KR20140044469A - Corynebacterium sp. microorganism having enhanced l-threonine productivity by regulation of dapa activity and a method of producing l-threonine using the same - Google Patents

Abstract

The present invention relates to a Corynebacterium genus microorganism having improved L-threonine productivity and a method of producing L-threonine using the same, and more specifically, to a Corynebacterium genus microorganism having improved L-threonine productivity by reducing activity of or inactivating inherent dihydrodipicolinate synthetase and introducing activity of UDP-N-acetylmuramyl tripeptide synthetase, a method for preparing the microorganism, and a method for producing L-threonine using the microorganism. The use of the Corynebacterium genus microorganism, in which activity of UDP-N-acetylmuramyl tripeptide synthetase derived from Streptococcus pyogenes is introduced and dihydrodipicolinate synthase dapA is inactivated, can significantly improve the production yield of L-threonine, and thus can be widely applied to the efficient and economical production of L-threonine.

Description

The present invention relates to a microorganism belonging to the genus Corynebacterium having improved L-threonine production ability by controlling the activity of dapA, and a method for producing L-threonine using the microorganism of the genus Corynebacterium sp. microorganism having enhanced L-threonine productivity by regulation of dapA activity and a method of producing L-threonine using the same}

The present invention relates to a microorganism belonging to the genus Corynebacterium having improved L-threonine production ability and a method for producing L-threonine using the microorganism, and more particularly, to a method for producing L-threonine by introducing the activity of a UDP-N-acetylmuramyltreotide synthase Threonine producing ability by reducing or inactivating the activity of an intrinsic dihydrodipicolinate at the same time, a process for producing the same, and a process for producing L-threonine using the microorganism.

L-threonine is an essential amino acid, widely used as feed, food additive and animal growth promoter. It is also used as a synthesis material for medicine and medicine. Such L-threonine is an amino acid that can be produced by a microbial fermentation technology, and is an amino acid that can be produced by microorganism fermentation technology, such as Escherichia coli, Corynebacterium, Brevibacterium, Serratia, It is produced by a fermentation method mainly using a mutant strain derived from the wild-caught province of Providencia.

Known techniques for the recombinant strains include aspartate kinase / homoserine dehydrogenase (thrA), homoserine kinase (thrB), and threonine synthase (thrC) (Japanese Unexamined Patent Application Publication No. 05-227977) using a recombinant Escherichia coli transformed with a threonine operon comprising a gene encoding a threonine operon and a threonine operon as an E. coli chromosome A method of producing L-threonine by enhancing expression by a method of additional insertion (Korean Patent Registration No. 10-0427479), and a method of producing a threonine operon derived from Escherichia coli using Brevibacterium flora Threonine by introducing it into Brevibacterium flavum (TURBA E, et al, Agric. Biol. Chem., 53: 2269-2271, 1989).

On the other hand, Corynebacterium, particularly Corynebacterium glutamicum, is a gram-positive microorganism widely used for the production of L-amino acid. Thus, since the production of L-amino acid using the Corynebacterium strain is important, many attempts have been made to improve the production method thereof. However, in order to increase the production yield of L-threonine, research has focused on the biosynthetic pathway from phosphoenolpyruvate to threonine as described above, but still a higher yield of L-threonine There is a need for a method for industrial mass production.

The biosynthesis process of L-threonine is carried out by phosphoenol pyruvate (hereinafter referred to as PEP) by phosphoenol pyruvate carboxylase (hereinafter referred to as ppc) and / Or pyruvate is converted to oxaloacetate (hereinafter referred to as OAA) which is a precursor of the L-threonine biosynthetic pathway by pyruvate carboxylase (hereinafter referred to as pyc) After this OAA has been converted back to aspartate, the genes involved in the pathway for biosynthesizing L-threonine from aspartate, aspartate kinase (lysC), aspartate semialdehyde dehydrogenase Aspartate semialdehyde dehydrogenase (asd), homoserine dehydrogenase (hom), homoserine kinase (thrB), threonine The L- threonine is synthesized by; (thrC threonine synthase) gene, through an intermediate process of several steps te rise.

Aspartate semi-aldehyde not only participates in the biosynthesis process of L-threonine but also undergoes various steps of metabolism and is converted into diaminopimelate during the biosynthetic metabolic process L-lysine and peptidoglycan (peptidoglycan). However, in order to further increase the biosynthesis of L-threonine in Corynebacterium glutamicum, it is necessary to genetically block the branch point where aspartic aldehyde is converted into the biosynthesis of L-lysine and peptidoglycan, There has been no successful report of genetically blocking the dihydrodipicolinate synthase ( dapA ) gene to block this branch point. This is because genetic blocking of the dihydrodipicolinate synthetase gene in Corynebacterium glutamicum can block the biosynthesis of the peptidoglycan and render the growth of cells impossible. Therefore, there was a need to develop a method for efficiently producing L-threonine by genetically blocking the dapA gene and enabling cell growth.

Under these circumstances, the present inventors have made intensive efforts to develop a more effective method for producing L-threonine. As a result, it has been found that L-lysine can be used as a precursor for biosynthesis of peptidoglycan in place of diaminopimelate The expression of the UDP-N-acetylmuramyl tripeptide synthetase (murE) gene derived from Streptococcus pyogenes was induced in Corynebacterium glutamicum and the expression of dihydrodipicolinate synthase , dapA ) gene was genetically blocked to increase the production amount of L-threonine, thereby completing the present invention.

It is an object of the present invention to provide a method for the production of UDP-N-acetylmuramyl tripeptide synthetase (UDP-N-acetylmuramyl tripeptide synthetase) Inactivated microorganism of the genus Corynebacterium with improved L-threonine production ability.

It is still another object of the present invention to provide a method for producing a UDP-N-acetylmuramyltryptase synthase, comprising: introducing a recombinant vector comprising a murE gene encoding the UDP-N-acetylmuramyltryptase synthase into a host cell; And a step of introducing into the host cell a recombinant vector comprising a polynucleotide fragment lacking a part of the sequence of the dapA gene encoding dihydrodipicolinate synthase, And to provide a method for producing microorganisms of the genus Bacterium.

Another object of the present invention is to provide a method for producing a microorganism, which comprises culturing said microorganism to obtain a culture; And recovering L-threonine from the culture. The present invention also provides a method for producing L-threonine.

In order to achieve the above object, the present invention provides a method for producing a UDP-N-acetylmuramyl tripeptide synthetase by introducing the activity of UDP-N-acetylmuramyl tripeptide synthetase and introducing an intrinsic dihydrodipicolinate synthase activity of the Corynebacterium genus is decreased or inactivated, and L-threonine production is improved.

The present invention relates to a method for controlling L-threonine biosynthesis pathway in a microorganism of the genus Corynebacterium by controlling the function of a gene involved in a branch point of the L-threonine biosynthesis pathway, Effect. The regulation of the gene function is to inactivate dihydrodipicolinate synthase ( dapA ), which is inherently present in the genus Corynebacterium. In addition, for inactivation of the gene, Streptococcus (UDP-N-acetylmuramyl tripeptide synthetase, murE ) derived from pyogenes was introduced from Corynebacterium glutamicum to replace the diamino pimelate necessary for biosynthesis of peptidoglycan L-lysine may be used.

Since the dapA gene is inactivated to prevent the aspartate semialdehyde, which is an intermediate in the L-threonine generation mechanism, from being used for the production of L-lysine, L-threonine production is specifically increased, The concentration of the leonin can be significantly increased. Inactivation of the gene inactivates NCgl1896.

The term "dihydrodipicolinate synthase ( dapA )" in the present invention is an enzyme responsible for the first reaction of biosynthesis of diaminopimelate from aspart semi-aldehyde.

In the present invention, the term "intrinsic" means that the microorganism is in a natural state. In the present invention, it is used to indicate the activity of dapA or dapA which is naturally occurring in the genus Corynebacterium.

In the present invention, "inactivating dihydrodipicolinate synthase" means disabling the expression of a normal gene by mutation of the dapA gene encoding dihydrodipicolinate synthase. In the present invention, the dapA gene NCgl1896 present on the chromosome of Corynebacterium sp. Microorganism is mutated and used to indicate a state in which normal protein expression is impossible.

In the present invention, "inactivated" means that the expression of the dapA gene is decreased to a low level or is not expressed at all, and when the expression is expressed, the activity is lost or decreased. Can be accomplished by any known inactivation method known in the art.

In the present invention, "inactivation of dihydrodipicolinate synthase ( dapA )" is not particularly limited, but an insertion mutation by insertion of one or more base pairs into the gene encoding the dihydrodipicolinate synthase , A deletion mutation having deletion of one or more base pairs in the gene, and a transition, transversion mutation of a base pair introducing a nonsense codon in the gene, and a mutation method selected from the group consisting of And preferably, a method of deleting the gene by homologous recombination is preferably used.

The dihydro some sequences by Diffie coli carbonate synthetase of inactivation dihydro the Diffie introducing coli carbonate synthase recombinant vector carrying a portion of the gene encoding the second containing the deleted gene in the microorganism leading to transformation, dapA gene . The recombinant vector is not particularly limited, but it is preferable to use one derived from a pK18 mobsacB vector. More preferably, the recombinant vector is not particularly limited, but pSJC2509 having a cleavage map shown in Fig. 3 including an internal deletion of NCgl1896 and the like can be used. The pK18mobsacB has the function of performing marker-free deletion of a target gene without being replicated in Corynebacterium glutamicum (Schafer et al. 1994).

In one embodiment of the present invention, a recombinant vector comprising a gene sequence in which a part of the gene coding for dihydrodipicolinate synthase is deleted and an antibiotic marker and levan sucrase gene (sacB) was used. At this time, the antibiotic marker is not particularly limited, but it is preferable to use a kanamycin resistance-imparting gene.

The present inventors have found that mutation of the dapA gene existing on the chromosome of Corynebacterium sp. Microorganism to reduce the activity of dihydrodipicolinate synthetase inhibits the activity of aspartate seminar not used by dihydrodipicolinate synthase It was confirmed that the aldehyde was converted to homoserine according to the L-threonine production pathway, and as a result, the production yield of L-threonine was improved as a result. To this end, UDP-N-acetylmuramyltryptase synthase (UDP-N-acetylmuramyltryptase) derived from S. pyogenes was added to UDP-N-acetylmuramate pentapeptide so that L-lysine could be contained instead of diaminopimelate, UDP-N-acetylmuramyl tripeptide synthetase, murE ) into the microorganism of the genus Corynebacterium, thereby eliminating essential elements of diaminopimelate for peptidoglycan biosynthesis.

1 is a schematic diagram showing the production process of L-threonine of Corynebacterium glutamicum.

As a result, it was expected that the inactivation of the dapA gene would lead to an increase in the biosynthesis of L-threonine, which has been experimentally proven.

The term "L-threonine" in the present invention refers to a basic amino acid which is one of basic alpha -amino acids and which is not synthesized in the body and has the formula NH ₂ (CH ₂ ) ₄ CH (NH ₂ ) COOH. It says. L-threonine is biosynthesized via lysine biosynthesis pathway from oxalacetic acid, and NADPH-dependent reductase catalyzes the intermediate process for lysine biosynthesis.

The term "Corynebacterium genus microorganism having improved L-threonine production ability" in the present invention refers to a microorganism belonging to the genus Corynebacterium which is produced by mutation of the dapA gene present on the chromosome and the dehydrodipicolinate synthase activity is decreased or inactivated, The dapA gene is preferably, but not limited to, NCgl1896 consisting of the nucleotide sequence of SEQ ID NO: 2.

The term "Corynebacterium sp." In the present invention refers to a bacterium of the actinomycetes, which is generally in the form of a bacterium of the spatula type, and is characterized by non-swingability, polymorphism, spore formation and gram positive As a microorganism. The microorganism of the genus Corynebacterium according to the present invention is preferably selected from the group consisting of Corynebacterium ( Corynebacterium < RTI ID = 0.0 > hydrocarboclastus , C. glutamicum , C. thermoaminogenes , and the like, more preferably Corynebacterium glutamicum . And more preferably NCgl0624 (Homoserine-O-acetyltransferase), NCgl2046 (threonine-dehydratase), NCgl1133 (homoserine-O-acetyltransferase) in Corynebacterium glutamicum ATCC 13032 Diaminopimelate decarboxylase) and SJ3611 (KACC91730P, Corynebacterium glutamicum, which deleted a part of NCgl2528 (D-2-hydroxyisocaproate dehydrogenase, D-2-hydroxyisocaproate dehydrogenase) Tamiquim ATCC 13032, NCgl0624Δ, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ). Most preferably, MurE, which is a gene coding for UDP-N-acetylmuramyl tripeptide synthetase, is introduced into the strain SJ3611 as a parent strain, and dehydrodipicolinate synthase Corynebacterium glutamicum SJ3638 (KACC91733P, Corynebacterium glutamicum ATCC 13032, NCgl0624 :: Pgap-spy0388-TrrnB, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ, NCgl1896Δ, ).

In addition, if in order to improve the L- threonine producing ability of the present invention, the mutant dapA genes of four Corey tumefaciens in microbial peptides causes a problem in the generation of glycans, derived from the S. pyogenes in order to compensate UDP- The activity of UDP-N-acetylmuramyl tripeptide synthetase ( murE ) can be introduced. Specifically, a murE gene using L-lysine can be introduced into UDP-N-acetyl muramate pentapeptide in place of diaminopimelate which is an intermediate of L-lysine biosynthesis.

The term "peptidoglycan" in the present invention is a polymer composed of various sugar molecules and amino acids as components constituting the cell wall of bacteria, and performs various structural functions of bacterial cell walls. The biosynthesis of the peptidoglycan starts from the cytoplasm and UDP-N-acetylmuramate is used as a precursor to form UDP-N-acetyl muramate pentapeptide. Corynebacterium glutamyl In case of Kum, UDP-N-acetyl muramate pentapeptide will contain diaminopimelate, an intermediate of L-lysine biosynthesis. Therefore, the biosynthesis of diaminopimelate in Corynebacterium glutamicum is an essential element for cell growth.

In one embodiment of the present invention, recombinant strains SJ3638 ( murE ) introduced with UDP-N-acetylmuramyltryptase sirtutase ( murE ) in Corynebacterium glutamicum and destroyed with dihydrodipicolinate synthetase gene ( dapA ) , The production of L-threonine was about 10 times higher than that of the parent strain (0.18 vs. 1.79 g / l). These results show that inactivation of dapA plays a role in increasing the concentration of L-threonine in Corynebacterium glutamicum.

In another embodiment of the present invention, the present invention provides a recombinant vector comprising the steps of: introducing a recombinant vector comprising a murE gene encoding a UDP-N-acetylmuramyltryptase synthase into a host cell; And a step of introducing into the host cell a recombinant vector comprising a polynucleotide fragment in which a part of the dapA gene encoding the dihydrodipicolinate synthase has been deleted, the Corynebacterium strain having improved productivity of L-threonine Lt; RTI ID = 0.0 > microorganism. ≪ / RTI >

Preferably, in step (i), the murE expression recombinant vector comprises: (a) obtaining a polynucleotide fragment of a gene encoding murE ; And (b) introducing the obtained polynucleotide fragment into a vector capable of being introduced into a host cell capable of producing L-threonine and capable of performing homologous recombination on the chromosome. have.

Also preferably, in step (ii), the dapA inactive recombinant vector is obtained by (a) obtaining a polynucleotide fragment in which a part of the sequence of the gene encoding dapA has been mutated; And (b) introducing the obtained polynucleotide fragment into a vector capable of being introduced into a host cell capable of producing L-threonine and capable of performing homologous recombination on the chromosome. have.

At this time, the murE gene is not particularly limited, but may be preferably derived from S. pyogenes , and more preferably, it may be composed of the nucleotide sequence of SEQ ID NO: 1. In addition, the dapA gene is preferably NCgl1896, which is composed of the nucleotide sequence of SEQ ID NO: 2 having an open reading frame DNA sequence of Genbank accession number NC_003450.

In addition, the host cell is not particularly limited, but microorganisms that produce L-threonine can be used. Preferably, L-threonine is produced by a pathway including an aspartate semialdehyde intermediate. Microorganisms that produce L-threonine can be used, and more preferably, Corynebacterium hydrocarboclastus, Corynebacterium glutamicum, Corynebacterium, A microorganism belonging to the genus Corynebacterium such as C. thermoaminogenes may be used, more preferably a strain of Corynebacterium glutamicum, and most preferably a strain of Corynebacterium glutamicum SJ3611 (KACC91730P).

As used herein, the term "recombinant vector" refers to a vector that can not be cloned separately from the chromosome of a host cell, and that comprises a gene construct containing an essential component whose gene insert can be homologously recombined with a specific gene on the chromosome of the host cell Specifically, may include a selection gene such as an antibiotic resistance gene and a levansucrase (sacB) gene. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A can be used as the phage vector or cosmid vector, and pBR, pUC, pBluescriptII based , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.

According to one embodiment of the present invention, the present inventors have found that a pK18 mobsacB vector (Schafer et al., 2002), which is capable of performing marker-free deletion of a target gene without being replicated in Corynebacterium glutamicum, , Gene 145: 69-73, 1994). Specifically, the pK18 mobsacB vector comprises a polynucleotide fragment obtained by mutating, preferably deletion, a part of NCgl186, which is a gene coding for 1) murE gene (spy0388), or 2) a gene coding for dapA , A recombinant vector was further prepared which further contained an antibiotic marker and levan sucrase gene (sacB). The recombinant vector may be introduced into a host cell capable of biosynthesizing L-threonine, including a gene encoding dapA on the chromosome by any method known in the art, and homologous recombination in the chromosome may be used to introduce murE and / Corynebacterium microorganism for producing L-threonine in which the dapA gene was inactivated was prepared.

Specifically, a recombinant vector pSJ2810 was prepared by inserting a mutated polynucleotide fragment of NCgl0624 containing the terminator of 1) the gene (spy0388) -rrnB encoding the promoter- murE of the GAP gene into the pK18mobsacB vector, and 2) A part of the polynucleotide fragment was deleted, and the obtained polynucleotide fragment was inserted to prepare a recombinant vector pSJ2509.

Then, each of the prepared recombinant vectors pSJ2810 and pSJ2509 was added to Corynebacterium glutamicum SJ3611 (ATCC13032, NCgl0624Δ, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ), which is a host cell capable of producing L-threonine Sequentially, the plasmids are introduced by electroporation, and kanamycin resistant phenotypes are selected. Through the diagnostic PCR using a gene-specific primer, the plasmid is ligated to the chromosomal region of the corresponding gene by a single crossover . After that, it was confirmed that the plasmid was excised from the chromosomal region of the gene through selection of secondary recombination in 10% sucrose medium and diagnostic PCR using gene-specific primer Respectively. As a result, Corynebacterium glutamicum strain, in which a murE gene was introduced on the chromosome and a part of NCgl1896, which is a dapA gene, was deleted, was named SJ3638, and deposited on August 9, 2012 at the National Institute of Agricultural Science And received the deposit number of KACC91733P.

According to another embodiment of the present invention, the present invention relates to a method for producing L-threonine, which comprises culturing a microorganism of the genus Corynebacterium having improved L-threonine production ability of the present invention in a culture medium containing glucose as a part or all of a carbon source, ; And recovering L-threonine from the culture. The present invention also provides a method for producing L-threonine.

The term "cultivation" in the present invention means cultivation of microorganisms under moderately artificially controlled environmental conditions. In the present invention, a method of culturing the microorganism of the genus Corynebacterium may be carried out by any culture conditions and culture methods known in the art. Specifically, the culturing can be carried out continuously in a batch process or in an injection batch or a repeated batch batch process (but not limited thereto).

The medium used for the culture should meet the requirements of the particular strain in an appropriate manner. Culture media for Corynebacteria strains are known (eg, Manual of Methods for General Bacteriology. American Society for Bacteriology.Washington D.C., USA, 1981). Sugars which may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil and the like, palmitic acid, , Fatty acids such as linoleic acid, glycerol, alcohols such as ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture. Examples of nitrogen sources that may be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture. Potassium which may be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. In addition, the culture medium should contain metal salts such as magnesium sulfate or iron sulfate required for growth. Finally, in addition to these materials, essential growth materials such as amino acids and vitamins can be used. In addition, suitable precursors may be used in the culture medium. The above-mentioned raw materials can be added to the culture in a batch manner or in a continuous manner by an appropriate method.

Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or acid compounds such as phosphoric acid or sulfuric acid can be used in a suitable manner to adjust the pH of the culture.

In addition, bubble formation can be suppressed by using a defoaming agent such as a fatty acid polyglycol ester. Inject oxygen or oxygen-containing gas (eg, air) into the culture to maintain aerobic conditions. The temperature of the culture is usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. The culture continues until the amount of L-threonine produced is maximized. Usually for 10 to 160 hours for this purpose. L-threonine may be released into the culture medium or contained in the cells.

In a specific example of the present invention, the produced recombinant strain was cultured in MMY2 medium containing glucose.

In addition, the step of recovering L-threonine from the culture can be carried out by a method known in the art. Specifically, known L-threonine recovery methods include, but are not limited to, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (such as ammonium sulfate precipitation) It is preferable to use a method such as chromatography (for example, ion exchange, affinity, hydrophobicity and size exclusion).

Meanwhile, in order to further increase L-threonine production, the activity of known enzymes related to the biosynthesis of L-threonine can be further controlled in the present invention. Preferably, in order to control the activity of the aspartate semialdehyde dehydrogenase enzyme, the production of L-threonine can be increased by overexpressing the asd gene encoding the enzyme.

The inventors of the present invention found that the Corynebacterium sp. Microorganism having improved productivity of L-threonine prepared above is cultured in a medium containing glucose as a carbon source, and the level of increase in the production of L-threonine produced therefrom is compared Respectively. As a result, it was confirmed that L-threonine production was increased in strains in which murE was introduced and dapA was inactivated (Table 4).

The inventive Streptococcus pyogenes (UDP-N-acetylmuramyl tripeptide synthetase, murE ) derived from the pyogenes of the present invention and activating dihydrodipicolinate synthase ( dapA ) The use of microorganisms of the genus Bacterium can significantly improve the production yield of L-threonine, and thus can be widely used for the efficient and economical production of L-threonine.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing an L-threonine biosynthetic metabolic process involving a mechanism by which an enzyme expressing the dapA gene of Corynebacterium glutamicum is acted.
Figure 2 is a graph UDP-N- acetyl mu of pyogenes derived Ramil tripeptide Sinter hydratase (UDP-N-acetylmuramyl tripeptide synthetase , murE) a diagram showing a genetic map of the gene expression vector pSJ2810 to expressed on the dielectric of the Corynebacterium glutamicum .
Fig. 3 is a schematic diagram showing a gene map of vector pSJ2509 for mutating NCgl1896, a dapA gene existing in the chromosome of Corynebacterium glutamicum.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Example 1 : Production of recombinant vector

1-1. Parent strain  Production of inactivated inducible recombinant vector for production

A primer was prepared to prepare SJ3611 (Lys-, Met-, Ile-), which is a genetically recombinant parent strain of the present invention. First, NCgl0624 (homoserine-O-acetyltransferase), NCgl2046 (threonine-dehydratase), NCgl1133 (diaminopimelate decarboxylase) and NCgl2528 0624F1, 0624F2, 0624R1, 0624R2, and D-2-hydroxyisocaproate dehydrogenase) based on the sequence of GenBank accession number NC_003450 to construct an inactivated fragment of the D-2-hydroxyisocaproate dehydrogenase (D- 2046F1, 2046F2, 2046R1, 2046R2, 1133F1, 1133F2, 1133R1, 1133R2, 2528F1, 2528F2, 2528R1, 2528R2.

For secondary site-specific gene disruption, it is not possible to replicate in the Corynebacterium glutamicum, and secondary recombinant strains including the sacB gene can be selected, and pK18mobsacB vector having a kanamycin resistance gene And an open reading frame of NCgl0624, NCgl2046, NCgl1133 and NCgl2528 was internally deleted to make a gene-disrupted mutant strain, and a pK18mobsacB derivative was produced.

The pK18mobsacB derivatives were named pSJC2501, pSJC2504, pSJC2505 and pSJC2507, respectively.

pSJC2501 contains the internal gene deletion of the KpnI fragment of the NCgl0624 ORF with the pK18mobsacB derivative containing the BamHI-XbaI end of the 2,038-bp NCgl0624 ORF. The KpnI fragment was generated by performing cross-PCR with a pair of 0624F1-0624R1 primer and 0624F2-0624R2 primer using Corynebacterium glutamicum ATCC13032 genomic DNA as a template.

pSJC2504 contains the internal gene deletion of the BamHI fragment of the NCgl2046 ORF with the pK18mobsacB derivative containing the XbaI-XbaI end of the 1,902-bp NCgl2046 ORF. The BamHI fragment was generated by cross-PCR using a genomic DNA of Corynebacterium glutamicum ATCC13032 as a template in a pair of 2046F1-2046R1 primer and 2046F2-2046R2 primer.

pSJC2505 contains the internal gene deletion of the SmaI fragment of the NCgl1133 ORF with the pK18mobsacB derivative containing the XbaI-HindIII end of the 2,018-bp NCgl1133 ORF. The SmaI fragment was generated by cross-PCR using 1131F1-1133R1 primer and 1133F2-1133R2 primer pairs as a template of Corynebacterium glutamicum ATCC13032 genomic DNA.

pSJC2507 contains the internal gene deletion of the SmaI fragment of the NCgl2528 ORF with the pK18mobsacB derivative containing the XbaI-XbaI end of the 2,317-bp NCgl2528 ORF. The SmaI fragment was generated by cross-PCR using Corynebacterium glutamicum ATCC13032 genomic DNA as a template and a pair of 2528F1-2528R1 primer and 2528F2-2528R2 primer.

1-2. murE  Introduction Recombinant Vector Production

For overexpression of the murE gene derived from S. pyogenes using the promoter of the glyceraldehyde 3-phosphate dehydrogenase ( Gap ) gene of Corynebacterium, the pK18mobsacB gene, which is not replicable in the Corynebacterium glutamicum, (Site specific gene insertion) was performed, and an open reading frame of NCgl0624 was used to create a pK18mobsacB derivative that was internally deleted. The pK18mobsacB derivative is pSJC2501 prepared in Example 1-1.

PCR was carried out using the genomic DNA of Corynebacterium glutamicum ATCC13032 strain as a template and PgapF-PgapR primer, and PCR was performed using the spy0388F-spy0388R primer. PCR was performed using pTrc99A (Amann et al. 1988) as a template and a TrrnBF-TrrnBR primer to prepare an rrnB terminator.

The PCR was performed using PfuUltra ( ^TM ) Highly Reliable DNA Polymerase (Stratagene) as the polymerase, denaturing 95 ° C for 30 seconds; Annealing 55 캜, 30 seconds; And Extension 68 [deg.] C for 1 minute were repeated 25 times. The ends of each PCR products were treated with restriction enzymes and ligated with pBluescript KSII vector treated with restriction enzyme XbaI to obtain a recombinant vector.

The recombinant pSJC2501 vector obtained in Example 1-1 was subjected to restriction enzyme treatment with KpnI and subjected to blunt-end treatment using T4 DNA polymerase. The promoter fragment of the Gap gene obtained above, the murE gene fragment derived from S. pyogenes, and the rrnB The pBluescript KSII recombinant vector containing the terminator fragment was subjected to restriction enzyme treatment with XbaI, followed by blunt-end treatment using Klenow DNA polymerase and conjugated with blunt-ended KpnI-treated pSJC2501 to obtain a recombinant vector pSJ2810 (FIG.

1-3. dapA Production of inactivated inducible recombinant vector

A primer was prepared to prepare SJC3638, a dielectric recombinant strain of the present invention in which dihydrodipicolinate synthase (dapA) was inactivated. First, primers 1896F1, 1896F2, 1896R1, and 1896R2 were prepared based on the sequence of NCgl1896 to construct an inactivated fragment of NCgl1896, which is known as a gene expressing dihydrodipicolinate synthase, in Corynebacterium glutamicum. Respectively.

This pK18mobsacB, which is not replicable in the Corynebacterium glutamicum, was used for site-specific gene disruption. To make a gene-disrupted mutant strain, An open reading frame of NCgl1896 produced an internally deleted pK18mobsacB derivative.

The pK18mobsacB derivative was designated pSJC2509.

pSJC2509 contains the internal gene deletion of the KpnI fragment of NCgl1896 with the pK18mobsacB derivative containing the EcoRI-XbaI end of the 1,919-bp NCgl1896. The KpnI fragment was generated by cross-PCR with a pair of 1896F1-1896R1 primer and 1896F2-1896R2 primer using Corynebacterium glutamicum ATCC13032 genomic DNA as a template (Fig. 3).

The sequences of the primers used are summarized in Table 1 below.

PCR and recombinant primers used primer Nucleic acid sequence 0624F1 (SEQ ID NO: 3) cg ggatcc TCCTGGATATTCCTGCGG ( BamHI ) 0624F2 (SEQ ID NO: 4) gg ggtacc AGCAAGAACACCTCTCC (KpnI) 0624R1 (SEQ ID NO: 5) gg ggtacc TGATGGCTTTGCCGGGAC (KpnI) 0624R2 (SEQ ID NO: 6) gc tctaga TGCTGGGTTGGATTGAGG ( Xba I) 2046F1 (SEQ ID NO: 7) gc tctaga TGGAGTCCCTAGTAGAGG (XbaI) 2046F2 (SEQ ID NO: 8) cg ggatcc CTATCGCTGGGTTGAAGG (BamHI) 2046R1 (SEQ ID NO: 9) cg ggatcc TTGGTGCAATGACGGAGG (BamHI) 2046R2 (SEQ ID NO: 10) gc tctaga CCTTCCACGACTCTCACC (XbaI) 1133F1 (SEQ ID NO: 11) gc tctaga TCCCTGATCCGTTCCTCC (XbaI) 1133F2 (SEQ ID NO: 12) tcc cccggg TACTGCTACGCCATGAGC (SmaI) 1133R1 (SEQ ID NO: 13) tcc cccggg GTCTTCGTGGCTAGTGG (SmaI) 1133R2 (SEQ ID NO: 14) ccc aagctt ACTCTGACGACGATCGCA (HindIII) 2528F1 (SEQ ID NO: 15) gc tctaga TCAAGGCTGCTGCTGACC ( Xba I) 2528F2 (SEQ ID NO: 16) tcc cccggg CAAGCTGGACCGAAACCC (SmaI) 2528R1 (SEQ ID NO: 17) tcc cccggg CACAGGAACAGCACGTCC (SmaI) 2528R2 (SEQ ID NO: 18) gc tctaga CTTGCTGGCTGATCCTCG ( Xba I) 1896F1 (SEQ ID NO: 19) cggaattc GTGGAGTTGATAGCGTG (EcoRI) 1896F2 (SEQ ID NO: 20) ggggtacc GGTGGAGTCAGCTTGGCA (KpnI) 1896R1 (SEQ ID NO: 21) ggggtacc GCCGAAGTGCTCTACTCC (KpnI) 1896R2 (SEQ ID NO: 22) gc tctaga TCGTTGACCTCGATCAGC (XbaI) PgapF (SEQ ID NO: 23) gc tctaga GTCGTATTCGTCGTCTTTTGACGATCGC (XbaI) PgapR (SEQ ID NO: 24) ggaattc catatg GTTGTGTCTCCTCTAAAGATTGTAGG (NdeI) spy0388F (SEQ ID NO: 25) ggaattc catatg ATAACCATTGAACAA (NdeI) spy0388R (SEQ ID NO: 26) aactgcag TTAAAGTGTTCATCTGCCC (PstI) TrrnBF (SEQ ID NO: 27) aactgcag GCTGTTTTGGCGGATGAGAG (PstI) TrrnBR (SEQ ID NO: 28) gc tctaga AAAAGGCCATCCGTCAGG (XbaI)

In Table 1, the underlined sequence indicates the restriction site for the restriction enzyme as shown in parentheses, and the upper case means the sequence of the bacterial gene.

The plasmids used and produced in the above examples and their structures are summarized in the following table (Table 2).

Used or produced plasmids and their structures Plasmid rescue pK18mobsacB Non-replicable sacB Km ^R in Corynebacterium pSJC2501 The NCgl0624 fragment containing the 2,038-bp BamHI-Xba I fragment generated by cross-PCR of the Corynebacterium glutamicum ATCC13032 genomic DNA pair with the 0624F1-0624R1 primer and the 0624F2-0624R2 primer pair was used as the in-frame internal PK18mobsacB derivatives containing gene deletion pSJC2504 The NCgl2046 fragment containing the 1,902-bp XbaI-XbaI termini generated by cross-PCR of the Corynebacterium glutamicum ATCC13032 genomic DNA as a template with a 2046F1-2046R1 primer and a 2046F2-2046R2 primer pair was used as the in-frame internal PK18mobsacB derivatives containing gene deletion pSJC2505 Corynebacterium glutamicum ATCC13032 The NCgl1133 fragment carrying the 2,018-bp XbaI-HindIII fragment generated by cross-PCR of the 1133F1-1133R1 primer and the 1133F2-1133R2 primer pair as genomic DNA template was used as the in-frame internal PK18mobsacB derivatives containing gene deletion pSJC2507 The NCgl0624 fragment containing the 2,317-bp BamHI-XbaI termini generated by cross-PCR using the Corynebacterium glutamicum ATCC13032 genomic DNA template as a pair of the 2528F1-2528R1 primer and the 2528F2-2528R2 primer was used as the in-frame internal PK18mobsacB derivatives containing gene deletion pSJC2509 The NCgl1896 fragment carrying the 1,896-bp EcoRI-XbaI termini generated by cross-PCR with the 1896F1-1896R1 primer and 1896F2-1896R2 primer pairs as a template for the Corynebacterium glutamicum ATCC13032 genomic DNA was used as the in-frame internal PK18mobsacB derivatives containing gene deletion pSJC2810 Gap gene promoter of Corynebacterium glutamicum, murE from S. pyogenes Gene, a transcriptional fusion consisting of the nucleotide sequence of the rrnB terminator of the pTrc99A plasmid was inserted into the KpnI site of the NCgl0624 fragment on pSJC2501, the pK18mobsacB derivative

The following plasmids were used to prepare the following recombinant strains.

Example  2: Production of recombinant strain

2-1. Parent strain  making

The deletion inducing plasmids pSJC2501, pSJC2504, pSJC2505 and pSJC2507 prepared in Example 1 were transformed by electrophoresis (van der Rest et al. 1999), and each plasmid was transformed into a chromosome by a single crossover . Subsequently, excision of the plasmid from the chromosome was induced by secondary recombination in 10% sucrose, and the open reading frame of NCgl0624, NCgl2046, NCgl1133 and NCgl2528 was deleted internally from the parental strain SJ3611 ( ATCC13032, NCgl0624Δ, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ). We confirmed that all of the NCgl0624, NCgl2046, NCgl1133, and NCgl2528 genes were deleted through diagnostic PCR using a gene-specific primer and named SJ3611. On August 9, 2012, And was granted accession number KACC91730P by the National Institute of Agricultural Science and Technology.

2-1. murE  Production of recombinant strain into which a gene is introduced

The recombinant plasmid pSJ2810 prepared in Example 1-2 was transformed into Corynebacterium glutamicum SJ3611 strain (ATCC 13032, NCgl0624Δ, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ) by electroporation (van der Rest et al 1999). The plasmid was introduced into the chromosome by a single crossover. Thereafter, excision of the plasmid from the chromosome was induced by secondary recombination in 10% sucrose. The promoter fragment of the Gap gene, the murE gene fragment derived from S. pyogenes, and the rrnB terminator fragment were inserted into the NCgl0624 gene through a diagnostic PCR using a gene-specific primer, and SJ3650 Respectively.

2-3. dapA  Production of a recombinant strain in which a gene is deleted

Example 2-2 The Corynebacterium glutamicum mutant strain SJ3650 which deleted the NCgl1896 gene dapA gene in addition to the (ATCC13032, NCgl0624 :: Pgap-spy0388 -TrrnB, NCgl2046 △, NCgl1133 △, NCgl2528 △) produced in Respectively.

Specifically, the deletion inducing plasmid pSJ2509 prepared in Example 1-3 was transformed by electroporation (van der Rest et al. 1999), and each of the plasmids was introduced into the chromosome by a single crossover . The recombinant strain SJ3638 of the present invention (ATCC 13032, SEQ ID NO: 3), in which the open reading frame of NCgl1896 was internally deleted by inducing excision of the plasmid from the chromosome through secondary recombination in 10% sucrose, NCgl0624 :: Pgap-spy0388-TrrnB, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ, NCgl1896Δ).

The strains thus prepared and their characteristics are summarized in the following table.

The strains and characteristics Strain characteristic SJ3611 Corynebacterium glutamicum ATCC 13032, NCgl0624Δ, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ SJ3650 Corynebacterium glutamicum ATCC 13032, NCgl0624 :: Pgap-spy0388-TrrnB, NCgl2046Δ, NCgl1133Δ, NCgl2528Δ SJ3638 Corynebacterium glutamicum SJ3650, NCgl1896

Example  3. Recombination Corynebacterium Glutamicum  Culture of strain

SJ3611 and SJ3628, which were recombinant strains of Corynebacterium glutamicum prepared in Example 2, were cultured in the following manner. The culture medium was cultured for 24 hours using Recovery Glucose medium (80 g BHI, 20 g Clucose, 60 g sorbitol / L) containing kanamycin (50 mg / L) as the seed medium. The production medium consisted of MMY2 medium [1.0 g KH ₂ PO ₄ , 60 g (NH ₄ ) ₂ SO ₄ , 0.8 g MgSO ₄ .7H ₂ O, 10 mg MnSO ₄ .H ₂ O , 10 mg of FeSO ₄ .7H ₂ O, 20 g of yeast extract, 0.4 mg of biotin, 0.3 mg of thiamine, and 60 g of Glucose / L, pH 7.0]. Corynebacterium glutamicum strain SJ3611 and the strain Corynebacterium glutamicum SJ3638 of the present invention were respectively inoculated and shaken cultured (200 rmp) in a 100 ml baffle flask containing seed medium. After harvesting the clutamicum cultivated in the seed medium, the glutamicum was resuspended in a 100 ml baffle flask containing 10 ml of the production medium until the absorbance at 0.4 to 0.5 at 600 nm. Then, 0.2 g of sterile CaCO ₃ per 10 ml was added and, if necessary, kanamycin was added to a final concentration of 50 μg / L. The above cultivation was carried out in a rotary shaker at 200 rpm at 30 ° C.

Example  4. Recombination Corynebacterium Glutamicum  The L- Threonine  production

The production concentrations of L-threonine in the recombinant Corynebacterium glutamicum strains SJ3611 and SJ3638 produced and cultured in Examples 2 and 3 were measured. At this time, the concentration of L-threonine was quantified using an Agilent 1100 series HPLC (Agilent Technologies, CA, USA) and a Zorbax Eclipse C ₁₈ column. The dry cell mass was measured based on the point that the absorbance at 600 nm corresponds to a dry weight per liter of 0.3 g.

The measured values were as shown in the following table (Table 4).

Production of L-threonine in the recombinant strain Corynebacterium glutamicum L-threonine (g / L) SJ3611 0.18 SJ3638 1.79

These values represent mean values based on the results obtained in at least two independent cultures and in all cases the standard deviation was less than 10%.

As shown in Table 4, SJ3638 increased the production of L-threonine approximately 10-fold compared to SJ3611 (0.18 vs. 1.79 g / l). This suggests that introduction of murE and inactivation of dapA play a role in increasing the concentration of L-threonine in Corynebacterium glutamicum.

The increased production of L-threonine by blocking the pathway through the expression of the dapA gene resulted in the inhibition of the entry of the intermediate into L-lysine or peptidoglycan production at the point of L-threonine production From the above results, it was found that the mutant strain in which the dapA gene NCgl1896 was inactivated and the murE enzyme derived from S. pyogenes was introduced to overcome the inability to produce peptidoglycan was used to produce L-threonine from glucose A method can be proposed.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

Agricultural Genetic Resource Center KACC91733P 20120809 Agricultural Genetic Resource Center KACC91730P 20120809

<110> SANGJI UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Corynebacterium sp. microorganism having enhanced L-threonine          productivity by regulation of dapA activity and a method of producing          L-threonine using the same <130> PA120800 / KR <160> 28 <170> Kopatentin 2.0 <210> 1 <211> 1446 <212> DNA <213> Streptococcus pyogenes murE <400> 1 atgataacca ttgaacaatt attagacatt ttaaaaaaag accataattt tcgtgaggtt 60 cttgatgccg acggatacca ctaccattat caaggcttta gttttgagcg cttgagttac 120 gatagccgtc aagtagatgg caagaccctt ttttttgcta aaggggcaac tttcaaagct 180 gactacctta aagaagcaat cactaacgga ttacaactct atatttcaga ggtagattac 240 gagcttggta ttcccgttgt tttggtcact gatatcaaaa aagctatgag tctaattgcc 300 atggctttct atggcaaccc tcaagaaaag ctcaaactac tagcttttac aggtactaag 360 ggaaagacga cggctgctta ttttgcctac cacatgttga aagaatccta taaacctgcc 420 atgttttcta ccatgaatac caccttagat ggcaagacct ttttcaaatc acaactcaca 480 actcctgaga gcttggatct ttttgctatg atggctgagt gtgtgactaa tggcatgacc 540 cacttgatta tggaagtttc tagtcaggct tacctcgttg accgtgtcta tgggcttacg 600 ttcgatgttg gggttttcct aaatattagt cctgatcata ttggcccaat cgagcatcca 660 acgtttgaag attatttcta tcataagcgt cttttaatgg agaatagcag agctgttgtg 720 atcaatagcg ggatggatca tttttcattt ctagcggatc aggtagcgga tcaagagcat 780 gtgttttatg gtcccttgtc tgacaaccag atcaccacta gccaagcctt ttcatttgag 840 gccaatggac aattggctgg gcactatgat atccaattaa tcgggcactt caatcaagaa 900 aatgctatgg cagctggact tgcctgcctt cgtttgggtg ctagcctagc tgatattcaa 960 aaaggtatcg ctaagactcg cgtcccaggc cgtatggaag tcctcactat gacaaatcat 1020 gctaaagttt ttgttgatta tgcccataat ggtgacagct tagaaaaatt actcagcgtt 1080 gtggaagaac atcagacagg caaattaatg ttgattttag gtgcaccagg aaataaaggc 1140 gagagcagac gagctgattt tggtagggtg attcatcagc atccaaacct caccgtcatt 1200 ctcactgctg atgaccctaa tttcgaggat ccagaagata tttcaaaaga aattgctagc 1260 catatcgcac gcccggtaga gattattagt gaccgtgagc aagctattca aaaagccatg 1320 tctctttgcc aaggagcaaa agatgctgtg attatcgctg ggaaaggcgc agatgcttat 1380 caaattgtta aaggacaaca agtagcttat gctggtgatt tagcaatcgc caaacactac 1440 ctctag 1446 <210> 2 <211> 906 <212> DNA <213> C. glutamicum NCgl1896 <400> 2 atgagcacag gtttaacagc taagaccgga gtagagcact tcggcaccgt tggagtagca 60 atggttactc cattcacgga atccggagac atcgatatcg ctgctggccg cgaagtcgcg 120 gcttatttgg ttgataaggg cttggattct ttggttctcg cgggcaccac tggtgaatcc 180 ccaacgacaa ccgccgctga aaaactagaa ctgctcaagg ccgttcgtga ggaagttggg 240 gatcgggcga agctcatcgc cggtgtcgga accaacaaca cgcggacatc tgtggaactt 300 gcggaagctg ctgcttctgc tggcgcagac ggccttttag ttgtaactcc ttattactcc 360 aagccgagcc aagagggatt gctggcgcac ttcggtgcaa ttgctgcagc aacagaggtt 420 ccaatttgtc tctatgacat tcctggtcgg tcaggtattc caattgagtc tgataccatg 480 agacgcctga gtgaattacc tacgattttg gcggtcaagg acgccaaggg tgacctcgtt 540 gcagccacgt cattgatcaa agaaacggga cttgcctggt attcaggcga tgacccacta 600 aaccttgttt ggcttgcttt gggcggatca ggtttcattt ccgtaattgg acatgcagcc 660 cccacagcat tacgtgagtt gtacacaagc ttcgaggaag gcgacctcgt ccgtgcgcgg 720 gaaatcaacg ccaaactatc accgctggta gctgcccaag gtcgcttggg tggagtcagc 780 ttggcaaaag ctgctctgcg tctgcagggc atcaacgtag gagatcctcg acttccaatt 840 atggctccaa atgagcagga acttgaggct ctccgagaag acatgaaaaa agctggagtt 900 ctataa 906 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 0624F1 <400> 3 cgggatcctc ctggatattc ctgcgg 26 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer 0624F2 <400> 4 ggggtaccag caagaacacc tctcc 25 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 0624R1 <400> 5 ggggtacctg atggctttgc cgggac 26 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 0624R2 <400> 6 gctctagatg ctgggttgga ttgagg 26 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 2046F1 <400> 7 gctctagatg gagtccctag tagagg 26 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 2046F2 <400> 8 cgggatccct atcgctgggt tgaagg 26 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 2046R1 <400> 9 cgggatcctt ggtgcaatga cggagg 26 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 2046R2 <400> 10 gctctagacc ttccacgact ctcacc 26 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 1133F1 <400> 11 gctctagatc cctgatccgt tcctcc 26 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 1133F2 <400> 12 tcccccgggt actgctacgc catgagc 27 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 1133R1 <400> 13 tcccccgggg tcttcgtggc tagtgg 26 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 1133R2 <400> 14 cccaagctta ctctgacgac gatcgca 27 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 2528F1 <400> 15 gctctagatc aaggctgctg ctgacc 26 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 2528F2 <400> 16 tcccccgggc aagctggacc gaaaccc 27 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 2528R1 <400> 17 tcccccgggc acaggaacag cacgtcc 27 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 2528R2 <400> 18 gctctagact tgctggctga tcctcg 26 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer 0281F1 <400> 19 cggaattcgt ggagttgata gcgtg 25 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 0281F2 <400> 20 ggggtaccgg tggagtcagc ttggca 26 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 0281R1 <400> 21 ggggtaccgc cgaagtgctc tactcc 26 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 0281R2 <400> 22 gctctagatc gttgacctcg atcagc 26 <210> 23 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer PgapF <400> 23 gctctagagt cgtattcgtc gtcttttgac gatcgc 36 <210> 24 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer PgapR <400> 24 ggaattccat atggttgtgt ctcctctaaa gattgtagg 39 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer thrBF <400> 25 ggaattccat atgataacca ttgaacaa 28 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer thrBR <400> 26 aactgcagtt aaagtgttca tctgccc 27 <210> 27 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer TrrnBF <400> 27 aactgcaggc tgttttggcg gatgagag 28 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer TrrnBR <400> 28 gctctagaaa aaggccatcc gtcagg 26

Claims (14)

L-Thru, wherein the activity of UDP-N-acetylmuramyl tripeptide synthetase is introduced and the activity of intrinsic dihydrodipicolinate synthase is reduced or inactivated A microorganism of the genus Corynebacterium with enhanced production of leonin.
The method of claim 1,
The reduction or inactivation may be due to an insertion mutation by insertion of one or more base pairs into the dapA gene encoding a dihydrodipicolinate synthase, a deletion mutation with a deletion of one or more base pairs in the gene, and a nonsense codon or difference in the gene. A microorganism of the genus Corynebacterium, by one or more mutation methods selected from the group consisting of transition or transversion mutations of base pairs introducing codons.
The method of claim 1,
Said reduction or inactivation is a microorganism of the genus Corynebacterium, wherein the part of the dapA gene encoding a dihydrodipicolinate synthase is transformed with a recombinant vector comprising a gene deleted.
The method of claim 3,
The recombinant vector is pSJC2509 having a cleavage map shown in Figure 3, Corynebacterium genus microorganisms.
The method of claim 3,
The dapA gene is composed of the nucleotide sequence of SEQ ID NO: 2, Corynebacterium genus microorganism.
The method of claim 1,
The activity introduction is transformed with a recombinant vector comprising a murE gene encoding UDP-N-acetyl muramyl tripeptide synthetase, Corynebacterium genus microorganisms.
The method according to claim 6,
The recombinant vector is pSJC2810 having a cleavage map shown in Figure 2, Corynebacterium genus microorganisms.
The method of claim 1,
The murE gene is Streptococcus pyogenes ) derived from, the microorganism of the genus Corynebacterium.
The method according to claim 6,
The murE gene is composed of the nucleotide sequence of SEQ ID NO: 1, Corynebacterium genus microorganisms.
The method of claim 1,
The microorganism of the genus Corynebacterium is Corynebacterium glutamicum (Corynebacterium glutamicum), Corynebacterium genus microorganisms.
The method of claim 1,
The microorganism of the genus Corynebacterium is derived from Corynebacterium glutamicum SJ3611 accession number KACC91730P, Corynebacterium genus microorganisms.
The method of claim 1,
The microorganism of the genus Corynebacterium is Corynebacterium glutamicum SJ3638 accession number KACC91733P, Corynebacterium genus microorganisms.
(I) introducing into a host cell a recombinant vector comprising murE gene encoding a UDP-N-acetylmuramil tripeptide sirtatase; And
(Ii) introducing into a host cell a recombinant vector comprising a polynucleotide fragment in which a partial sequence of the dapA gene encoding a dihydrodipicolinate synthase is deleted; A method for producing microorganisms of the genus Corynebacterium with improved L-threonine production capacity.
(Iii) obtaining a culture by culturing the microorganism of Corynebacterium having improved L-threonine production according to any one of claims 1 to 12 in a culture medium containing glucose as part or all of a carbon source. ; And
(Ii) recovering L-threonine from the culture.

Images