KR20200045439A - Recombinant Pseudomonas putida strains and method for producing mevalonate using the same - Google Patents

Abstract

The present invention relates to a recombinant Pseudomonas putida strain and a method for producing mevalonate using the same. According to the present invention, a mevalonate biosynthesis circuit is established in the Pseudomonas putida strain. The recombinant Pseudomonas putida strain with significantly improved mevalonate production yields was prepared through studies such as improving external gene stability, regulating ethanol catabolism circuits, and regulating fatty acid biosynthesis circuits. The recombinant Pseudomonas putida strain of the present invention is highly resistant to organic solvent toxicity, thereby having toxic resistance to terpenoids produced by using mevalonate as a precursor. Therefore, the recombinant Pseudomonas putida strain can also be used as a biocatalyst for the production of high concentration terpenoids.

Description

Recombinant Pseudomonas putida strains and method for producing mevalonate using the same}

The present invention relates to a recombinant Pseudomonas putida strain and a method for producing mevalonic acid using the same, and more specifically, to construct mevalonic acid biosynthetic pathway in a Pseudomonas putida strain having strong organic solvent resistance to produce mevalonic acid from carbon source ethanol. It's about how.

Mevalonic acid is a raw material for cosmetics and bioplastics, and is a material that is a major precursor to terpenoids, which are a wide variety of biochemical substances. Mevalonic acid uses Acetyl-CoA as a biosynthetic precursor. However, when existing sugars are used as carbon sources, high concentration production is difficult due to by-products produced from substances in the process. In addition, terpenoids produced from mevalonic acid are non-polar as hydrocarbons, so they are very toxic to microorganisms and have difficulty in developing microbial processes.

The present inventors tried to develop a bioprocess capable of producing mevalonic acid, which is difficult to produce at high concentration, at a high concentration. As a result, the present invention was completed by examining the high yield of mevalonic acid from ethanol, a carbon source, by introducing a foreign gene into the Pseudomonas putida strain, which has strong resistance to toxicity of organic solvents, to build a biosynthetic pathway for mevalonic acid.

It is an object of the present invention to provide a recombinant Pseudomonas putida strain.

Another object of the present invention is to provide a composition for producing mevalonic acid.

Another object of the present invention is to provide a method for producing mevalonic acid.

According to an aspect of the present invention, the present invention is a nucleic acid sequence of acetyl coenzyme A Acetyltransferase represented by SEQ ID NO: 1, HMG CoA synthetase represented by SEQ ID NO: 2 (3-hydroxy-3-methylglutaryl A nucleic acid sequence of coenzyme A synthetase and a recombinant vector comprising the nucleic acid sequence of HMG CoA reductase (3-hydroxy-3-methylglutaryl coenzyme A reductase) represented by SEQ ID NO: 3, is transformed into endonuclease A (endonuclease A) A, endA) and the endonuclease X (endonuclease A, endX) gene is related to a recombinant Pseudomonas putida ( Pseudomonas putida ) strain.

The present inventors tried to develop a bioprocess capable of producing mebalonic acid at a high concentration, which is difficult to produce at high concentrations. As a result, the carbon cause was obtained by introducing a foreign gene into the Pseudomonas putida strain, which has strong resistance to toxic organic solvents, and constructing a biosynthetic pathway for mevalonic acid It has been found that mevalonic acid can be produced from ethanol in high yield.

According to the present invention, the recombinant Pseudomonas putida strain of the present invention is a nucleic acid sequence of acetyl coenzyme acetyl transferase represented by SEQ ID NO: 1, a nucleic acid sequence of HMG CoA synthetase represented by SEQ ID NO: 2 and HMG represented by SEQ ID NO: 3 As a strain transformed with a recombinant vector containing a nucleic acid sequence of CoA reductase, an upper mevalonate pathway is constructed by introducing the acetyl coenzyme acetyl transferase, HMG CoA synthetase and HMG CoA reductase genes. You can.

According to one embodiment of the present invention, the recombinant Pseudomonas putida strain of the present invention may be additionally transformed into a recombinant vector comprising a nucleic acid sequence of acetyl coenzyme A synthetase represented by SEQ ID NO: 4. The recombinant Pseudomonas putida strain of the present invention can prevent the accumulation of acetic acid in the strain by primarily converting acetic acid to Acetyl-CoA by introducing the acetyl coenzyme synthase gene.

According to another embodiment of the present invention, the recombinant Pseudomonas putida strain of the present invention may be a strain in which the endonuclease A (endonuclease A, endA) gene and the endonuclease X (endonuclease A, endX) gene are deleted. . The stability of the foreign gene introduced through the recombinant vector can be improved by the deletion of the gene. The endonuclease A gene may be represented by the nucleic acid sequence of SEQ ID NO: 5, and the endonuclease X gene may be represented by the nucleic acid sequence of SEQ ID NO: 6.

According to another embodiment of the present invention, the recombinant Pseudomonas putida strain of the present invention is quinoprotein Ethanol Dehydrogenase I (Quinoprotein Ethanol Dehydrogenase I) gene and quinoprotein Ethanol Dehydrogenase II (Quinoprotein Ethanol Dehydrogenase II) gene is additionally defective It may be a strain. The deficiency of the gene can prevent periplasmic oxidation of ethanol. The quinoprotein ethanol dehydrogenase I gene may be represented by the nucleic acid sequence of SEQ ID NO: 7, and the quinoprotein ethanol dehydrogenase II gene may be represented by the nucleic acid sequence of SEQ ID NO: 8.

The term "vector" means a means for expressing a target gene in a host cell. For example, viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors and adenoassociated virus vectors. Vectors that can be used as the recombinant vector include plasmids used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pUC19, pUCP19, pTrc99A, pCM184, pAWP89, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series and pUC19, etc.), phages (e.g., λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (e.g., SV40, etc.) It can be produced, but is not limited thereto.

The recombinant vector can typically be constructed as a vector for cloning or for expression. The expression vector can be used in the art, conventional ones used to express foreign proteins in plants, animals or microorganisms. The recombinant vector can be constructed through various methods known in the art.

The recombinant vector can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector used is an expression vector, and a prokaryotic cell is a host, a strong promoter capable of progressing transcription (eg, pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7) Promoter, etc.), a ribosome binding site for initiation of translation and a transcription / detox termination sequence. When eukaryotic cells are used as hosts, the origin of replication operating in eukaryotic cells included in the vector includes f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, and BBV origin of replication. It is not limited. In addition, a promoter derived from the genome of a mammalian cell (eg, a metallothionine promoter) or a promoter derived from a mammalian virus (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, Cytomegalovirus promoter and HSV's tk promoter) can be used and generally have a polyadenylation sequence as the transcription termination sequence.

In one example of the present invention, a transformant can be made by inserting a recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into an appropriate host cell.

The host cell is a cell capable of continuously cloning or expressing the expression vector while being stable, and any host cell known in the art can be used.

The host cells used in the present invention may include E. coli, yeast, animal cells, plant cells, or insect cells. Prokaryotic cells include, for example, E. coli DH10B, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis and Bacillus strains, and Salmonella typhimurium, Enteric bacteria and strains such as Ceratia Marcesons and various Pseudomonas species, etc. When transformed into eukaryotic cells, as host cells, yeast (Saccharomyce cerevisiae), insect cells, plant cells and animal cells, for example, Sp2 / 0, CHO (Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell line, etc. may be used, but is not limited thereto.

The transport (introduction) of the polynucleotide or a recombinant vector containing the same into a host cell can be carried out using a transport method well known in the art. For the transport method, for example, when the host cell is a prokaryotic cell, a CaCl ₂ method or an electroporation method can be used. When the host cell is a eukaryotic cell, a micro-injection method, a calcium phosphate precipitation method, an electroporation method, Liposomal mediated transfection and gene bombardment may be used, but are not limited thereto.

The method for selecting the transformed host cell can be easily carried out according to a method well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

According to another aspect of the present invention, the present invention is a nucleic acid sequence of acetyl coenzyme acetyl transferase represented by SEQ ID NO: 1, a nucleic acid sequence of HMG CoA synthetase represented by SEQ ID NO: 2 and HMG CoA reductase represented by SEQ ID NO: 3 It is transformed with a recombinant vector containing a nucleic acid sequence of, and relates to a composition for producing mevalonic acid comprising a recombinant Pseudomonas putida strain, wherein the endonuclease A gene and the endonuclease X gene are deleted.

The composition for producing mevalonic acid of the present invention includes the recombinant Pseudomonas putida strain, and overlapping information between them is omitted in consideration of the complexity of the present specification.

Since the recombinant Pseudomonas putida strain is a strain having mevalonic acid production capacity, the strain can be used as a composition for producing mevalonic acid.

The composition for producing mevalonic acid may include a substance necessary for culturing the recombinant Pseudomonas putida strain, for example, a culture medium. The culture medium is not particularly limited and may include a medium for culturing a normal microorganism containing a suitable carbon source, nitrogen source, amino acid or vitamin.

According to another aspect of the invention, the invention relates to a method of producing mevalonic acid comprising the following steps:

Culturing the recombinant Pseudomonas putida strain; And

Obtaining mevalonic acid from the culture result.

The recombinant Pseudomonas putida strain can be cultured in a medium for culturing microorganisms containing a suitable carbon source, nitrogen source, amino acid or vitamin.

According to one embodiment of the present invention, the recombinant Pseudomonas putida strain can be cultured in a culture medium having the composition shown in Table 3 below.

The recombinant Pseudomonas putida strain can be cultured under normal microbial culture conditions, for example, can be cultured under the culture conditions shown in Table 4 below.

According to one embodiment of the present invention, the recombinant Pseudomonas putida strain can be cultured in a pH range of 6.5 to pH 7.0, for example, at pH 6.75.

The present invention relates to a recombinant Pseudomonas putida strain and a method for producing mevalonic acid using the same, to construct a mevalonic acid biosynthesis circuit in the Pseudomonas putida strain, to improve external gene stability, control ethanol catabolism, and control fatty acid biosynthesis circuits. A recombinant Pseudomonas strain having a significantly improved production yield of mevalonic acid was prepared, and mevalonic acid can be produced at a high concentration using the recombinant Pseudomonas strain. The recombinant Pseudomonas putidae strain of the present invention has strong toxicity resistance to organic solvents, and thus has toxicity resistance to terpenoids produced using mevalonic acid as a precursor, and thus can also be used as a biocatalyst for producing high concentration terpenoids. .

1 is a schematic diagram showing the ethanol metabolic pathway in the P. putida strain.
2A is a schematic diagram of the upper mevalonic acid pathway.
2B is a pSGP10 vector map.
3 is a schematic diagram of a pK19 mobsacB- mediated Markerless deletion method.
4A and 4B are schematic diagrams for the ethanol catabolism pathway and regulation in P. putida .
5 is a schematic diagram for ethanol catabolism regulatory gene recombination.
6 is a schematic diagram of fatty acid biosynthesis control pathway and gene recombination.
7A is a graph for the metabolic profile of the recombinant strain ELPP000.
7B is a graph for the metabolic profile of the recombinant strain ELPP010.
8 is a result of confirming the effect of increasing the stability of an external gene insertion vector according to whether an endonuclease ( endA, endX ) is deleted through dTomato fluorescence analysis.
9 is a graph for the metabolic profile of the recombinant strain ELPP110.
10A is a graph for the metabolic profile of the recombinant strain ELPP111.
10B is a graph for the metabolic profile of the recombinant strain ELPP211.
10C is a graph for the metabolic profile of the recombinant strain ELPP212.
10D is a graph for the metabolic profile of the recombinant strain ELPP213.
11A is a graph for the metabolic profile of the recombinant strain ELPP221.
11B is a graph for the metabolic profile of the recombinant strain ELPP311.
12 is a graph analyzing fatty acids in a recombinant strain through Nile-red staining.
13A is a graph of the metabolic profile of recombinant strain ELPP211 cultured at pH 7.0.
13B is a graph for the metabolic profile of recombinant strain ELPP211 cultured at pH 6.75.
13C is a graph of metabolic profile of recombinant strain ELPP211 cultured at pH 6.5.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Preparation of strains with mevalonic acid production circuit

In the microorganism, ethanol is converted to Acetyl-CoA through an oxidation reaction through acetaldehyde-acetic acid, and Acetyl-CoA, the main intermediate in the cell, enters the TCA cycle and fatty acid biosynthesis circuit, and various biosynthetic pathways such as energy-cell composition synthesis Flows into Therefore, in order to develop a high-efficiency mevalonic acid production catalyst, it is important to introduce Acetyl-CoA in the microorganism into the mevalonic acid pathway.

By implementing the upper mevalonic acid pathway to mevalonic acid, which is an intermediate of the mevalonic acid pathway in the P. putida strain, a study was conducted to confirm how much the microbial Acetyl-CoA intermediate can be introduced into the mevalonic acid pathway.

In order to construct the upper mevalonic acid pathway and to confirm the production of mevalonic acid from ethanol, three steps of gene expression were performed. Acetyl-CoA Acetyl-CoA Acetyltransferase gene ( atoB from Escherichia coli MG1655), which converts two molecules to Acetoacetyl-CoA, polymerizes Acetoacetyl-CoA and Acetyl-CoA to 3-Hydroxy-3-Methyl-Glutaryl-CoA (HMG-CoA ) To synthesize HMG-CoA Synthase gene ( mvaS from Enterococcus faecalis ), and HMG-CoA to reduce HMG-CoA Reductase gene ( mvaE from Enterococcus faecalis ) to optimize codon according to Codon usage of Pseudomonas putida After inserting the pSGP10 E. coli - Pseudomonas Shuttle Expression Vector (Tetracycline Selection Marker, trc Promoter) developed in the invention using a Gibson Assembly, it was transformed into P. putida to produce a recombinant strain.

In the case of ELPP000, which is a negative control, it is possible to grow using ethanol, but cell growth occurs and acetic acid accumulates, eventually consuming all the carbon sources and killing cells, whereas in the case of the ELPP010 strain that built the mevalonic acid production circuit, acetic acid Without accumulation, all ethanol was consumed to produce about 1.7 g / L mevalonic acid. However, there is a problem that the yield is very low, and in order to overcome this, an experiment was conducted to improve the stability of the gene introduced outside.

Example 2. Preparation of strains with improved transgene stability

One of the problems of metabolic engineering studies using P. putida strain is that the stability of the gene expression during long incubation time is poor due to the low stability of the introduced gene (plasmid vector). Low stability of such plasmid vectors are known to the P. putida strains themselves due to the defense mechanism of decomposition and recombination of foreign genes, this study, with reference to the prior research studies that improve the stability of transgene external P. putida, outside EndA and endX, which encode Endonuclease, which serves to degrade genes, were deleted through the pK19 mobsacB mediated Markerless Deletion method.

By deleting the Endonuclease gene, in order to confirm that the stability of the vector into which the external gene was inserted was increased, the dTomato gene, a fluorescence protein, was inserted into the pSGP10 Vector and transformed into Wild-Type and Endonuclease-deficient strains.

In order to investigate the effect of increasing the stability of the external gene insertion vector due to the endonuclease ( endA, endX ) deficiency, the tendency of the increase in fluorescence intensity according to the expression time after the expression of dTomato Protein was confirmed. Fluorescence Intensity was measured with a Fluorescence Microplate Leader and analyzed under conditions of excitation wavelength 544 nm and emission wavelength 590 nm. In the case of the endA and endX- deficient strains ELPP1dT0, the increase in Fluorescence Intensity from 24 to 48 hours was greater, and the decrease in the standard deviation between the same experiments was also confirmed, confirming the effect of increasing the stability of the external gene insertion vector.

As a result of incubation of ELPP110 with a mevalonic acid circuit in an endonuclease ( endA, endX ) -deficient strain, mevalonic acid production increased to about 2.43 g / L, but acetic acid rapidly accumulated in some flasks, resulting in loss of cell metabolism. Did. This was thought to be due to the speed of Ethanol's Periplasmic Oxidation being too fast in a situation where the cell's growth capacity was reduced due to a decrease in the ability to cope with mutations due to the deletion of the endonuclease, thereby regulating the ethanol catabolism circuit.

Example 3. Preparation of strains with controlled ethanol catabolism circuit

During a culture in which ethanol was converted to mevalonic acid, there was a problem in that a specific experimental set reduced cell activity due to excessive accumulation of acetic acid and reduced reproducibility of mevalonic acid production. To overcome this, the catabolism pathway of P. putida was first identified, and the catabolic pathway was generally redesigned so that acetic acid did not accumulate.

To prevent the accumulation of acetic acid, the Acetyl-CoA Synthetase ( acs from Escherichia coli MG1655) gene, which primarily converts acetic acid to Acetyl-CoA, was inserted into the Broad-Host Range Vector pAWP89-0 and transformed.

In addition, P. putida , unlike E. coli , has PQQ (Pyrroloquinoline quinone) Dependent Periplasmic Ethanol Dehydrogenase, which rapidly oxidizes alcohols such as ethanol in Periplasm, whereas acetic acid is converted to Acetyl-CoA while ethanol oxidation is very fast. It was thought that acetic acid would accumulate at a rate less than that, and the Quinoprotein Ethanol Dehydrogenase ( qedH-I , qedH-II ) gene was deleted through Markerless Deletion using pK19 mobsacB to prevent periplasmic oxidation of ethanol.

In addition, by additionally expressing Putative Aldehyde Dehydrogenase ( eutE from Escherichia coli MG1655) that can directly convert Acetaldehyde to Acetyl-CoA without going through acetic acid, it is necessary to further prevent Acetate accumulation and convert Acetate to Acetyl-CoA. To reduce ATP consumption.

In order to prevent the accumulation of acetic acid, in the case of the ELPP111 strain expressing the acs gene capable of converting acetic acid to Acetyl-CoA, the mevalonic acid production capacity increased slightly compared to the ELPP110 strain, but it did not solve the fundamental acetic acid accumulation problem.

In the case of the ELPP211 strain expressing the mevalonic acid circuit and the acs gene in the qedH gene-deficient strain to prevent ethanol periplasmic oxidation, it was confirmed that it can stably produce high concentrations of mevalonic acid, and a mevalonic acid of about 4.07 g / L. Produced.

The eutE gene that can convert acetaldehyde to acetyl-CoA without going through acetic acid without acs In the case of the expressed strain (ELPP212), rather, it showed a result that causes the accumulation of acetic acid, and since the concentration of acetaldehyde in the cell is very low, eutE , a Reversible Enzyme, rather converts Acetyl-CoA to acetaldehyde and then oxidizes to acetic acid again. It can be expected to have led to the process. In the case of the strain expressing acs and eutE together (ELPP213), the results showed that the ELPP211 strain without eutE was not significantly different. Through this, it was confirmed that the expression of the acs gene is an important factor for ethanol metabolism.

Example 4. Preparation of a strain that modulates the fatty acid biosynthetic pathway

In order to increase the production yield of mevalonic acid, the fatty acid biosynthesis pathway, which is one of the competitive circuits using acetyl-CoA as a precursor, was controlled to allow more acetyl-CoA to be introduced into mevalonic acid biosynthesis. The schematic diagram of fatty acid biosynthesis pathway regulation is as follows.

First, the pSGP11 vector ( atoB, mvaS, mvaE ) of Acetoacetyl-CoA Synthase ( nphT7 from Streptomyces sp.CL190), which can serve to convert Malonyl-CoA introduced into fatty acid biosynthesis into Acetoacetyl-CoA into the mevalonic acid cycle, Insertion vector).

In addition, Pseudomonas putida is known to synthesize and store carbon sources as fatty acids by itself. In order to prevent such polyhydroxyalkanoate (PHA) biosynthesis and to prevent unnecessary consumption of carbon sources, the (R) -3-hydroxydecanoyl-ACP: CoA transacylase ( phaG ) gene, a major step in PHA biosynthesis, was deleted.

Of Malonyl-CoA, and by polymerizing the Acetyl-CoA For ELPP212 strains which express the nphT7 gene synthesized Acetoacetyl-CoA were a very large growth inhibition occurs Malonyl-CoA through which flowing in the fatty acid biosynthesis pathway, the flow of the fatty acid biosynthesis It can be seen that the adverse effects of excessively high synthesis of mevalonic acid occurred, and it was confirmed that a mechanism for controlling the expression of the nphT7 gene in more detail is needed.

In the case of the ELPP311 strain in which the phaG gene, which is the main step of the PHA biosynthetic circuit, was deleted, the mevalonic acid production did not increase compared to the conventional ELPP211 strain. Deletion of the phaG gene was used to determine if PHA accumulation was really inhibited, and if so, why the mevalonic acid production did not increase. Quantitative differences were confirmed. Fluorescence Intensity was measured with a Fluorescence Microplate Leader and analyzed under conditions of excitation wavelength 530 nm and emission wavelength 590 nm.

As a result of analyzing the fatty acid component in cells through Nile-red staining, it can be seen that the fatty acid content increases with the incubation time for the ELPP000 strain without the mevalonic acid cycle, but the ELPP211 and ELPP311 strains incorporating the mevalonic acid cycle are defective in phaG. Regardless of this, the fatty acid content in the cells tended to remain constant or decrease. Therefore, by constructing the mevalonic acid circuit, it was possible to naturally inhibit the accumulation of fatty acids (PHA) in the cell, and for this reason, it was confirmed that the mevalonic acid production of the ELPP311 strain did not increase.

Information on the recombinant strains prepared in Examples 1 to 4 is shown in Table 1.

Strain, plasmid Genotype or properties Mevalonic acid production Strains P. putida KT2440 Wild-Type - E. coli DH10B F-endA1recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139Δ (ara, leu) 7697 mcrA Δ (mrr-hsdRMS-mcrBC) λ-T1R - ELPP000 (-con) P. putida KT2440 harboring pSGP10, pAWP89-0 - ELPP010 P. putida KT2440 harboring pSGP11, pAWP89-0 1.7 g / L ELPP0dT0 P. putida KT2440 harboring pSGP1dT, pAWP89-0 - ELPP1dT0 P. putida KT2440 ΔendA ΔendX harboring pSGP1dT, pAWP89-0 - ELPP110 P. putida KT2440 ΔendA ΔendX harboring pSGP11, pAWP89-0 2.43 g / L ELPP111 P. putida KT2440 ΔendA ΔendX harboring pSGP11, pAWP89-1 2.88 g / L ELPP211 P. putida KT2440 ΔendA ΔendX ΔqedH-I ΔqedH-II harboring pSGP11, pAWP89-1 4.07 g / L ELPP212 P. putida KT2440 ΔendA ΔendX ΔqedH-I ΔqedH-II harboring pSGP11, pAWP89-2 0.68 g / L ELPP213 P. putida KT2440 ΔendA ΔendX ΔqedH-I ΔqedH-II harboring pSGP11, pAWP89-3 3.94 g / L ELPP221 P. putida KT2440 ΔendA ΔendX ΔqedH-I ΔqedH-II harboring pSGP12, pAWP89-1 0.78 g / L ELPP311 P. putida KT2440 ΔendA ΔendX ΔqedH-I ΔqedH-II ΔphaG harboring pSGP11, pAWP89-1 3.88 g / L

Information on the plasmid used in the production of the recombinant strain of Table 1 is shown in Table 2.

Plasmids pUCP19 E. coli-Pseudomonas Shuttle Expression Vector, P _lac , Amp ^R pUC19 E. coli Expression Vector, lacI , P _lac , Amp ^R pTrc99A E. coli Expression Vector, lacI , P _trc , Amp ^R pCM184 Allelic Exchange Vector, Amp ^R , Tet ^R , loxP-Kan ^R -loxP pAWP89 Broad Host Range Expression Vector, P _tac -dTomato, Kan ^R pK19 mobsacB Allelic Exchange Vector, sacB , Kan ^R pK19 mobsacB ( :: lacI ) pK19 mobsacB - lacI (derived from pTrc99A) pSGP10 E. coli-Pseudomonas Shuttle Expression Vector (pUCP19 derived), lacI + P _trc derived from pTrc99A, Tet ^R derived from pCM184 pSGP1dT pSGP10 -dTomato (derived from pAWP89) pSGP11 pSGP10- mvaE _opti- mvaS _opti- atoB _opti pSGP12 pSGP10- mvaE _opti- mvaS _opti- atoB _opti- nphT7 _opti pAWP89-0 Broad Host Range Expression Vector (pAWP89 derived), P _lac drived from pUC19, MCS from MEV Vector pAWP89-1 pAWP89-0- acs _opti pAWP89-2 pAWP89-0- eutE _opti pAWP89-3 pAWP89-0- acs _opti- eutE _opti

Information on the primers used in the preparation of the plasmid of Table 2 is shown in Table 3.

Primer Sequence Sequence number F- lacI (pK19 mobsacB ) TGCATGCCTGCAGGTCGACTCTAGAGACACCATCGAATGGTGC 11 R- lacI (pK19 mobsacB ) AAAACGACGGCCAGTGAATTCTCACTGCCCGCTTTCC 12 F- endA- upstream CTATGACCATGATTACGCCAAGCTTTGCTGCTCTTGAAATGAACC 13 R- endA- upstream TTTGAAACGGGGGGAAAACATATTTCAGGTTG 14 F- endA- downstream TGTTTTCCCCCCGTTTCAAAGGCTGCG 15 R- endA- downstream TGCACCATTCGATGGTGTCTCTAGAATGAAGAAGCGAATCGTCCT 16 F- endX -upstream CTATGACCATGATTACGCCAAGCTTGTGCTTCCCCCTCAGGG 17 R- endX -upstream GGCCTGAGGAGCGCAGTCAATCTTCCTTCG 18 F- endX -downstream TTGACTGCGCTCCTCAGGCCAGCGTTTG 19 R- endX -downstream TGCACCATTCGATGGTGTCTCTAGAACCAGTAAAAGTGGCGCCG 20 F- qedH-I -upstream CTATGACCATGATTACGCCAAGCTTGTGGCCATGAACTGGCG 21 R- qedH-I -upstream CCGCTGCAGGGGTTGCAGTTCCCAGTGGA 22 F- qedH-I -downstream AACTGCAACCCCTGCAGCGGGGAGC 23 R- qedH-I -downstream TGCACCATTCGATGGTGTCTCTAGAATGAATATCGTGTTGGTCGATGAC 24 F- qedH-II -upstream CTATGACCATGATTACGCCAAGCTTGTGGCCATGAACTGGCG 25 R- qedH-II -upstream TAGGCAGGCGGACGGCTACCTTTGGTTTTTTTG 26 F- qedH-II -downstream GGTAGCCGTCCGCCTGCCTACTGCCG 27 R- qedH-II -downstream TGCACCATTCGATGGTGTCTCTAGATTAGAAGAAGCCCAGCGGAT 28 F- phaG -upstream CTATGACCATGATTACGCCAAGCTTGTGTCTGCAGTGAAACCCG 29 R- phaG -upstream GCCGAGCCGCGTCATCGACTCCTGGCGC 30 F- phaG -downstream AGTCGATGACGCGGCTCGGCGCC 31 R- phaG -downstream TGCACCATTCGATGGTGTCTCTAGACTAACCCTGTTCGGTCACTTG 32 F-Confirm1-upstream (Universal) CGATTCATTAATGCAGCTGGC 33 R-Confirm1-downstream (Universal) TCCACTTTTTCCCGCGTTTTC 34 R-Confirm1-upstream ( endA ) GGCACGATGTGTTCCCAC 35 F-Confirm1-downstream ( endA ) AAGCCAGAGGCCAAACCAA 36 R-Confirm1-upstream ( endX ) TTTACAGCCGCAATAAAACTCGG 37 F-Confirm1-downstream ( endX ) AAGCCTGGGAGCGGCAA 38 R-Confirm1-upstream ( qedH-I ) TGGCCGCTGTTGCCA 39 F-Confirm1-downstream ( qedH-I ) CGTGGGCTACGGCGG 40 R-Confirm1-upstream ( qedH-II ) GCATCGAGCATGCGCAAG 41 F-Confirm1-downstream ( qedH-II ) ATCTCCAGGTCCGCCGC 42 R-Confirm1-upstream ( phaG ) GCCGTGGTGGCCAGC 43 F-Confirm1-downstream ( phaG ) CCCGCAATGTCATGCTGG 44 F-Confirm2- endA TGCTGCTCTTGAAATGAACC 45 R-Confirm2- endA ATGAAGAAGCGAATCGTCCT 46 F-Confirm2- endX GCAACGTCACCGACACC 47 R-Confirm2- endX -R AGCTCTGCGGTGGAGC 48 F-Confirm2- qedH-I GCATCGAGCATGCGCAAG 49 R-Confirm2- qedH-I ATCTCCAGGTCCGCCGC 50 F-Confirm2- qedH-II CACCGCCTGAGGTTGCT 51 R-Confirm2- qedH-II AGCCACGGTGCCTTCG 52 F-Confirm2- phaG TCCGCAACACCGTACCG 53 R-Confirm2- phaG GCCGATCAGGATCGGCC 54 F- lacI + P _trc (pSGP10) GTGCGGTATTTCACACCGCATATGGGCTTCACCTTCAACCCAACAC 55 R- lacI + P _trc (pSGP10) CGATGGTGTCGAGCGTCAGACCCCGTAG 56 F-ori + Tet ^R (pSGP10) TCTGACGCTCGACACCATCGAATGGTGCA 57 R-ori + Tet ^R (pSGP10) GACCTGCAGGCATGCAAGCTTCATGGTCTGTTTCCTGTGTGAA 58 F-dTomato TGCATGCCTGCAGGTCGACTCTAGAATGGTGAGCAAGGGCGAG 59 R-dTomato TGAATTCGAGCTCGGTACCCGGGCTACTTGTACAGCTCGTCCATG 60 F- mvaE _opti AAGCTTGCATGCCTGCAGGTCGACTCTAGAATTTAAGGAGAACTTTATATGAAGACCGT 61 R- mvaE _opti AAAGTGTCTAGGATTATTGCTTACGCAAATCGTTCA 62 F- mvaS _opti GCGTAAGCAATAATCCTAGACACTTTCACCATAAGGA 63 R- mvaS _opti TACCCAGCGGACTTTAGTTGCGATAGCTGCGC 64 F- atoB _opti CTATCGCAACTAAAGTCCGCTGGGTAGACTAAGG 65 R- atoB _opti GCCAGTGAATTCGAGCTCGGTACCCGGGTCAGTTCAGGCGCTCGATC 66 R- atoB _opti (pSGP12) CTACAGAACTTAATCAGTTCAGGCGCTCGATC 67 F- nphT7 _opti GCGCCTGAACTGATTAAGTTCTGTAGGGCCGAGAC 68 R- nphT7 _opti GCCAGTGAATTCGAGCTCGGTACCCGGGTCACCACTCGATCAGCGC 69 F- acs _opti TTTCACACAGGAAACAGCGGGCCCCTGAGAATAGCCCTCAACTACGT 70 F- acs _opti (pAWP89-3) CATCGTGTGACTGAGAATAGCCCTCAACTACGT 71 R- acs _opti GATAGTCTAGAAGGTACCAGAATTCTCAGCTCGGCATGGCG 72 F- eutE _opti TTTCACACAGGAAACAGCGGGCCCAGAAAGACAAGAGATAAGGAGGT 73 R- eutE _opti GATAGTCTAGAAGGTACCAGAATTCTCACACGATGCGGAAGGC 74 R- eutE _opti (pAWP89-3) CTATTCTCAGTCACACGATGCGGAAGGC 75

Example 5: Production of mevalonic acid using recombinant strain

The strains prepared in Examples 1 to 4 were stored in a frozen stock form of 25% glycerol at -80 ° C, and after about 14 hours of seed culture in LB (kanamycin 75 mg / L, tetracyclin 30 mg / L), M9D (Dextrose 12 g / L), inoculated with 2%, incubated for 24 hours, and then harvested and inoculated to M9E (Ethanol 200 mM) so that OD = 1. The composition of M9 Media used for culture is shown in Table 4, and detailed culture conditions are shown in Table 5.

- M9D M9E Phosphate Buffer K ₂ HPO ₄ 16.0 g / L
KH ₂ PO ₄ 8.0 g / L Nitrogen Source (NH ₄ ) ₂ SO ₄ 4.7 g / L Carbon Substrate Dextrose 12 g / L Ethanol 200mM
(11.7 mL / L)
Dextrose 1 g / L MgSO ₄ 7H ₂ O 0.12 g / L NaCl 0.5 g / L FeSO ₄ 7H ₂ O 6 mg / L CaCO ₃ 2.7 mg / L ZnSO ₄ H ₂ O 2.0 mg / L MnSO ₄ H ₂ O 1.16 mg / L CuSO ₄ 5H ₂ O 0.33 mg / L CoSO ₄ 7H ₂ O 0.37 mg / L H ₃ BO ₃ 0.08 mg / L HCl 0.01 mL

Media Composition Physiological Condition M9E Media
Ethanol 200 mM (9.2 g / L)
OD = 1.0 Inoculation
from M9D (Dextrose 12 g / L)
Culture Baffled Flask
Working Volume: 50 mL
Agitation: 230rpm
Temperature: 30 ℃
IPTG Induction: 0.1 mM

Both ethanol as a substrate, acetic acid as a by-product, and mevalonic acid as a product were quantified through HPLC analysis, and the conditions are shown in Table 6.

HPLC analysis conditions Instrument LC-20A Prominence Series (Shimazu) Column Hi Plex-H Column Temperature 40 ℃ Mobile Phase 0.1N H2SO4 Flow Rate 0.6 mL / min Analysis Time 25 min

In order to analyze the scale-up possibility and the tendency of mevalonic acid production according to pH, 1 L batch culture was performed under three conditions from pH 7.0 to pH 6.5 (pH 7.0, pH 6.75, pH 6.5), known as the optimum pH for P. putida growth. The pH 7.0 condition showed the fastest growth rate and the fastest ethanol consumption rate, but the cell growth was high, so the production of mevalonic acid was lower than the pH 6.75 condition. Therefore, it was confirmed that the condition of pH 6.75 is a pH optimized for mevalonic acid production. However, the yield of mevalonic acid in batch culture was lower compared to flask fermentation (4.07 g / L from 200 mM of Ethanol-Yp / x = 0.41 g / g) (4.60 g / L from 300 mM of Ethanol-Yp / x = 0.32 g / g) This confirmed that the volatile carbon source, ethanol, evaporated and leaked due to direct air injection, and this can be overcome by supplementing processes such as exhaust gas treatment.

<110> SOGANG UNIVERSITY RESEARCH FOUNDATION <120> Recombinant Pseudomonas putida strains and method for producing          mevalonate using the same <130> PN180366P <150> KR 18/0125997 <151> 2018-10-22 <160> 75 <170> KoPatentIn 3.0 <210> 1 <211> 1216 <212> DNA <213> Artificial Sequence <220> <223> Acetyl-CoA acetyltransferase <400> 1 agtccgctgg gtagactaag gaggttatag tatgaagaac tgcgtgatcg tgagcgccgt 60 gcgcaccgcc atcggcagct tcaacggcag cctggccagc accagcgcca tcgatctggg 120 tgccaccgtg atcaaagccg ccatcgagcg tgccaagatc gacagccagc acgtggacga 180 ggtgatcatg ggcaacgtgc tgcaagccgg tctgggtcag aacccagcgc gtcaggccct 240 gctgaaaagc ggtctggccg aaaccgtgtg cggcttcacc gtgaacaagg tgtgcggcag 300 cggtctgaag tcggtggccc tggccgcgca agccatccaa gcgggtcaag cccagagcat 360 cgtggccggt ggcatggaaa acatgtcgct ggccccatac ctgctggacg ccaaagcgcg 420 tagcggctac cgcctgggtg acggccaggt gtacgacgtg atcctgcgcg acggcctgat 480 gtgcgcgacc cacggctacc acatgggcat caccgccgag aacgtggcca aagagtacgg 540 catcacccgc gagatgcagg acgagctggc cctgcacagc cagcgtaaag ccgccgccgc 600 gatcgagagc ggtgccttca ccgcggaaat cgtgccggtg aacgtggtga cccgcaagaa 660 aaccttcgtg ttcagccagg acgagttccc gaaggccaac agcaccgcgg aggccctggg 720 tgccctgcgt ccagccttcg ataaagccgg caccgtgacc gccggtaacg ccagcggcat 780 caacgacggt gccgccgcgc tggtcatcat ggaagaaagc gcggccctgg cggccggtct 840 gaccccactg gcgcgtatca agagctacgc gagcggtggt gtcccgccag cgctgatggg 900 tatgggtcca gtgccagcca cccagaaggc cctgcaactg gcgggtctgc agctggccga 960 catcgacctg atcgaggcca acgaggcctt cgccgcgcag ttcctggccg tgggcaagaa 1020 cctgggcttc gacagcgaga aggtgaacgt caacggtggt gcgatcgccc tgggccatcc 1080 gatcggtgcc agcggtgccc gtatcctggt gaccctgctg catgccatgc aagcccgtga 1140 caagaccctg ggcctggcga ccctgtgcat cggtggcggt cagggtatcg ccatggtgat 1200 cgagcgcctg aactga 1216 <210> 2 <211> 1185 <212> DNA <213> Artificial Sequence <220> <223> Hydroxymethylglutaryl-CoA synthase <400> 2 tcctagacac tttcaccata aggaaatatt ttaatgacca tcggcatcga taaaatcagc 60 ttcttcgtgc ccccgtatta catcgacatg actgctttgg ccgaagcacg caacgtcgat 120 ccagggaaat ttcacatcgg catcggccag gaccagatgg cggtaaaccc gatcagccaa 180 gacatcgtca ccttcgccgc caacgccgcc gaggcgatcc tcaccaagga agataaggag 240 gctattgaca tggtgatcgt ggggaccgag agcagcatcg acgagtccaa ggccgccgcc 300 gtggtgctgc accgcctgat gggcattcag ccgttcgcgc gctcgttcga gatcaaggaa 360 gcctgctacg gcgcaacggc aggcctgcag ctggccaaga accacgttgc gctgcatccg 420 gacaaaaagg tgctggtcgt ggcggctgat atcgcgaagt acggtctgaa cagcggcggc 480 gaacccaccc agggcgcggg cgccgtggcc atgctcgtgg cctcggagcc gcggattctg 540 gccctgaagg aagacaatgt catgttgacc caggacatct acgacttctg gcgtcctacc 600 ggccacccgt accccatggt cgacggcccg ctgagcaacg agacctacat ccagtccttc 660 gcacaggtgt gggacgagca caagaagcgc accggcctcg atttcgccga ctatgatgcg 720 ctggcctttc acatcccgta caccaagatg ggcaaaaagg cgctgctggc gaagatcagc 780 gatcagacgg aggccgagca agagcggatc ctggcccgtt acgaggagtc gatcatctac 840 agccgccgcg tcggcaatct gtacaccggc agcctgtacc tgggtctgat ttcgctgctg 900 gagaacgcta ccaccctgac cgcggggaac cagatcggcc tgttcagcta cggtagtggc 960 gccgtggccg agttcttcac cggcgagctg gtggccggct accagaacca tctgcagaag 1020 gagacgcacc tcgccctgct ggacaatcgc accgagctgt cgatcgccga gtacgaggcc 1080 atgttcgcgg agaccctgga cacggacatc gaccagaccc tggaggacga gctgaaatac 1140 agcatctccg ccatcaacaa caccgtgcgc agctatcgca actaa 1185 <210> 3 <211> 2430 <212> DNA <213> Artificial Sequence <220> <223> Acetyl-CoA acetyltransferase / Hydroxymethylglutaryl-CoA          reductase <400> 3 atttaaggag aactttatat gaagaccgtg gtcatcatcg atgccctgcg caccccgatc 60 ggcaaataca aaggctcgct cagccaggtc tcggccgtgg acctgggcac ccacgtgacc 120 acccagttgc tgaagcgcca cagcacgatc agcgaagaga tcgaccaggt tatctttggg 180 aacgtgctgc aggcgggtaa cggccagaac cccgcgcgtc agatcgccat caactcgggg 240 ctgtcgcatg aaatcccggc catgaccgtg aatgaggtct gcggctccgg catgaaggcg 300 gtcatcctgg ctaagcagct gatccagctg ggcgaagccg aggtgctcat cgccggcggc 360 atcgaaaaca tgagccaggc cccgaagctg cagcggttca actatgaaac tgagagttac 420 gacgccccgt tcagcagcat gatgtacgac ggcctgacgg atgcgttcag cggccaggca 480 atgggcctga ccgccgagaa cgtggccgag aagtaccacg tgacccgcga ggaacaggac 540 cagttcagcg tgcactccca gctgaaggcc gcacaggccc aagccgaagg catcttcgcc 600 gacgagattg cgcccctgga agttagcggc acgctcgtgg agaaggatga gggcatccgt 660 ccaaactcga gcgtggagaa actgggcacc ctgaagaccg tgttcaagga ggacggcacc 720 gtcactgccg ggaacgcgtc caccatcaac gacggggcct cggccctgat tatcgctagt 780 caggaatatg ccgaggccca tggcctgccg tacttggcga tcatccgcga ctcggtggag 840 gtcggcatcg acccggcgta catgggcatc agcccgatca aagccatcca gaagctcttg 900 gcccgcaacc aactgacgac cgaagagatc gatctgtacg aaatcaatga ggccttcgct 960 gccaccagca tcgtcgtaca gcgcgaactg gcgctgccgg aggaaaaggt gaacatctac 1020 ggtggtggca tcagcctggg tcacgcgatc ggcgcaaccg gcgcccgcct gctgaccagc 1080 ctttcctacc agctgaacca aaaggagaaa aagtatggtg tcgccagcct ctgcattggg 1140 ggcggcctgg gccttgccat gctgttggag cgtccgcagc agaaaaagaa ttcgcgcttt 1200 taccagatgt ccccggagga gcgcctggcc tccctgctga acgaaggcca gatctcggcg 1260 gataccaaga aggagttcga gaacacggct ctgagctcgc agatcgccaa ccacatgatt 1320 gagaaccaga tcagcgagac cgaggttccc atgggcgtcg gcctgcacct gaccgtggat 1380 gagaccgact acctggtgcc gatggccacc gaggagccga gtgtcatcgc cgcactgagc 1440 aacggcgcca agatcgcgca gggcttcaaa accgtgaacc agcagcgcct gatgcggggc 1500 cagatcgtgt tctacgacgt ggcggacgcc gaaagcctga tcgacgagct gcaggtgcgc 1560 gagaccgaga tcttccaaca ggccgagctc agctacccga gcatcgtaaa gcgcggcggg 1620 ggcctgcgcg acctgcaata ccgggcgttc gacgagtctt tcgttagtgt ggatttcctg 1680 gtcgacgtca aggacgcgat gggtgccaac atcgtgaatg caatgttgga aggtgtcgcc 1740 gagctgttcc gcgaatggtt cgccgaacaa aaaatcctgt tcagcatcct gtccaactac 1800 gccaccgagt cggtcgtgac gatgaagacg gcgatcccgg taagccgcct cagcaaaggt 1860 agcaacggcc gcgagatcgc agaaaagatc gtgctggcct cacgctatgc cagcctggac 1920 ccctaccgcg ccgtgaccca taacaagggc atcatgaacg gtattgaggc ggtagtgctg 1980 gcgaccggca atgacacccg tgccgtgagc gcatcgtgcc acgcatttgc cgtcaaggaa 2040 ggccggtacc agggcttgac ctcctggacc ctggacggcg aacagctgat tggcgaaatc 2100 agcgtgccgc tcgcgcttgc caccgtgggc ggggccacta aggtgctgcc gaaaagccag 2160 gccgccgctg acctgctggc ggttaccgat gcaaaagagc tgtcgcgcgt cgtcgccgct 2220 gtggggctgg cccaaaactt ggccgccctg cgcgcgctcg tgtcggaggg catccagaag 2280 ggccacatgg ctctgcaggc ccgtagcctg gccatgacag tgggggccac cggcaaggag 2340 gtcgaagcgg tagcgcagca gctgaagcgc cagaaaacca tgaaccagga ccgcgccctg 2400 gctatcctga acgatttgcg taagcaataa 2430 <210> 4 <211> 1994 <212> DNA <213> Artificial Sequence <220> <223> Acetyl-CoA synthetase <400> 4 ctgagaatag ccctcaacta cgtaaggagg tatttatgag ccagatccac aagcacacca 60 tcccagccaa catcgccgac cgctgcctga tcaacccgca gcagtacgag gccatgtacc 120 agcagagcat caacgtgccg gacaccttct ggggtgagca gggcaagatc ctggactgga 180 tcaagccgta ccagaaggtc aagaacacca gcttcgcccc aggcaacgtg agcatcaagt 240 ggtacgagga cggcaccctg aacctggccg ccaactgcct ggaccgccat ctgcaagaga 300 acggcgaccg caccgccatc atctgggaag gcgacgacgc cagccagagc aagcacatca 360 gctacaaaga actgcaccgc gacgtgtgcc gcttcgcgaa caccctgctg gaactgggca 420 tcaagaaagg cgacgtggtg gccatctaca tgccgatggt gccggaagcc gccgtggcca 480 tgctggcctg cgcgcgtatc ggtgccgtgc acagcgtgat cttcggtggc ttcagcccag 540 aggccgtggc cggtcgcatc atcgacagca acagccgtct ggtcatcacc agcgacgagg 600 gcgtgcgtgc cggtcgtagc atcccgctga agaagaacgt cgacgacgcg ctgaaaaacc 660 cgaacgtgac cagcgtggaa cacgtggtgg tgctgaaacg caccggtggc aagatcgact 720 ggcaagaggg tcgcgatctg tggtggcacg acctggtgga acaggccagc gaccagcacc 780 aggccgagga aatgaacgcg gaggacccgc tgttcatcct gtacaccagc ggcagcaccg 840 gcaagccgaa gggcgtgctg cataccaccg gtggttacct ggtgtatgcc gcgctgacct 900 tcaagtacgt gttcgactac catccgggtg acatctactg gtgcaccgcc gatgtcggtt 960 gggtcaccgg tcacagctac ctgctgtacg gtccgctggc gtgcggtgcg accaccctga 1020 tgttcgaagg cgtgccgaac tggccgaccc cagcgcgtat ggcccaggtg gtggacaagc 1080 accaggtgaa catcctgtat accgcgccaa ccgccatccg tgcgctgatg gccgaaggcg 1140 acaaggccat cgaaggcacc gaccgcagca gcctgcgtat cctgggcagc gtgggcgagc 1200 cgatcaaccc cgaagcctgg gagtggtact ggaagaagat cggcaacgag aagtgcccag 1260 tggtcgacac ctggtggcag accgaaaccg gtggcttcat gatcacccca ctgccaggtg 1320 ccaccgagct gaaagccggt agcgcgaccc gtccgttctt cggcgtgcag ccagcgctgg 1380 tcgacaacga gggcaacccg ctggaaggtg cgaccgaggg cagcctggtg atcaccgaca 1440 gctggccagg ccaagcgcgt accctgttcg gcgaccacga gcgcttcgag cagacctact 1500 tcagcacctt caagaacatg tacttcagcg gtgacggtgc ccgtcgtgac gaggatggct 1560 actactggat caccggtcgc gtggacgacg tcctgaacgt gagcggtcac cgtctgggca 1620 ccgcggagat cgaaagcgcc ctggtggccc atccgaagat cgccgaagcc gcggtggtgg 1680 gcatcccgca caacatcaag ggccaagcca tctacgccta cgtgaccctg aaccacggcg 1740 aggaaccgtc gccagagctg tacgccgagg tgcgcaactg ggtgcgcaaa gagatcggtc 1800 ccctggcgac cccagacgtg ctgcactgga ccgacagcct gccaaagacc cgcagcggca 1860 aaatcatgcg tcgcatcctg cgcaagatcg cggccggtga caccagcaac ctgggcgaca 1920 cctcgaccct ggccgatcca ggcgtggtgg aaaagctgct ggaagagaag caagcgatcg 1980 ccatgccgag ctga 1994 <210> 5 <211> 966 <212> DNA <213> Artificial Sequence <220> <223> endA <400> 5 atgaaatcac tgctttacgc cgtaacctta ttattttcct ttaccctccc cgctctggcc 60 aacccgccgg ccaccttcac cgaagccaag gtggtggcca agcagaaggt ctacctggac 120 caggccagca gtgccatggg cgacctgtac tgcggttgca aatggacctg ggtgggcaag 180 tctggcgggc gcatcgacgc tgcctcgtgt ggttaccaga cacgcaagca gcagaaccgt 240 gccgaacgca ccgagtggga acacatcgtg cccgcccaca ccttcggcaa ccagcgccag 300 tgctggaaga acggcggccg tgagcactgc gtggacaacg acccggtgtt ccgcgccatg 360 gaggccgacc tgttcaacct ttacccggcc gtgggtgagg tcaacggtga ccgcagcaac 420 ttcaactacg gcatggtcac tggcaatgcc ggcgaatacg gccaatgcac caccaaggtc 480 gatttcgtcc agcgcaccgc cgaaccgcgt gacgaagtca aaggcctggt ggcccgcacc 540 acgttctaca tgttcgaccg ctacaagctg aacatgtcgc gccaacagca acagctgctg 600 atggcctggg acaagcaaca ccccgtgtcg gcctgggaga aagaacgcga ccggcgcatt 660 gccgcgatca tgggccatgc caacccgttc gtaagcggcg aacgcaagtg gactgccggc 720 tacaagccgg ttggcagcgg cgtggtagag gcggtgccgg taaacgcagc caagccagag 780 gccaaaccaa gcctggccag cgccggttcg gtcggcgccg tgcttggcaa ccgcaacagc 840 cacgtctatc acctgtcagt cggctgcccg ggctacaacc aggttacagc gaagaaccag 900 gttaccttcg caaacgaagg tgaagcgcag gcagcggggt atcgcaaggc aggcaactgc 960 cgctga 966 <210> 6 <211> 693 <212> DNA <213> Artificial Sequence <220> <223> endX <400> 6 atgagagttt cgcttttcgc agcagcctgc ctgttactga ccactccgct tgctcaagcc 60 gacgccccgc gcaccttcca ggaggccaag aaggtcgcct ggaagctcta tgcaccacaa 120 tcgaccgagt tttattgcgg ctgtaaatac aagggcaaca aggtcaacct ggcctcctgc 180 ggctatgccc cacgcaagaa tgcccagcgc gcgtcacgca tcgagtggga gcacatcgta 240 cccgcctggc agatcggcca tcagcgccag tgctggcaga gtggcggacg caagcagtgc 300 tcgcagcatg acgaagtgta ccaacgcgcc gaagccgacc tgcacaacct ggtgcccagc 360 atcggtgagg tcaacggcga ccgcagcaac ttcagtttcg gctggctacc agaacaacgc 420 ggccagtatg gccgctgcct gacccaggtc gacttcaagg cgaggaaggt gatgccgcgc 480 ccgtcgatcc gcggcatgat cgcccgcacc tacttctaca tgagcaagca gtacaacctg 540 cgcctgtcca aacaggatcg ccagttgttc gaggcctgga acaagaccta cccgccgcaa 600 gcctgggagc ggcaacgcaa ccaacaggtc gcctgcgtga tggggcgggg aaacgcgttc 660 gtggggccgg tcaacctcaa ggcgtgcggt tga 693 <210> 7 <211> 1896 <212> DNA <213> Artificial Sequence <220> <223> qedH-I <400> 7 atgacaataa gatcgctacc cgccctttcc ccgctggccc tgagcgtgcg cgtcctgctg 60 atggccggta gcctggccct gggcaatgtg gcaacagcgg ccagcacacc cgctgcacct 120 gccggcaaga acgtcacctg ggaagacatc gccaatgacc acctgaccac ccaggacgtg 180 ctgcagtacg gcatgggcac caatgcccag cgctggagcc cgctggccca ggtcaatgac 240 aagaacgtgt tcaagctgac cccggcctgg tcctactcct tcggcgacga gaagcagcgc 300 ggccaggaat cccaggccat cgtcagcgat ggcgtggtct acgtcaccgg ttcgtactca 360 cgggtattcg ccctcgatgc caagaccggc aaacgcctgt ggacctacaa ccaccgcctg 420 cccgacaaca ttcgtccctg ctgcgacgtg gtcaaccgcg gggcggcgat ctacggcgac 480 aagatctact ttggcaccct cgatgcgcgt gtcatcgccc tcgacaagcg caccggcaaa 540 gtggtgtgga acaagaagtt cggcgaccac agcgccggct acaccatgac cggtgcgcca 600 gtgctgatca aggacaagac cagcggcaag gtgctgctga tccacggcag ctccggcgat 660 gaattcggcg tggtcggcca gctgttcgcg cgcgacccgg acaccggtga agaagtgtgg 720 atgcggccct tcgtggaggg ccacatgggc cgcctgaacg gcaaggacag caccccgacc 780 ggtgacgtca aggcgccgtc ctggccagac gaccctacca ccgaaaccgg caaggtcgaa 840 gcctggagcc acggcggcgg tgccccttgg caaagcgcga gcttcgaccc cgaaaccaac 900 accatcattg tcggcgctgg caaccccggc ccttggaata cctgggcgcg cacgtcgaag 960 gacggcaacc cgcatgactt cgacagcctg tacacctccg gccaggtcgg cgtcgacccg 1020 agcaccggcg aggtcaagtg gttctaccag cacaccccca acgatgcctg ggacttctcc 1080 ggcaacaacg agctggtgct gttcgactac aaggacaaga acggcaacgt ggtcaaggcc 1140 accgcccacg ccgaccgcaa cggtttcttc tatgtggttg accgcaacaa cggcaagctg 1200 caaaacgctt tccccttcgt cgacaacatc acctgggcca gccatatcga cctgaagacc 1260 gggcgcccgg tggaaaaccc cggccaacgc ccggccaagc cgctgccggg tgaaaccaag 1320 ggcaagccgg tggaagtctc gccaccgttc ctgggcggca agaactggaa ccccatggcc 1380 tacagccagg acaccgggct gttctacatc cccggcaacc agtggaaaga ggaatactgg 1440 accgaggaag tgaactacaa gaagggctcg gcttatctgg gcatgggctt ccgtatcaag 1500 cgcatgtacg acgaccacgt cggcacgttg cgcgccatgg acccgaccac cggcaagctg 1560 gtgtgggaac acaaggaaca cctgccgtta tgggccggtg tgttggcgac caagggcaac 1620 ctggtgttca ccggcacggg cgacggcttc ttcaaggcct tcgacgccaa gacgggcaaa 1680 gagctgtgga agttccagac cggcagcggc atcgtctcgc cgcccatcac ctgggagcag 1740 gacggcgagc agtacatcgg cgtgaccgtg ggctacggcg gtgcagtacc gctgtggggc 1800 ggcgacatgg ccgagctgac caaaccggtg gctcagggtg gttcgttctg ggtgttcaag 1860 atcccgagct gggacaacaa gactgcacaa cgttga 1896 <210> 8 <211> 1788 <212> DNA <213> Artificial Sequence <220> <223> qedH-II <400> 8 atgacccgat ccccacgtcg ccccttgttc gccgtgagcc tggtgctcag cgccatgctg 60 cttgccggcg cggctcacgc cgctgtcagc aatgaagaaa tcctccagga cccgaagaac 120 ccgcagcaga tcgtgaccaa tggcctgggc gtgcagggcc agcgctacag cccgctggac 180 ctgctcaatg tcaataacgt caaggagctg cgcccggtct gggcgttctc cttcggcggg 240 gagaagcagc gcggccagca ggcccagccg ctgatcaagg acggggtgat gtacctgacc 300 ggctcctact cgcgggtgtt cgccgtggat gcccgcaccg gcaagaaact gtggcaatac 360 gatgcacgtc tgccggatga catccgcccc tgctgcgacg taatcaaccg cggcgtcgcg 420 ctgtacggca acctggtgtt cttcggcacg ctggacgcca agctggtggc cctgaacaag 480 gacaccggca aggtggtctg gagcaagaag gtcgccgacc acaaagaagg ctactccatc 540 agcgccgcgc cgatgatcgt caatggcaag ctgatcacag gcgttgccgg cggcgagttc 600 ggcgtggtgg gcaagatcca ggcgtacaac ccggagaacg gcgaactgct gtggatgcgc 660 cccaccgtgg aagggcacat gggctatgtg tacaaggatg gcaaggcgat cgagaacggt 720 atttccggcg gtgaggcggg caagacctgg cctggcgacc tgtggaagac cggcggcgcc 780 gcgccgtggc tggggggtta ctacgaccct gaaaccaacc tgatcctgtt tggtaccggt 840 aacccggcgc cgtggaactc gcacctgcgc cccggtgaca acctgtactc ctcctcacgc 900 ctggcactga acccggacga cggcaccatc aagtggcact tccagagcac gccgcatgac 960 ggctgggact tcgacggcgt caacgagctg atctcgttca actacaagga cggcggcaag 1020 gaggtcaagg ctgccgccac ggcagaccgc aacggtttct tctacgtgct cgaccgcacc 1080 aacggcaagt tcatccgcgg cttccccttc gtggacaaga tcacctgggc cactggcctg 1140 gacaaggacg gccggccgat ctacaacgac gccagccgcc cgggcgcacc cggcagcgag 1200 gccaagggca gctcggtgtt cgtcgcgccg gccttcctcg gcgccaagaa ctggatgccg 1260 atggcctaca acaaggacac agggctgttc tacgtgccgt ccaacgagtg gggcatggac 1320 atctggaacg aaggcatcgc ctataagaaa ggtgcggcgt tcctcggtgc cggcttcacc 1380 atcaagccgc tcaatgaaga ctacatcggc gtgctgcgcg ccatcgaccc ggtcagcggc 1440 aaggaagtgt ggcgccacaa gaactatgcg ccgctgtggg gcggtgtgct gaccaccaag 1500 ggcaacctgg tgttcacggg cacgccagag ggcttcctgc aggcattcaa cgccaagacc 1560 ggcgacaagg tctgggaatt ccagaccggc tcgggcgtgc tcggctcgcc cgtcacctgg 1620 gaaatggacg gcgagcaata cgtttcggta gtctccggct ggggcggcgc ggtgccgctg 1680 tggggcggcg aagtggccaa acgggtcaag gacttcaacc agggcggcat gctctggacc 1740 ttcaagttgc ccaagcagtt gcagcaaacg gcaagcgtca agccataa 1788 <210> 9 <211> 1432 <212> DNA <213> Artificial Sequence <220> <223> Putative aldehyde dehydrogenase / ethanolamine utilization          protein <400> 9 agaaagacaa gagataagga ggtattttat gaaccagcag gacatcgaac aggtggtgaa 60 ggccgtgctg ctgaagatgc agagcagcga caccccgagc gccgccgtgc atgagatggg 120 tgtgttcgcc agcctggacg acgccgtggc cgccgccaag gtggcccagc aaggtctgaa 180 gtcggtggcc atgcgtcagc tggcgatcgc ggccatccgc gaagccggtg agaagcatgc 240 ccgtgacctg gccgaactgg ccgtgagcga aaccggcatg ggtcgcgtcg aggacaagtt 300 cgccaagaac gtggcccaag cgcgtggcac cccaggcgtg gaatgcctgt cgccacaggt 360 gctgaccggt gacaacggtc tgaccctgat cgagaacgcg ccatggggtg tcgtggccag 420 cgtgacccca agcaccaacc cagccgccac cgtgatcaac aacgccatca gcctgatcgc 480 cgccggtaac agcgtgatct tcgccccaca tccagccgcg aagaaagtga gccagcgtgc 540 gatcaccctg ctgaaccagg ccatcgtggc ggccggtggt ccggaaaacc tgctggtgac 600 cgtggcgaac cccgacatcg aaaccgcgca gcgcctgttc aagttcccag gcatcggcct 660 gctggtcgtc accggtggcg aagccgtggt ggaagccgcg cgtaagcaca ccaacaagcg 720 cctgatcgcg gccggtgcgg gtaacccacc agtggtggtg gacgaaaccg ccgacctggc 780 gcgtgccgcg cagagcatcg tgaagggtgc cagcttcgac aacaacatca tctgcgccga 840 cgagaaggtg ctgatcgtgg tggacagcgt ggccgacgag ctgatgcgcc tgatggaagg 900 ccagcacgcc gtgaagctga ccgccgaaca ggcccagcag ctgcagccgg tcctgctgaa 960 aaacatcgac gagcgtggca agggcaccgt gagccgtgat tgggtgggtc gtgatgccgg 1020 taagatcgcc gcggccatcg gcctgaaggt gccgcaagaa acccgtctgc tgttcgtgga 1080 aaccaccgcc gagcatccgt tcgccgtgac cgaactgatg atgcccgtgc tgccggtggt 1140 gcgcgtggcc aacgtggccg atgcgatcgc cctggccgtc aagctggaag gcggttgcca 1200 tcacaccgcc gccatgcaca gccgcaacat cgagaacatg aaccagatgg ccaacgcgat 1260 cgacaccagc atcttcgtga agaacggtcc gtgcatcgcc ggtctgggcc tgggtggcga 1320 aggctggacc accatgacca tcaccacccc gaccggtgag ggcgtgacca gcgcgcgtac 1380 cttcgtgcgt ctgcgtcgct gcgtgctggt cgacgccttc cgcatcgtgt ga 1432 <210> 10 <211> 1026 <212> DNA <213> Artificial Sequence <220> <223> Acetyl-CoA: malonyl-CoA acyltransferase <400> 10 ttaagttctg tagggccgag actaaggagg ttttttatga ccgacgtgcg cttccgcatc 60 atcggcaccg gtgcgtacgt gccggaacgc atcgtgagca acgacgaggt gggtgcccca 120 gccggtgtgg acgacgattg gatcacccgc aagaccggca tccgccagcg tcgttgggcc 180 gccgatgatc aggccacctc ggacctggcc accgccgccg gtcgtgccgc gctgaaagcc 240 gccggtatca ccccagagca gctgaccgtg atcgccgtgg cgaccagcac cccagatcgt 300 ccgcagccac caaccgccgc ctacgtgcag catcacctgg gtgccaccgg caccgcggcc 360 ttcgacgtga acgccgtgtg cagcggcacc gtgttcgccc tgagcagcgt ggcgggcacc 420 ctggtgtatc gcggtggcta cgccctggtg atcggtgccg acctgtacag ccgcatcctg 480 aacccagccg accgcaaaac cgtggtgctg ttcggcgacg gtgcgggtgc catggtgctg 540 ggtccgacct cgaccggcac cggtccaatc gtgcgtcgcg tggccctgca caccttcggt 600 ggtctgaccg acctgatccg cgtgccagcc ggtggtagcc gtcagccgct ggataccgat 660 ggcctggatg cgggtctgca gtacttcgcc atggacggtc gcgaggtgcg tcgcttcgtg 720 accgagcatc tgccgcagct gatcaagggc ttcctgcacg aagcgggtgt cgatgccgcc 780 gacatcagcc acttcgtgcc gcaccaagcc aacggcgtga tgctggacga ggtgttcggt 840 gagctgcatc tgccacgtgc caccatgcac cgtaccgtgg aaacctacgg caacaccggt 900 gcggcgagca tccccatcac catggatgcg gccgtgcgtg ccggtagctt ccgtccgggt 960 gaactggtgc tgctggccgg tttcggtggc ggtatggccg ccagcttcgc gctgatcgag 1020 tggtga 1026 <210> 11 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> F-lacI <400> 11 tgcatgcctg caggtcgact ctagagacac catcgaatgg tgc 43 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> R-lacI <400> 12 aaaacgacgg ccagtgaatt ctcactgccc gctttcc 37 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> F-endA-upstream <400> 13 ctatgaccat gattacgcca agctttgctg ctcttgaaat gaacc 45 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R-endA-upstream <400> 14 tttgaaacgg ggggaaaaca tatttcaggt tg 32 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> F-endA-downstream <400> 15 tgttttcccc ccgtttcaaa ggctgcg 27 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> R-endA-downstream <400> 16 tgcaccattc gatggtgtct ctagaatgaa gaagcgaatc gtcct 45 <210> 17 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> F-endX-upstream <400> 17 ctatgaccat gattacgcca agcttgtgct tccccctcag gg 42 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> R-endX-upstream <400> 18 ggcctgagga gcgcagtcaa tcttccttcg 30 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> F-endX-downstream <400> 19 ttgactgcgc tcctcaggcc agcgtttg 28 <210> 20 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> R-endX-downstream <400> 20 tgcaccattc gatggtgtct ctagaaccag taaaagtggc gccg 44 <210> 21 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> F-qedH-I-upstream <400> 21 ctatgaccat gattacgcca agcttgtggc catgaactgg cg 42 <210> 22 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> R-qedH-I-upstream <400> 22 ccgctgcagg ggttgcagtt cccagtgga 29 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F-qedH-I-downstream <400> 23 aactgcaacc cctgcagcgg ggagc 25 <210> 24 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> R-qedH-I-downstream <400> 24 tgcaccattc gatggtgtct ctagaatgaa tatcgtgttg gtcgatgac 49 <210> 25 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> F-qedH-II-upstream <400> 25 ctatgaccat gattacgcca agcttgtggc catgaactgg cg 42 <210> 26 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> R-qedH-II-upstream <400> 26 taggcaggcg gacggctacc tttggttttt ttg 33 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> F-qedH-II-downstream <400> 27 ggtagccgtc cgcctgccta ctgccg 26 <210> 28 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> R-qedH-II-downstream <400> 28 tgcaccattc gatggtgtct ctagattaga agaagcccag cggat 45 <210> 29 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> F-phaG-upstream <400> 29 ctatgaccat gattacgcca agcttgtgtc tgcagtgaaa cccg 44 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> R-phaG-upstream <400> 30 gccgagccgc gtcatcgact cctggcgc 28 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F-phaG-downstream <400> 31 agtcgatgac gcggctcggc gcc 23 <210> 32 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> R-phaG-downstream <400> 32 tgcaccattc gatggtgtct ctagactaac cctgttcggt cacttg 46 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm1-upstream <400> 33 cgattcatta atgcagctgg c 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm1-upstream <400> 34 tccacttttt cccgcgtttt c 21 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm1-upstream <400> 35 ggcacgatgt gttcccac 18 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm1-downstream <400> 36 aagccagagg ccaaaccaa 19 <210> 37 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm1-upstream <400> 37 tttacagccg caataaaact cgg 23 <210> 38 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm1-downstream <400> 38 aagcctggga gcggcaa 17 <210> 39 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm1-upstream <400> 39 tggccgctgt tgcca 15 <210> 40 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm1-downstream <400> 40 cgtgggctac ggcgg 15 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm1-upstream <400> 41 gcatcgagca tgcgcaag 18 <210> 42 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm1-downstream <400> 42 atctccaggt ccgccgc 17 <210> 43 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm1-upstream <400> 43 gccgtggtgg ccagc 15 <210> 44 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm1-downstream <400> 44 cccgcaatgt catgctgg 18 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm2-endA <400> 45 tgctgctctt gaaatgaacc 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm2-endA <400> 46 atgaagaagc gaatcgtcct 20 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm2-endX <400> 47 gcaacgtcac cgacacc 17 <210> 48 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm2-endX-R <400> 48 agctctgcgg tggagc 16 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm2-qedH-I <400> 49 gcatcgagca tgcgcaag 18 <210> 50 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm2-qedH-I <400> 50 atctccaggt ccgccgc 17 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm2-qedH-II <400> 51 caccgcctga ggttgct 17 <210> 52 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm2-qedH-II <400> 52 agccacggtg ccttcg 16 <210> 53 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> F-Confirm2-phaG <400> 53 tccgcaacac cgtaccg 17 <210> 54 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> R-Confirm2-phaG <400> 54 gccgatcagg atcggcc 17 <210> 55 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> F-lacI + Ptrc (pSGP10) <400> 55 gtgcggtatt tcacaccgca tatgggcttc accttcaacc caacac 46 <210> 56 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> R-lacI + Ptrc (pSGP10) <400> 56 cgatggtgtc gagcgtcaga ccccgtag 28 <210> 57 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> F-ori + TetR (pSGP10) <400> 57 tctgacgctc gacaccatcg aatggtgca 29 <210> 58 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> R-ori + TetR (pSGP10) <400> 58 gacctgcagg catgcaagct tcatggtctg tttcctgtgt gaa 43 <210> 59 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> F-dTomato <400> 59 tgcatgcctg caggtcgact ctagaatggt gagcaagggc gag 43 <210> 60 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> R-dTomato <400> 60 tgaattcgag ctcggtaccc gggctacttg tacagctcgt ccatg 45 <210> 61 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> F-mvaE_opti <400> 61 aagcttgcat gcctgcaggt cgactctaga atttaaggag aactttatat gaagaccgt 59 <210> 62 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> R-mvaE_opti <400> 62 aaagtgtcta ggattattgc ttacgcaaat cgttca 36 <210> 63 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> F-mvaS_opti <400> 63 gcgtaagcaa taatcctaga cactttcacc ataagga 37 <210> 64 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R-mvaS_opti <400> 64 tacccagcgg actttagttg cgatagctgc gc 32 <210> 65 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> F-atoB_opti <400> 65 ctatcgcaac taaagtccgc tgggtagact aagg 34 <210> 66 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> R-atoB_opti <400> 66 gccagtgaat tcgagctcgg tacccgggtc agttcaggcg ctcgatc 47 <210> 67 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R-atoB_opti (pSGP12) <400> 67 ctacagaact taatcagttc aggcgctcga tc 32 <210> 68 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> F-nphT7_opti <400> 68 gcgcctgaac tgattaagtt ctgtagggcc gagac 35 <210> 69 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> R-nphT7_opti <400> 69 gccagtgaat tcgagctcgg tacccgggtc accactcgat cagcgc 46 <210> 70 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> F-acs_opti <400> 70 tttcacacag gaaacagcgg gcccctgaga atagccctca actacgt 47 <210> 71 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> F-acs_opti (pAWP89-3) <400> 71 catcgtgtga ctgagaatag ccctcaacta cgt 33 <210> 72 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> R-acs_opti <400> 72 gatagtctag aaggtaccag aattctcagc tcggcatggc g 41 <210> 73 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> F-eutE_opti <400> 73 tttcacacag gaaacagcgg gcccagaaag acaagagata aggaggt 47 <210> 74 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> R-eutE_opti <400> 74 gatagtctag aaggtaccag aattctcaca cgatgcggaa ggc 43 <210> 75 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> R-eutE_opti (pAWP89-3) <400> 75 ctattctcag tcacacgatg cggaaggc 28

Claims (7)

Nucleic acid sequence of acetyl coenzyme A Acetyltransferase represented by SEQ ID NO: 1, nucleic acid sequence of HMG CoA synthetase (3-hydroxy-3-methylglutaryl coenzyme A synthetase) represented by SEQ ID NO: 2 and SEQ ID NO: 3 It is transformed into a recombinant vector containing a nucleic acid sequence of HMG CoA reductase (3-hydroxy-3-methylglutaryl coenzyme A reductase), endonuclease A (endonuclease A, endA) gene and endonuclease X (endonuclease A, endX) Recombinant Pseudomonas putida strain with a missing gene.
The recombinant Pseudomonas putida strain of claim 1, wherein the recombinant vector further comprises a nucleic acid sequence of Acetyl coenzyme A synthetase represented by SEQ ID NO: 4.
The method of claim 1, wherein the strain is a quinoprotein ethanol dehydrogenase I (Quinoprotein Ethanol Dehydrogenase I) gene and quinoprotein ethanol dehydrogenase II (Quinoprotein Ethanol Dehydrogenase II) gene is further deleted, recombinant Pseudomonas putida ( Pseudomonas). putida ) strain.
Nucleic acid sequence of acetyl coenzyme A Acetyltransferase represented by SEQ ID NO: 1, nucleic acid sequence of HMG CoA synthetase (3-hydroxy-3-methylglutaryl coenzyme A synthetase) represented by SEQ ID NO: 2 and SEQ ID NO: 3 It is transformed with a recombinant vector containing a nucleic acid sequence of HMG CoA reductase (3-hydroxy-3-methylglutaryl coenzyme A reductase), endonuclease A (endonuclease A, endA) gene and endonuclease X (endonuclease A, endX) A composition for producing mevalonate comprising a recombinant Pseudomonas putida strain having a missing gene.
The composition for producing mevalonic acid according to claim 4, wherein the recombinant vector further comprises a nucleic acid sequence of acetyl coenzyme A synthetase represented by SEQ ID NO: 4.
According to claim 4, The strain is a quinoprotein ethanol dehydrogenase I (Quinoprotein Ethanol Dehydrogenase I) gene and a quinoprotein ethanol dehydrogenase II (Quinoprotein Ethanol Dehydrogenase II) gene is further deleted, the composition for producing mevalonic acid.
Method for producing mevalonic acid comprising the following steps:
Culturing the recombinant Pseudomonas putida strain of any one of claims 1 to 3; And
Obtaining mevalonic acid from the culture result.

Images