KR102182987B1 - Recombinant Influenza A virus H5N1 strain and Vaccine Composition for Highly Pathogenic Influenza A virus comprising the same - Google Patents

Abstract

The present invention provides a recombinant influenza A virus H5N1 strain, a preparation method thereof, and a vaccine composition against influenza A virus H5N1 comprising the same. The vaccine composition is a vaccine having a high antigenicity that maintains a high titer (2 ⁷ ) for up to 24 weeks, and provides the advantage of sufficiently protecting against viral infection by vaccination twice a year.

Description

Recombinant Influenza A virus H5N1 strain and Vaccine Composition for Highly Pathogenic Influenza A virus comprising the same}

The present invention relates to a recombinant influenza A virus H5N1 strain and a highly pathogenic influenza A virus vaccine composition comprising the same.

Avian Influenza (AI) is an acute infectious disease in birds caused by infection with the avian influenza virus. In Korea, since the first occurrence in 2003, it has occurred every year from 2014. In particular, from November 2016 to June 2017, a total of 419 cases of HPAI of two types (H5N6, H5N8) occurred (H5N6 343, H5N8 76), resulting in 3,800 Astronomical direct and indirect expenses were required, such as killing 10,000 animals, causing the largest damage ever. This had a huge impact on not only the domestic poultry industry, but also the entire related industry due to the shrinking consumption. In addition, HPAI (Highly Pathogenic Avian Influenza) has been continuously occurring in Southeast Asia, which is geographically close to Korea, from 2004 to the present. In particular, cases of human infections caused by H5N1 type HPAI in Thailand and Vietnam continue to appear. Actually. HPAI has a policy of eradication through killing of infected animals in most countries, including Korea, excluding Mexico and Italy, which use avian influenza vaccines. However, even in Korea, if HPAI occurs at all times, direct and indirect expenses such as compensation for killings, concerns about circulatory infection of the human body, and environmental problems will prevent Korea from insisting on killing policies as in the past. Therefore, while trying to eradicate and prevent recurrence of HPAI, the need to develop vaccine stocks that exhibit protective effects against HPAI in case of emergency that cannot be controlled by killing alone is raised.

The causative agent of such avian influenza (avian influenza virus) is influenza A virus. Influenza A virus (Influenza A Virus) is an RNA virus belonging to the Orthomyxo family (Family Orthomyxoviridae), a virus having 8 negative single-stranded RNA fragments as a genome, and a hemagglutinin (hemagglutinin) from the 8 RNA fragments; HA), neuraminidase (NA), nucleoprotein (NP), matrix proteins 1 and 2 (matrix, M1, M2), polymerase units A, B1 and B2 (polymerase subunit A, B1) &B2; PA, PB1, PB2, respectively), and nonstructural proteins 1 & 2 (NS1, NS2, respectively) are made. Influenza A virus infection has been confirmed in humans, horses, pigs and other mammals, as well as various types of poultry and wild birds.

The serotypes of influenza A virus are classified according to the types of two proteins on the virus surface, hemagglutinin (HA) and neuraminidase (NA), and 18 HA subtypes (H1~H16 from wild algae). , H17 from bat, H18) and 11 NA subtypes (N1 to N9 from wild birds, N10 from bats, N11). HA is responsible for attaching viruses to somatic cells, and NA allows viruses to penetrate into cells.

Although most avian influenza viruses do not directly infect humans, it has been known that sometimes human and avian viruses are genetically recombined and amplified in pigs, and then new antigenic viruses that can infect humans can emerge. Among the various serotypes of the avian influenza virus, all of the highly pathogenic avian influenza (HPAI) that have occurred to date were found to be due to the H5 or H7 serotype. In 1996, a highly pathogenic avian influenza virus (HPAIV), A/Gs/Gd/1/1996 (H5N1), was first isolated from a goose farm in China. Since then, the H5 virus has evolved into a new form by AI and genetic recombination of infected wild birds and poultry. For example, various subtypes of H5 highly pathogenic avian influenza virus (HPAIV) were discovered as H5N2, H5N5, H5N6, H5N8, etc. as they spread by wild birds.

Among the vaccines for preventing avian influenza, it is almost impossible to develop a live virus vaccine due to the nature of a virus that is easily mutated, and the vaccines developed so far can be largely divided into deadox vaccines and genetically modified vaccines. In Italy in 1999 and Hong Kong in 2003, the outbreak of highly pathogenic avian influenza prolonged and spread across the country. As a result, the avian influenza vaccine was combined with the selective killing policy. Currently, in Italy and Hong Kong, the use of avian influenza vaccine is highly pathogenic avian influenza. It is receiving positive reviews that it was effective in controlling. The vaccines that received positive evaluations in Italy (serum type A/H7N1) (I.Capua et al. 2002) and Hong Kong (serum type A/H5N1) (Ellis TM. et al. , 2006) were all deadlock vaccines, type HA type. Is a case of attempting to differentiate it from field infections when an antibody test was performed by preparing a Zadok vaccine with a heterogeneous serotype virus (serotype A/H7N3, serotype A/H5N2) of the same but different NA types. In addition, the currently developed Zadok vaccine can reduce the amount of virus discharged into the feces during highly pathogenic avian influenza infection, but it is evaluated that it does not completely prevent the spread of the disease.

Avian influenza vaccines developed to date are being used in several countries. China, Vietnam, Mexico, Egypt and Indonesia are implementing vaccine policies. However, avian influenza has a variety of serotypes as stated, and it is not protected if the serotypes are different, so it shows high protection against serotypes prevalent in Asia since 2003, and has high safety and protective ability during the vaccine manufacturing process. And there is a need to develop a vaccine using a highly pathogenic vaccine strain having excellent efficacy.

Accordingly, the present inventors produced attenuated influenza A virus H5N1 by deleting the highly pathogenic tetrapeptide (-RRRK-) of the HA gene of the highly pathogenic avian influenza virus strain (one virus; A/chicken/Vietnam/NCVD-KA435/2013). The present invention was completed by preparing a highly pathogenic influenza A virus vaccine composition comprising the same.

Korean Patent Registration No. 10-1170113 Korean Patent Registration No. 10-1466326

Webster RG et al., Microbiol Rev., 56(1), pp152-179 Medina et al., Nat. Rev. Microbiol.., 9, pp590-603 2011 Alexander DJ, Vet. Microbiol., 74(1-2), pp3-13, 2000 Kim et al., Emerg. Microbes Infect., 3(e75), 2014 Gu M. et al., Emerg. Infect. Dis. 19, pp2021-2024, 2013 Capua I et al., Avian Pathol., 32, pp47-55, 2003 Capua I and Marangon S, Avian Pahol., 32, pp335-343, 2003 Swayne ED et al., Avian Pathol., 28, pp245-255, 1999

The present inventors made intensive research efforts to develop a recombinant vaccine against highly pathogenic influenza A virus H5N1. As a result, an attenuated influenza A virus H5N1 was prepared by deleting the tetrapeptide in HA that confers pathogenicity of the highly pathogenic influenza A virus H5N1, and the present invention was completed by examining its high stability, immunity and vaccine efficacy.

Accordingly, an object of the present invention is to provide a method for preparing recombinant influenza A virus H5N1 strain.

Another object of the present invention is to provide a recombinant influenza A virus strain H5N1.

Another object of the present invention is to provide a vaccine composition against influenza A virus H5N1.

According to one aspect of the present invention, the present invention provides a method for preparing a recombinant influenza A virus H5N1 strain comprising the following steps:

(a) High pathogenic influenza A virus H5N1 derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 1 and NA (neuraminidase) derived from high pathogenic virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 2, respectively, into a vector to prepare a recombinant plasmid ;

(b) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (respectively consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8) non-structural protein) to prepare a recombinant plasmid by cloning each vector;

(c) transfecting the recombinant plasmid of steps (a) and (b) into a packaging cell; And

(d) obtaining recombinant influenza A virus H5N1 from the culture supernatant of the packaging cells.

The present inventors made intensive research efforts to develop a recombinant vaccine against highly pathogenic influenza A virus H5N1. As a result, the attenuated influenza A virus H5N1 was prepared by deleting the tetrapeptide (-RRRK-) in HA that confers pathogenicity of the highly pathogenic influenza A virus H5N1, and its high stability, immunity and vaccine efficacy were investigated.

The term "avian influenza" as used herein refers to an acute infectious disease of birds caused by infection with avian influenza virus. The causative agent of the avian influenza is influenza A virus.

In the present specification, the term'influenza A virus' is a virus that causes highly infectious respiratory diseases, commonly referred to as'flu' that occurs in animals and humans, and has an envelope having a fragmented genome consisting of single-stranded negative RNA fragments. It means RNA virus.

In the present specification, the term'recombinant influenza A virus' refers to a virus in which the RNA fragment of the influenza A virus has been recombined using gene recombination technology. For example, it is a virus containing genetic material produced by the combination of RNA fragments of at least two donor viruses (high pathogenic influenza A virus and low pathogenic influenza A virus).

In the present specification, the term'highly pathogenic influenza A virus' refers to (i) inoculation to 8 susceptible chickens aged 4-8 weeks and dying 6 or more (75%) within 10 days; (Ii) Intravenous pathogenicity (IVPI, 10 numbers of 4-8 weeks old susceptible chickens) intravenously inoculated with virus, and the clinical symptoms and mortality of chickens were checked at 24 hour intervals for 10 days, respiratory symptoms and depression. , Diarrhea, cyanosis of the outer skin or clefts, swelling of the head, and the severity of neurological symptoms were recorded as a score, and the sum of each symptom multiplied by the number of symptoms divided by 100) was 1.2 or higher; (Iii) In the case of H5 or H7 type, which is low pathogenicity in chickens, it means the case where the amino acid sequence of the HA protein segment is determined to be similar to high pathogenicity.

In the present specification, the term'low pathogenic influenza A virus' is more than highly pathogenic influenza A virus, when (i) 2 or less (25%) deaths within 10 days after inoculation to 8 susceptible chickens aged 4-8 weeks; (Ii) the intravenous pathogenicity index is less than 1.2; (Iii) In the case of H5 or H7 type, which is low pathogenicity in chickens, it means the case where the amino acid sequence of the HA protein segment is determined to be different from the highly pathogenicity.

As used herein, the term'influenza A virus H5N1' refers to an influenza A virus in which the antigen characteristic of the HA protein, which is the surface protein of the influenza A virus, is H5 type and the antigen characteristic of the NA protein is N1 type.

The method for preparing the recombinant influenza A virus H5N1 strain of the present invention will be described step by step.

Step (a): Preparation of recombinant plasmids each containing HA and NA of highly pathogenic influenza A virus

First, the highly pathogenic influenza A virus H5N1 derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 1 and the highly pathogenic virus H5N1 derived NA (neuraminidase) consisting of the nucleotide sequence of SEQ ID NO: 2 are each cloned into a vector to prepare a recombinant plasmid.

In the present specification, the term'nucleotide sequence' is interpreted as including a nucleotide sequence exhibiting substantial identity to the nucleotide sequence in addition to the above-mentioned sequence. The above substantial identity is at least 80% when the nucleotide sequence of the present invention and any other sequence are aligned to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. It means a nucleotide sequence that exhibits homology, more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv. Appl. Math. 2:482 (1981) ; Needleman and Wunsch, J. Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al. , Nuc. Acids Res. 16:10881-90 (1988); Huang et al. , Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al. , Meth. Mol. Biol. 24:307-31 (1994). NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. , J. Mol. Biol. 215:403-10(1990)) can be accessed from NCBI (National Center for Biological Information), etc., and blastp, blasm, and It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLAST is available at www.ncbi.nlm.nih.gov/BLAST/ . A method for comparing sequence homology using this program can be found at www.ncbi.nlm.nih.gov/BLAST/blast_help.html .

The recombinant plasmid of step (a) contains HA consisting of the nucleotide sequence of SEQ ID NO: 1 derived from the highly pathogenic influenza A virus H5N1, and the NA consisting of the nucleotide sequence of SEQ ID NO: 2.

According to one embodiment of the present invention, the highly pathogenic influenza A virus H5N1 is A/chicken/Vietnam/NCVD-KA435/2013 (H5N1).

According to the nomenclature of influenza virus [subtype/originate host/isolated area/separation order/year of isolation (HA type, NA type)], the A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) is an influenza A virus and chicken It is the virus isolated from Vietnam for the 435th time by the National Center for Veterinary Diagnostics (NCVD) in 2013 and has antigenic types of H5 and N1.

The HA derived from the highly pathogenic influenza A virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 1 is an HA in which a highly pathogenic inducing gene has been deleted.

According to an embodiment of the present invention, the HA derived from the highly pathogenic influenza A virus H5N1 is an HA in which Arg-Arg-Arg-Lys is deleted located at the carboxy terminal region of HA1 constituting HA.

HA of influenza A virus is a surface glycoprotein, and when influenza A virus is introduced into cells, it plays a role of interacting with specific receptors on the cell surface. The HA is composed of subunits of HA1 and HA2, and an amino acid sequence (Arg-Arg-Arg-Lys-Lys, RRRKK) that induces high pathogenicity of influenza A virus is present at the carboxyl terminal region of HA1.

The present invention attenuates the highly pathogenic influenza A virus by deleting the highly pathogenic inducing site of the HA1 site of the influenza A virus.

The highly pathogenic influenza A virus H5N1 derived NA consisting of the nucleotide sequence of SEQ ID NO: 2 is a surface glycoprotein of the influenza A virus, and the binding between the host cell receptor and the virus particle so that the virus proliferated from the infected cell is released and infects new cells. It plays a role in cutting off.

The HA consisting of the nucleotide sequence of SEQ ID NO: 1 derived from the highly pathogenic influenza A virus H5N1 and the NA consisting of the nucleotide sequence of SEQ ID NO: 2 are cloned into a vector to prepare a recombinant plasmid.

As used herein, the term'vector' is a linear or circular DNA molecule composed of a fragment encoding a polypeptide of interest operably linked to an additional fragment provided for transcription of the vector. Such additional fragments include promoter and terminator sequences. The vector also includes one or more origins of replication, one or more selection markers, and the like. Vectors are generally derived from plasmid or viral DNA, or contain elements of both.

According to an embodiment of the present invention, the vector is a v2pHW vector.

The v2pHW vector (Korea Patent Registration No. 10-1323582) is a human PolI promoter of the pHW2000 vector (Hoffmann E et al. Proc Natl Acad Sci USA 2000 23;97(11):6108-13) in Vero cells (from monkeys). It is a vector substituted with the derived PolI promoter.

According to one embodiment of the present invention, the recombinant plasmid is composed of a first recombinant plasmid containing HA and a second recombinant plasmid containing NA.

Step (b): Preparation of recombinant plasmids each containing PB2, PB1, PA, NP, M and NS of the low pathogenic influenza A virus

Next, PB2, PB1, PA, NP, M, and NS derived from the hypopathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8, were cloned into a vector to prepare a recombinant plasmid.

The recombinant plasmid of step (b) contains PB2, PB1, PA, NP, M, and NS, respectively, consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 derived from the low pathogenic influenza A virus.

In one embodiment of the present invention, the low pathogenic influenza A virus is A/PR/8/34 (H1N1).

PB2, PB1, PA, NP, M and NS derived from the hypopathogenic influenza A virus, each consisting of the nucleotide sequence of SEQ ID NO: 3 to 8 of the hypopathic influenza A virus, were cloned into a vector to prepare a recombinant plasmid.

According to an embodiment of the present invention, the recombinant plasmid is a third recombination plasmid comprising PB2, a fourth recombination plasmid comprising PB1, a fifth recombination plasmid comprising PA, a sixth recombination plasmid comprising NP, M It consists of a seventh recombinant plasmid containing and an eighth recombinant plasmid containing NS.

Step (c): Transfection into packaging cells

Next, the first to eighth recombinant plasmids of steps (a) and (b) are transfected into the packaging cells.

In the present specification, the term'packaging cell' refers to a cell capable of producing a recombinant virus through a non-viral transfection method. For example, the packaging cell is a recombinant influenza A virus H5N1 in which HA, NA, PB2, PB1, PA, NP, M and NS proteins expressed from the transfected first to eighth recombination plasmids are assembled. Can produce.

According to one embodiment of the present invention, the packaging cells are one or more cells selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells.

According to a specific embodiment of the present invention, the packaging cell is a 293T cell.

Step (d): Obtaining the recombinant influenza A virus H5N1

Finally, recombinant influenza A virus H5N1 is obtained from the culture supernatant of the packaging cells.

According to another aspect of the present invention, the present invention provides (i) HA (hemagglutinin) derived from highly pathogenic influenza A virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 1; (Ii) NA (neuraminidase) derived from highly pathogenic virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 2; And (iii) low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8 Recombinant influenza A virus H5N1 strain [rgKA435(H5N1)] containing the genome of 8 negative-sense ssRNAs of (non-structural protein) is provided.

The recombinant influenza A virus H5N1 strain of the present invention is almost the same as the content of the method for preparing the recombinant influenza A virus H5N1 strain described above, so that descriptions of the content in common between the two are omitted in order to avoid excessive complexity of the present specification.

According to another aspect of the present invention, the present invention provides (i) HA (hemagglutinin) derived from highly pathogenic influenza A virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 1; (Ii) NA (neuraminidase) derived from highly pathogenic virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 2; And (iii) low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8 A vaccine composition against influenza A virus H5N1 comprising a recombinant influenza A virus H5N1 strain, comprising the genome of eight negative-sense ssRNAs of (non-structural protein) is provided.

In the present specification, the term'vaccine composition' refers to a composition that positively affects the immune response of a subject. The vaccine composition provides the subject with an enhanced systemic or local immune response triggered by a cellular immune response, such as a Cytotoxic T Lymphocyte (CTL) or a humoral immune response, such as an antibody. Targets of the vaccine composition include birds, humans, dogs, horses, pigs, cats, etc., but are not limited thereto.

The vaccine composition of the present invention comprises a pharmaceutically effective amount of the recombinant influenza A virus H5N1 strain of the present invention. The vaccine composition may additionally include a pharmaceutically acceptable carrier. The term "pharmaceutically effective amount" as used herein refers to an amount sufficient to achieve prophylactic, alleviating or therapeutic efficacy against a disease or pathological condition caused by a virus. Pharmaceutically acceptable carriers that can be included in the composition of the present invention are commonly used in formulation, and are lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, silicic acid. Calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It is not. The composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). The vaccine composition of the present invention may contain other components such as stabilizers, excipients, other pharmaceutically acceptable compounds or any other antigens or portions thereof. Vaccines can be in the form of freeze-dried preparations or suspensions, all of which are common in the field of vaccine production.

The dosage form of the vaccine composition of the present invention may be in the form of an enteric coating unit, intraperitoneal, intramuscular or subcutaneous inoculation, aerosol spray, oral or intranasal use. It is also possible to administer as drinking water or edible pellets. The vaccine composition of the present invention can also be delivered as a single vaccine by expressing immunomodulatory molecules such as heterologous antigens and cytokines in the same recombinant, as a "cocktail" comprising two or more viral vectors having different foreign genes or adjuvants. Can be administered. As used herein, the term "adjuvant" generally refers to any substance that increases the body fluid or cellular immune response to an antigen (eg, alum, Freund's complete adjuvant, Freund's incomplete adjuvant, LPS, poly IC , poly AU, etc.).

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a recombinant influenza A virus H5N1 strain, a preparation method thereof, and a vaccine composition against influenza A virus H5N1 comprising the same.

(b) The vaccine composition of the present invention is a vaccine having a high antigenicity that maintains a high titer (2 ⁷ ) for up to 24 weeks, and provides the advantage of being able to sufficiently protect against viral infection by vaccination twice a year.

In particular, the recombinant influenza A virus strain of the present invention is an attenuated vaccine strain developed from a virus isolated in Vietnam that has not yet been developed or developed in Korea. Do. In addition, the vaccine strain of the present invention was developed as part of the establishment of the HPAI antigen bank for domestic poultry, and can play a very important role in the prevention of domestic poultry diseases.

1 shows images 72 hours after inoculation of chicken embryos inoculated with the A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) (left) and rgKA435 (H5N1) vaccine strains (right).
FIG. 2 shows the percentage survival for 14 days after challenge of A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) of SPF chickens inoculated with or without rgKA435 (H5N1) vaccine line.
3 shows HI titers for 24 weeks after vaccination with rgKA435(H5N1) vaccine.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Throughout the present specification, "%" used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol) %.

Example

Example 1. Preparation of H5N1 type attenuated recombinant vaccine

1-1. HA gene (H5) removal of highly pathogenic H5N1 strain

RNA was extracted from A/chicken/Vietnam/NCVD-KA435/2013(H5N1) influenza virus using an RNA extration kit (iNtRON, Korea). In order to remove the highly pathogenic gene (RRRKK) in the segmental region of the HA segment, two segments (HA1 and HA2) using the overlapping primers shown in Table 1 below were converted into Onestep RT (reverse transcription)-PCR kit ( Qiagen, USA) after amplification (PCR conditions: 50℃ 30min, 95℃ 15min, 94℃ 30sec, 57℃ 1min, 72℃ 1min/35 times) and then PCR using these two segments Through the amplification of the HA gene (PCR conditions: 94 ℃ 30 seconds, 57 ℃ 1 minute, 72 ℃ 4 minutes / 35 times), was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number HA1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGG 9 H26-H5R CCTCTTGTTTCTCTTTGAGGACTATTTCTGAGCCC 10 H26-H5F CTCAAAGAGAAACAAGAGGACTATTTGGAGCTATA 11 NS-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTG 12

1-2. Amplification of gene NA(N1) of highly pathogenic H5N1 strain

After performing the experiment in the same manner as in Example 1-1 to create cDNA, the full sequence of N1 was amplified through PCR using the primers shown in Table 2 below for NA (N1) (PCR conditions: 94 ℃ 30 seconds, 57 ℃ 1 minute, 72 ℃ 2 minutes / 35 times), and was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number N1-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGAG 13 N1-1413R GGGCCGCCGGGTTATTAGTAGAAACAAGGAGT 14

1-3. Vector cloning of highly pathogenic influenza A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) strain

The genes HA and NA amplified by PCR in Examples 1-1 and 1-2 were conjugated to v2pHW vector (KCDC) with an In-Fusion HD Cloning kit (Takara, USA), and then Escherichia coli , stella competent cells). Transformed E. coli was incubated for 18 hours in a 37°C rotating incubator (shaking incubator) using LB broth (Bio Science, Korea). From the culture of transformed E. coli, the plasmid was purified using a Plasmid DNA purification Kit (iNtRON, Korea) to obtain HA and NA genes.

1-4. Vector cloning of hypopathogenic influenza A/PR/8/34 (H1N1) strain

PB2, PB1, PA, NP, M, NS genes by performing an experiment in the same manner as in Examples 1-1 to 1-3 above in A/PR/8/34 (H1N1) virus (ATCC VR-95, USA) Were amplified through PCR using specific primers shown in Table 3 below (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), and then v2pHW vector (Korean Patent Registration No. 10-1323582 In-Fusion HD Cloning kit (Takara, USA). The conjugated v2pHW vector was transformed into E. coli , stella competent cells, and then cultured for 18 hours in a 37°C rotating incubator using LB broth (Bioscience, Korea). PB2, PB1, PA, NP, M and NS genes were obtained from the culture of transformed E. coli using a Plasmid DNA purification Kit (iNtRON, Korea).

Primer name Base sequence (5'->3') Sequence number Phw-PB2-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGTC 15 Phw-PB2-2341R GGGCCGCCGGGTTATTAGTAGAAACAAGGTCG 16 Phw-PB1-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGCA 17 Phw-PB1-2341R GGGCCGCCGGGTTATTAGTAGAAACAAGGCAT 18 Phw-PA-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGTA 19 Phw-PA-2233R GGGCCGCCGGGTTATTAGTAGAAACAAGGTAC 20 Phw-NP-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGT 21 Phw-NP-1565R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTA 22 Phw-M-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGTA 23 Phw-M-1027R GGGCCGCCGGGTTATTAGTAGAAACAAGGTAG 24 Phw-NS-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGT 25 Phw-NS-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTG 26

1-5. Production of attenuated recombinant H5N1 serotype virus strain

293T cells (ATCC CRL-3216) were cultured with DMEM (1x), 10% FBS, and 1% Anti-Anti (Antibiotic-Antimycotic, 100x) at 37° C. and 5% CO ₂ . 0.5 μl of each plasmid obtained in Examples 1-3 and 1-4 was transfected into 293T cells using Lipofectamin LTX and Plus Reagent (Lipofectamin LTX and Plus Reagent, Invitrogen, USA). . After 48 hours, the supernatant was inoculated into a 10-day-old specific pathogen free (SPF, specific pathogen free) incubated egg (10 ^5.0 EID ₅₀ /0.1ml) and attenuated recombinant H5N1 serotype virus strain (hereinafter, rgKA435(H5N1)). (Designated as) was prepared and obtained (deposit institution: Animal and Plant Quarantine Agency, deposit date December 1, 2017).

Example 2. Preparation of Zadok vaccine

The rgKA435 (H5N1) strain obtained in Example 1 (deposit institution: Korea Veterinary Culture Collection, KVCC, deposit date: November 29, 2017, deposit number: VR1700107) was inoculated into 100 SPF hatched eggs of 10 days old. After 48 hours incubation in a 37 ℃ incubator. The hatched eggs cultured for 48 hours were refrigerated at 4° C. for 6 hours, and then urine (allantoic fluid, 10 ^8.5 EID ₅₀ /0.1 ml) was obtained. After the obtained urine water was concentrated to 1/10, the concentrated virus was inactivated at 4°C for 12 hours with 0.01% formalin.

Experimental example

Experimental Example 1. Verification of whether rgKA435(H5N1) removes highly pathogenic genes in the HA segment

In order to verify whether the HA gene of rgKA435 (H5N1) obtained in Example 1 was removed, an experiment was performed as follows.

1-1. Verification by genetic analysis

The highly pathogenic H5N1 avian influenza virus has a highly pathogenic gene (RRRKK: AGA AGA AGA AAA AAG) in the HA protein segment and causes fatal diseases in poultry. Attenuated vaccine strains from which are removed should be developed.

The HA gene was amplified by PCR from the rgKA435 (H5N1) vaccine strain in the experimental method of Example 1-1 and cloned into the vpHW2000 vector, and Briddye Terminaor v3.1 Cycle Sequencing Kit (Bionics, Korea) and Applied Biosystems 3730XL DNA The base sequence was calculated using an analyzer. It was confirmed whether or not highly pathogenic genes were removed using CLC Main workbench (USA).

As a result of the experiment, it was confirmed that RRRK, a highly pathogenic gene of the rgKA435 vaccine strain, was removed as shown in Table 4 below.

Virus stock Base sequence A/chicken/Vietnam/NCVD-KA435/2013(H5N1) AGAAATAGTCCTCAAAGAGAGAGAAGAAGAAAAAGAGG rg_KA435(H5N1) AGAAATAGTCCTCAAAGAGA------------AAGAGG

1-2. Inoculated into 10-day-old hatching eggs to verify high pathogenicity

When A/chicken/Vietnam/NCVD-KA435/2013 (H5N1), which has a highly pathogenic gene RRRK, is inoculated into a 10-day-old hatching egg, the fetus dies, and blood vessels are not visible when egg eggs are lit.

A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) and the attenuated rgKA435 (H5N1) vaccine strain obtained in Example 1 were inoculated into 10-day-old hatching eggs, and 72 hours later, using a lamp, The condition was checked.

As shown in FIG. 1, the hatched eggs inoculated with A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) showed little blood vessels, whereas the hatched eggs inoculated with the attenuated rgKA435 (H5N1) vaccine strain Because the fetus did not die, he was able to see clear blood vessels.

Experimental Example 2. rgKA435 (H5N1) recombinant vaccine strain safety and immunity verification

In order to confirm the safety of the recombinant vaccine obtained in Example 2 and the immunity to H5N1 serotype highly pathogenic avian influenza virus, an experiment was performed as follows using SPF chickens.

Since SPF chicken is a vaccine developed for use as an actual target animal, it was used for the efficacy test of the highly pathogenic H5N1 avian influenza vaccine. The biceps muscle of 10 6-week-old SPF chickens was inoculated with 1 ml of rgKA435(H5N1) avian influenza vaccine antigen (500 μl/dose, 10 ^9.0 EID _50/ 0.1 ml). Serum was obtained 2 weeks after inoculation, and the antibody titer was verified by hemagglutination inhibition (HI). Ten SPF chickens used as a control group were inoculated with physiological saline for efficacy comparison.

As a result, it was confirmed that all of the 10 SPF chickens that received the vaccine had a hemagglutination inhibitory titer (HI) titer of 2 ⁷ or more, and did not show any special clinical symptoms such as death and weight loss (Table 5). .

No. Vaccination object Control HI titer
(log ₂ ) Dead water/Vaccination water HI titer
(log ₂ ) Dead water/Vaccination water One 7 0/10 <1 0/10 2 8 <1 3 7 <1 4 9 <1 5 7 <1 6 8 <1 7 9 <1 8 10 <1 9 7 <1 10 9 <1

Experimental Example 3. rgKA435 (H5N1) avian influenza poisoning vaccine strain protective efficacy verification

To verify the protective efficacy of the rgKA435 (H5N1) Zadok vaccine strain (vaccine antigen) obtained in Example 2, an experiment was performed as follows.

3-1. H5N1 attack vaccination

Ten 6-week-old SPF chickens were inoculated with 500 μl of rgKA435 (H5N1) avian influenza vaccine antigen (10 ^9.0 EID ₅₀ /0.1 ml) to the right leg biceps. After 3 weeks of vaccination, a highly pathogenic influenza A/chicken/Vietnam/NCVD-KA435/2013 (H5N1) virus 10 ⁶ Egg Infectious dose (EID ₅₀ ) was administered by nasal attack with 10 control animals not vaccinated. It was determined whether to survive.

3-2. Virus excretion titer verification

In the above experiment, according to the experimental method of 3-1, 10 ⁶ Egg Infectious dose (EID50) was injected through the nose, and on days 3, 5, 7, 10 and 14, swabs were applied from the experimental group and the control group using a swab in the throat and the total excretory cavity. The virus titer (log ₁₀ TCID ₅₀ /0.1 ml) discharged after the challenge was measured.

group Swap part The number of virus discharged/lived.
(Virus titer, log ₁₀ TCID ₅₀ /0.1 ml, mean ± standard deviation) Survival/Total 3 days later 5 days later 7 days later 10 days later 14 days later Vaccination Throat 0/10 0/10 0/10 0/10 0/10 10/10 Total excretion 0/10 0/10 0/10 0/10 0/10 Control Throat 1/1
(2.3) Our company Our company Our company Our company 0/10 Total excretion 1/1
(4.3) Our company Our company Our company Our company

As a result, high pathogenic H5N1 avian influenza virus was not detected in the lab group vaccinated with rgKA435 (H5N1) vaccine antigen (dead venom vaccine), whereas the control group not vaccinated with the vaccine antigen was pharyngeal and total crypt It was confirmed that a high titer virus was detected in the sample (Table 6).

Therefore, it was confirmed that the rgKA435 (H5N1) dead venom vaccine of the present invention exhibits excellent protection against the highly pathogenic influenza virus of type H5N1.

3-3. Immunogenicity verification of vaccine strains

Since SPF chicken is a vaccine developed for use as an actual target animal, it was used for the efficacy test of the highly pathogenic H5N1 avian influenza vaccine. Ten six-week-old SPF chickens were inoculated with 1 ml of rgKA435(H5N1) avian influenza vaccine antigen (500 μl/dose, (10 ^9.0 EID ₅₀ /0.1 ml)) to the biceps muscle of 6-week-old SPF chickens. Thus, the change in antibody titer was verified by hemagglutination inhibition (HI).

The World Organization for Animal Health (OIE) is setting standards to prevent mortality as well as reduce virus emissions if the HI titer is 2 ⁷ or higher in poultry. As shown in the experimental results of FIG. 4, it was confirmed that the antibody had a high titer of 2 ⁷ or more until 24 weeks after vaccination (Table 7 and FIG. 3). 'Wpv' in Table 7 means'weeks post vaccination'.

- 4 wpv 8 wpv 12 wpv 16 wpv 20 wpv 24 wpv Titer 9.5±1.7 10.3±1.5 9.5±2.1 8.5±1.5 8.0±2.1 8.0±2.3

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Recombinant Influenza A virus H5N1 strain and Vaccine Composition for Highly Pathogenic Influenza A virus comprising the same <130> PN180122 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 1764 <212> RNA <213> Influenza A virus <400> 1 agcaaaagca ggggttcatt ctgtcaaaat ggagaaaata gttcttctct ttgcaacaat 60 cagccttgtc aaaagcgatc atatttgcat tggttatcat gcaaataact cgacagagca 120 ggttgacaca ataatggaaa agaacgttac tgttacacat gcccaagaca tactggaaaa 180 gacacacaac gggaagctct gcgatctaaa tggagtgaag cctctgattt taaaagattg 240 tagtgtagca ggatggctcc tcggaaatcc attgtgtgac gaattcacca atgtgccaga 300 atggtcttac atagtagaga aggccaatcc agccaatgac ctctgttacc cagggaattt 360 caacgattat gaagaattga aacacctatt gagcaggata aaccattttg agaaaataca 420 gatcatcccc aaagattctt ggtcagatca tgaagcctca ttgggggtga gcgcagcatg 480 ttcataccag ggaaattcct ccttcttcag aaatgtggtg tggcttatca aaaaggacaa 540 tgcataccca acaataaaga aaggctacaa taataccaac cgagaagatc tcttgatact 600 gtgggggatc caccatccta atgatgaggc agagcagaca aggctctacc aaaatccaac 660 tacctatatt tccattggga cttcaacact aaaccagaga ttggtaccaa aaatagccac 720 tagatccaaa ataaacggac aaagcggcag gatagatttc ttctggacaa ttttaaaacc 780 gaatgacgca atccacttcg agagtaatgg aaatttcatt gctccagaat atgcatacaa 840 aattgtcaag aagggagact ccacaatcat gagaagtgaa gtggaatatg gtaactgcaa 900 caccaggtgt cagactccaa taggagcgat aaactctagt atgccattcc acaacataca 960 tcctctcacc atcggagaat gtcccaaata tgtgaaatca aacaaattag tccttgcaac 1020 tgggctcaga aatagtcctc aaagagaaag aggactgttt ggagctatag ctggttttat 1080 agagggagga tggcagggaa tggtagatgg ttggtttgtt tgtctccgcg accaagagca 1140 ggggagtggt tacgctgcag acaaagaatc tactcaaaag gcgatagacg gagtcaccaa 1200 taaggtcaat tcgatcattg acaaaatgaa cacccagttt gaggctgtag gaagggaatt 1260 taataactta gagaggagaa tagaaaattt aaacaagaag atggaagacg gattcctaga 1320 tgtctggact tataatgctg aacttctggt tctcatggag aatgagagaa ctctagactt 1380 ccatgattca aatgtcaaga acctttacga taaggtccga ctacagctta aggataatgc 1440 aaaagagctg ggaaacggtt gtttcgagtt ctatcacaaa tgtaataatg aatgtatgga 1500 aagtgtaaga aacgggacgt atgactaccc gcattatgca gaagaagcaa gattaaaaag 1560 agaggaaata agtggagtaa aactggaatc aataggaatc taccaaatac tgtcaattta 1620 ttcaacagtg gcgagttccc tagtgctggc aatcatgatg gctggtctat ctttatggat 1680 gtgttccaac gggtcgttac agtgcagaat ttgcatttaa gtttgtgaat tcagattgta 1740 gttaaaaaca cccttgtttc tact 1764 <210> 2 <211> 1320 <212> RNA <213> Influenza A virus <400> 2 ggatcaatct gtatggtaat tggaataatt agcttgatgt tacagattgg gaacataata 60 tcaatatggg tcagtcattc aattcaaaca gggaatcaac accaaactga accaatcaga 120 aatactaatt ttcttaatga gaacgctgta gcttcagtaa cattagctgg caattcatct 180 ctttgcccca ttaaaggatg ggctgtacac agtaaagaca acagtataag gattgggtcc 240 aagggggatg tgtttgtaat tagagagccg ttcatatcat gctcccatct ggaatgcaga 300 actttctttt tgactcaggg agctttactg aatgacaagc actccaatgg gactgtcaaa 360 gataggagcc ctcacagaac gctaatgagt tgccctatag gtgaggctcc ctccccatat 420 aactcaaggt ttgagtctgt tgcttggtcg gcaagtgctt gccatgatgg caccagttgg 480 ttgataattg gaatttctgg tccagacaat ggggctgtgg cggtattgaa atacaatggc 540 ataataacag acactatcaa gagttggagg aataacatac tgaggaccca agagtctgaa 600 tgtgcatgtg taaatggctc ttgctttgct gttatgacag atggaccaag taatgggcag 660 gcatcatata agattttcaa aatagaaaaa gggaaagtag ttaagtcagt cgaattgaat 720 gcccctaatt atcactatga ggaatgctcc tgttatcctg atgctggcga aatcatatgt 780 gtgtgcaggg ataattggca tggctcaaac aggccatggg tatctttcaa tcagaatttg 840 gagtatcaaa taggatatat ttgcagtgga gttttcggtg acaatccacg gccaaatgac 900 ggtacaggta gttgtggtcc agtgtcctct aacggggcat atggggtaaa agggttctca 960 tttaaatatg gcaatggtgt ctggatcggg aggaccaaaa gcactcattc caggagcggc 1020 tttgaaatga tttgggatcc aaacgggtgg actggaacgg acagtgaatt ttcgatgaaa 1080 caagatatag tagcaataac tgattggtca ggatatagcg ggagttttgt ccagcaccca 1140 gaaatgacag gattagattg cataagacct tgcttctggg ttgagttaat cagagggcgg 1200 cccaaagaga gcacaatttg gactagtggg agcagcatat ctttttgtgg tgtaaatggt 1260 gacactgtga gttggtcttg gccagacggt gctgagttgc cattcaccat tgacaagtag 1320 1320 <210> 3 <211> 2313 <212> RNA <213> Influenza A virus <400> 3 tcaattatat tcaatatgga aagaataaaa gaactaagaa atctaatgtc gcagtctcgc 60 acccgcgaga tactcacaaa aaccaccgtg gaccatatgg ccataatcaa gaagtacaca 120 tcaggaagac aggagaagaa cccagcactt aggatgaaat ggatgatggc aatgaaatat 180 ccaattacag cagacaagag gataacggaa atgattcctg agagaaatga gcaaggacaa 240 actttatgga gtaaaatgaa tgatgccgga tcagaccgag tgatggtatc accactggct 300 gtgacatggt ggaataggaa tggaccaata acaaatacag ttcattatcc aaaaatctac 360 aaaacttatt ttgaaagagt cgaaaggcta aagcatggaa cctttggccc tgtccatttt 420 agaaaccaag tcaaaatacg tcggagagtt gacataaatc ctggtcatgc agatctcagt 480 gccaaggagg cacaggatgt aatcatggaa gttgttttcc ctaacgaagt gggagccagg 540 atactaacat cggaatcgca actaacgata accaaagaga agaaagaaga actccaggat 600 tgcaaaattt ctcctttgat ggttgcatac atgttggaga gagaactggt ccgcaaaacg 660 agattcctcc cagtggctgg tggaacaagc agtgtgtaca ttgaagtgtt gcatttgact 720 caaggaacat gctgggaaca gatgtatact ccaggagggg aagtgaggaa tgatgatgtt 780 gatcaaagct tgattattgc tgctaggaac atagtgagaa gagctgcagt atcagcagat 840 ccactagcat ctttattgga gatgtgccac agcacacaga ttggtggaat taggatggta 900 gacatcctta ggcagaaccc aacagaagag caagccgtgg atatatgcaa ggctgcaatg 960 ggactgagaa ttagctcatc cttcagtttt ggtggattca catttaagag aacaagcgga 1020 tcatcagtca agagagagga agaggtgctt acgggcaatc ttcaaacatt gaagataaga 1080 gtgcatgagg gatatgaaga gttcacaatg gttgggagaa gagcaacagc catactcaga 1140 aaagcaacca ggagattgat tcagctgata gtgagtggga gagacgaaca gtcgattgcc 1200 gaagcaataa ttgtggccat ggtattttca caagaggatt gtatgataaa agcagtcaga 1260 ggtgatctga atttcgtcaa tagggcgaat cagcgattga atcctatgca tcaactttta 1320 agacattttc agaaggatgc gaaagtgctt tttcaaaatt ggggagttga acctatcgac 1380 aatgtgatgg gaatgattgg gatattgccc gacatgactc caagcatcga gatgtcaatg 1440 agaggagtga gaatcagcaa aatgggtgta gatgagtact ccagcacgga gagggtagtg 1500 gtgagcattg accgtttttt gagaatccgg gaccaacgag gaaatgtact actgtctccc 1560 gaggaggtca gtgaaacaca gggaacagag aaactgacaa taacttactc atcgtcaatg 1620 atgtgggaga ttaatggtcc tgaatcagtg ttggtcaata cctatcaatg gatcatcaga 1680 aactgggaaa ctgttaaaat tcagtggtcc cagaacccta caatgctata caataaaatg 1740 gaatttgaac catttcagtc tttagtacct aaggccatta gaggccaata cagtgggttt 1800 gtaagaactc tgttccaaca aatgagggat gtgcttggga catttgatac cgcacagata 1860 ataaaacttc ttcccttcgc agccgctcca ccaaagcaaa gtagaatgca gttctcctca 1920 tttactgtga atgtgagggg atcaggaatg agaatacttg taaggggcaa ttctcctgta 1980 ttcaactata acaaggccac gaagagactc acagttctcg gaaaggatgc tggcacttta 2040 actgaagacc cagatgaagg cacagctgga gtggagtccg ctgttctgag gggattcctc 2100 attctgggca aagaggacaa gagatatggg ccagcactaa gcatcaatga actgagcaac 2160 cttgcgaaag gagagaaggc taatgtgcta attgggcaag gagacgtggt gttggtaatg 2220 aaacggaaac gggactctag catacttact gacagccaga cagcgaccaa aagaattcgg 2280 atggccatca attagtgtcg aatagtttaa aaa 2313 <210> 4 <211> 2313 <212> RNA <213> Influenza A virus <400> 4 gcaaaccatt tgaatggatg tcaatccgac cttacttttc ttaaaagtgc cagcacaaaa 60 tgctataagc acaactttcc cttatactgg agaccctcct tacagccatg ggacaggaac 120 aggatacacc atggatactg tcaacaggac acatcagtac tcagaaaagg gaagatggac 180 aacaaacacc gaaactggag caccgcaact caacccgatt gatgggccac tgccagaaga 240 caatgaacca agtggttatg cccaaacaga ttgtgtattg gaggcgatgg ctttccttga 300 ggaatcccat cctggtattt ttgaaaactc gtgtattgaa acgatggagg ttgttcagca 360 aacacgagta gacaagctga cacaaggccg acagacctat gactggactc taaatagaaa 420 ccaacctgct gcaacagcat tggccaacac aatagaagtg ttcagatcaa atggcctcac 480 ggccaatgag tctggaaggc tcatagactt ccttaaggat gtaatggagt caatgaacaa 540 agaagaaatg gggatcacaa ctcattttca gagaaagaga cgggtgagag acaatatgac 600 taagaaaatg ataacacaga gaacaatggg taaaaagaag cagagattga acaaaaggag 660 ttatctaatt agagcattga ccctgaacac aatgaccaaa gatgctgaga gagggaagct 720 aaaacggaga gcaattgcaa ccccagggat gcaaataagg gggtttgtat actttgttga 780 gacactggca aggagtatat gtgagaaact tgaacaatca gggttgccag ttggaggcaa 840 tgagaagaaa gcaaagttgg caaatgttgt aaggaagatg atgaccaatt ctcaggacac 900 cgaactttct ttcaccatca ctggagataa caccaaatgg aacgaaaatc agaatcctcg 960 gatgtttttg gccatgatca catatatgac cagaaatcag cccgaatggt tcagaaatgt 1020 tctaagtatt gctccaataa tgttctcaaa caaaatggcg agactgggaa aagggtatat 1080 gtttgagagc aagagtatga aacttagaac tcaaatacct gcagaaatgc tagcaagcat 1140 cgatttgaaa tatttcaatg attcaacaag aaagaagatt gaaaaaatcc gatcgctctt 1200 aatagagggg actgcatcat tgagccctgg aatgatgatg ggcatgttca atatgttaag 1260 cactgtatta ggcgtctcca tcctgaatct tggacaaaag agatacacca agactactta 1320 ctggtgggat ggtcttcaat cctctgacga ttttgctctg attgtgaatg cacccaatca 1380 tgaagggatt caagccggag tcgacaggtt ttatcgaacc tgtaagctac ttggaatcaa 1440 tatgagcaag aaaaagtctt acataaacag aacaggtaca tttgaattca caagtttttt 1500 ctatcgttat gggtttgttg ccaatttcag catggagctt cccagttttg gggtgtctgg 1560 gatcaacgag tcagcggaca tgagtattgg agttactgtc atcaaaaaca atatgataaa 1620 caatgatctt ggtccagcaa cagctcaaat ggcccttcag ttgttcatca aagattacag 1680 gtacacgtac cgatgccata gaggtgacac acaaatacaa acccgaagat catttgaaat 1740 aaagaaactg tgggagcaaa cccgttccaa agctggactg ctggtctccg acggaggccc 1800 aaatttatac aacattagaa atctccacat tcctgaagtc tgcctaaaat gggaattgat 1860 ggatgaggat taccaggggc gtttatgcaa cccactgaac ccatttgtca gccataaaga 1920 aattgaatca atgaacaatg cagtgatgat gccagcacat ggtccagcca aaaacatgga 1980 gtatgatgct gttgcaacaa cacactcctg gatccccaaa agaaatcgat ccatcttgaa 2040 tacaagtcaa agaggagtac ttgaggatga acaaatgtac caaaggtgct gcaatttatt 2100 tgaaaaattc ttccccagca gttcatacag aagaccagtc gggatatcca gtatggtgga 2160 ggctatggtt tccagagccc gaattgatgc acggattgat ttcgaatctg gaaggataaa 2220 gaaagaagag ttcactgaga tcatgaagat ctgttccacc attgaagagc tcagacggca 2280 aaaatagtga atttagcttg tccttcatga aaa 2313 <210> 5 <211> 2206 <212> RNA <213> Influenza A virus <400> 5 gtactgatcc aaaatggaag attttgtgcg acaatgcttc aatccgatga ttgtcgagct 60 tgcggaaaaa acaatgaaag agtatgggga ggacctgaaa atcgaaacaa acaaatttgc 120 agcaatatgc actcacttgg aagtatgctt catgtattca gattttcact tcatcaatga 180 gcaaggcgag tcaataatcg tagaacttgg tgatccaaat gcacttttga agcacagatt 240 tgaaataatc gagggaagag atcgcacaat ggcctggaca gtagtaaaca gtatttgcaa 300 cactacaggg gctgagaaac caaagtttct accagatttg tatgattaca aggagaatag 360 attcatcgaa attggagtaa caaggagaga agttcacata tactatctgg aaaaggccaa 420 taaaattaaa tctgagaaaa cacacatcca cattttctcg ttcactgggg aagaaatggc 480 cacaaaggca gactacactc tcgatgaaga aagcagggct aggatcaaaa ccagactatt 540 caccataaga caagaaatgg ccagcagagg cctctgggat tcctttcgtc agtccgagag 600 aggagaagag acaattgaag aaaggtttga aatcacagga acaatgcgca agcttgccga 660 ccaaagtctc ccgccgaact tctccagcct tgaaaatttt agagcctatg tggatggatt 720 cgaaccgaac ggctacattg agggcaagct gtctcaaatg tccaaagaag taaatgctag 780 aattgaacct tttttgaaaa caacaccacg accacttaga cttccgaatg ggcctccctg 840 ttctcagcgg tccaaattcc tgctgatgga tgccttaaaa ttaagcattg aggacccaag 900 tcatgaagga gagggaatac cgctatatga tgcaatcaaa tgcatgagaa cattctttgg 960 atggaaggaa cccaatgttg ttaaaccaca cgaaaaggga ataaatccaa attatcttct 1020 gtcatggaag caagtactgg cagaactgca ggacattgag aatgaggaga aaattccaaa 1080 gactaaaaat atgaagaaaa caagtcagct aaagtgggca cttggtgaga acatggcacc 1140 agaaaaggta gactttgacg actgtaaaga tgtaggtgat ttgaagcaat atgatagtga 1200 tgaaccagaa ttgaggtcgc ttgcaagttg gattcagaat gagtttaaca aggcatgcga 1260 actgacagat tcaagctgga tagagctcga tgagattgga gaagatgtgg ctccaattga 1320 acacattgca agcatgagaa ggaattattt cacatcagag gtgtctcact gcagagccac 1380 agaatacata atgaaggggg tgtacatcaa tactgccttg cttaatgcat cttgtgcagc 1440 aatggatgat ttccaattaa ttccaatgat aagcaagtgt agaactaagg agggaaggcg 1500 aaagaccaac ttgtatggtt tcatcataaa aggaagatcc cacttaagga atgacaccga 1560 cgtggtaaac tttgtgagca tggagttttc tctcactgac ccaagacttg aaccacataa 1620 atgggagaag tactgtgttc ttgagatagg agatatgctt ataagaagtg ccataggcca 1680 ggtttcaagg cccatgttct tgtatgtgag aacaaatgga acctcaaaaa ttaaaatgaa 1740 atggggaatg gagatgaggc gttgcctcct ccagtcactt caacaaattg agagtatgat 1800 tgaagctgag tcctctgtca aagagaaaga catgaccaaa gagttctttg agaacaaatc 1860 agaaacatgg cccattggag agtcccccaa aggagtggag gaaagttcca ttgggaaggt 1920 ctgcaggact ttattagcaa agtcggtatt caacagcttg tatgcatctc cacaactaga 1980 aggattttca gctgaatcaa gaaaactgct tcttatcgtt caggctctta gggacaacct 2040 tgaacctggg acctttgatc ttggggggct atatgaagca attgaggagt gcctgattaa 2100 tgatccctgg gttttgctta atgcttcttg gttcaactcc ttccttacac atgcattgag 2160 ttagttgtgg cagtgctact atttgctatc catactgtcc aaaaaa 2206 <210> 6 <211> 1537 <212> RNA <213> Influenza A virus <400> 6 tagataatca ctcactgagt gacatcaaaa tcatggcgtc tcaaggcacc aaacgatctt 60 acgaacagat ggagactgat ggagaacgcc agaatgccac tgaaatcaga gcatccgtcg 120 gaaaaatgat tggtggaatt ggacgattct acatccaaat gtgcaccgaa ctcaaactca 180 gtgattatga gggacggttg atccaaaaca gcttaacaat agagagaatg gtgctctctg 240 cttttgacga aaggagaaat aaataccttg aagaacatcc cagtgcgggg aaagatccta 300 agaaaactgg aggacctata tacaggagag taaacggaaa gtggatgaga gaactcatcc 360 tttatgacaa agaagaaata aggcgaatct ggcgccaagc taataatggt gacgatgcaa 420 cggctggtct gactcacatg atgatctggc attccaattt gaatgatgca acttatcaga 480 ggacaagagc tcttgttcgc accggaatgg atcccaggat gtgctctctg atgcaaggtt 540 caactctccc taggaggtct ggagccgcag gtgctgcagt caaaggagtt ggaacaatgg 600 tgatggaatt ggtcagaatg atcaaacgtg ggatcaatga tcggaacttc tggaggggtg 660 agaatggacg aaaaacaaga attgcttatg aaagaatgtg caacattctc aaagggaaat 720 ttcaaactgc tgcacaaaaa gcaatgatgg atcaagtgag agagagccgg aacccaggga 780 atgctgagtt cgaagatctc acttttctag cacggtctgc actcatattg agagggtcgg 840 ttgctcacaa gtcctgcctg cctgcctgtg tgtatggacc tgccgtagcc agtgggtacg 900 actttgaaag ggagggatac tctctagtcg gaatagaccc tttcagactg cttcaaaaca 960 gccaagtgta cagcctaatc agaccaaatg agaatccagc acacaagagt caactggtgt 1020 ggatggcatg ccattctgcc gcatttgaag atctaagagt attaagcttc atcaaaggga 1080 cgaaggtgct cccaagaggg aagctttcca ctagaggagt tcaaattgct tccaatgaaa 1140 atatggagac tatggaatca agtacacttg aactgagaag caggtactgg gccataagga 1200 ccagaagtgg aggaaacacc aatcaacaga gggcatctgc gggccaaatc agcatacaac 1260 ctacgttctc agtacagaga aatctccctt ttgacagaac aaccattatg gcagcattca 1320 atgggaatac agaggggaga acatctgaca tgaggaccga aatcataagg atgatggaaa 1380 gtgcaagacc agaagatgtg tctttccagg ggcggggagt cttcgagctc tcggacgaaa 1440 aggcagcgag cccgatcgtg ccttcctttg acatgagtaa tgaaggatct tatttcttcg 1500 gagacaatgc agaggagtac gacaattaaa gaaaaat 1537 <210> 7 <211> 1000 <212> RNA <213> Influenza A virus <400> 7 gtagatattg aaagatgagt cttctaaccg aggtcgaaac gtacgtactc tctatcatcc 60 cgtcaggccc cctcaaagcc gagatcgcac agagacttga agatgtcttt gcagggaaga 120 acaccgatct tgaggttctc atggaatggc taaagacaag accaatcctg tcacctctga 180 ctaaggggat tttaggattt gtgttcacgc tcaccgtgcc cagtgagcga ggactgcagc 240 gtagacgctt tgtccaaaat gcccttaatg ggaacgggga tccaaataac atggacaaag 300 cagttaaact gtataggaag ctcaagaggg agataacatt ccatggggcc aaagaaatct 360 cactcagtta ttctgctggt gcacttgcca gttgtatggg cctcatatac aacaggatgg 420 gggctgtgac cactgaagtg gcatttggcc tggtatgtgc aacctgtgaa cagattgctg 480 actcccagca tcggtctcat aggcaaatgg tgrcaacaac caatccacta atcagacatg 540 agaacagaat ggttttagcc agcactacag ctaaggctat ggagcaaatg gctggatcga 600 gtgagcaagc agcagaggcc atggaggttg ctattcgggc taggcaaatg gtgcaggcaa 660 tgagaaccat tgggactcat cctagctcca gtgctggtct gaaaaatgat cttcttgaaa 720 atttgcaggc ctatcagaaa cgaatggggg tgcagatgca acggttcaag tgatcctctc 780 attattgcct caartatcat tgggatcttg cacttgayat tgtggattct tgatcgtctt 840 tttttcaaat gcatttaccg tctctttaaa tacggtttga aaagagggcc ttctacggaa 900 ggagtgccaa agtctatgag ggaagaatat caaaaggaac agcagagtgc tgtggatgct 960 gacgatggtc attttgtcag catagagctg gagtaaaaaa 1000 <210> 8 <211> 861 <212> RNA <213> Influenza A virus <400> 8 tgacaaaaac ataatggatc caaacactgt gtcaagcttt caggtagatt gctttctttg 60 gcatgtccgc aaacgagttg cagaccaaga actaggtgat gccccattcc ttgatcggct 120 tcgccgagat cagaaatccc taagaggaag gggcagtact ctcggtctgg acatcaagac 180 agccacacgt gctggaaagc agatagtgga gcggattctg aaagaagaat ccgatgaggc 240 acttaaaatg accatggcct ctgtacctgc gtcgcgttac ctaactgaca tgactcttga 300 ggaaatgtca agggactggt ccatgctcat acccaagcag aaagtggcag gccctctttg 360 tatcagaatg gaccaggcga tcatggataa gaacatcata ctgaaagcga acttcagtgt 420 gatttttgac cggctggaga ctctaatatt gctaagggct ttcaccgaag agggagcaat 480 tgttggcgaa atttcaccat tgccttctct tccaggacat actgctgagg atgtcaaaaa 540 tgcagttgga gtcctcatcg gaggacttga atggaatgat aacacagttc gagtctctga 600 aactctacag agattcgctt ggagaagcag taatgagaat gggagacctc cactcactcc 660 aaaacagaaa cgagaaatgg cgggaacaat taggtcagaa gtttgaagaa ataagatggt 720 tgattgaaga agtgagacac aaactgaaga taacagagaa tagttttgag caaataacat 780 ttatgcaagc cttacatcta ttgcttgaag tggagcaaga gataagaact ttctcgtttc 840 agcttattta gtactaaaaa a 861 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HA1F <400> 9 tccgaagttg ggggggagca aaagcagggg 30 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> H26-H5R <400> 10 cctcttgttt ctctttgagg actatttctg agccc 35 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> H26-H5F <400> 11 ctcaaagaga aacaagagga ctatttggag ctat 34 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> NS-890R <400> 12 gggccgccgg gttattagta gaaacaaggg tg 32 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> N1-1F <400> 13 tccgaagttg ggggggagca aaagcaggag 30 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> N1-1413R <400> 14 gggccgccgg gttattagta gaaacaagga gt 32 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB2-1F <400> 15 tccgaagttg ggggggagcg aaagcaggtc 30 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB2-2341R <400> 16 gggccgccgg gttattagta gaaacaaggt cg 32 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB1-1F <400> 17 tccgaagttg ggggggagcg aaagcaggca 30 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB1-2341R <400> 18 gggccgccgg gttattagta gaaacaaggc at 32 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PA-1F <400> 19 tccgaagttg ggggggagcg aaagcaggta 30 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PA-2233R <400> 20 gggccgccgg gttattagta gaaacaaggt ac 32 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-NP-1F <400> 21 tccgaagttg ggggggagca aaagcagggt 30 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-NP-1565R <400> 22 gggccgccgg gttattagta gaaacaaggg ta 32 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-M-1F <400> 23 tccgaagttg ggggggagca aaagcaggta 30 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-M-1027R <400> 24 gggccgccgg gttattagta gaaacaaggt ag 32 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-NS-1F <400> 25 tccgaagttg ggggggagca aaagcagggt 30 <210> 26 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-NS-890R <400> 26 gggccgccgg gttattagta gaaacaaggg tg 32

Claims (8)

delete delete delete delete delete delete delete (i) HA (hemagglutinin) derived from highly pathogenic influenza A virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 1;
(ii) NA (neuraminidase) derived from highly pathogenic virus H5N1 consisting of the nucleotide sequence of SEQ ID NO: 2; And
(iii) Low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS (each consisting of the nucleotide sequence of SEQ ID NOs: 3 to 8) non-structural protein) containing 8 negative-sense ssRNAs,
Inactivated vaccine composition for the prevention of influenza A virus A/chicken/Vietnam/NCVD-KA435/2013 H5N1 infection of chickens comprising the recombinant influenza A virus H5N1 strain.

Images