KR20180113441A - Recombinant microorganism producing 5-Aminolevulinic acid and method of producing 5-Aminolevulinic acid using the same - Google Patents

Abstract

The present invention relates to a recombinant microorganism producing 5-aminolevulinic acid and a method for producing 5-aminolevulinic acid using the same. More specifically, the present invention relates to a recombinant microorganism which ensures enhanced productivity of 5-aminolevulinic acid by precisely regulating expression of a gene involved in central carbon flow and optimizing the carbon flow to the production of 5-aminolevulinic acid. The present invention further relates to a method for producing 5-aminolevulinic acid using the same. According to the present invention, when expression of aceA, which is a gene involved in a glyoxylate circuit, is precisely regulated, it is possible to produce recombinant microorganisms capable of optimizing carbon for ALA production and maximizing ALA productivity and cell mass without experiencing the intracellular metabolic imbalance which is a conventional problem. In addition, since ALA can be produced from glucose with high efficiency by using the recombinant microorganism, the recombinant microorganism can be widely applied in various industries where ALA is utilized.

Description

The present invention relates to a recombinant microorganism producing 5-aminolevulinic acid and a method for producing 5-aminolevulinic acid using the same,

The present invention relates to a recombinant microorganism producing 5-aminolevulinic acid and a method for producing 5-aminolevulinic acid using the recombinant microorganism. More particularly, the present invention relates to a method for producing 5-aminolevulinic acid, Aminolevulinic acid and a method for producing 5-aminolevulinic acid using the recombinant microorganism.

5-Aminolevulinic acid (ALA) is a non-proteinaceous amino acid that can be naturally produced in a variety of organisms across bacteria, yeast, animals and plants. This ALA is used in the synthesis of tetrapyrrole, heme, chlorophyll, and vitamin B12 in each organism. Even in vitro, ALA can be used as a naturally degrading herbicide, insecticide, growth regulator, and recently, ALA has been attracting attention as it can be used in tumor localization and photodynamic diagnosis.

The commercial production of ALA is largely dependent on several chemical methods, but these methods are very expensive due to their extremely low yields because they involve very complex process steps. On the other hand, since ALA has properties that can be synthesized naturally in various organisms, ALA production using microorganisms has been studied as an alternative method of chemical production method, which is advantageous in terms of price competitiveness and process design as compared with chemical methods .

ALA can be biosynthesized through two pathways from precursors of TCA (tricarboxylic acid) circuits. Among them, the C4 synthesis pathway exists mainly in mammals, birds, yeast, some photosynthetic bacteria, and synthesizes ALA through the condensation reaction of glycine with succinylcoenzyme A. Although many ALA production methods have been suggested using this pathway, low activity of biosynthetic enzymes and imbalance in supply of precursors have been major obstacles to high production of ALA.

On the other hand, another C5 synthetic pathway exists in many bacteria, including E. coli, and glutamate acts as a precursor to glutamyl-tRNA synthethase, NADPH-dependent glutamyl-tRNA reductase (NADPH- tRNA reductase) and glutamate-1 semialdehyde aminotransferase (glutamate-1 semialdehyde aminotransferase). Since the activity of the ALA biosynthetic enzymes in the C5 synthetic pathway is regulated by the heme complex, it is not possible to achieve high ALA production through overexpression of simple ALA biosynthesis enzymes. Mutagenesis of glutamyl-tRNA reductase is known to be an effective way to overcome this. In addition, simultaneous expression with glutamate-1-semialdehyde aminotransferase promoted ALA production at 2052.29 mg / L for 48 hours have. In addition, expression of an RNA fragment that regulates the expression of threonine / homoserine transporter or regulates the heme synthesis pathway is known as another method for increasing ALA productivity. In general, various methods have been studied to increase the activity of ALA biosynthetic enzymes for ALA production, or to minimize feedback control.

On the other hand, redistribution of carbon flow in upstream metabolic circuits can be a new method for improving ALA productivity. In recent years, there has been an attempt to produce ALA by the carbon flow control method based on the C4 ALA synthesis route.

Similarly, increasing the amount of precursors through removal of genes involved in the TCA cycle has been used to increase compound productivity based on other TCA circuit intermediates. Examples include itaconic acid, succinic acid, fumaric acid, and lysine. Thus, the method of removing the gene of the TCA circuit has been useful for controlling the carbon flow toward the target compound. However, since the TCA circuitry plays a role in producing various precursors and energy required for cell growth, such methods have inevitably faced the problem of cell growth inhibition due to imbalance of TCA circuit intermediates. Such intracellular imbalance problems have been overcome through in-situ feeding of TCA intermediates or the use of complex media, but they are not appropriate in terms of the economics of industrial compound production and require a more sophisticated carbon flow redistribution to overcome the imbalance problem fundamentally Needs to be.

The present inventors used a synthetic biological tool including a promoter and a synthetic 5 'UTR (5' Untranslated region) to maximize the expression of genes involved in ALA production and then finely control and optimize the carbon flow in the upstream metabolic pathway The present invention has been completed by preparing a recombinant microorganism having improved productivity of ALA.

Li Y et al., Production of Succinate from Acetate by Metabolically Engineered Escherichia coli, ACS Synth Biol 18: 5 (11): 1299-1307 (2016)

It is an object of the present invention to provide an aceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, and an aceA gene.

It is also an object of the present invention to provide a first recombinant vector comprising the aceA gene expression cassette.

It is also an object of the present invention to provide a recombinant microorganism for producing 5-aminolevulinic acid into which the first recombinant vector is introduced.

Another object of the present invention is to provide a process for producing the recombinant microorganism and a process for producing 5-aminolevulinic acid.

In order to accomplish the above object, the present invention provides an aceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, Lt; / RTI >

The present invention also provides a first recombinant vector comprising the aceA gene expression cassette.

In addition, the present invention provides a recombinant microorganism for producing 5-aminolevulinic acid into which the first recombinant vector is introduced.

Further, the present invention provides a method for producing a protein comprising the steps of: a) deleting the sucA gene; b) introducing an aceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, and an aceA gene; Aminolevulinic acid (ALA). ≪ / RTI >

The present invention also provides a method for producing a recombinant microorganism, comprising the steps of: culturing the recombinant microorganism in a culture medium containing glucose as a carbon source; Aminolevulinic acid (ALA). ≪ / RTI >

According to the present invention, when the expression of aceA, a gene involved in the glyoxylate cycle, is precisely controlled, it is possible to optimize carbon for ALA production without experiencing the intracellular metabolic imbalance, which is a conventional problem, Microorganisms can be produced. In addition, since ALA can be produced from glucose with high efficiency by using the recombinant microorganism, it can be widely applied in various industries in which ALA is utilized.

1 is a schematic diagram illustrating a biosynthetic pathway from glucose to ALA and a carbon flow optimization process.
Fig. 2 is a schematic diagram showing the design of a plasmid used in the biosynthetic pathway and carbon flow optimization process of ALA.
Figure 3 shows the ALA production profiles (A, B) and cell mass (C) of the wild-type Escherichia coli strain (W) and the strain (WAL) transformed with the vector containing the ALA biosynthetic pathway gene expression cassette (pCDAL) , And ALA production (D) (●: OD ₆₀₀ , ■: glucose consumption, ∇: ALA production, □: acetic acid production).
Figure 4 is a diagram showing a time slot ALA production profile of the WS strain that remove the sucA gene from the strain W (●: OD _600, ■: glucose consumption, ▽: ALA production, □: acetic acid production).
FIG. 5 is a graph showing the ALA production profile of the WSAL strain in which the sucA gene was removed from the WAL strain by time ((OD ₆₀₀₎ , () glucose consumption, () ALA production, and () acetic acid production).
FIG. 6 is a graph showing acetic acid production amount (A) per cell and ALA production amount (B) per cell of WAL and WSAL.
7 shows ALA production profile of strain WSAL0 produced by transforming pCOG containing a gltA gene expression cassette into WSAL strain (●: OD ₆₀₀ , ■: glucose consumption, ∇: ALA production, □: acetic acid production) .
8 shows the activity of isoleuclease (aceA) of strain WSAL1-6 obtained by transforming pCOGA1-6 containing aceA gene expression cassettes of various intensities for controlling the carbon flow to the glyoxylate cycle in WSAL0 strain Fig.
9 shows the comparison of the amount of cells (A) and the amount of ALA (B) obtained as a result of culture of the WSAL1-6 strain, the ALA production profile (C) of the WSAL4 strain and the ALA production amount (D) per cell of the WSAL1-6 strain, (●: OD ₆₀₀ , ■: consumption of glucose, ∇: production of ALA, □: production of acetic acid).
10 shows the results of the ALA production profile (A), the isocitrate degrading enzyme (AceA) activity (B), the amount of cells (C), and the number of cells of WSAL0 and WSAL4 strains of the WSIAL0 strain produced by the iclR gene deletion in WSAL0 strain, ALA production (D) (●: OD ₆₀₀ , ■: glucose consumption, ∇: ALA production, □: acetic acid production).

Hereinafter, the present invention will be described in detail.

Terms not otherwise defined herein have meanings as commonly used in the art to which the present invention belongs.

The present invention provides an aceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, and an aceA gene.

In the present invention, the synthetic 5'UTR is a synthetic 5'UTR for regulating the expression amount of the aceA gene encoding isocitrate lyase, which is represented by the nucleotide sequence of SEQ ID NO: 4 .

In the present invention, "expression cassette" means a unit cassette containing a promoter and a gene encoding a target protein, which can be expressed to produce a target protein operably linked downstream of the promoter. Inside or outside of such an expression cassette, various factors capable of helping efficient production of the target protein can be included. The target protein expression cassette may specifically be a gene operably linked to a gene encoding a target protein downstream of the promoter sequence.

Operably linked "means that the nucleic acid sequence having the promoter activity of the present invention is functionally linked to the gene sequence and the promoter sequence so as to initiate and mediate the transcription of the gene encoding the target protein. Operable linkages can be made using known recombinant techniques in the art, and site-specific DNA cleavage and linkage can be made using, but not limited to, cutting and linking enzymes in the art.

In the present invention, "target protein" refers to a protein to be expressed from a microorganism. Specifically, any protein that is desired to be expressed from a recombinant microorganism can be included without limitation, and examples thereof include, but are not limited to, aceA, gltA, hemA, and hemL genes.

The recombinant gene expression cassette can be inserted into the chromosome of the host cell to produce a recombinant microorganism. As a person skilled in the art will appreciate that the recombinant gene expression cassette can be inserted into the genome of a host cell, It is obvious that the recombinant vector has the same effect as the case of introducing the recombinant vector into the host cell.

As a method for inserting the recombinant gene expression cassette onto the chromosome of the host cell, a commonly known gene manipulation method can be used. Examples include retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, Poxvirus vector, lentiviral vector, or nonviral vector.

Also, in the present invention, the aceA gene expression cassette uses 6 promoters having various intensities and a synthetic 5 'UTR to regulate the aceA gene encoding the isocitrate degrading enzyme at various levels in the transcription step . The promoters having various intensities can be expressed by precisely regulating the aceA gene at transcription level.

In the present invention, the term "promoter" refers to a nucleic acid sequence which is upstream of the coding region and contains a binding site for the polymerase and which has a transcription initiation activity to the mRNA of the promoter sub-gene, To initiate transcription of the gene. The promoter may be located at the 5 'site of the mRNA transcription initiation site.

The promoter nucleic acid molecules of the present invention can be isolated or prepared using standard molecular biology techniques. For example, it can be prepared using standard synthetic techniques using an automated DNA synthesizer, but is not limited thereto.

In the present invention, the promoters may bring about expression of a target gene operatively linked to a nucleic acid molecule having the promoter activity in the desired microorganism, and may have the nucleotide sequence shown in SEQ ID NOs: 36 to 41, It does not.

In addition, the promoter sequences of the present invention can be easily modified by those skilled in the art by known mutagenesis methods, such as directional evolution and site-specific mutagenesis. Accordingly, the promoter is preferably at least 70%, more preferably at least 80%, more particularly at least 90%, even more specifically at least 95%, even more specifically at least 98%, to the nucleotide sequence of SEQ ID NOS: , Most particularly at least 99%, of the nucleotide sequence shown in SEQ ID NO. Also, as the nucleotide sequence having such homology, a nucleotide sequence having deletion, modification, substitution, or addition of a part of the nucleotide sequence should be interpreted as being within the scope of the present invention if it is a nucleotide sequence having promoter activity.

As used herein, the term "homology" refers to the percentage of identity between two polynucleotide or polypeptide mimetics. The homology between sequences from one moiety to another can be determined by known techniques. For example, homology can include sequence information between two polynucleotide molecules or two polypeptide molecules, such as score, identity, and similarity, using a computer program that aligns sequence information and is readily available. (E.g., BLAST 2.0). ≪ / RTI > In addition, homology between polynucleotides can be determined by hybridization of the polynucleotide under conditions that result in a stable double strand between homologous regions, followed by degradation to single-strand-specific nucleases to determine the size of the resolved fragment.

In the present invention, the aceA gene may be derived from Escherichia coli.

The present invention also provides a first recombinant vector comprising the aceA gene expression cassette.

In the present invention, "gene" should be regarded as the broadest meaning, and it is possible to encode a structural or regulatory protein. Wherein the regulatory protein comprises a transcription factor, a heat shock protein or a protein involved in DNA / RNA replication, transcription and / or translation. In the present invention, the target gene to be inhibited in expression may exist as an extrachromosomal component.

In the present invention, "vector" means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several to several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector, (C) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be easily accomplished using a calcium chloride method or electroporation.

As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and detoxification control regulatory sequence that functions within the selected expression host. Preferably, the expression control sequence and the gene are contained within a recombinant vector containing a bacterial selection marker and a replication origin.

In the present invention, a "recombinant vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked to a particular host organism. The recombinant vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include, but are not limited to, antibiotic resistance genes such as ampicilin, kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, It can be selected appropriately.

In addition, the present invention provides a recombinant microorganism for producing 5-aminolevulinic acid (ALA) into which the first recombinant vector is introduced.

In the present invention, the recombinant microorganism refers to a product transformed with the recombinant vector of the present invention. As used herein, "transformation" means introducing a vector comprising a promoter according to the present invention, or a gene encoding a desired protein, into a host cell. In addition, the gene encoding the transformed target protein can be inserted into the chromosome of the host cell or located outside the chromosome as long as it can be expressed in the host cell.

Not all vectors function equally well in expressing the DNA sequences of the present invention, and likewise all hosts do not function equally in the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In the present invention, the recombinant microorganism may be Escherichia sp. Microorganism, and most preferably Escherichia coli.

In addition, the first recombinant vector may further comprise a synthetic 5'UTR, a promoter and a gltA gene.

In the present invention, the synthetic 5'UTR may be a synthetic 5'UTR for regulating the expression level of the gltA gene encoding citrate synthase and represented by the nucleotide sequence of SEQ ID NO: 3.

In the present invention, the promoter may be a promoter represented by SEQ ID NO: 39.

In the present invention, the recombinant microorganism may be one in which the sucA gene coding for succinyl-CoA synthetase has been removed.

In addition, the recombinant microorganism may be further introduced with a second recombinant vector comprising a synthetic 5'UTR, a promoter and a hemA gene encoding NADPH-dependent glutamyl-tRNA reductase (NADPH-dependent glutamyl-tRNA reductase) have.

In the present invention, the promoter may be selected from the group consisting of strong promoters tac promoter, trc promoter, T7 promoter, lac promoter and trp promoter. Preferably, tac promoter may be used. It is not.

The hemA gene may be derived from Salmonella typhimurium , and the second lysine codon may be inserted into the third amino acid site.

In the present invention, the synthetic 5'UTR is for controlling the expression level of the hemA gene and may be a synthetic 5'UTR represented by the nucleotide sequence of SEQ ID NO: 1.

In addition, the second recombinant vector may further comprise a hemL gene encoding a synthetic 5'UTR, a tac promoter and a glutamate-1 semialdehyde aminotransferase.

The second recombinant vector was prepared for the expression of the hemA and hemL genes and can be introduced together with a first recombinant vector for expression of gltA and aceA and used for transformation of the recombinant microorganism of the present invention.

In the present invention, the synthetic 5'UTR may be a synthetic 5'UTR for regulating the expression level of the hemL gene and represented by the nucleotide sequence of SEQ ID NO: 2.

In the present invention, the synthetic 5'UTR represented by the nucleotide sequence of SEQ ID NO: 1 or the synthetic 5'UTR represented by the nucleotide sequence of SEQ ID NO: 2 for regulating the expression amount of the hemA or hemL gene, au) can be designed to be 500,000 or more and 5,000,000 or less.

The reason for this sophisticated control rather than the increase in carbon flow to the simple glyoxylate circuit was the determination that there would be a proper carbon flow, which is precisely the case when the carbon flow to the circuit is excessive, the precursor alpha-chitosyltartar This is because the amount of acid decreases and the production of ALA decreases. On the other hand, the amount of succinic acid and oxaloacetic acid, which are important TCA products for cell growth, is insufficient to inhibit cell growth. Thus, the glyoxylate circuit must be precisely controlled as disclosed in the present invention.

Further, the present invention provides a method for producing a protein comprising the steps of: a) deleting the sucA gene; b) introducing an aceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, and an aceA gene; Aminolevulinic acid (ALA). ≪ / RTI >

In the present invention, the method for producing the recombinant microorganism comprises the steps of: (c) introducing a promoter, synthetic 5'UTR and a gltA gene expression cassette; d) introducing a promoter, a synthetic 5'UTR and a hemA gene expression cassette; And e) introducing a promoter, a synthetic 5'UTR and a hemL gene expression cassette; As shown in FIG.

In the present invention, each step of the method for producing a recombinant microorganism is represented by a), b), c), d) and e) for simplicity, but each of the steps may be performed sequentially, It can also be done by changing.

The present invention also provides a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism of the present invention in a culture medium containing glucose as a carbon source; Aminolevulinic acid (ALA). ≪ / RTI >

In the present invention, the glucose may be contained as a single carbon source in the culture medium.

The medium used for culturing the microorganism of the present invention and other culture conditions may be any medium used for culturing Escherichia genus microorganisms, but the microorganisms of the present invention must satisfy the requirements of the present invention. Preferably, the microorganism of the present invention is cultured in an ordinary medium containing an appropriate carbon source, a nitrogen source, an amino acid, a vitamin, and the like under aerobic conditions while controlling temperature, pH, and the like.

The medium may include potassium phosphate, potassium phosphate and the corresponding sodium-containing salts as a source. Examples of the inorganic compound may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate. In addition, amino acids, vitamins and suitable precursors may be included. These media or precursors may be added to the culture either batchwise or continuously.

During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, foaming can be suppressed by using a defoaming agent such as fatty acid polyglycol ester during the culture. Also, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without injecting gas to maintain anaerobic and microorganism conditions.

The temperature of the culture can usually be set at 27 캜 to 37 캜, preferably at 30 캜 to 35 캜. The incubation period can be continued until the desired amount of useful substance is obtained, preferably, for 10 to 100 hours.

The 5-aminolevulinic acid produced in the culturing step of the present invention may further include purification or recovery, and the method for recovering the target protein from the microorganism or the culture may be performed by a method known in the art, for example, Filtration, anion exchange chromatography, crystallization, HPLC, and the like can be used, but the present invention is not limited to these examples.

The recovering step may include a purification step, and a person skilled in the art can select and utilize it according to the needs of various known purification processes.

As disclosed in the present invention, in the optimization of the central carbon flow for the production of 5-aminolevulinic acid, it is the first attempt in the present invention to remove the sucA gene and regulate the expression amount of aceA at various intensities. In particular, the control of the expression level of aceA of the present invention was the first attempt to precisely control the glyoxylate circuit, and thus no similar studies or inventions have been conducted until now, and an effective tuning of the glyoxylate circuit by controlling the expression level of aceA Production of 5-aminolevulinic acid is possible.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

Example  1. Preparation of recombinant Escherichia coli for ALA production

An overview of the invention for efficient production of ALA in E. coli is as shown in Fig. First, for the production of ALA, genes encoding two enzymes involved in the ALA biosynthetic process were expressed through plasmid pCDFduet-1 (including CloDF13 origin), which has a normal copy number. First, the hemA gene (NCBI ID: 1253296, SEQ ID NO: 45) derived from Salmonella typhimurium that codes for NADPH-dependent glutamyl-tRNA reductase encodes a third amino acid residue Two lysine codons were inserted. In the case of glutamate-1 semialdehyde aminotransferase, an E. coli-derived hemL gene (NCBI ID: 12693913, SEQ ID NO: 46) coding for glutamate-1 semialdehyde aminotransferase was used.

To maximize the expression of both genes, the existing expression cassette was replaced with an expression cassette utilizing the tac promoter and synthetic 5 'UTR. In the synthetic 5 'UTR, the synthetic 5' UTR designed to maximize the expression level of the two genes is designed to have a predicted expression level of over 500,000 through the UTR Designer. For example, The synthetic 5 'UTR of SEQ ID NO: 1 (hemA) and SEQ ID NO: 2 (hemL) was used. For this, the pCDFduet-1 plasmid was used as a template and amplified using the pCDF_F / pCDF_R primer set shown in Table 2. Each gene was amplified using the primers set for hemA_F1 / hemA_R1, hemA_F2 / hemA_R2 and hemL_F1 / hemL_R1, hemL_F2 / And then inserted into the plasmid by cloning using a BsaI restriction enzyme sequence to finally prepare a pCDAL plasmid. The constructed recombinant plasmid pCDAL is shown in Fig.

The plasmid pCDAL shown in Fig. 2 was transformed into Escherichia coli W strain (KCTC1039) showing resistance to an acidic substance to prepare a recombinant E. coli WAL. The recombinant E. coli WAL was used in the following examples.

Gene name The synthetic 5 'UTR sequence (5'-3') The predicted expression level (a.u) SEQ ID NO: hema CGCAACCAGGCAAAGGAGGAATGTG 4,615,069.57 One hemL GACCCCCTGAGGAGGAATTAAATCT 3,735,611.56 2

Primer name The polynucleotide sequence (5'-3 ') SEQ ID NO: pCDF_F gagtgtggtctccttctcgaggcatttgagaagcacacg 5 pCDF_R gagtgtggtctcccaaaagcttgagctgatccaggagtcg 6 hemA_F1 ggaattgtgagcggataacaattcgcaaccaggcaaaggaggaatgtgatgaccaagaagcttttagcgctcggtattaac 7 hemA_F2 gagtgtggtctcgtttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt 8 hemA_R1 aaaaaaaaaccccgccgaagcggggtttttttttggtgcgatctactccagcccgaggctgtcgc 9 hemA_R2 gagtgtggtctcgaaggtaccgcggccgcaaaaaaaaaccccgccgaagcg 10 hemL_F1 ggaattgtgagcggataacaattgaccccctgaggaggaattaaatctatgagtaagtctgaaaatctttac 11 hemL_F2 gagtgtggtctccccttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt 12 hemL_R1 aaaaaaaaaccccgccgaagcggggtttttttttggtgcgattcacaacttcgcaaacacccgac 13 hemL_R2 gagtgtggtctccagaaaaaaaaaccccgccgaagcgg 14

Example 2 . Identification of ALA biosynthetic pathway amplification in recombinant E. coli

To confirm that the ALA biosynthetic pathway was amplified in the recombinant E. coli thus prepared, cell culture was carried out together with wild-type Escherichia coli (wild-type W strain).

All future recombinant strains, including recombinant E. coli WAL, were grown in 25 ml of glucose-modified M9 medium (100 mM phosphate buffer, 0.5 g / L MgSO ₄ 7H ₂ O, 2 g / L NH ₄ Cl, 2 g / / L yeast extract, containing 0.01 g / L of MnSO ₄ H ₂ O and using 20 g / L of glucose as the sole carbon source), cultured at 37 ° C and 200 rpm for 18 hours, Concentration was determined by diluting the cells prepared in advance in the same medium with the OD600 concentration of 0.05. If necessary, 50 ug / ml streptomycin and kanamycin were added to the medium for the maintenance of the plasmid, and 0.1 mM IPTG was added for gene expression.

Cell growth was quantified by measuring the absorbance at 600 nM using a UV-1700 spectrophotometer. The result was expressed as OD600 or 0.31 g DCW / L per OD600 unit. After incubation, the amount of ALA produced was measured by a colorimetric assay using modified Ehrlich's reagent as previously known, and the absorbance at 553 nm was measured using VICTOR3 1420 Multilabel Plate Reader. Other organics in the medium were measured using Aminex HPX-87H column and 0.6 ml of 5 mM H2SO4 as mobile phase, and Shodex RI-101 instrument was used for detection. The results of analysis of cell amount, acetic acid production amount and ALA production amount as ALA production profile are shown in FIG.

As shown in Figs. 3A, B and D, the WAL strain showed significantly increased ALA productivity as compared with the wild type Escherichia coli as a control group, and it was confirmed that ALA was produced at 735.33 mg / L for 18 hours. In addition, as shown in FIG. 3C, it was confirmed that the final amount of cell retained was decreased by 60.1% in the WAL strain through the maximum expression of the two enzymes, as compared with the control. Overall, the maximum expression of the ALA biosynthetic enzyme was successfully demonstrated by comparison of the two strains.

Example  3. Recombination for ALA production In E. coli TCA  Circuit gene removal

3-1. sucA  Recombinant E. coli WS  And WSAL's  making

In order to increase the amount of the precursor alpha-chitosyl tartaric acid in the two wild-type W strains used in Example 2, the sucA gene encoding succinyl-CoA synthetase NCBI ID: 12694541, SEQ ID NO: 44) was removed on the chromosome and each strain was designated WS and WSAL.

For this, the previously known Lambda-Red recombination system, pKD46 and pcp20 plasmids were used. The DNA fragment for sucA gene deletion was amplified using the FRT-KanR-FRT template as the template and the sucA_del_F / sucA_del_R primer set shown in Table 3. Finally, WS and WSAL in which the sucA gene was deleted were cultured in the same manner as in Example 2, and the cell amount, acetic acid production amount and ALA production amount were analyzed as an ALA production profile.

Primer name The polynucleotide sequence (5'-3 ') SEQ ID NO: sucA_del_F atgcagaacagcgctttgaaagcctggttggactcttcttacctctctgggcatgaccggcgcgatgc 15 sucA_del_R ttattcgacgttcagcgcgtcattaaccagatcttgctgctgtttctggtgctcagcggatctcatgcgc 16

3-2. WS , WSAL  Observation of cell mass and ALA production of strain

As shown in Fig. 4, it was confirmed that the WS strain in which the sucA gene was removed from wild-type E. coli W was inhibited by the gene deletion. On the other hand, it was confirmed that ALA production was increased by 9.66 times and 102.50 mg / L of ALA was produced, whereby the sucA gene deletion increased the amount of alpha-chitosyl tartaric acid and thereby increased the carbon flow to ALA I have confirmed that it is helpful.

As shown in Fig. 5, the amount of WSAL in which the sucA gene was deleted in the recombinant E. coli WAL was significantly inhibited, and it was 0.48 g DCW / L, which was 63.6% lower than that of the WAL strain. On the other hand, ALA production amounted to 641.18 mg / L, which is 13.8%, which is different from the previous WS strain. The decrease in ALA was thought to be due to the severely inhibited amount of cells. In addition, it was judged that this is due to the imbalance of the TCA circuit due to deletion of the sucA gene, and thus the energy required for cell growth and the precursor could not be synthesized smoothly.

3-3. WAL , WSAL  Strain Per cell  Acetic acid production, ALA production analysis

WAL and WSAL were analyzed for acetic acid production per cell and ALA production per cell. The results are shown in Fig.

As shown in Fig. 6A, it was confirmed that the production amount of acetic acid per cell of WSAL strain was 2.76 g / g DCW, which was 345.1% higher than that of WAL strain. In addition, as shown in Fig. 6B, the ALA production per cell of WSAL strain was 1324.74 mg / g DCW, which was 236.9% higher than that of WAL strain. From the above results, it was confirmed that the deletion of the sucA gene is effective in increasing the carbon flow to the ALA production circuit. Therefore, it was determined that additional cell flow optimization could achieve cell volume recovery and increase ALA productivity, which was confirmed in the following examples.

Example  4. Recombination for ALA production In E. coli TCA  Increase circuit flow

4-1. gltA  Recombinant Escherichia coli expressing the gene WSAL0's  making

In order to elaborate carbon flow redistribution and optimization of the WSAL strain in Example 3, gltA (NCBI ID: 12694535, SEQ ID NO: 43) gene encoding citrate synthase known as the pace-making enzyme of the TCA circuit Was expressed through a recombinant plasmid. Specifically, in order to express the E. coli-derived gltA gene, it was inserted into a plasmid containing pCOLAduet-1 (including ColA origin) having an intermediate copy number using a promoter and a synthetic 5 'UTR. Specifically, the synthetic 5 'UTR used the synthetic 5' UTR of SEQ ID NO: 3 in Table 4, and the promoter used was the middle-length BBa_J23110 promoter registered in the Registry of Standard Biological Parts shown in Table 5.

Gene name The synthetic 5 'UTR sequence (5'-3') The predicted expression level (a.u) SEQ ID NO: gltA AAAGGGAAAAAAAGGAGCATCAAAT 820, 540.95 3

Strain name Promoter Predicted transference strength Actual AceA active value SEQ ID NO: WSAL4 BBa_J23110 0.33 0.31 + 0.02 39

For gene introduction, the pCOLAduet-1 plasmid was amplified using the pCOAL_F / pCOLA_R primer set shown in Table 6, and the genes were sequentially amplified using the gltA_F1 / gltA_R1 and gltA_F2 / gltA_R2 primer sets shown in Table 6. The recombinant plasmid pCOG was constructed using BsaI restriction enzyme sites for gene recombination and is shown in Fig.

The recombinant plasmid pCOG was transformed into the WSAL strain of Example 3 to prepare recombinant Escherichia coli WSAL0.

Primer name The polynucleotide sequence (5'-3 ') SEQ ID NO: pCOLA_F gtcactggtctcctcggtaccgtggcacttttcggg 17 pCOLA_R gtcactggtctccctggcgcaacgcaattaatgtaagttagctca 18 gltA_F1 Tttacggctagctcagtcctaggtacaatgctagcaaagggaaaaaaaggagcatcaaatatggctgatacaaaagcaaaac 19 gltA_F2 gtcactggtctcggactttacggctagctcagtcctaggtaca 20 gltA_R1 gcggccgcgcggccgcaaaaaaaaaccccgccgaagcggggtttttttttgtcgttaacgcttgatatcgcttttaaagtcgc 21 gltA_R2 gtcactggtctcgagcggccgcgcggccgcaaaa 22

4-2. Recombinant E. coli WSAL0's  Cell mass, ALA production, acetic acid production, glucose metabolism analysis

In order to confirm the expression of the gltA gene in the recombinant E. coli strain WSAL0, cultivation was carried out in the same manner as in Example 2, and the results are shown in FIG.

As shown in Fig. 7, it was confirmed that the amount of ALA production of WSAL0 strain was 404.50 mg / L which is somewhat lower than that of WSAL strain. The amount of cell was 0.53 g / DCW increased by 9.2% compared with WSAL strain. In addition, glucose metabolism increased by 6.0% to 3.76 g / L, and acetic acid production per cell decreased by 22.5% to 2.14 g / g DCW. From the above results, it was confirmed that the TCA circuit flow was successfully increased by the expression of the gltA gene.

Example  5. Recombination for ALA production In E. coli Glyoxylate  Sophisticated regulation of circuit carbon flow

5-1. aceA  Recombinant E. coli that optimally expresses the gene WSAL1 Production of ~ 6

To further improve the strain WSAL0 of Example 4 above, carbon flow optimization through fine carbon flow control to the glyoxylate circuit was performed.

The precise control of the carbon flow to the glyoxylate circuit is based on the fact that the two enzymes involved in the circuit, isocitrate lyase and malate synthase, are thermodynamically unfavorable isosheet Lt; RTI ID = 0.0 > lyase. ≪ / RTI >

For the purposes stated above, the aceA gene coding for isocitrate degrading enzyme (NCBI ID: 12698123, SEQ ID NO: 42) was intended to be regulated at various levels in the transcription step. The aceA gene was derived from Escherichia coli. For the elaborate control of the transcription level, expression cassettes were prepared using six promoters having various intensities in Table 9 and a synthetic 5 'UTR. For the 5 'UTR sequence, SEQ ID NO: 4 (aceA) shown in Table 7 was used.

Each aceA expression cassette was additionally introduced into the recombinant plasmid pCOG of Example 4. For this, pCOG was amplified using the pCOLA_F2 / pCOLA_R2 primer set shown in Table 8, and the aceA gene was amplified by sequentially using the aceA_F1 / aceA_R1, aceA_F2- (1-6) / aceA_R2 primer set shown in Table 8 . Subsequently, the recombinant plasmids pCOGA1 to 6 having the aceA expression cassettes of different intensities were prepared using the BsaI restriction enzyme site, which is shown in Fig.

The recombinant plasmids pCOG1-6 were transformed into the WSAL strain of Example 3 to produce recombinant Escherichia coli WSAL1-6.

Gene name The synthetic 5 'UTR sequence (5'-3') The predicted expression level (a.u) SEQ ID NO: aceA GTGATCTAGAAAAGGAGCATCCGTA 1,085,302.27 4

Primer name The polynucleotide sequence (5'-3 ') SEQ ID NO: pCOLA_F2 gtcttcggtctccggtcgacgctctcccttatgcg 23 pCOLA_R2 gtcttcggtctcctggatcccggacaccatcgaatg 24 aceA_F1 gtgatctagaaaaggagcatccgtaatgaaaacccgtacacaacaaatt 25 aceA_F2-1 gtcttcggtctcgtccatactagcgacgcacgtcatttatagctagctcagcccttggtacaatgctagcgtgatctagaaaaggagcatccgta 26 aceA_F2-2 gtcttcggtctcgtccatactagcgacgcacgtcatttatggctagctcagtcctaggtacaatgctagcgtgatctagaaaaggagcatccgta 27 aceA_F2-3 gtcttcggtctcgtccatactagcgacgcacgtcactgacagctagctcagtcctaggtataatgctagcgtgatctagaaaaggagcatccgta 28 aceA_F2-4 gtcttcggtctcgtccatactagcgacgcacgtcatttacggctagctcagtcctaggtacaatgctagcgtgatctagaaaaggagcatccgta 29 aceA_F2-5 gtcttcggtctcgtccatactagcgacgcacgtcattgacggctagctcagtcctaggtacagtgctagcgtgatctagaaaaggagcatccgta 30 aceA_F2-6 gtcttcggtctcgtccatactagcgacgcacgtcattgacagctagctcagtcctaggtattgtgctagcgtgatctagaaaaggagcatccgta 31 aceA_R1 aaaaaaaaaccccgccgaagcggggtttttttttgtcgttagaactgcgattcttcagtggagc 32 aceA_R2 gtcttcggtctcggacccgaaaagtgccacggtac 33

Strain name Promoter Predicted transference strength Actual AceA active value SEQ ID NO: WSAL1 BBa_J23115 0.15 0.04 0.02 36 WSAL2 BBa_J23114 0.10 0.06 ± 0.00 37 WSAL3 BBa_J23108 0.51 0.08 ± 0.00 38 WSAL4 BBa_J23110 0.33 0.31 + 0.02 39 WSAL5 BBa_J23100 1.00 0.65 ± 0.00 40 WSAL6 BBa_J23104 0.72 1.00 + 0.02 41

5-2. Recombinant E. coli WSAL1 ~ 6 of Isocitrate  Measurement of enzyme activity

The activity of each of the isocitrate degrading enzymes was measured in order to confirm the effect of the recombinant E. coli WSAL1 ~ 6 on the expression level of aceA, and the results are shown in FIG. The activity of isocitrate degrading enzyme was measured as reported in previous studies. Each sample was prepared by collecting the culture medium at a concentration of OD600 3.0 at 12 hours after the strain culture. For the measurement procedure, VICTOR3 1420 Multilabel Plate Reader was used to record the absorbance at a wavelength of 324 nm.

As shown in FIG. 8, the activity of isoleuclease-degrading enzymes of WSAL1 to 6 was increased up to 24.2 times in a stepwise manner, confirming that the expression of aceA was successfully regulated. The predicted intensity and the actual expression level of the promoters used were slightly different, but it was confirmed that the tendency of the promoters was identical.

5-3. Recombinant E. coli WSAL1 ~ 6 cell mass, ALA production, acetic acid production, glucose metabolism analysis

In order to confirm the effect of controlling the expression level of the aceA gene in the recombinant E. coli WSAL1 ~ 6, cultivation was carried out in the same manner as in Example 2, and the results are shown in FIG.

As shown in FIGS. 9A and 9B, it was confirmed that the amount of cell and ALA production was low in a strain having too low or high isocitrate lipase activity such as WSAL1 or WSAL6. As shown in Figure 9 D, WSAL1 and WSAL2 strains with relatively low enzymatic activity showed higher ALA production per cell than other strains.

On the other hand, it was confirmed that the highest cell amount and ALA production amount in WSAL4 strain having intermediate isocitrate protease activity. In addition, the amounts were 2.02 g DCW / L and 1080.00 mg / L, respectively, which were 281.8% and 167.0% higher than the WSAL0 strain, respectively. In addition, as shown in Fig. 9C, it was confirmed that the production of acetic acid was greatly reduced without removal of the acetic acid production circuit gene, indicating 0.55 g / L (0.27 g / g DCW of acetic acid production per cell).

From the above results, it was confirmed that the amount of cells and the amount of ALA were regulated according to the activity difference of isocitrate degrading enzyme, thereby controlling the carbon flow to the glyoxylate circuit by controlling the expression level of aceA, As shown in Fig.

Comparative Example  1. ALA production compared to existing technology

As described in the above examples, the precise control of the carbon flow of the glyoxylate circuit and the optimization of the carbon flow through it were initially contemplated by the present invention, and the present invention was previously described (Li Y et al, ACS Synth Biol (2016)), as compared with the glyoxylate circuit utilization strategy.

Previously, as a strategy for using a glyoxylate circuit, a method of amplifying a circuit by removing an iclR gene, which suppresses transcription of an aceBAK operon encoding an enzyme involved in a glyoxylate circuit, on a chromosome was used. Thus, in order to make an accurate comparison between the two methods, the present inventors carried out the iclR gene deletion in the WSAL0 strain of Example 4 to prepare the WSIAL0 strain. The iclR gene deletion proceeded as in the method using the Lambda-Red recombination system of Example 3, and the DNA fragment for iclR gene deletion was amplified using the iclR_del_F / iclR_del_R primer set shown in Table 10. Then, the isocitrate degrading enzyme activity was measured and cultured by the above-mentioned method, and the results are shown in FIG. As shown in Fig. 10A, an increased cell mass was observed in the recombinant strain WSIAL0, but the production of ALA was greatly reduced.

Primer name The polynucleotide sequence (5'-3 ') SEQ ID NO: iclR_del_F atggaaagtaaagtagttgttccggcacaaggcaagaagatcaccctgcagcatgaccggcgcgatgc 34 iclR_del_R ttacatgttcttgatgatcgcatcaccaaattctgaacatttcagcagttgctcagcggatctcatgcgc 35

As shown in FIG. 10B, the activity of the WSIAL0 strain was increased compared to the WSAL0 strain, but was slightly lower than that of the WSAL4 strain. In addition, as shown in Fig. 10C, in WSIAL0, the cell amount was increased by 118.2% at 1.15 g DCW / L, but it was confirmed that the increase amount did not reach the WSAL4 strain. On the other hand, as shown in Fig. 10D, ALA production amount of WSIAL0 was observed at 264.2 mg / L, and it was confirmed that it was 35.7% lower than that of WSAL0 strain. Through the above results, removal of iclR additionally increases the expression of aceK encoding isocitrate dehydrogenase kinase / phosphatase, in addition to the two enzymes involved in the glyoxylate circuit, (isocitrate dehydrogenase) activity was reduced and it was thought to reduce carbon flow to ALA.

Through the above comparative examples, it was found that the use of the glyoxylate circuit regulating method of the present invention, as compared with the case of the glyoxylate circuit utilization strategy conducted in the previous study, , It is once again confirmed that efficient ALA production is possible.

Although the present invention has been described in terms of the preferred embodiments mentioned above, it is possible to make various modifications and variations without departing from the spirit and scope of the invention. It is also to be understood that the appended claims are intended to cover such modifications and changes as fall within the scope of the invention.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Recombinant microorganism producing 5-Aminolevulinic acid and          method of producing 5-Aminolevulinic acid using the same <130> POSTECH1-45P-1 <150> KR 10-2017-0044984 <151> 2017-04-06 <160> 46 <170> KoPatentin 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> redesigned 5'UTR for hemA <400> 1 cgcaaccagg caaaggagga atgtg 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> redesigned 5'UTR for hemL <400> 2 gaccccctga ggaggaatta aatct 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> redesigned 5'UTR for gltA <400> 3 aaagggaaaa aaaggagcat caaat 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> redesigned 5'UTR for aceA <400> 4 gtgatctaga aaaggagcat ccgta 25 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> pCDF_F <400> 5 gagtgtggtc tccttctcga ggcatttgag aagcacacg 39 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pCDF_R <400> 6 gagtgtggtc tcccaaaagc ttgagctgat ccaggagtcg 40 <210> 7 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> hemA_F1 <400> 7 ggaattgtga gcggataaca attcgcaacc aggcaaagga ggaatgtgat gaccaagaag 60 cttttagcgc tcggtattaa c 81 <210> 8 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> hemA_F2 <400> 8 gagtgtggtc tcgtttgaca attaatcatc ggctcgtata atgtgtggaa ttgtgagcgg 60 ataacaatt 69 <210> 9 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> hemA_R1 <400> 9 aaaaaaaaac cccgccgaag cggggttttt ttttggtgcg atctactcca gcccgaggct 60 gtcgc 65 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> hemA_R2 <400> 10 gagtgtggtc tcgaaggtac cgcggccgca aaaaaaaacc ccgccgaagc g 51 <210> 11 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> hemL_F1 <400> 11 ggaattgtga gcggataaca attgaccccc tgaggaggaa ttaaatctat gagtaagtct 60 gaaaatcttt ac 72 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> hemL_F2 <400> 12 gagtgtggtc tccccttgac aattaatcat cggctcgtat aatgtgtgga attgtgagcg 60 gataacaatt 70 <210> 13 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> hemL_R1 <400> 13 aaaaaaaaac cccgccgaag cggggttttt ttttggtgcg attcacaact tcgcaaacac 60 ccgac 65 <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> hemL_R2 <400> 14 gagtgtggtc tccagaaaaa aaaaccccgc cgaagcgg 38 <210> 15 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> sucA_del_F <400> 15 atgcagaaca gcgctttgaa agcctggttg gactcttctt acctctctgg gcatgaccgg 60 cgcgatgc 68 <210> 16 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> sucA_del_R <400> 16 ttattcgacg ttcagcgcgt cattaaccag atcttgctgc tgtttctggt gctcagcgga 60 tctcatgcgc 70 <210> 17 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> pCOLA_F <400> 17 gtcactggtc tcctcggtac cgtggcactt ttcggg 36 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> pCOLA_R <400> 18 gtcactggtc tccctggcgc aacgcaatta atgtaagtta gctca 45 <210> 19 <211> 82 <212> DNA <213> Artificial Sequence <220> <223> gltA_F1 <400> 19 tttacggcta gctcagtcct aggtacaatg ctagcaaagg gaaaaaaagg agcatcaaat 60 atggctgata caaaagcaaa ac 82 <210> 20 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> gltA_F2 <400> 20 gtcactggtc tcggacttta cggctagctc agtcctaggt aca 43 <210> 21 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> gltA_R1 <400> 21 gcggccgcgc ggccgcaaaa aaaaaccccg ccgaagcggg gttttttttt gtcgttaacg 60 cttgatatcg cttttaaagt cgc 83 <210> 22 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> gltA_R2 <400> 22 gtcactggtc tcgagcggcc gcgcggccgc aaaa 34 <210> 23 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pCOLA_F2 <400> 23 gtcttcggtc tccggtcgac gctctccctt atgcg 35 <210> 24 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> pCOLA_R2 <400> 24 gtcttcggtc tcctggatcc cggacaccat cgaatg 36 <210> 25 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> aceA_F1 <400> 25 gtgatctaga aaaggagcat ccgtaatgaa aacccgtaca caacaaatt 49 <210> 26 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> aceA_F2-1 <400> 26 gtcttcggtc tcgtccatac tagcgacgca cgtcatttat agctagctca gcccttggta 60 caatgctagc gtgatctaga aaaggagcat ccgta 95 <210> 27 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> aceA_F2-2 <400> 27 gtcttcggtc tcgtccatac tagcgacgca cgtcatttat ggctagctca gtcctaggta 60 caatgctagc gtgatctaga aaaggagcat ccgta 95 <210> 28 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> aceA_F2-3 <400> 28 gtcttcggtc tcgtccatac tagcgacgca cgtcactgac agctagctca gtcctaggta 60 taatgctagc gtgatctaga aaaggagcat ccgta 95 <210> 29 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> aceA_F2-4 <400> 29 gtcttcggtc tcgtccatac tagcgacgca cgtcatttac ggctagctca gtcctaggta 60 caatgctagc gtgatctaga aaaggagcat ccgta 95 <210> 30 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> aceA_F2-5 <400> 30 gtcttcggtc tcgtccatac tagcgacgca cgtcattgac ggctagctca gtcctaggta 60 cagtgctagc gtgatctaga aaaggagcat ccgta 95 <210> 31 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> aceA_F2-6 <400> 31 gtcttcggtc tcgtccatac tagcgacgca cgtcattgac agctagctca gtcctaggta 60 ttgtgctagc gtgatctaga aaaggagcat ccgta 95 <210> 32 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> aceA_R1 <400> 32 aaaaaaaaac cccgccgaag cggggttttt ttttgtcgtt agaactgcga ttcttcagtg 60 gagc 64 <210> 33 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aceA_R2 <400> 33 gtcttcggtc tcggacccga aaagtgccac ggtac 35 <210> 34 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> iclR_del_F <400> 34 atggaaagta aagtagttgt tccggcacaa ggcaagaaga tcaccctgca gcatgaccgg 60 cgcgatgc 68 <210> 35 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> iclR_del_R <400> 35 ttacatgttc ttgatgatcg catcaccaaa ttctgaacat ttcagcagtt gctcagcgga 60 tctcatgcgc 70 <210> 36 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> BBa_J23115 <400> 36 tttatagcta gctcagccct tggtacaatg ctagc 35 <210> 37 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> BBa_J23114 <400> 37 tttatggcta gctcagtcct aggtacaatg ctagc 35 <210> 38 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> BBa_J23108 <400> 38 ctgacagcta gctcagtcct aggtataatg ctagc 35 <210> 39 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> BBa_J23110 <400> 39 tttacggcta gctcagtcct aggtacaatg ctagc 35 <210> 40 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> BBa_J23100 <400> 40 ttgacggcta gctcagtcct aggtacagtg ctagc 35 <210> 41 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> BBa_J23104 <400> 41 ttgacagcta gctcagtcct aggtattgtg ctagc 35 <210> 42 <211> 1602 <212> DNA <213> Artificial Sequence <220> <223> wild type aceA gene from Escherichia coli W <400> 42 atgactgaac aggcaacaac aaccgatgaa ctggctttca taaggccgta tggcgagcag 60 gagaagcaaa ttcttactgc cgaagcggta gaatttctga ctgagctggt gacgcatttt 120 acgccacaac gcaataaact tctggcagcg cgcattcagc agcagcaaga tattgataac 180 ggaacgttgc ctgattttat ttcggaaaca gcttccattc gcgatacgga ctggaaaatt 240 cgtggtattc ccgcggactt acaagatcgt cgagtcgaga taactggccc ggttgagcgc 300 aagatggtga tcaacgcact gaacgccaat gtgaaagtct ttatggccga tttcgaagat 360 tcactggcac cagactggaa caaagtgatc gacgggcaaa ttaacctgcg cgatgcggtt 420 aacggcacca tcagctatac caatgaagca ggcaaaattt atcagctcaa gcccaatcca 480 gcggttttga tttgtcgggt acgcggtctg cacttgccgg aaaaacatgt cacctggcgt 540 ggtgaggcaa tccccggtag cctgtttgat tttgcgctct atttcttcca caactatcag 600 gcactgttgg caaagggcag cggtccctat ttctatctgc cgaaaaccca gtcctggcag 660 gaagcggcct ggtggagcga agtcttcagc tatgcagaag atcgctttaa tctgccgcgc 720 ggcaccatca aggcgacgtt gctgattgaa acgctgcccg ccgtgttcca gatggatgaa 780 atccttcacg cgctgcgtga ccatattgtt ggtctgaact gcggtcgttg ggattacatc 840 ttcagctata tcaaaacgtt gaaaaactat cccgatcgcg tcctgccaga cagacaggca 900 gtgacgatgg ataaaccatt cctgaatgct tactcacgcc tgttgattaa aacctgccat 960 aaacgcggtg cttttgcgat gggcggcatg gcagcgttta ttccgagcaa agatgaagag 1020 cgcaataacc aggtgctcaa caaagtaaaa gcggataaag cgctggaagc caataacggt 1080 cacgatggca catggattgc tcacccaggc cttgcggata cggcaatggc ggtattcaac 1140 gacattctcg gctcccgtaa aaatcagctt gaagtgatgc gcgaacaaga cgcgccgatt 1200 actgccgatc agctgctggc accttgtgat ggtgaacgca ccgaagaagg tatgcgcgcc 1260 aacattcgcg tggcagtgca gtacatcgaa gcatggatct ccggcaacgg ctgcgtgccg 1320 atttatggcc tgatggaaga tgcggcgacg gctgaaattt cccgtacctc aatctggcag 1380 tggatccatc atcaaaaaac gttgagcaat ggcaaaccgg tgaccaaagc cttgttccgc 1440 cagatgctgg gtgaagagat gaaagtcatt gccagcgaac tgggcgaaga acgtttctcc 1500 cggggcgtt ttgacgatgc cgcacgcttg atggaacaga tcaccacttc cgatgagtta 1560 attgatttcc tgaccctgcc aggctaccgc ctgttagcgt aa 1602 <210> 43 <211> 1284 <212> DNA <213> Artificial Sequence <220> <223> wild type gltA gene from Escherichia coli W <400> 43 atggctgata caaaagcaaa actcaccctc aacggggata cagctgttga actggatgtg 60 ctgaaaggca cgctgggtca agatgttatt gatatccgta ctctcggttc aaaaggtgtg 120 ttcacctttg acccaggctt cacttcaacc gcatcctgcg aatctaaaat tacttttatt 180 gatggtgatg aaggtatttt gctgcaccgc ggtttcccga tcgatcagct ggcgaccgat 240 tctaactacc tggaagtttg ttacatcctg ctgaatggtg aaaaaccgac tcaggaacag 300 tatgacgaat ttaaaactac ggtgacccgt cataccatga tccacgagca gattacccgt 360 ctgttccatg ctttccgtcg cgactcgcat ccaatggcag tcatgtgtgg tattaccggc 420 gcgctggcgg cgttctatca cgactcgctg gatgttaaca atcctcgtca ccgtgaaatt 480 gccgcgttcc gcctgctgtc gaaaatgccg accatggccg cgatgtgtta caagtattcc 540 attggtcagc catttgttta cccgcgcaac gatctctcct acgccggtaa cttcctgaat 600 atgatgttct ccacgccgtg cgaaccgtat gaagttaatc cgattctgga acgtgctatg 660 gaccgtattc tgatcctgca cgctgaccat gaacagaacg cctctacctc caccgtgcgt 720 accgctggct cttcgggtgc gaacccgttt gcctgtatcg cagcaggtat tgcttcactg 780 tggggacctg cgcacggcgg tgctaacgaa gcggcgctga aaatgctgga agaaatcagc 840 tccgttaaac acattccgga atttgttcgt cgtgcgaaag acaaaaatga ttctttccgc 900 ctgatgggct tcggtcaccg cgtgtacaaa aattacgacc cgcgcgccac cgtaatgcgt 960 gaaacctgcc atgaagtgct gaaagagctg ggcacgaagg atgacctgct ggaagtggct 1020 atggagctgg aaaacatcgc gctgaacgac ccgtacttta tcgagaagaa actgtacccg 1080 aacgtcgatt tctactctgg tatcatcctg aaagcgatgg gtattccgtc ttccatgttc 1140 accgtcattt tcgcaatggc acgtaccgtt ggctggatcg cccactggag cgaaatgcac 1200 agtgacggta tgaagattgc ccgtccgcgt cagctgtata caggatatga aaaacgcgac 1260 tttaaaagcg atatcaagcg ttaa 1284 <210> 44 <211> 2802 <212> DNA <213> Artificial Sequence <220> <223> wild type sucA gene from Escherichia coli W <400> 44 atgcagaaca gcgctttgaa agcctggttg gactcttctt acctctctgg cgcaaaccag 60 agctggatag aacagctcta tgaagacttc ttaaccgatc ctgactcggt tgacgctaac 120 tggcgttcga cgttccagca gttacctggt acgggagtca aaccggatca attccactct 180 caaacgcgtg aatatttccg ccgcctggcg aaagacgctt cacgttactc ttcaacgatc 240 tccgaccctg acaccaatgt aaagcaggtt aaagtcctgc agctcattaa cgcataccgc 300 ttccgtggtc accagcatgc gaatctcgat ccgctgggac tgtggcagca agataaagtg 360 gccgatctgg atccgtcttt ccacgatctg accgaagcag acttccagga gaccttcaac 420 gtcggttcat ttgccagcgg caaagaaacc atgaaactcg gcgagctgct ggaagccctc 480 aagcaaacct actgcggccc gattggtgcc gagtatatgc acattaccag caccgaagaa 540 aaacgctgga tccaacagcg tatcgagtct ggtcgcgcga ctttcaatag cgaagagaaa 600 aaacgcttct taagcgaact gaccgccgct gaaggccttg aacgttacct cggcgcaaaa 660 ttccctggcg caaaacgctt ctcgctggaa ggcggtgacg cgttaatccc gatgcttaaa 720 gagatgatcc gccacgctgg caacagcggc acccgggaag tggttctcgg gatggcgcac 780 cgtggtcgtc tgaacgtgtt ggtgaacgtg ctgggtaaaa aaccgcaaga cttgttcgac 840 gagtttgccg gtaaacataa agaacacctc ggcacgggtg acgtgaaata ccacatgggc 900 ttctcgtctg acttccagac cgatggcggc ctggtgcacc tggcgctggc gtttaacccg 960 tctcaccttg agattgtaag cccggtcgtt atcggctctg ttcgtgcccg tctggacaga 1020 cttgatgagc cgagcagcaa caaagtgctg ccaattacca tccacggtga cgccgcagtg 1080 accggacagg gcgtggttca ggaaaccctg aacatgtcga aagcgcgtgg ttatgaagtt 1140 ggcggtacgg tacgtatcgt tatcaacaac caggttggtt tcaccacctc taatccgctg 1200 gatgcccgtt ctacgccgta ctgtactgat atcggcaaga tggttcaggc accgattttc 1260 ccgttaacg cggacgatcc ggaagccgtt gcctttgtga cccgtctggc gctcgatttc 1320 cgtaacacct ttaaacgtga tgtcttcatc gacctggtat gctaccgccg tcacggccac 1380 aacgaagccg acgagccgag cgcaacccag ccgctgatgt atcagaaaat caaaaaacat 1440 ccgacaccgc gcaaaatcta cgctgacaag ctggagcagg aaaaagtggc gacgctggaa 1500 gatgccaccg agatggttaa cctgtaccgc gatgcgctgg atgctggcga ttgcgtggta 1560 gcagagtggc gtccgatgaa catgcactct ttcacctggt cgccgtacct caaccacgaa 1620 tgggacgaag agtacccgaa caaagttgag atgaagcgcc tgcaggaact ggctaaacgc 1680 atcagcacgg tgccggaagc ggttgaaatg cagtctcgcg ttgccaagat ttatggcgat 1740 cgccaggcga tggctgccgg tgagaaactg ttcgactggg gcggcgcgga aaacctcgct 1800 tacgccacgc tggttgacga aggcattccg gttcgcctgt cgggtgaaga ctccggtcgc 1860 ggtaccttct tccaccgcca cgcggtgatc cacaaccagt ctaacggttc cacttacacg 1920 ccgctgcaac acatccataa cggccagggc gcgttccgtg tttgggactc cgtactgtct 1980 gaagaagcag tgctggcgtt tgaatacggt tatgccaccg cagaaccacg caccctgacc 2040 atctgggaag cgcagttcgg tgacttcgcc aacggtgcgc aggtggttat cgaccagttc 2100 atctcctctg gcgagcagaa atggggccgg atgtgtggtc tggtgatgtt gctgccgcac 2160 ggttacgaag ggcaggggcc ggagcactcc tccgcgcgtc tggaacgtta tctgcaactt 2220 tgtgctgagc aaaacatgca ggtttgcgta ccgtctaccc cggcacaggt ttaccacatg 2280 ctgcgtcgtc aggcgctgcg cgggatgcgt cgtccgctgg tcgtgatgtc gccgaaatcc 2340 ctgctgcgtc atccgctggc ggtttccagc ctcgaagaac tggcgaacgg caccttcctg 2400 ccagccatcg gtgaaatcga cgagcttgat ccgaagggcg tgaagcgcgt agtaatgtgt 2460 tctggtaagg tttattacga cctgctggaa cagcgtcgta agaacaatca acacgatgtc 2520 gccattgtgc gtatcgagca actctacccg ttcccgcata aagcgatgca ggaagtgttg 2580 cagcagtttg ctcacgtcaa ggattttgtc tggtgccagg aagagccgct caaccagggc 2640 gcatggtact gcagccagca tcatttccgt gaagtgattc cgtttggggc ttctctgcgt 2700 tatgcaggcc gcccggcctc cgcctctccg gcggtagggt atatgtccgt tcaccagaaa 2760 cagcagcaag atctggttaa tgacgcgctg aacgtcgaat aa 2802 <210> 45 <211> 1263 <212> DNA <213> Artificial Sequence <220> <223> modified hemA gene from Salmonella typhimurium <400> 45 atgaccaaga agcttttagc gctcggtatt aaccataaaa cggcacctgt atcgctgcga 60 gaacgcgtaa cgttttcgcc ggacacgctt gatcaggcgc tggacagcct gcttgcgcag 120 ccaatggtgc agggcggggt cgtgctgtca acctgtaacc gtacagagct gtatctgagc 180 gtggaagagc aggataacct gcaggaagcg ctgatccgct ggttatgcga ttaccataac 240 ctgaacgagg acgatctgcg caacagtctg tactggcatc aggacaatga cgccgtcagc 300 cacctgatgc gcgtcgccag cggtctggat tcactggtgc tgggcgaacc gcaaatcctc 360 ggtcaggtga aaaaagcgtt tgcggattcg caaaaaggcc accttaacgc cagcgcgctg 420 gagcgaatgt ttcagaagtc tttttccgtc gccaagcgag tgcggactga aaccgatatc 480 ggcgccagcg ccgtctccgt cgcgtttgcc gcctgtacgc tcgcccgcca aatctttgaa 540 tcgctgtcga cggtcactgt actgttagtt ggcgcgggcg aaaccattga actggtggcg 600 cgtcacctgc gcgagcataa agtacaaaag atgattatcg ccaaccgaac ccgcgagcgc 660 gcgcaagccc tggcggatga ggtaggcgct gaggttatct cgctcagcga tatcgacgcc 720 cgtttgcagg atgccgatat tatcatcagt tcgaccgcca gcccgctgcc gattatcggt 780 aaaggcatgg tggagcgcgc attaaaaagc cgtcgtaatc agccgatgct gctggtggat 840 atcgccgtac cacgtgacgt tgagccggaa gtcggcaaac tggcgaacgc ttatctttat 900 agcgtcgatg atttacagag cattatttcg cataatctgg cgcagcgtca ggctgctgca 960 gtagaagcgg aaacgattgt tgagcaggaa gccagcgagt ttatggcctg gctacgcgcc 1020 cgggggcca gcgagaccat tcgggaatac cgtagtcagt cggagcagat tcgtgacgaa 1080 ctgactacca aagcgctgtc agcccttcaa cagggcggcg atgcgcaagc catcttgcag 1140 gatctggcat ggaaactgac caaccgcctg attcatgcgc caacgaaatc acttcaacag 1200 gctgcccgtg acggggatga cgaacgcctg aatattctgc gcgacagcct cgggctggag 1260 tag 1263 <210> 46 <211> 1281 <212> DNA <213> Artificial Sequence <220> <223> wild type hemL gene from Escherichia coli W <400> 46 atgagtaagt ctgaaaatct ttacagcgca gcgcgcgagc tgatccctgg cggtgtgaac 60 tcccctgttc gcgcctttac tggcgtgggc ggcactccac tgtttatcga aaaagcggac 120 ggcgcctatc tgtacgatgt tgatggcaaa gcctatatcg attatgtcgg ttcctggggg 180 ccgatggtgc tgggccataa ccatccggcg atccgcaatg ccgtgattga agccgccgag 240 cgtggtttaa gctttggtgc accaaccgaa atggaagtga aaatggcgca actggtgacc 300 gaactggtcc cgaccatgga tatggtgcgc atggtgaact ccggcactga agcgaccatg 360 agcgccatcc gcctggcccg tggttttacc ggtcgcgaca aaatcattaa atttgaaggt 420 tgttaccacg gtcacgctga ctgcctgctg gtgaaagccg gttctggcgc actcacgtta 480 ggccagccaa actcgccggg tgttccggca gatttcgcca aacatacctt aacctgtact 540 tataacgatc tggcttctgt acgcgccgcg tttgagcaat acccgcaaga gattgcctgt 600 attatcgtcg agccggtggc aggcaatatg aactgcgttc caccgctgcc agagttcctg 660 ccaggtctgc gcgcgctgtg cgacgaattt ggcgcattgc tgatcatcga tgaagtaatg 720 actggcttcc gcgtagcgct agctggcgca caggattatt acggtgtgga accggatctc 780 acctgcctgg gcaaaatcat cggcggtgga atgccggtag gcgcattcgg tggtcgtcgt 840 gatgtaatgg atgcgctggc cccgacgggt ccggtctatc aggcgggtac gctttccggt 900 aacccaattg cgatggcagc gggtttcgcc tgtctgaatg aagtcgcgca gccgggcgtt 960 cacgaaacgt tggatgagct gacatcacgt ctggcagaag gtctgctgga agcggcagaa 1020 gaagccggaa ttccgctggt cgttaaccac gttggcggca tgttcggtat tttctttacc 1080 gcgccgagt ccgtgacgtg ctatcaggat gtgatggcct gtgacgtgga acgctttaag 1140 cgtttcttcc atatgatgct ggatgaaggt gtttacctgg caccgtcagc gtttgaagcg 1200 ggctttatgt ccgtggcgca cagcatggaa gatatcaata acaccatcga tgctgcacgt 1260 cgggtgtttg cgaagttgtg a 1281

Claims (18)

AceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, and an aceA gene.
The cassette according to claim 1, wherein the synthetic 5'UTR is for regulating the expression amount of the aceA gene and is represented by the nucleotide sequence of SEQ ID NO: 4.
A first recombinant vector comprising the aceA gene expression cassette of claim 1.
A recombinant microorganism for producing 5-aminolevulinic acid (ALA), wherein the first recombinant vector of claim 3 is introduced.
5. The recombinant microorganism according to claim 4, wherein the microorganism is Escherichia sp. Microorganism, for producing 5-aminolevulinic acid (ALA).
5. The recombinant microorganism for producing 5-aminolevulinic acid (ALA) according to claim 4, wherein the first recombinant vector further comprises a synthetic 5'UTR, a promoter represented by SEQ ID NO: 39 and a gltA gene. .
7. The recombinant microorganism for producing 5-aminolevulinic acid (ALA) according to claim 6, wherein the synthetic 5'UTR is for regulating the expression amount of the gltA gene and is represented by the nucleotide sequence of SEQ ID NO: .
5. The recombinant microorganism according to claim 4, wherein the recombinant microorganism is a recombinant microorganism for producing 5-aminolevulinic acid (ALA).
6. The recombinant microorganism according to claim 4, wherein the recombinant microorganism further comprises a second recombinant vector comprising a synthetic 5'UTR, a tac promoter and a hemA gene, wherein the recombinant microorganism for producing 5-aminolevulinic acid (ALA) .
10. The recombinant microorganism for producing 5-aminolevulinic acid (ALA) according to claim 9, wherein the synthetic 5'UTR is for regulating the expression level of the hemA gene and is represented by the nucleotide sequence of SEQ ID NO: .
11. The method according to claim 9, wherein the synthetic 5'UTR is designed so that the predicted expression amount (au) of the hemA gene is 500,000 or more and 5,000,000 or less. The recombinant microorganism for producing 5-aminolevulinic acid (ALA) .
10. The recombinant microorganism according to claim 9, wherein the second recombinant vector further comprises a synthetic 5'UTR, a tac promoter and a hemL gene.
14. The recombinant microorganism for producing 5-aminolevulinic acid (ALA) according to claim 12, wherein the synthetic 5'UTR is for regulating the expression level of the hemL gene and is represented by the nucleotide sequence of SEQ ID NO: .
13. The recombinant microorganism for producing 5-aminolevulinic acid (ALA) according to claim 12, wherein the synthetic 5'UTR is designed such that the predicted expression level (au) of the hemL gene is 500,000 or more and 5,000,000 or less.
a) deleting the sucA gene;
b) introducing an aceA gene expression cassette comprising a synthetic 5'UTR (untranslated region), one promoter selected from the group consisting of the promoters represented by SEQ ID NOS: 36 to 41, and an aceA gene; (ALA). &Lt; RTI ID = 0.0 &gt; 5. &lt; / RTI &gt;
16. The method of claim 15,
c) introducing a promoter, a synthetic 5'UTR and a gltA gene expression cassette;
d) introducing a promoter, a synthetic 5'UTR and a hemA gene expression cassette; And
e) introducing a promoter, a synthetic 5'UTR and a hemL gene expression cassette; (ALA). &Lt; RTI ID = 0.0 &gt; 5. &lt; / RTI &gt;
Culturing the recombinant microorganism of any one of claims 4 to 14 in a culture medium containing glucose as a carbon source; Aminolevulinic acid (ALA).
18. The method according to claim 17, wherein the glucose is contained as a single carbon source in the culture medium.

Images