 cgaaccgaac ggctacattg agggcaagct gtctcaaatg tccaaagaag taaatgctag 780 aattgaacct tttttgaaaa caacaccacg accacttaga cttccgaatg ggcctccctg 840 ttctcagcgg tccaaattcc tgctgatgga tgccttaaaa ttaagcattg aggacccaag 900 tcatgaagga gagggaatac cgctatatga tgcaatcaaa tgcatgagaa cattctttgg 960 atggaaggaa cccaatgttg ttaaaccaca cgaaaaggga ataaatccaa attatcttct 1020 gtcatggaag caagtactgg cagaactgca ggacattgag aatgaggaga aaattccaaa 1080 gactaaaaat atgaagaaaa caagtcagct aaagtgggca cttggtgaga acatggcacc 1140 agaaaaggta gactttgacg actgtaaaga tgtaggtgat ttgaagcaat atgatagtga 1200 tgaaccagaa ttgaggtcgc ttgcaagttg gattcagaat gagtttaaca aggcatgcga 1260 actgacagat tcaagctgga tagagctcga tgagattgga gaagatgtgg ctccaattga 1320 acacattgca agcatgagaa ggaattattt cacatcagag gtgtctcact gcagagccac 1380 agaatacata atgaaggggg tgtacatcaa tactgccttg cttaatgcat cttgtgcagc 1440 aatggatgat ttccaattaa ttccaatgat aagcaagtgt agaactaagg agggaaggcg 1500 aaagaccaac ttgtatggtt tcatcataaa aggaagatcc cacttaagga atgacaccga 1560 cgtggtaaac tttgtgagca tggagttttc tctcactgac ccaagacttg aaccacataa 1620 atgggagaag tactgtgttc ttgagatagg agatatgctt ataagaagtg ccataggcca 1680 ggtttcaagg cccatgttct tgtatgtgag aacaaatgga acctcaaaaa ttaaaatgaa 1740 atggggaatg gagatgaggc gttgcctcct ccagtcactt caacaaattg agagtatgat 1800 tgaagctgag tcctctgtca aagagaaaga catgaccaaa gagttctttg agaacaaatc 1860 agaaacatgg cccattggag agtcccccaa aggagtggag gaaagttcca ttgggaaggt 1920 ctgcaggact ttattagcaa agtcggtatt caacagcttg tatgcatctc cacaactaga 1980 aggattttca gctgaatcaa gaaaactgct tcttatcgtt caggctctta gggacaacct 2040 tgaacctggg acctttgatc ttggggggct atatgaagca attgaggagt gcctgattaa 2100 tgatccctgg gttttgctta atgcttcttg gttcaactcc ttccttacac atgcattgag 2160 ttagttgtgg cagtgctact atttgctatc catactgtcc aaaaaa 2206 <210> 6 <211> 1537 <212> RNA <213> Influenza A virus <400> 6 tagataatca ctcactgagt gacatcaaaa tcatggcgtc tcaaggcacc aaacgatctt 60 acgaacagat ggagactgat ggagaacgcc agaatgccac tgaaatcaga gcatccgtcg 120 gaaaaatgat tggtggaatt ggacgattct acatccaaat gtgcaccgaa ctcaaactca 180 gtgattatga gggacggttg atccaaaaca gcttaacaat agagagaatg gtgctctctg 240 cttttgacga aaggagaaat aaataccttg aagaacatcc cagtgcgggg aaagatccta 300 agaaaactgg aggacctata tacaggagag taaacggaaa gtggatgaga gaactcatcc 360 tttatgacaa agaagaaata aggcgaatct ggcgccaagc taataatggt gacgatgcaa 420 cggctggtct gactcacatg atgatctggc attccaattt gaatgatgca acttatcaga 480 ggacaagagc tcttgttcgc accggaatgg atcccaggat gtgctctctg atgcaaggtt 540 caactctccc taggaggtct ggagccgcag gtgctgcagt caaaggagtt ggaacaatgg 600 tgatggaatt ggtcagaatg atcaaacgtg ggatcaatga tcggaacttc tggaggggtg 660 agaatggacg aaaaacaaga attgcttatg aaagaatgtg caacattctc aaagggaaat 720 ttcaaactgc tgcacaaaaa gcaatgatgg atcaagtgag agagagccgg aacccaggga 780 atgctgagtt cgaagatctc acttttctag cacggtctgc actcatattg agagggtcgg 840 ttgctcacaa gtcctgcctg cctgcctgtg tgtatggacc tgccgtagcc agtgggtacg 900 actttgaaag ggagggatac tctctagtcg gaatagaccc tttcagactg cttcaaaaca 960 gccaagtgta cagcctaatc agaccaaatg agaatccagc acacaagagt caactggtgt 1020 ggatggcatg ccattctgcc gcatttgaag atctaagagt attaagcttc atcaaaggga 1080 cgaaggtgct cccaagaggg aagctttcca ctagaggagt tcaaattgct tccaatgaaa 1140 atatggagac tatggaatca agtacacttg aactgagaag caggtactgg gccataagga 1200 ccagaagtgg aggaaacacc aatcaacaga gggcatctgc gggccaaatc agcatacaac 1260 ctacgttctc agtacagaga aatctccctt ttgacagaac aaccattatg gcagcattca 1320 atgggaatac agaggggaga acatctgaca tgaggaccga aatcataagg atgatggaaa 1380 gtgcaagacc agaagatgtg tctttccagg ggcggggagt cttcgagctc tcggacgaaa 1440 aggcagcgag cccgatcgtg ccttcctttg acatgagtaa tgaaggatct tatttcttcg 1500 gagacaatgc agaggagtac gacaattaaa gaaaaat 1537 <210> 7 <211> 1000 <212> RNA <213> Influenza A virus <400> 7 gtagatattg aaagatgagt cttctaaccg aggtcgaaac gtacgtactc tctatcatcc 60 cgtcaggccc cctcaaagcc gagatcgcac agagacttga agatgtcttt gcagggaaga 120 acaccgatct tgaggttctc atggaatggc taaagacaag accaatcctg tcacctctga 180 ctaaggggat tttaggattt gtgttcacgc tcaccgtgcc cagtgagcga ggactgcagc 240 gtagacgctt tgtccaaaat gcccttaatg ggaacgggga tccaaataac atggacaaag 300 cagttaaact gtataggaag ctcaagaggg agataacatt ccatggggcc aaagaaatct 360 cactcagtta ttctgctggt gcacttgcca gttgtatggg cctcatatac aacaggatgg 420 gggctgtgac cactgaagtg gcatttggcc tggtatgtgc aacctgtgaa cagattgctg 480 actcccagca tcggtctcat aggcaaatgg tgrcaacaac caatccacta atcagacatg 540 agaacagaat ggttttagcc agcactacag ctaaggctat ggagcaaatg gctggatcga 600 gtgagcaagc agcagaggcc atggaggttg ctattcgggc taggcaaatg gtgcaggcaa 660 tgagaaccat tgggactcat cctagctcca gtgctggtct gaaaaatgat cttcttgaaa 720 atttgcaggc ctatcagaaa cgaatggggg tgcagatgca acggttcaag tgatcctctc 780 attattgcct caartatcat tgggatcttg cacttgayat tgtggattct tgatcgtctt 840 tttttcaaat gcatttaccg tctctttaaa tacggtttga aaagagggcc ttctacggaa 900 ggagtgccaa agtctatgag ggaagaatat caaaaggaac agcagagtgc tgtggatgct 960 gacgatggtc attttgtcag catagagctg gagtaaaaaa 1000 <210> 8 <211> 861 <212> RNA <213> Influenza A virus <400> 8 tgacaaaaac ataatggatc caaacactgt gtcaagcttt caggtagatt gctttctttg 60 gcatgtccgc aaacgagttg cagaccaaga actaggtgat gccccattcc ttgatcggct 120 tcgccgagat cagaaatccc taagaggaag gggcagtact ctcggtctgg acatcaagac 180 agccacacgt gctggaaagc agatagtgga gcggattctg aaagaagaat ccgatgaggc 240 acttaaaatg accatggcct ctgtacctgc gtcgcgttac ctaactgaca tgactcttga 300 ggaaatgtca agggactggt ccatgctcat acccaagcag aaagtggcag gccctctttg 360 tatcagaatg gaccaggcga tcatggataa gaacatcata ctgaaagcga acttcagtgt 420 gatttttgac cggctggaga ctctaatatt gctaagggct ttcaccgaag agggagcaat 480 tgttggcgaa atttcaccat tgccttctct tccaggacat actgctgagg atgtcaaaaa 540 tgcagttgga gtcctcatcg gaggacttga atggaatgat aacacagttc gagtctctga 600 aactctacag agattcgctt ggagaagcag taatgagaat gggagacctc cactcactcc 660 aaaacagaaa cgagaaatgg cgggaacaat taggtcagaa gtttgaagaa ataagatggt 720 tgattgaaga agtgagacac aaactgaaga taacagagaa tagttttgag caaataacat 780 ttatgcaagc cttacatcta ttgcttgaag tggagcaaga gataagaact ttctcgtttc 840 agcttattta gtactaaaaa a 861 <210> 9 <211> 1783 <212> RNA <213> Influenza A virus <400> 9 tccgaagttg ggggggagca aaagcagggg ttcactctgt caaaatggag aacatagtgc 60 ttcttcttgc aatagttagc cttgttaaaa gtgatcagat ttgcattggt taccatgcaa 120 acaactcgac agagcaagtt gacacgataa tggaaaagaa cgtcactgtt acacatgccc 180 aagacatact ggagaaaaca cacaacggga agctctgcga tctaaatgga gtgaagcctc 240 tgattttaaa ggattgtagt gtagctggat ggctcctcgg aaacccaatg tgcgacgaat 300 tcatcagagt gccggaatgg tcttacatag tggagaggga taatccagct aatgacctct 360 gttacccagg gagcctcaat gactatgaag aactgaaaca cctgttgagc agaataaatc 420 attttgagaa gattctgatc atccccaaga gttcttggcc caatcatgaa acatcattag 480 gggtgagcgc agcttgtcca taccagggag cgccctcctt tttcagaaat gtggtatggc 540 ttatcaaaaa gaacgatgca taccccacaa taaagataag ctacaataat accaatcggg 600 aagatctctt gatactgtgg gggattcatc attccaacaa tgcagaagag cagacaaatc 660 tctataaaaa cccaaccacc tatatttcag ttggaacatc aacattaaac cagagattgg 720 taccaaaaat agctactaga tcccaagtaa acgggcaacg tggaagaatg gacttcttct 780 ggacaatttt gaaaccgaat gatgcaattc atttcgagag taatggaaat ttcattgctc 840 cagaatatgc atacaaaatt gtcaagaaag gggactcaac aattatgaaa agtggagtgg 900 aatatggcca ctgcaacacc aaatgtcaaa ccccagtagg agcgataaac tctagtatgc 960 cgttccacaa tatacatcct ctcaccattg gggaatgccc caaatacgtg aagtcaaaca 1020 agttggtcct tgcgactggg ctcagaaata gtcctcaaag agaaacaaga ggactatttg 1080 gagctatagc aggttttata gagggaggat ggcagggaat ggttgatggt tggtatggct 1140 accaccatat caatgagcag gggagtgggt acgctgcaga caaagagtcc acccaaaagg 1200 caatagatgg agttaccaat aaggtcaact cgatcattga caaaatgaac actcaatttg 1260 aggcagttgg aagggagttt aataacttag aaaggaggat agagaatttg aacaagaaaa 1320 tggaagacgg attcctagat gtctggacct ataatgctga acttctagtt ctcatggaaa 1380 acgagaggac tctagatttc catgactcaa atgtcaagaa cctttacgac aaagtcagac 1440 tgcagcttag ggataatgca aaggagctgg gtaacggttg tttcgaattc tatcacaaat 1500 gtgataatga atgtatggaa agtgtgagaa atgggacgta tgactaccct cagtactcag 1560 aagaagcaag attaaaaaga gaagaaataa gcggagttaa attagaatca ataggaactt 1620 accaaatact gccaatttat tcaacagtgg cgagttccct agcactggca atcatggtgg 1680 ctggtctatc tttatggatg tgctccaatg ggtcgttaca gtgcagaatt tgcatttaaa 1740 tttgtgagct cagattgtag ttaaaaacac ccttgtttct act 1783 <210> 10 <211> 1435 <212> RNA <213> Influenza A virus <400> 10 gaaaatgaat ccaaatcaga agataatatg catttcagcc acaggaatga cactatcggt 60 agtaagcctg ctaataggaa ttgccaattt aggcctaaac atcggacttc actataaggt 120 gggtgatgca ccaactgttg atatcccgag catgaatgaa accaactcaa ccacaacaat 180 aataaacaat aatactcaaa ataatttcac aaatatcact aacattataa taaacaaaga 240 ggaggaaaga atatttctaa acctgactaa gcctctatgt gaggtaaact catggcacat 300 tctatcgaag gacaatgcaa taagaatagg ggaggatgct catatactag tcacaaggga 360 gccctattta tcctgtgatc cgcaaagctg taggatgttt gctctgagcc aaggcacgac 420 actcagagga cggcatgcga acggaactat acatgacaga agcccattca gagctctcgt 480 gagctgggaa atgggtcaag cgcccagtcc atacaacgtt agggtcgaat gtataggatg 540 gtcaagcaca tcatgccacg atggcatatc aagaatgtcg atatgcatgt cggggccaaa 600 caacaatgcg tcagcagtgg tctggtacgg gggtaggcca gtaacagaaa tcccatcatg 660 ggcaggaaat attctcagaa ctcaggaatc agaatgcgtg tgtcataaag gggtctgtcc 720 agtagtcatg acagatggcc cagcaaatag tagagcagca actaagataa tttatttcaa 780 agaggggaag atacagaaaa ttgaagaatt gagagggaat gcccagcaca ttgaggaatg 840 ttcatgctat ggggcagcaa gggtaatcaa atgtgtgtgc agggacaatt ggaaaggggc 900 aaacagacca gtaatcacta tagatcctga aatgatgact cacacaagca agtatttgtg 960 ctcaagggta ttaaccgata caagtcgccc caatgatccc actagcggga actgtgatgc 1020 tccgataatg ggggagagcc cagatcctgg ggtgaagggg tttgcattct tggatggaga 1080 gaattcatgg cttggaagga caattagcaa agactccaga tcaggctacg aaatattaaa 1140 ggtcccaaat gcagaaactg atacccagtc agggccaaca tcacaccaga taattgtcaa 1200 caacccaaac tggtcgggat actcaggagc gttcatagac tattgggcaa acaaagagtg 1260 cttcaatcct tgtttttatg tggaactaat cagagggaga cccaaggaga gtagtgtact 1320 gtggacttca aatagcattg tagctctctg tggatccaaa gagcgattgg gatcatggtc 1380 ctggcacgat ggtgctgaga tcatctactt taagtaggaa taatttagga aaaaa 1435 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HA1F <400> 11 tccgaagttg ggggggagca aaagcagggg 30 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> H26-MuCl-H5R <400> 12 cctcttgttt ctctttgagg actatttctg agccc 35 <210> 13 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> H26-MuCl-H5F <400> 13 ctcaaagaga aacaagagga ctatttggag ctata 35 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> NS-890R <400> 14 gggccgccgg gttattagta gaaacaaggg tg 32 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> N1-1F <400> 15 tccgaagttg ggggggagca aaagcaggag 30 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> N1-1413R <400> 16 gggccgccgg gttattagta gaaacaagga gt 32 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB2-1F <400> 17 tccgaagttg ggggggagcg aaagcaggtc 30 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB2-2341R <400> 18 gggccgccgg gttattagta gaaacaaggt cg 32 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB1-1F <400> 19 tccgaagttg ggggggagcg aaagcaggca 30 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB1-2341R <400> 20 gggccgccgg gttattagta gaaacaaggc at 32 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PA-1F <400> 21 tccgaagttg ggggggagcg aaagcaggta 30 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PA-2233R <400> 22 gggccgccgg gttattagta gaaacaaggt ac 32 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-NP-1F <400> 23 tccgaagttg ggggggagca aaagcagggt 30 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-NP-1565R <400> 24 gggccgccgg gttattagta gaaacaaggg ta 32 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-M-1F <400> 25 tccgaagttg ggggggagca aaagcaggta 30 <210> 26 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-M-1027R <400> 26 gggccgccgg gttattagta gaaacaaggt ag 32 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-NS-1F <400> 27 tccgaagttg ggggggagca aaagcagggt 30 <210> 28 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-NS-890R <400> 28 gggccgccgg gttattagta gaaacaaggg tg 32 <210> 29 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> N6-1F <400> 29 tccgaagttg ggggggagca aaagcagggt gaaaatg 37 <210> 30 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> N6-890R <400> 30 gggccgccgg gttattagta gaaacaaggg tgtttt 36

Claims (18)

Method for producing H5N8 type recombinant influenza A virus comprising the following steps:
(a) H5N8 highly pathogenic influenza A virus-derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 1 and H5N8 highly pathogenic influenza A virus-derived NA (neuraminidase) consisting of the nucleotide sequence of SEQ ID NO: 2 were cloned into a vector, respectively, and recombinant plasmids Manufacturing a;
(b) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (non) consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8 -structural protein) to prepare a recombinant plasmid by cloning each vector;
(c) transfecting the recombinant plasmid of steps (a) and (b) into a packaging cell; And
(d) obtaining H5N8 type recombinant influenza A virus from the culture supernatant of the packaging cells.
The method according to claim 1, wherein the H5N8 type highly pathogenic influenza A virus in step (a) is A/chicken/Korea/Gimje2/2017(H5N8), H5N8 type recombinant influenza A virus.
The method of claim 1, wherein the HA derived from the H5N8 type highly pathogenic influenza A virus of the step (a) is an HA in which Lys-Arg-Arg-Lys is deleted located at the carboxy terminal region of HA1 constituting the HA, H5N8 Method for producing recombinant influenza A virus.
The method according to claim 1, wherein the low pathogenic influenza A virus of step (b) is A/PR/8/34 (H1N1), H5N8 type recombinant influenza A virus.
The method of claim 1, wherein the packaging cell of step (c) is a cell selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells, H5N8 type recombinant influenza A virus.
(I) HA (hemagglutinin) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1;
(Ii) NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2; And
(iii) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8) non-structural protein) containing 8 negative-sense ssRNAs,
Recombinant H5N8 type influenza A virus.
The H5N8 type recombinant influenza A virus according to claim 6, wherein the H5N8 type highly pathogenic influenza A virus-derived HA is Lys-Arg-Arg-Lys located at the carboxy terminal region of HA1 constituting the HA is deleted.
(I) HA (hemagglutinin) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1;
(Ii) NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2; And
(iii) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8) non-structural protein) containing 8 negative-sense ssRNAs,
Vaccine composition against H5 serotype influenza A virus, including H5N8 type recombinant influenza A virus.
The vaccine composition of claim 8, wherein the H5 serotype influenza A virus belongs to clade 2.3.4.4B.
delete delete delete delete delete delete delete delete delete

Images