KR20180042870A - Method for crystallization of CgLOG protein - Google Patents

Abstract

The present invention relates to a method of producing Cg LOG protein crystals. More specifically, the present invention relates to a method of crystallizing Cg LOG protein originated from Corynebacterium glutamicum, to a method of screening for a Cg LOG protein activity modulator by using a three-dimensional structure of the protein, and to a method of producing cytokinin by using the Corynebacterium glutamicum. Since Cg LOG protein is an enzyme producing biologically available cytokinin, the crystals of Cg LOG protein, the method of crystallizing the protein, and the three-dimensional structure thereof provided in the present invention may be used to provide information useful in the Cg LOG protein processing for improving the efficiency of cytokinin production.

Description

Method for Crystallization of CgLOG Protein Crystals [

The present invention relates to a process for the preparation of Cg LOG protein crystals, specifically, Corynebacterium glutamicum (Corynebacterium glutamicum- derived Cg LOG protein, a method for screening the activity regulator of the Cg LOG protein using the tertiary structure of the protein, and a method for producing cytokinin using the Corynebacterium glutamicum ≪ / RTI >

Between the non-talkie (cytokinin) is a plant hormone that plays a key role in regulating the growth and development of plants, N ⁶ - (δ ² - iso-pentenyl) adenine ^{(N 6 - (δ 2 -isopentenyl} ) adenine; iP) or trans- claim ahtin (trans-zeatin; tZ) - N ⁶ a modified adenine and the like. Cytokinins can bind to sugar residues such as nucleotides, nucleosides and glucosides, but such binding forms diminish or inactivate activity against plant cytokinin receptors Sakakibara H. et al., Annu Rev Plant Biol, 57, 431-49, 2006).

The biosynthetic pathway of this cytokinin originates from dimethylallyl pyrophosphate (DMAPP) derived from the mevalonate pathway and is prenylated by IPT (isopentenyltransferase). Adenylate-IPT binds ATP / ADP or adenylate to DMAPP and tRNA-IPT transforms the N ⁶ -atom of the adenine moiety at the 37-position of the tRNA. The isopentenylated product is converted to the metabolite iPRMP (N- (δ-isopentenyl) adenosine 5'-monophosphate) by dephosphorylation or degradation of the tRNA. The nucleotide iPRMP is dephosphorylated by a nucleotidase and is cleaved by the above-mentioned cleavage enzyme to generate an activated nucleobase. Previous studies have identified a single-step cytokinin activation pathway first, and a novel cytokinin activating enzyme called LOG (lonely guy) has emerged (Kurakawa, T. et al., Nature, 445, 652-5, 2007). LOG is N ⁶ from the non-talkie precursor such as between iPRMP or tZRMP (trans-zeatin riboside 5'-monophosphate) - between the base substitution (N ⁶ -substituted base) and ribose 5'-1 monoxide salt (ribose 5'-monophosphate) Hydrolysis of the bond yields activated cytokinin through deoxyinophosphorylation.

Prior to the identification of the cytokinin production function of LOGs as described above, it has been postulated that LOG would be a lysine decarboxylase (LDC), which was done according to the Pfam database without further experimental evidence (Kukimoto- Niino, M. et al., Protein Sci., 13, 3038-42, 2004). In recent years Rice ( Oryza sativa ), Arabidopsis thaliana , Claviceps purpurea , Mycobacterium tuberculosis , and the like, have been undergoing biochemical and functional studies of LOG proteins. According to morphological and metabolic analyzes, the LOG-mediated single step pathway has been suggested to be a major cytokinin production pathway, which is essential for the normal growth and development of Arabidopsis (Kuroha, T. et al., Plant Cell, 21, 3152-69, 2009). In addition, despite the lack of reports on the active mechanism of the active form of cytokinin, phosphoribohydrolase, a structural study of the protein revealed that LOG has a homodimeric arrangement homozygous disposition and a highly conserved "PGG _X GT _XX E" motif in the active site (Jeon, WB et al., Proteins, 65, 1051-4, 2006; Dzurova, L. et al. et al., Proteins, 83, 1539-46, 2015). However, there has been no research on LOG proteins other than the above-mentioned organisms, particularly LOG proteins derived from bacteria.

On the other hand, Corynebacterium ( Corynebacterium < RTI ID = 0.0 > glutamicum ) is a bacterium that lives in soil, and has excellent ability to produce amino acids, nucleotides or vitamins, and many studies have been conducted to utilize this in industry (Vertes, AA et al., Appl. Environ. Microbiol. 71, 7633-42, 2005). Among them, L-lysine has attracted the greatest interest in the industry. In this connection, a method for producing L-lysine using corynebacterium (Korean Patent No. 10-0782867) or a method for producing L-lysine biosynthetic pathway gene To increase the production of L-lysine in Corynebacterium glutamicum (Korean Patent No. 10-0760222) have been developed. In particular, C. glutamicum ATCC 13032 has been found to contain the gene product of Cg 2612 designated as LDC (lysine decarboxylase, pfam03641) and a nucleotide binding protein. The above-mentioned LDC converts L-lysine to cadaverine by a decarboxylation reaction and is known as a PLP (pyridoxal 5'-phosphate) dependent enzyme.

Proteins such as enzymes must have a tertiary structure in order to exhibit their functions. In order to control the related proteins and to use them in industry, it is necessary to identify the structural information of the protein and the binding structure between the active site (catalyst site) and the substrate have. However, the enzyme derived from Corynebacterium glutamicum involved in the biosynthesis of cytokinin and its tertiary structure have not been elucidated so far, and it has been difficult to control the activity of the protein based on the structure of the protein.

Under these circumstances, the present inventors have made intensive efforts to identify the structure of the Cg 2612 gene product derived from Corynebacterium glutamicum, and as a result, have found that a method for effectively producing a crystal of Cg 2612 protein And the crystals prepared therefrom were obtained. In addition, as a result of identifying the structure of the crystals from 2612 Cg, Cg 2612 was confirmed that the function as LOG, by naming them as Cg LOG, and completed the present invention.

One object of the present invention is to provide a protein solution containing (i) a Cg LOG protein and (ii) a reservoir solution comprising malic acid and PEG (polyethylene glycol) ( Cg LOG) protein derived from Corynebacterium glutamicum , which comprises crystallizing the LOG ( Cg LOG) protein by a hanging-drop vapor-diffusion method.

Another object of the present invention is to provide a method for the production of (a) Corynebacterium < RTI ID = 0.0 > ( Corynebacterium < / RTI > producing or selecting a Cg LOG protein activity-regulating candidate peptide or Cg LOG protein binding candidate compound using the tertiary structure of LOG ( Cg LOG) protein derived from glutamicum ; And (b) to provide a screening method for the active control agent, Cg LOG protein comprising the step of verifying whether or not the step (a) is produced or selected candidate peptide or compound in step modulates the activity of Cg LOG protein.

Yet another object of the present invention is to provide a method for producing Corynebacterium glutamicum by culturing Corynebacterium glutamicum in a medium; And recovering the cytokinin from the cultured microorganism or culture medium. The present invention also provides a method for producing cytochinin.

In order to achieve the above object, one aspect of the present invention provides a method for crystallizing LOG ( Cg LOG) protein derived from Corynebacterium glutamicum .

There are many methods for characterizing the protein crystal structure, but there are mainly two methods such as a method using NMR spectroscopy and a method using x-ray crystallization. NMR Spectroscopy uses a principle that predicts the distance between specific atoms of a molecule by analyzing the signal change due to chemical causes that can be observed in the NMR spectrum of the molecule. By analyzing the chemical change data obtained through NMR experiments, we obtain a set of distances between the labeled atoms in a protein and generate a set of models or models that are well suited to the information of all distances determined experimentally, There is a blind spot to invest considerably in the collection and analysis of On the other hand, the x-ray crystallization method is based on the principle of putting a crystal of a substance into an x-ray generator and analyzing an x-ray reflected by a cloud of electrons surrounding the atom of the crystal to obtain a result. Because protein crystals are arranged in a regular lattice of individual protein molecules, x-rays reflected by protein crystals have a regular pattern, so that x-rays scattered in protein crystals reflect the electrons of proteins It is a method to analyze protein structure by generating density. However, there is a need for a pure protein sample, which requires the crystallization of the protein.

In the present invention Corynebacterium glutamicum (Corynebacterium glutamicum) it was identified a way to manufacture a crystal of the LOG protein derived from Cg LOG protein at best, and to obtain a crystal of Cg LOG protein therefrom identifying the three-dimensional structure through the x- ray analysis, its activity modulators Based on the results of the study. Furthermore, by identifying the function Cg of the LOG protein using a three-dimensional structure of the Cg LOG protein, it was well-positioned to produce between the non-talkie with a counter-active agent.

The term " Cg LOG protein" of the present invention means a LOG (LONELY GUY) protein derived from Corynebacterium glutamicum , specifically, a cytokinin ribose 5'-1 phosphate phospholipid hydroxy Lysine (Cytokinin riboside 5'-monophosphate phosphoribohydrolase). The LOG is an enzyme that converts an inactive cytokinin base to a form of a biologically active base, resulting in cytokinin production. Therefore, if the Cg LOG protein is structurally determined to catalyze the above-mentioned action, and if it is actually involved in the production of cytokinin, a substance that regulates the activity of the protein by identifying its action mechanism based on its tertiary structure and structure Can provide a basis for producing cytokinins effectively. Thus, in the present invention, the crystal of the Cg LOG protein was prepared and the tertiary structure of the Cg LOG protein was determined in the prepared crystal.

In the present invention, ' Cg LOG' may be used in the same meaning as ' Cg 2612'.

In the present invention, the term " crystallization " or having "crystallinity" means that the protein is converted from a homogeneous liquid phase into a uniform shape and size To form solid particles having a high crystallinity and to stabilize the crystalline state of the protein. The three-dimensional structure of proteins is very important for understanding the in vivo action of proteins. In other words, if you know the array and the three-dimensional structure of the atoms constituting the polymer, a protein, can be three-dimensional structure analysis of Cg LOG protein, and can through the activity of Cg LOG protein to prepare the foundation for efficient between talkie non manufacturing a medicament or a It is an important task to identify the tertiary structure of the protein in the food industry.

The Cg LOG protein crystal of the present invention has an amino acid sequence represented by SEQ ID NO: 1 and has a space group of I 2 22 and a unit cell dimension of a = 113.51 5 A and b = 130.5 Å, c = 150.51 Å, and α = β = γ = 90 °. More specifically, the unit cell dimensions may be a = 113.51 Å, b = 130.50 Å, c = = [beta] = [gamma] = 90 [deg.].

The term 'space group' is a symmetry of a unit cell of a crystal, and a combination of symmetry elements forms a group. The space may be mixed with a space group.

The term 'unit cell dimension' is also referred to as a lattice constant. The unit cell is the smallest repeating unit which is the most easily interpretable and constitutes a space group. The unit cell is a crystallographic axes, And may be the lengths ( a , b , c ) of the three vectors and the angles (?,?,?) Between them.

The phase information may be obtained through a multiple isomorphous replacement method, a multiwavelength anomalous dispersion method, and a molecular replacement method. First, the heavy metal substitution method is to collect data by replacing several crystals with heavy metals, and then analyzing the information to obtain phase information. Second, multiwavelength spectroscopy is one of the technologies widely used to obtain phase information after collecting data by using anomalous atoms at various wavelengths using specific metals or atoms in the crystals instead of heavy metals. In other words, without the hassle of collecting data from various determinations, the amino acid methionine can be easily replaced with selenium-methionine (Se-Met) by using a molecular biological method from one crystal to easily obtain data using this selenium atom. Has to be obtained only from the synchrotron radiation. Third, the structure replacement method is a method to solve the phase problem from a similar structure already known. This is a widely used method as the known structure increases. After obtaining each structure from the data, The refinement step process is performed. This process is performed by using various known programs (CCP4, Coot, Quanta, CNS, etc.), and standardization processes such as angle and coupling length are required. In this process, The process of fitting to the obtained electron density map is repeatedly performed. In the analysis stage after the structure refinement, various information can be inferred from the structure, and research on the mechanism based on the structure in the analysis stage can be conducted. It is the basis for obtaining branch information. In addition, the structure of the complex with the modulating compound for the protein can be directly related to the residues, providing important information for the next step in the study of regulatory compounds.

In the present invention, the phase information of the LOG ( Cg LOG) protein structure derived from Corynebacterium glutamicum was obtained using the molecular substitution method, and the atomic coordinates of the Cg LOG protein are shown in Table 1 below.

Specifically, the present invention relates to a method of mixing a protein solution containing (i) a Cg LOG protein and (ii) a reservoir solution containing malic acid and PEG (polyethylene glycol) ( Cg LOG) protein derived from Corynebacterium glutamicum, comprising the step of crystallizing LOG ( Cg LOG) protein, which comprises crystallizing the LOG ( Cg LOG) protein.

Such a crystal can be produced by various known crystallization methods, and can be performed by a vapor-diffusion method, more specifically, a hanging-drop vapor-diffusion method , But is not limited thereto.

In the vapor diffusion method, the protein solution is brought into equilibrium with a large water-soluble reservoir solution having a concentration of precipitant suitable for producing crystals. Generally, the purified protein solution is mixed with an equal volume of reservoir solution to bring the concentration of the precipitant to about half that required for crystallization, and the solution is suspended above the reservoir under a closed cover slip or attached to the top of the container. Then, the sealed container is left for 1 day to 1 year, usually for 2 to 6 weeks, so that the crystal becomes large. Specifically, the vapor diffusion method causes water or other volatile substances to migrate between a small droplet of the mother liquid and a much larger reservoir solution in an enclosed space while separating them, and the super saturated , And the crystallization method using the precipitation of the protein in accordance with the change of the precipitant in the thermodynamically metastable state. When the protein is precipitated, the rate is slowed down to a stable crystallization state. What is known as a precipitant serves to reduce the solubility of the protein solution in the concentrated state. In order to reduce the relative adsorption layer around the protein molecule, They gather together and this forms crystals.

The reservoir solution is mixed with various concentrations of such precipitants, buffers, salts, and detergents. The protein solution and the reservoir solution of these various conditions usually mix with each other at a ratio of 1: 1 to form droplets , And the thus obtained droplets are placed and sealed. At this time, the concentration of the protein in the droplet differs from the concentration of the reservoir solution in the initial stage, so that the protein does not exist in a crystalline state. When it is left in such a sealed state, the equilibrium is gradually made, and crystals are formed under the condition of a specific state by the above-described principle. Particularly, the droplet mixed vapor diffusion method is a method of providing a crystal of sufficient size to analyze the protein structure. The droplet mixing vapor diffusion method attaches the sample containing reagent and pure reagent in liquid state to the top of the vessel in vapor equilibrium. The sample contained in the sample is dropped into the container so that the sample with a smaller reagent content than the container reaches equilibrium, so that the water contained in the sample is removed until the concentration with the liquid reagent becomes equal, Can be obtained.

In such a vapor diffusion method, the kind and proper concentration of salt, buffer and surfactant, the pH of the solution and the temperature of the test as well as the precipitant in the reservoir solution are selected depending on the type of the protein, and in some cases, It becomes an important factor.

Accordingly, the present invention provides a method of crystallizing an optimized Cg LOG protein to bring the crystal form of Cg LOG protein.

Specifically, the Cg LOG protein crystallization method of the present invention comprises (i) a protein solution containing 50 to 150 mg / ml, specifically 60 to 120 mg / ml of Cg LOG protein; (ii) a water tank solution containing 0.1 to 0.3 M, specifically 0.2 M malic acid and 15 to 35% (v / v), specifically 24% (v / v) PEG, , But is not limited thereto.

When the protein solution is mixed into the reservoir solution, the reservoir solution and the protein solution are mixed in a ratio of 1: 1, but the present invention is not limited thereto.

Further, by attaching the mixed solution under a cover slip sealed to reservoir top, or top of the vessel, as described above, and so as to increase the crystal, when the non-limiting examples 1 to 7, in detail the two days appropriate Cg LOG Protein crystals can be obtained.

In a specific embodiment of the present invention, 1.0 μl of a protein solution containing a Cg LOG protein at a concentration of 90 mg / ml was diluted with 1.0 ml containing 0.2 M DL-malic acid, pH 7.0 and 24% PEG 3350 Mu] l of the reservoir solution, and then the resulting solution was mixed with 0.5 ml of the reservoir solution to prepare crystals by a droplet mixed vapor diffusion method. Two days after placing the sealed container, a crystal of excellent quality of a maximum size of about 0.3 x 0.3 x 0.1 mm was obtained (Example 1-2).

In another specific embodiment of the present invention, the crystal of the Cg LOG protein is obtained, and after x-ray analysis thereof, the structure of the Cg LOG protein is identified through molecular replacement.

Specifically, the Cg LOG protein comprises two dimers (FIG. 2), constituting a pocket functioning as an active site through the dimerization, and a conserved "PGG _X GT _XX E" motif on the surface of the pocket (FIG. 5). These Cg LOG proteins are structurally similar to other biologically derived LOG proteins and have high homology to the amino acid sequence and have no lysine decarboxylase (LDC) activity, but phospholipid hydrolase phosphoribohydrolase activity was confirmed to be high, it was confirmed to function as LOG (FIG. 6).

Another embodiment provides a method of screening for an activity modulator of the Cg LOG protein.

More specifically, the present invention comprises (a) four corridor having the atomic coordinates shown in Table 1 tumefaciens glutamicum (Corynebacterium glutamicum) Origin of LOG (Cg LOG) using a three-dimensional structure of the protein Cg LOG protein activity regulatory candidate peptide Or a Cg LOG protein binding candidate compound; And (b) a method for screening of modulators of the activity, Cg LOG protein comprising the step of verifying whether or not the step (a) is produced or selected candidate compounds or peptides in step modulates the activity of Cg LOG protein.

The atomic coordinates for the Cg LOG protein can be stored in a medium for subsequent use with a computing device such as a computer. Typically, the coordinates may be stored in a medium useful for storing large amounts of data, such as magnetic or optical media (i.e., floppy disks, hard disks, compact disks, magneto-optical media or electronic media, etc.). The selection of computers, storage media, networking and other devices or technologies in this regard will be familiar to those skilled in the art of structural / computational chemistry.

In addition, based on the three-dimensional structure of the Cg LOG protein identified in the present invention, a computer-readable medium containing data on atomic coordinates and / Information can be provided.

The step (a) of the screening method includes (i) designing a tertiary structure of Cg LOG protein using the atomic coordinates shown in Table 1; And (ii) generating or screening a Cg LOG protein activity modulating candidate peptide or Cg LOG protein binding candidate compound using the designed tertiary structure.

The step (i) may further comprise the steps of: inputting data on atomic coordinates and the like to the tertiary structure of the proteins on a computer together with an appropriate software program; And a three-dimensional protein structure capable of visualization and further computer manipulation.

The step (ii) may be performed through a molecular docking simulation, for example, AutoDock, GOLD (Genetic Optimization for Ligand Docking), FlexX (Flexible docking using an incremental construction algorithm) (Internal Coordinate Mechanics), and the like, but the present invention is not limited thereto.

In addition, the screening method of the present invention includes the step of (b) judging whether the Cg LOG protein regulatory candidate peptide or compound produced or selected in the step (a) regulates the activity of the Cg LOG protein.

If the above in step (b), the candidate substance inhibits the activity of Cg LOG protein, which can determine the active inhibitors of Cg LOG protein, if the candidate compound increases the activity of the LOG protein Cg Cg LOG protein activator.

In addition, the screening method can further screen a substance having a greater ability to regulate Cg LOG protein activity than the Cg LOG protein activity modulator screened in step (b) using the designed tertiary structure, Which can be used to identify substances with a moderating effect on the Cg LOG protein.

Yet another object of the present invention is to provide a method for producing Corynebacterium glutamicum by culturing Corynebacterium glutamicum in a medium; And recovering the cytokinin from the cultured microorganism or culture medium. The present invention also provides a method for producing cytokinin.

The term "cultivation" of the present invention means that the microorganism is grown under moderately artificially controlled environmental conditions. The culturing process of the present invention can be carried out according to a suitable culture medium and culture conditions known in the art. Conditions such as the specific culture temperature, incubation time, and pH of the medium can be carried out according to the general knowledge of the person skilled in the art or according to conventionally known methods and can be suitably adjusted accordingly. In addition, the culture method may include a batch culture, a cintinuous culture, and a fed-batch culture, and specifically, a batch process or an injection batch or a repeated batch process or a repeated fed batch process, but is not limited thereto.

In the present invention, the medium may include an activity modulator screened through a screening method of an activity modulator of the Cg LOG protein of the present invention. Specifically, the activity modulator may be a peptide or a compound, but is not limited thereto. In addition, the activity regulator may be a Cg LOG protein activator that enhances the activity of the Cg LOG protein, thereby increasing cytokinin production capacity of Corynebacterium glutamicum.

The medium used for culturing should meet the requirements of a specific strain in an appropriate manner and the carbon sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, Oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil and the like, fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Examples of nitrogen sources that may be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate , The nitrogen source may also be used individually or as a mixture, but is not limited thereto. Potential for use may include potassium dihydrogenphosphate or dipotassium hydrogenphosphate or the corresponding sodium-containing salts and the like. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth. Finally, in addition to these materials, essential growth materials such as amino acids and vitamins can be used. In addition, suitable precursors may be used in the culture medium. The raw materials may be added to the culture in a batch process, either batchwise or continuously, in an appropriate manner, but are not limited thereto.

Also, during culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid may be added to the culture in an appropriate manner to adjust the pH of the culture. During the culture, defoaming agents such as fatty acid polyclicol esters can be used to inhibit the formation of bubbles. In order to maintain the aerobic state of the culture, it is also possible to inject oxygen or oxygen-containing gas into the culture or to inject nitrogen, hydrogen or carbon dioxide gas without injecting gas to maintain anaerobic and microorganism conditions.

The temperature of the culture is usually 27 ° C to 37 ° C, specifically 30 ° C to 35 ° C. The incubation period may be continued until the desired amount of useful material is obtained, and may be 10 to 100 hours. Cytokinin may be released into the culture medium or contained in microorganisms.

In addition, methods for recovering cytokinin from the microorganism or the culture medium are well known in the art. For example, filtration, anion exchange chromatography, crystallization and HPLC may be used, but the present invention is not limited thereto.

Since the Cg LOG protein is an enzyme that produces a biologically available cytokinin, the crystals of the Cg LOG protein, the method of crystallizing the protein, and the tertiary structure thereof provide the cytokinin production efficiency Lt; RTI ID = 0.0 > Cg LOG < / RTI >

Figure 1 shows a cartoon diagram of the tetrameric structure of Cg LOG in I 222 crystals. The interaction between the two dimers is shown, and each polypeptide is labeled with a different color. Phosphate molecules bound to K194 and Mol II from Mol III were labeled with blue and orange rod models, respectively. Hydrogen bonds between K194 and phosphate molecules are shown in dashed lines.
Figure 2 shows the results of SAXS analysis of Cg LOG in aqueous solution. A is plotted (Guinier plot) in guinea of x- ray distribution profile Cg LOG protein, B is a x- ray distribution profile Cg LOG protein. The open symbols represent the experimental data and the red line shows the x-ray distribution profile derived from the dummy atom model with the lowest χ ² = 0.027 value by the DAMMIF program. The bar blue line shows the SAXS curve of the theory calculated from the dimer crystal structure of the Cg LOG protein using the CRYSOL program. The difference between the experimental and theoretical lines (χ ² ) was 0.348. C is a pair distance distribution p ( r ) function for the Cg LOG protein, which is based on the analysis of experimental SAXS data using the GNOM program. D shows the 3D model structure of Cg LOG.
Figure 3 shows the overall structure of Cg LOG. A is a schematic diagram showing the biosynthetic pathway of cytokinin production. B shows the amino acid sequence of LOG and the element of secondary structure was confirmed based on the structure of Cg LOG. The residues associated with the catalyst and AMP linkage are shown in red and blue, respectively; Residues related to prenyl-group bonding are represented by the orange triangles. PGG _X GT _XX E motifs are separated by a purple dotted rectangle. Cg LOG, Mt LOG, At LOG, Os LOG, and Cp LOG is an abbreviation for LOG derived from Corynebacterium glutamicum , Mycobacterium tuberculosis , Arabidopsis thaliana , Oryza sativa , and Claviceps purpurea , respectively. C is a cartoon diagram showing the monomer structure of Cg LOG, It is an image superimposed with LOG ( Mm LOG) originating from Mycobacterium marinum . The combined AMPs are shown in the apo form of Cg LOG. D is a cartoon diagram showing the dimer structure of Cg LOG, and the structure below is the structure rotated 90 degrees horizontally. The combined AMP molecule is as shown in C above.
4 shows the dimer interface of Cg LOG. One monomer is represented by an electrostatic potential surface model, and the other monomer is represented by a cartoon diagram. The lower image is the upper image rotated 90 ° in the vertical direction. Three helixes were displayed in the dimer.
Figure 5 shows amino acids conserved in the LOG. The CgLOG structure is represented by a surface diagram using lines. The degree of conservation of amino acids is indicated by different colors, and the active sites are indicated by circles with dashed lines.
6 is a graph and an image showing the enzyme activity of Cg LOG. A is a graph showing the results of LDC (lysine decarboxylase) assay of Ec CadA and Cg LOG, and activity was measured in the presence or absence of PLP. All experiments were performed independently three times. B and C show the phosphorobohydrolase activity of Ec CadA (B) and Cg LOG (C). The activity was detected by reacting the reaction mixture in the form of dots on TLC. AMP and adenine standards were indicated, and the reaction incubation time was described at the bottom of the figure.
Figure 7 shows the active site of Cg LOG. A is a cartoon diagram showing the conformation of the Cg LOG AMP binding site. The residues associated with AMP binding are shown in linear form and bound glycerol and phosphate molecules in rod form. The hydrogen bonds associated with stabilization of the glycerol and phosphate molecules are shown in red dotted lines. The PGG _X GT _XX E motif is shown in green, and the covalent bond between the adenine-N ⁹ and ribose-C ¹ hydrolyzed by the enzyme is marked with an asterisk. B is an image showing the results of a position-directed mutagenesis experiment. AMP and adenine standards were indicated. C shows the prenyl-group binding position, and the Cg LOG structure overlapped with At LOG3. The bound AMP molecule was represented by a magenta rod model and the residues related to the arrangement of the two enylic residues (R39 and E122 in the Cg LOG) and the prenyl-group binding site were the gray and blue lines at Cg LOG and At LOG, Respectively. The potential prenyl-group binding sites are represented by the blue circle.
Figure 8 shows the electron density map of bound phosphates and glycerol molecules, and the Cg LOG structure is shown in a cartoon diagram. The "PGG _X GT _XX E" motifs located at the active site were green. An electron density map, in which the phosphate and glycerol molecules are combined, is indicated by a blue net and outlined by 1.2 σ.
Figure 9 shows the results of structural comparison of other LOG and Cg LOG. A shows the result of comparing the overall structure. The monomer structures of Cg LOG, At LOG, Cp LOG, and Mm LOG were superimposed and represented by cartoon diagrams of gray, blue, orange and green, respectively. The AMP molecule combined with the Mm LOG structure is represented by a magenta rod model. The N-terminus and the C-terminus of LOG were indicated. The structural differences found in the Cp LOG are represented by red dotted circles, and the crooked connection loop of α3-β4 at At LOG3 is represented by the dotted blue line. B shows the structural comparison of AMP binding sites. The residues of the four LOGs related to AMP binding are represented by the line model and indicated by the color as indicated by A above. The "PGG _X GT _XX E" motifs in the LOG are shown in red. C shows the structural comparison of the prenyl-group binding sites. The residues of the four LOGs related to the arrangement of the potential prenyl-group binding sites are indicated by the line model and are indicated by the color as indicated in A. above.

Hereinafter, the present invention will be described more specifically in the following examples. However, these examples are provided only to aid understanding of the present invention, and the present invention is not limited thereto.

Example  1. Experimental Method

Example  1-1. Cg LOG  Protein expression and purification

Corynebacterium < RTI ID = 0.0 > glutamicum ) The gene Cg 2612 (or Cg LOG) of LOG derived from ATCC 13032 was amplified by PCR from the chromosome of C. glutamicum . At this time, a primer having a sequence of SEQ ID NO: 1 (forward, 5'-GCGC CATATG ACTTCGCTTTTCGACGCCCC-3 ') and SEQ ID NO: 2 (reverse, 5'-GCGC CTCGAG CCATTTTGGTGCTGGTGGAGTCC-3') was used.

The PCR product was subcloned into pET30a (Novagen) having 6xHis at the C-terminus. The transformed E. coli BL21 (DE3) into which the vector was introduced was inoculated in LB medium containing 100 mg / L kanamycin And cultured until the OD600 reached 0.6. After induction with 1.0 mM IPTG (1-thio- [beta] -D-galactopyranoside), the cells were further cultured at 18 [deg.] C for 20 hours. The culture was centrifuged at 5,000 xg for 15 minutes and at 4 DEG C to obtain cell pellets, resuspended in cold A buffer (50 mM Tris-HCl, pH 8.0) and sonicated. Cell debris was removed by centrifugation at 11,000 xg for 1 hour and the lysate was bound to a Ni-NTA agarose column (Qiagen). After rinsing with A buffer containing 20 mM imidazole, the bound protein was eluted with 500 mM imidazole in A buffer. Additional purification was performed by HiTrap Q ion exchange chromatography and size exclusion chromatography, and the purified protein was concentrated to a concentration of 30 mg / ml in 50 mM Tris-HCl, pH 8.0 and stored at -80 [deg.] C. Herein, the information on the kind of microorganism, vector type, sequence, etc. used for Cg LOG protein expression is summarized in Table 2 below.

On the other hand, the production and purification of Cg LOG position-designating mutants and CadA derived from Escherichia coli were prepared in the same manner as described above.

Microbial species Corynebacterium < RTI ID = 0.0 > glutamicum ) DNA type Chromosomal DNA Omni-directional primer 5'-GCGC CATATG ACTTCGCTTTTCGACGCCCC-3 '(SEQ ID NO: 1) Reverse primer 5'-GCGC CTCGAG CCATTTTGGTGCTGGTGGAGTCC-3 '(SEQ ID NO: 2) Cloning vector pET30a Expression host Escherichia coli BL21 (DE3) The base sequence of the Cg LOG gene 5'-ttaccattttggtgctggtggagtccaggtctgcattgcctttagcagggcatgcgggtcggattccacgatgaggcactcaaagaagtctcgcttgataaatccacgctgggtcatctgctcaagcatttccagcaggggctgccaaaaaccatcgacatcataaagtgcgacgggcttttgatgaatgcccagctgttgccaggtccagacctcgaaaagttcttccaaggtgccggcgccaccgggcatggcgataaaaccatcgccaagttctgccatgcgacgcttgcggatgtgcatatcaggaacgatttcaagttcggtgagcttttcatgcccaagctcacccttcataagtgattccgtgatgacgccaaaggcttcgccacctgattccaggaacgcatccgcgacgatacccatgagccccacttttccgccaccgtaaaccaagtcgatgccgcggtctaccgcggttttcgccaaggtttgagccgcttgcgtgtacagcgaggaactgccgagcgccgagcccgtgaaaacggtgacgcgttggagggttggggcgtcgaaaagcgaagtcat-3 '(SEQ ID NO: 3) The amino acid sequence of the Cg LOG protein MTSLFDAPTLQRVTVFTGSALGSSSLYTQAAQTLAKTAVDRGIDLVYGGGKVGLMGIVADAFLESGGEAFGVITESLMKGELGHEKLTELEIVPDMHIRKRRMAELGDGFIWGWGQLTHELDVWTWQQLGIHQKPVALYDVDGFWQPLLEMLEQMTQRGFIKRDFFECLIVESDPHALLKAMQTWTPPAPKW (SEQ ID NO: 4)

Example  1-2. Cg LOG  Preparation of protein crystals

The crystallization of the Cg LOG protein purified through Example 1-1 was carried out by a hanging-drop vapor-diffusion method at 20 ° C. and a sparse- matrix screens. Each experiment consisted of mixing 1.0 μl of protein solution and 1.0 μl of reservoir solution and equilibration to 0.5 ml of reservoir solution.

At the end of several optimization steps using the mixed vapor diffusion method, when the reservoir solution composed of 0.2 M DL-malic acid, pH 7.0 and 24% PEG 3350 was used, it was found to be about 0.3 x 0.3 x 0.1 mm of the protein crystals. To protect the crystals at low temperature, a reservoir solution containing 30% glycerol was used.

Example  1-3. Cg LOG  Determination of protein structure

Results related to protein crystals were collected using a 7A beamline from Pohang Accelerator Laboratory (PAL, Pohang, Korea) and a QUANTUM 270 CCD detector (San Diego, CA, USA) at 1 A resolution. The Cg LOG crystals were diffracted at a resolution of 2.3 Å. The data was indexed, integrated, and scaled using the HKL2000 suite (Otwinowski & Minor, 1997).

The structure of Cg LOG was identified by molecular substitution method using MOLREP and LOG ( At LOG, PDB CODE 2A33) of A. thaliana was used as a retrieval model. The model was created using the WinCoot program and rearranged using REFMAC5 . The statistics of the data are shown in Table 3 below. A refined model of Cg LOG was published in the Protein Data Bank (PDB CODE 5 IT).

Example  1-4. SAXS  How to measure

Small-angle x-ray scattering (SAXS) measurements were performed using a 4C SAXS II beamline from the Pohang Accelerator Laboratory (Pohang, Korea). A sample-to-detector distance (SDD) of 4.00 m and a distance of 1.00 m for SAXS were used. The scale of the dispersion vector ( q = (4 / λ ) sin) was 0.1 nm ^-1 < q <6.50 nm ^-1 , where 2 θ is the angle of dispersion and λ is the wavelength of the x-ray beam. All dispersions were performed at 4 [deg.] C using an FP50-HL refrigerated circulator (JULABO, Germany). Data were collected at intervals of 0.1 min from six consecutive frames monitoring each radiation injury. Cg LOG was measured at a low concentration of 0.5 to 4.5 mg / ml. Each 2D SAXS pattern was averaged at the radial center of the beam and normalized to the intensity of the transmitted x-ray beam measured with a scintillation counter placed after the radiation sample. R _{g and} radius of gyration ( _G ) values were estimated from distributed data using Guinier analysis. The molecular weight (molecular mass; MM) was calculated from the dispersion cuff based on Q _R Method pair distance distribution (pair distance distribution; p (r )) function GNOM indirect Fourier transform (Fourier transform) using Programs of the method Lt; / RTI &gt;

Example  1-5. 3D structure SAXS  Model Configuration

To construct the SAXS model of the 3D structure, ab initio DAMMIF, a structural analysis program, was used. For each model configuration, five independent models were selected and averaged using the DAMAVER program. SAXS curves were calculated from the atomic model using the CRYSOL program. For comparison of the overall shape and dimension, the ribbon diagram of the atomic crystal model was superimposed on the reconstructed dummy atom model using the SUPCOMB program.

The contents confirmed by the above examples are summarized in the following experimental examples.

Experimental Example  1. Protein crystal X-ray analysis

Cg 2612 (or Cg LOG) The structure of the enzyme was identified to clarify the function of the protein.

First, the crystal of the protein was analyzed at a resolution of 2.3 Å. As a result, it was confirmed that the crystals of Cg 2612 belong to the space group I 222 having unit cell dimensions a = 113.51 Å, b = 130.50 Å, and c = 140.51 Å in the I-centered orthorhombic system. It has been confirmed that the Cg 2612 molecule per each asymmetric unit has a volume of crystallite per unit of protein mass of about 3.10 Å Da ^{-1 and} that it has a solvent content of about 60.31%.

Experimental Example  2. Cg LOG  Structure and activity analysis of proteins

Experimental Example  2-1. Cg LOG  The overall structure of proteins

Cg 2612 The structure of the enzyme was identified to clarify the function of the protein.

As a result, as shown in FIG. 1, it was confirmed that Cg 2612 contained two separated dimers. Molecules I, II, III, and IV of Cg 2612 contained each of the 9-191, 3-195, 3-190, and 2-195 residues observable on an electron density map. In particular, it was confirmed that Lys194 derived from one dimer interacts with phosphate at the active site of the other dimer, and crystallization compression of the I 222 space group results in the arrangement of tetramers as an artificial product. From the results of SAXS in Table 4, it was confirmed that Cg 2612 is a dimer state, and the dimer crystal structure of Cg 2612 was confirmed to fit the SAXS 3D-structure model (FIG. 2).

On the other hand, as can be seen in FIGS. 3B and 3C, it was confirmed that the monomer structure of Cg 2612 exhibited α / β folding belonging to the Rossmann fold, and the 7 parallel strands of β-strand It has been confirmed that the central β-sheet formed is surrounded by eight α-helices.

In addition, as shown in FIG. 3 D and FIG. 4, the dimerization of Cg 2612 showed dense domain folding, the interface of dimerization mainly consisting of α5- and α6-helix, and α4- And it is confirmed that it supports dimerization. The area of the buried interface was found to be 1,563 Å (average of AB dimer and CD dimer), and it was confirmed by PISA that the residue contained in this portion was about 24.5%. The dimerization of the two polypeptides constituted a pocket functioning as an active site, confirming that a conserved "PGG _X GT _XX E" motif was present on the surface of the pocket (FIG. 5).

Experimental Example  3. Cg LOG  Characterization using protein structure

Experimental Example  3-1. Identification of function through structure comparison

Through structural comparison using DALI server, the structure of Cg 2612 is similar to LOG3 ( At LOG3, PDB CODE 2A33, Z-score 29.4) and LOG8 ( At LOG8, PDB CODE 1YDH, z-score 30.4) of A. thaliana Respectively. In addition, it was confirmed that C. purpurea ( Cp LOG, PDB CODE 5AJT, Z-score 26.8) and M. marinum ( Mm LOG, PDB CODE 3SBX, Z-score 27.7) were structurally similar to Cg 2612. It was also found that this structural homology shares more than 33% of the same amino acids as Cg 2612. Proteins structurally similar to Cg 2612 are LOG proteins, and Cg 2612 functions as a LOG through not only the structure of the proteins but also the high similarity of amino acid sequences.

Experimental Example  3-2. Lee Sin Decarboxylation  Enzyme (lysine decarboxylase ; LDC ) Activity analysis

LOG is the LDC activity is reported as having the (Kukimoto-Niino, M. et al ., Protein Sci., 13, 3038-42, 2004), LDC activity of Cg 2612 to investigate the biochemical functions of Cg 2612 Respectively.

For this, an LDC assay was performed and the results were compared with the E. coli-derived lysine decarboxylase ( Ec CadA). Specifically, the LDC activity was confirmed by measuring the residual concentration of L-lysine using lysine oxidase and peroxidase. After LDC reaction, lysine oxidase to remain in the lysine 6-amino-2-oxohexanoate, NH 3, and converted to H ₂ O _2, and by the multidrug H ₂ O ₂ is a peroxy ABTS (2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid), and the reduced ABTS was detected at 412 nm absorbance by spectrophotometric method. The assay was performed using 100 mM phosphate, pH 6.0, 0.1 M L-lysine , 0.2 mM pyridoxal-5-phosphate and 25 μg of purified enzyme at 30 ° C. The reaction mixture was heated at 100 ° C. for 5 minutes to terminate the reaction. × g for 1 minute, 2 × reaction solution containing 0.1 unit / ml of lysine oxidase and 1 unit / ml peroxidase in phosphate buffer was added to the reaction mixture.

As a result, as shown in FIG. 6A, it was confirmed that Cg 2612 showed no lysine decarboxylase activity, while Ec CadA showed high activity. From the above results, it was found that Cg 2612 was not a lysine decarboxylase.

Experimental Example  3-3. Phospholipohydrolase ( phosphoribohydrolase ) Activity analysis

Phospholipids beam dihydro cyclase enzyme because it is the conversion of non-talkie between inactive base in the form of a base represents the biologically active, we analyzed the phospholipid beam dihydro cyclase activity of Cg 2612 to investigate the biochemical functions of Cg 2612.

Since AMP (adenosine monophosphate) was used as a substrate of phospholipid hydrolase, a natural cytokinin precursor could not be obtained, and since the AMP substrate was used in a previous study confirming the phospholipase hydrolase activity of LOG Samanovic, MI et al., Mol. Cell, 57, 984-94, 2015). In the present invention, AMP was also used. Specifically, the activity of the enzyme was confirmed by detecting an adenine ring compound separated by a thin layer chromatography (TLC) method. The enzyme reaction was carried out at 30 ° C using a mixture of 20 mM AMP, 36 mM Tris-HCl, pH 8.0, and 23 μM purified enzyme, and the reaction was terminated by heating at 95 ° C for 1.5 minutes. Thereafter, the reaction mixture was poured onto a PEI-cellulose-F plastic TLC sheet (Merck Millipore) in the form of a dot. The mobile phase was 1 M sodium chloride, placed in a TLC chamber and completely dried. Compounds containing an adenine-ring were detected in a UV lamp (290 nm).

As a result, as shown in FIG. 6B, it was confirmed that Cg 2612 had phospholipid hydrolase activity and increased activity over the reaction time. As the hydrolysis of AMP was observed from 30 minutes after the reaction, it was found that the activity of the enzyme was not very strong. On the other hand, as can be seen in Fig. 5C, Ec CadA did not show phospholipid hydrolase activity on the AMP substrate.

Since LOG exhibits a higher phospholipid hydrolase activity on natural cytokinin precursors than AMP (Hinsch, J. et al., Environmental Microbiology, 2015; Samanovic, MI et al., Mol. Cell, 57, 984 -94, 2015). As a result, it was found that Cg 2612 exhibited more excellent activity against natural cytokinin precursor than the activity against AMP confirmed in the present invention. From the above results, it was found that Cg 2612 is not an LDC family enzyme but belongs to the LOG family. Thus, Cg 2612 was named Cg LOG.

Experimental Example  4. Identification of cytokine production method of LOG

Experimental Example  4-1. Identify active site of LOG

Since the active site of the enzyme is a catalytic site, the active site and its structure have been confirmed in order to identify the production method of Cg 2612 (hereinafter referred to as Cg LOG) cytokine production.

As a result, as shown in Fig. 7A, it was confirmed that the active site of Cg LOG was located near the motif of "PGG _X GT _XX E &quot;, and the AMP stabilization of the Cg LOG by overlapping with the Mm LOG complexed with AMP Respectively. Phosphate moieties include the main chains of Gly116, Ala117 and Gly118; And Thr119 and Ser19, and that the ribose moiety mainly stabilizes the hydrogen bond interaction between Arg99 and the two hydroxy groups of the ribose moiety. In addition, to stabilize the adenine ring, the hydrophobic and hydrophilic residues of Met96, Lys100, and Glu121 form an adenine binding site, and the two catalytic residues Arg99 and Glu122 share a covalent bond between adenine-N ⁹ and ribose-C ¹ Lt; RTI ID = 0.0 &gt; hydrolyzed &lt; / RTI &gt; bond. In addition, among the residues associated with AMP binding and enzymatic catalysis, it was confirmed that Gly116, Ala117, Gly118, Thr119, Glu121, and Glu122 were located in the "PGG _X GT _XX E" motif.

From the above results, it can be seen that the motif functions as a nucleotide binding site. In addition, one phosphate and one glycerol molecule were bound to the AMP binding site, confirming that the molecules mimic the stabilization of the phosphate moiety and the ribose ring, respectively (FIGS. 7A and 8).

Experimental Example  4-2. Identification of substrate binding sites in LOG

A site-specific mutation was induced in the active site of the Cg LOG identified in Experimental Example 4-1 in order to confirm the association of AMP binding and residues to the enzyme catalyst.

As a result of substitution of alanine which is a residue essential for the catalytic function, it was confirmed that the phospholipid hydrolase activity was completely lost. However, as an exception, it was confirmed that the S19A mutation was more active than the wild type. It was confirmed that most residues related to AMP stabilization were conserved in all LOGs, and that the structure of the active site observed in Cg LOG was classified as LOG family enzyme.

On the other hand, despite the fact that the prenyl-group binding site has been revealed (Dzurova, L. et al., Proteins, 83, 1539-46, 2015) Stabilization of the prenyl group or the N ⁶ -modification moiety of the cytokinin precursor remains unidentified. Thus, the binding sites of N ⁶ -prenyl groups were identified through the arrangement of adenine moieties.

As a result, as shown in FIG. 7C, it was confirmed that Met96, His97, Lys100, Glu125, and Trp129 in the Cg LOG form a prenyl group binding site. It was also confirmed that these residues are the same as those found in At LOG3, Os LOG, and Cp LOG (FIGS. 3A and 7C). Through the above results, the present inventors confirmed that Cg LOG functions as a cytokinin-activating enzyme, and that the enzyme uses a cytokinin precursor similar to other LOGs derived from plant or plant-interacting fungi as a substrate.

Experimental Example  4-3. Other LOGs Cg With LOG  Structure comparison

In order to analyze the characteristics of the Cg LOG of the present invention in detail, other studies in which a lot of studies have been carried out, namely Arabidopsis thaliana , Claviceps purpurea ), or Mycobacterium tuberculosis The structure of LOG protein and Cg LOG of At LOG3, Cp LOG, or Mm LOG were compared.

As a result, it can be seen from FIG. 9A that although the four folds of the four LOG structures are similar to each other, Cp LOG shows a unique structural characteristic. When compared to the three other LOGs, the Cp LOG was found to have an additional helix at the C-terminal site and to include a linked loop of extended α3-β4 and α4-β5. Furthermore, it was confirmed that the extended connecting loop of? 3-? 4 was located near the AMP binding site.

However, as can be seen from FIG. 9B, in the Mm LOG, the site contained the Glu80 residue, confirming that it forms a hydrogen bond with the hydroxy group of the ribose ring. Based on the above results, it was confirmed that the C-terminal region varied according to the LOG, and the ribose ring was slightly different depending on each protein. Also, with the exception of the structural differences of the site, LOG has a similar AMP binding mode, confirming that the residues conserved in the "PGG _X GT _XX E" motif contribute to AMP stabilization like other conserved residues.

On the other hand, Mm LOG found an exception. In other LOGs, serine and glutamate contribute to AMP stabilization, whereas Ala19 and Asp120 are located in Mm LOG (Fig. 9B). The four LOGs had two catalytic residues and Arg99 and Glu122 of Cg LOG were located at the same location. From these results, it was confirmed that this LOG catalyzes the reaction through the same enzymatic mechanism.

In addition, LOG substrate specificity could be confirmed by comparison of prenyl group binding sites.

As can be seen in FIG. 9C, in Cg LOG, At LOG3 and Cp LOG contained residues of Met96, His97, Lys100, Glu125, and Trp129 at the prenyl group binding site. However, it was confirmed that Mm LOG shows a large difference at the prenyl-group binding sites when compared with Cg LOG, At LOG3, and Cp LOG. In the Mm LOG, the prenyl -group binding site was found to contain Asp124, Glu128, and Trp96 residues at the sites of glutamate, tryptophan, and histidine residues, unlike the other three LOGs.

The results show that Cg LOG will produce cytokinins similar to those produced from LOGs derived from plant or plant-interacting fungi. However, Mm LOG will produce a different type of cytokinin than Cg LOG, At LOG3 and Cp LOG, which means that mammalian-interacting bacteria such as Mycobacterium genus can be used to produce other types of cytokinins Could know.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Method for crystallization of CgLOG protein <130> KPA160339-KR <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gcgccatatg acttcgcttt tcgacgcccc 30 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gcgcctcgag ccattttggt gctggtggag tcc 33 <210> 3 <211> 588 <212> DNA <213> Artificial Sequence <220> <223> CgLOG cDNA <400> 3 ttaccatttt ggtgctggtg gagtccaggt ctgcattgcc tttagcaggg catgcgggtc 60 ggattccacg atgaggcact caaagaagtc tcgcttgata aatccacgct gggtcatctg 120 ctcaagcatt tccagcaggg gctgccaaaa accatcgaca tcataaagtg cgacgggctt 180 ttgatgaatg cccagctgtt gccaggtcca gacctcgaaa agttcttcca aggtgccggc 240 gccaccgggc atggcgataa aaccatcgcc aagttctgcc atgcgacgct tgcggatgtg 300 catatcagga acgatttcaa gttcggtgag cttttcatgc ccaagctcac ccttcataag 360 tgattccgtg atgacgccaa aggcttcgcc acctgattcc aggaacgcat ccgcgacgat 420 acccatgagc cccacttttc cgccaccgta aaccaagtcg atgccgcggt ctaccgcggt 480 tttcgccaag gtttgagccg cttgcgtgta cagcgaggaa ctgccgagcg ccgagcccgt 540 gaaaacggtg acgcgttgga gggttggggc gtcgaaaagc gaagtcat 588 <210> 4 <211> 195 <212> PRT <213> Artificial Sequence <220> <223> Recombinant CgLOG <400> 4 Met Thr Ser Leu Phe Asp Ala Pro Thr Leu Gln Arg Val Thr Val Phe   1 5 10 15 Thr Gly Ser Ala Leu Gly Ser Ser Ser Leu Tyr Thr Gln Ala Ala Gln              20 25 30 Thr Leu Ala Lys Thr Ala Val Asp Arg Gly Ile Asp Leu Val Tyr Gly          35 40 45 Gly Gly Lys Val Gly Leu Met Gly Ile Val Ala Asp Ala Phe Leu Glu      50 55 60 Ser Gly Gly Glu Ala Phe Gly Val Ile Thr Glu Ser Leu Met Lys Gly  65 70 75 80 Glu Leu Gly His Glu Lys Leu Thr Glu Leu Glu Ile Val Pro Asp Met                  85 90 95 His Ile Arg Lys Arg Arg Met Ala Glu Leu Gly Asp Gly Phe Ile Ala             100 105 110 Met Pro Gly Gly Ala Gly Thr Leu Glu Glu Leu Phe Glu Val Trp Thr         115 120 125 Trp Gln Gln Leu Gly Ile His Gln Lys Pro Val Ala Leu Tyr Asp Val     130 135 140 Asp Gly Phe Trp Gln Pro Leu Leu Glu Met Leu Glu Gln Met Thr Gln 145 150 155 160 Arg Gly Phe Ile Lys Arg Asp Phe Phe Glu Cys Leu Ile Val Glu Ser                 165 170 175 Asp Pro His Ala Leu Leu Lys Ala Met Gln Thr Trp Thr Pro Pro Ala             180 185 190 Pro Lys Trp         195

Claims (11)

(i) a protein solution containing a Cg LOG protein and (ii) a reservoir solution containing malic acid and PEG (polyethylene glycol) are mixed with each other to form a hanging-drop vapor-diffusion method ) by including a crystallization step, Corynebacterium glutamicum (Corynebacterium glutamicum- derived LOG ( Cg LOG) protein.
The method of claim 1, wherein the concentration of the Cg LOG protein is 50 to 150 mg / ml.
The method of claim 1, wherein the concentration of malic acid is between 0.1 and 0.3 M.
The method of claim 1, wherein the concentration of PEG is from 15 to 35% (v / v).
The method of claim 1, wherein the pH of the reservoir solution is from 6 to 8.
(a) Using the tertiary structure of the LOG ( Cg LOG) protein derived from Corynebacterium glutamicum having the atomic coordinates shown in Table 1, the Cg LOG protein activity regulatory candidate peptide or Cg LOG protein binding candidate Generating or selecting a compound; And
(b) wherein (a) generating or screening candidate peptides or compound in step is a screening method for the active control agent of Cg LOG including the steps to determine whether to adjust the activity of the protein, Cg LOG protein.
7. The method of claim 6, further comprising screening for a substance having a greater ability to modulate the activity of the Cg LOG protein than the activity modulator of the Cg LOG protein screened in step (b) using the tertiary structure How, one.
Corynebacterium &lt; RTI ID = 0.0 &gt; glutamicum ) in a medium; And recovering cytokinin from the cultured microorganism or culture medium. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt;
9. The production method according to claim 8, wherein said medium comprises an activity modulator screened through the screening method of claim 6 or 7.
9. The method of claim 8, wherein the activity modulator is a peptide or a compound.
9. The method of claim 8, wherein said activity modulator is an activator of a Cg LOG protein.

Images