KR20200024804A - Immunogenic system and Animal vaccine thereof - Google Patents

Abstract

The present application provides various embodiments and uses of an immunogenic material targeting pathogens of a particular animal disease, an immunogenic system, and an animal vaccine composition comprising the immunogenic system. In a preferable embodiment, the present invention can be used in a vaccine, a medicinal drug, a feedstuff and the like for preventing, alleviating, and treating porcine infectious disease.

Description

Immunogenic system and animal vaccine including the same TECHNICAL FIELD

The present application relates to an immunogenic substance, an immunogenic system, and an animal vaccine composition including the same, targeting a pathogen of a specific disease in an animal.

Vaccine-related technologies for animals are not only for the prevention of livestock diseases, but also for pandemic zoonosis, such as biological weapons (pox, anthrax, etc.), SARS (severe acute respiratory syndrome), and AI (avian influenza). It has contributed a lot to the development of countermeasure technologies for Korea, and is recognized as a strategic industry nationally.

In the event of a new disease, if the cause of the disease is identified and it is determined that eradication is impossible, rapid development of a vaccine is required to reduce the damage of the disease. In this case, it is common that an inactivated vaccine is first developed and commercialized. If the gene of the disease causative agent is easily mutated, the effectiveness of the existing vaccine is reduced. Therefore, it is necessary to continuously monitor whether the pathogen gene is mutated.

In the case of Porcine Epidemic Diarrhea (PED) virus, which is a porcine diarrhea virus disease that is emerging as a chronic homework in domestic pig farms, both live poison, dead poison, and oral vaccines have been developed and used in Korea, but the field virus continues to adapt to the environment. It is difficult to eradicate because it mutates. That is, the vaccine using the pathogen of PEDV has a problem in that the immune effect is low due to the denaturation of the protein in the process of attenuating the pathogen, and cannot effectively respond to the mutant strain of PEDV. The PEDV wave of pig farms that occurred around September 2014 was caused by PEDV outdoor wines that were introduced into Korea around October 2013, and is a representative case in which the problems of the existing PEDV vaccine were revealed.

Porcine CircoVirus (PCV) has been occurring all over the world, starting with Canada in 1991, including the United States, France, Spain, Ireland, Denmark, United Kingdom, and Germany.In Asia, it has also been confirmed in Japan and Taiwan, including Korea. Became. PCV is known to be one of the causative agents of postweaning multi-systemic wasting syndrome (PMWS) by infection, and it is a virus that is difficult to eradicate when contaminated with pig farms.

The PRRS virus, which has severe outdoor mutations, is also one of the strains of concern. ND (Newcastle Disease), IB (Infectious Bronchitis), IBD (Infectious Bronchitis Disease), and AI (Avian Influenza) viruses, which are a problem in the poultry industry, have already been developed in Korea. As it progresses, new subtypes of genotype and serotype have been reported. It can be said that the key to technology development is to reduce the time difference and secure the homogeneity of the field disease agent and the vaccine antigen.

In the event that the inactivated vaccine is less effective, it is essential to develop a live vaccine to supplement it, but it takes a lot of time and cost to secure a master seed capable of live vaccine from a pathogenic field virus.

As such, the existing killed vaccine and live attenuated vaccine have various problems and limitations in the process of combating livestock diseases, and exchanges between countries are rapidly expanding and the borders of livestock infectious diseases. In a situation where the concept becomes more sparse, the competition for technology development between countries is becoming more intense, and the intellectual ownership for technology preoccupation is also strengthening.

Therefore, there is a need to develop a vaccine that minimizes side effects and maximizes efficacy by harmonizing the existing traditional vaccine manufacturing methods and advanced molecular biological methods.

1. Korean Patent Registration No. 10-0578395 2. Korean Patent Registration No. 10-0267745 3. Japanese Patent Publication 2008-231063 4. WO 2016-140702

1. Microbiol Spectr. 2014 Oct;2(5). doi: 10.1128/microbiolspec. TBS-0011-2012. 2. J Bacteriol. 2001 Nov; 183(21): 6294-6301. Surface Display of Recombinant Proteins on Bacillus subtilis Spores 3. Vaccine. 2004 Mar 12;22(9-10):1177-87. Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner. 4. Microbiology. 2009 Feb;155(Pt 2):338-46, Phagocytosis, germination and killing of Bacillus subtilis spores presenting heterologous antigens in human macrophages. 5. Sun D et al., Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet Microbiol. 2008;131(1-2):73-81. 6. Gallagher TM, Buchmeier MJ. Coronavirus spike proteins in viral entry and pathogenesis. Virology. 2001;279(2):371-4. 7. Tsuda T. Porcine epidemic diarrhea: its diagnosis and control. Proc Jpn Pig Vet Soc. 1997;31:21-8. 8. Georgiou, G. et al., Display of heterologous proteins on the surface of microorganisms: From the screening of combinatorial libraries to live recombinant vaccines. Nature Biotechnology 15:29-34 (1997)

The object of the present application is to provide various aspects and various uses of an immunogenic substance, an immunogenic system, and an animal vaccine composition including the same, targeting pathogens of specific diseases of animals.

One object is to provide an animal vaccine against disease-causing pathogens and a method of manufacturing the same.

Another object is to provide an immunogenic system against disease-causing pathogens.

Another object is to provide an immunogenic spore system.

Another object is to provide a vaccine against PEDV and an immunogenic system therefor.

In addition, it includes all available uses with respect to immunogenic substances, immunogenic systems and animal vaccine compositions targeting pathogens of specific diseases in animals.

In order to achieve the above object, this application

i) spores of spore bacteria,

ii) a spore coat protein present in the outer spore region of the spore,

ii) the swine disease virus immune site fused to the spore coat protein

Including

At this time, the porcine disease virus provides an immunogenic spore fusion display system that is one or more of Porcine Epidemic Diarrhea Virus (PEDV) and Porcine Circovirus (PCV).

In addition, this application

i) Immunogenic spore fusion display system, characterized in that the immunogenic sites derived from Porcine Epidemic Diarrhea Virus (PEDV) and Porcine Circovirus (PCV) are fused to the spore coat protein,

ii) carrier that delivers the immunogenic spore fusion display system

It includes, and provides a vaccine composition, characterized in that the concentration of the immunogenic spore fusion display system is 10 ¹² ~ 10 ^{14 /ml concentration.}

In addition, the present application provides two primer sets selected from SEQ ID NOs: 1 to 4 for obtaining immunogenic sites of outdoor strains of Porcine Epidemic Diarrhea Virus (PEDV).

In addition, the present application provides two primer sets selected from SEQ ID NOs: 41 to 46 for obtaining immunogenic sites of porcine circovirus (PCV) outdoor strains.

In addition, this application is a spore system expression purpose base sequence

i) a spore coat protein present in the spore outer region of the spore, and

ii) Any one or more immunogenic sites of Porcine Epidemic Diarrhea Virus (PEDV) or Porcine Circovirus (PCV) fused to the spore coat protein

It provides a spore system recombination expression vector comprising a nucleotide encoding

In addition, the present application is an immunogenic spore fusion display system characterized in that the immunogenic site derived from Porcine Epidemic Diarrhea Virus (PEDV) or Porcine Circovirus (PCV) is fused to a spore coat protein. ^It provides a method of treating PEDV-infected animals excluding humans, characterized in that 2 ml of a vaccine composition containing 12 to 10 ^{14 pieces/ml is administered.}

It relates to a composition comprising an animal disease-causing agent (antigen) with enhanced immunogenicity and a method of using the same. The compositions and methods described herein enhance the immunogenic response of animals, preferably livestock, e.g. pigs, to antigens, thereby enhancing the protection of animals against certain disease infections.

When using the technology of the present application, there is a characteristic that the expression rate and acquisition rate are superior to that of the existing expression system. In addition, when the recombinant protein produced from the recombinant cell line is used as an antigen, it can effectively induce an immune response, so it is useful for vaccines, medicines, and feed for the prevention, improvement and treatment of diseases in livestock (eg, pigs). Can be used.

1 is a schematic diagram showing the structure of a pathogen.
Figure 2 is a schematic diagram showing the structure of the 1-antigen protein and 2-antigen protein on the pathogen.
Figure 3 is a graph showing the location of the immunogenic site of the 1-antigen protein (spike protein) of the PEDV pathogen
4 is an exemplary graph of an antigenic homologous protein including an immunogenic site.
5 is an exemplary graph of an antigenic homologous protein comprising at least two selected from immunogenic site-1 to immunogenic site-n.
6 is an exemplary graph of an antigenic homologous protein including an immunogenic site and a non-immunogenic site.
7 is an exemplary graph of an antigenic homologous protein comprising at least two selected from the 1-immunogenic site to the m-immunogenic site.
8 is an exemplary graph of an antigenic homologous addition protein including a non-antigenic portion and a site homologous to an antigenic protein.
9 is an exemplary graph of an antigenic homologous addition protein including a site homologous to an antigenic protein and a foreign part.
FIG. 10 is an exemplary graph of an antigenic homologous additional protein including a region homologous to an antigenic protein, a non-antigenous region, and a foreign region.
11 is a schematic diagram showing the structure of an immunogenic internal supporting system among immunogenic systems.
12 is a schematic diagram showing the structure of an immunogenic fusion display system among immunogenic systems.
13 is a schematic diagram showing the structure of an immunogenic coupling display system among immunogenic systems.
14 is a schematic diagram showing the structure of an immunogenic adhesion display system among immunogenic systems.
15 is a schematic diagram showing the structure of an immunogenic cross-linked display system among immunogenic systems.
16 is a schematic diagram of a serial connection system in which an aspect of a fusion display system is selected as an example among systems.
17 is a schematic diagram of a parallel system in which an aspect of a fusion display system is selected as an example among systems.
18 is an exemplary schematic diagram of an antigen homologous protein recombination expression vector in which an immunogenic expression target base sequence includes an immunogenic site.
19 is an exemplary schematic diagram of an antigenic homologous protein recombination expression vector including two or more nucleotide sequences selected from immunogenic site-1 to immunogenic site-n as an immunogenic expression target base sequence.
FIG. 20 is an exemplary schematic diagram of an antigenic homologous protein recombination expression vector comprising two or more nucleotide sequences selected from the 1-immunogenic site to the m-immunogenic site in which the target immunogenic expression target base sequence.
FIG. 21 is an exemplary schematic diagram of a pathogen-like particle recombination expression vector, which is an example of an antigen homologous additional protein recombination expression vector in which an immunogenic expression target base sequence includes an immunogenic site and a base sequence of a non-antigenic site.
FIG. 22 is an exemplary schematic diagram of an auxiliary immunogenic supplementary recombination expression vector, which is an example of an antigenic homologous supplementary protein recombination expression vector including an immunogenic site and a non-antigenic base sequence.
23 is an exemplary schematic diagram of a multivalent immunogenic recombination expression vector, which is an example of an antigenic homologous additional protein recombination expression vector including an immunogenic site and a nucleotide sequence of a foreign site in which the immunogenic expression target base sequence is an immunogenic site.
Fig. 24 is an exemplary schematic diagram of a multivalent pathogen-like particle recombination expression vector, which is an example of an antigenic homologous additional protein recombination expression vector including an immunogenic site and a nucleotide sequence of a foreign site in which the target base sequence for immunogenic expression is immunogenic.
FIG. 25 is an exemplary schematic diagram of an immunogenic serial connector recombination expression vector in which the component expression target base sequence includes the base sequence of the x-th protein and the y-th junction:
a-1: first protein, b-1: first connector, a-2: second protein, b-2: second connector, a-3: third protein, b-3: third connector, a- 4: fourth protein, b-4: fourth connection part, a-5: fifth protein
26 is a schematic diagram of a system recombination expression vector of an immunogenic serial-connected system that exemplarily selects the mode of the fusion display system among the systems, and the target base sequence of the system includes the base sequence of the surface initiator, the fusion part, and the immunogenic serial connector. It refers to an immunogenic serial-linked system recombination expression vector.
Fig. 27 is a schematic diagram of an immunogenic serial connection system expressed by the immunogenic serial connection system recombination expression vector of Fig. 26;
28 is an example of a single immunogenic parallel system recombination expression vector using a system of multiple parallel bodies as a system expression target base sequence, wherein the first parallel body is an internal support system, and the second parallel body and the third parallel body are fusion display systems. It is a schematic diagram of a recombination expression vector of a phosphorus immunogenic parallel system.
29 is a schematic diagram of an immunogenic parallel system expressed by the immunogenic parallel system recombination expression vector of FIG. 28. FIG.
FIG. 30 is an exemplary schematic diagram of a recombination expression vector of an immunogenic spore-bearing system in which a spore system expression target base sequence includes a base sequence of a spore-bearing surface inverse substance.
FIG. 31 is an exemplary schematic diagram of a recombination expression vector of an immunogenic intraspore-bearing system including a base sequence of a substance having a charge with an inverse substance when the spore system expression target base sequence is spore-bearing.
FIG. 32 is an exemplary schematic diagram of an immunogenic spore fusion display system recombination expression vector in which a spore system expression target base sequence includes a spore surface initiator and a nucleotide sequence of a spore fusion immunogenic substance.
Hereinafter, FIGS. 33 to 37 are examples of FIG. 32.
33 is an exemplary schematic diagram of an immunogenic spore fusion display system recombination expression vector in which a spore system expression target base sequence includes a plurality of spore external homology sites and a base sequence of a spore fusion immunogenic substance.
Fig. 34 is an exemplary illustration of a recombination expression vector of an immunogenic spore fusion display system in which a spore system expression target base sequence includes a part including a spore external signal sequence of another protein, a spore external homology site, and a nucleotide sequence of a spore fusion immunogenic substance. It is a schematic diagram.
FIG. 35 is an example of a recombination expression vector in an immunogenic spore fusion display system including a part of the spore system expression target base sequence including a spore external localization motif of another protein, a spore external homology site, and a base sequence of a spore fusion immunogenic substance It is a schematic diagram of the enemy.
Figure 36 is a spore system expression target base sequence including a part of the spore-external localization motif of a heterogeneous spore external protein, a spore-external homology site, and an immunogenic spore fusion display system recombination expression vector including the base sequence of a spore fusion immunogenic substance It is an exemplary schematic diagram of.
37 is an exemplary schematic diagram of an immunogenic spore fusion display system recombination expression vector including a spore foreign part, a spore external homology site, and a nucleotide sequence of a spore fusion immunogenic substance in which a spore system expression target base sequence carries a charge of a specific sign to be.
38 is an exemplary schematic diagram of an immunogenic spore attachment display system recombination expression vector in which a spore system expression target base sequence includes a base sequence of a spore-attached immunogenic substance.
39 is an exemplary schematic diagram of an immunogenic spore attachment display system recombination expression vector including the base sequence of a spore-attached immunogenic substance and a substance having a charge in the spore system expression target base sequence.
40 is a system diagram showing a process of selecting vaccine strains to be subject to a master vaccine by using a phylogenetic tree by multiple alignment.
FIG. 41 is a fluorescence microscope photograph for determining whether Bacillus was transformed when CotG was used to prepare a PEDV vaccine.
42 is a graph showing the results of a flow cytometry experiment to determine whether Bacillus was transformed when CotG was used when preparing a PEDV vaccine.
43 is an optical micrograph of Bacillus taken after Malachite green statining in order to determine whether Bacillus was expressed as spores when CotG was used when preparing a PEDV vaccine.
44 is a graph showing the results of a Pronase treatment experiment to confirm that GFP was expressed on the spore surface when CotG was used in the preparation of the PEDV vaccine.
45 is a graph showing the results of an experiment for confirming an immune response when CotG was used when preparing a PEDV vaccine.
46 is a graph showing the results of an immunoblotting assay for confirming the generation of antigen-specific antibodies when CotG was used in the production of a PEDV vaccine.
47 is a fluorescence microscope photograph to determine whether Bacillus was transformed when CotB was used to prepare a PEDV vaccine.
48 is a graph showing the results of a flow cytometry experiment to determine whether Bacillus was transformed when CotB was used when preparing a PEDV vaccine.
49 is an optical micrograph of Bacillus taken after performing Malachite green statining in order to determine whether Bacillus was expressed as spores when CotB was used to prepare a PEDV vaccine.
50 is a graph showing the results of an experiment to confirm an immune response when CotB was used when preparing a PEDV vaccine.
FIG. 51 is a graph showing the results of an immunoblotting assay for confirming the generation of antigen-specific antibodies when CotB was used when preparing a PEDV vaccine.
52 is a fluorescence microscope photograph to determine whether Bacillus was transformed when CotC was used to prepare a PEDV vaccine.
53 is a graph showing the results of a flow cytometry experiment to determine whether Bacillus was transformed when CotC was used when preparing a PEDV vaccine.
FIG. 54 is an optical micrograph of Bacillus taken after Malachite green statining to determine whether Bacillus was expressed as spores when CotC was used to prepare a PEDV vaccine.
55 is a graph showing the results of an experiment to confirm an immune response when CotC was used to prepare a PEDV vaccine.
56 is a graph showing the results of an immunoblotting assay experiment for confirming the generation of antigen-specific antibodies when CotC was used when preparing a PEDV vaccine.
57 is a graph showing the results of a flow cytometry experiment to determine whether Bacillus was transformed when CotG was used when preparing a PCV vaccine.
58 is a graph showing the results of a flow cytometry experiment to determine whether Bacillus was transformed when CotB was used when preparing a PCV vaccine.
59 is a graph showing the results of a flow cytometry experiment to determine whether Bacillus was transformed when CotC was used when preparing a PCV vaccine.
FIG. 60 is a graph showing the results of an immune response confirmation experiment when PCV-2A is used when preparing a PCV vaccine.
61 is a graph showing the results of an immune response confirmation experiment when PCV-2B is used in the preparation of a PCV vaccine.
FIG. 62 is a graph showing the results of an immune response confirmation experiment when PCV-m2B was used when preparing a PCV vaccine.
63 is a graph showing the results of an immunoblotting assay for confirming the generation of antigen-specific antibodies when PCV-2A is used in the production of a PCV vaccine.
FIG. 64 is a graph showing the results of an immunoblotting assay for confirming the generation of antigen-specific antibodies when PCV-2B was used when preparing a PCV vaccine.
FIG. 65 is a graph showing the results of an immunoblotting assay for confirming the generation of antigen-specific antibodies when PCV-m2B is used when preparing a PCV vaccine.

The present application relates to substances, systems and methods involved in the immune response. In particular, it is involved in the mechanism of the immune response that occurs due to infection by pathogens.

Diseases caused by pathogens have been the leading cause of death of living organisms on Earth, including humans and animals, regardless of history and region.

When a living body is infected with a pathogen, an immune process occurs that kills or neutralizes the pathogen. In general, the immune process proceeds to cellular immunity and humoral immunity. Cellular immunity is immunity in which cytotoxic T cells individually kill pathogen-infected cells. First, the pathogen-infected cells use the MHC-I protein to initiate the pathogen's antigen on the cell surface, and the cytotoxic T cells recognize it and induce apoptosis. Humoral immunity is immunity that kills pathogens by producing antibodies against antigens. First, dendritic cells, macrophages, and B cells fed with the antigen of the pathogen initiate the antigen on the cell surface using the MHC-II protein. It secretes kine and activates B cells and cytotoxic T cells by cytokines. Activated B cells differentiate into plasma cells and memory B cells and are involved in the production of antibodies. B cells differentiated into plasma cells function to kill pathogens by producing antibodies against antigens. B cells differentiated into memory B cells do not produce antibodies, but exist in body fluids, and when pathogens re-invade, they re-differentiate into plasma cells and memory B cells.

The immune response exhibits a peculiar pattern of primary and secondary immunity when a living body is first infected with a pathogen and when it is secondary infection. When first infected with a pathogen, since memory B cells do not exist, a small number of plasma cells are generated, and thus primary immunity occurs in which the concentration of antibody slowly rises. However, when infected with a pathogen after the first immunization, memory B cells created in the first immunization process immediately differentiate into plasma cells, resulting in a secondary immunity, that is, acquired immunity, in which the concentration of antibody rapidly rises. Therefore, when a living body undergoes the first immunization by the initial infection, it more efficiently copes with the pathogen through the acquired immunity. Vaccines function to induce the organism to produce these memory B cells without being infected with the pathogen to show acquired immunity against the pathogen.

The dramatic reduction in the threat of disease caused by pathogens is coupled with the development of these vaccines.

Existing vaccines can be classified according to which immunogenic substances they contain. First, there is a form that uses the pathogen itself. The first vaccine was in the form of using a wild pathogen diluted in a solution, but had a disadvantage of high risk of disease infection. To solve this problem, existing vaccines are used to reduce pathogenicity by chemically treating pathogens and genetically modifying them. Second, there is a form that uses only the antigenic protein or surface protein of the pathogen. Antigen proteins have the advantage of being less pathogenic than pathogens. Antigen proteins are either isolated from pathogens or produced by genetic engineering methods.

The present application relates to an immunogenic substance, an immunogenic system, and an animal vaccine composition including the same, targeting a pathogen of a specific disease in an animal.

Preferably, it relates to a genetically modified immunogenic system using only the antigenic protein or surface protein of the pathogen, and a genetically recombinant animal vaccine composition comprising the same. But,

One aspect of the present application relates to a vaccine.

"Vaccine" refers to a substance or antigen that forms an acquired immunity against a specific disease to an administered organism.

"Adaptive immune system" refers to an immune state present in memory B cells differentiated by a specific antigen as cellular immunity of a living body.

"Immunogen" refers to a substance that causes immunity in vivo as a component of a vaccine.

"Native" means a state in which matter is obtained in nature without artificial manipulation.

[Immunogen]

One embodiment of the present application is a vaccine containing an immunogenic substance.

The immunogenic substance includes all substances capable of causing an acquired immune response, and may be, for example, a pathogen, an antigen protein, an antigen homology protein, or an antigen homology addition protein.

1) pathogen

"Pathogen" is a collective term that refers to an individual that causes diseases in living organisms, including viruses, bacteria, fungi, algae, and the like.

"Virulence portion" means a site that exhibits virulence as part of a pathogen.

The “maintenance portion” refers to a site involved in metabolism or proliferation as part of a pathogen.

An example of the present application may be a vaccine containing the pathogen itself as an immunogenic material.

The pathogen may disclose one or more antigenic proteins on the outer membrane of the pathogen, and the antigenic protein may be only one type, but several types of proteins may function as antigenic proteins. Pathogens containing these antigenic proteins can be used as immunogenic substances for vaccines.

In one embodiment the pathogen may be in the wild state.

In other embodiments, the pathogen may be a deletion/modification of a specific site. In this case, the specific site may be a virulence site. Also, a specific site may be a viable site. In addition, the specific site may be an immunogenic site in the antigenic protein.

In other embodiments, the pathogen may have a modified or engineered structure. The transformation and manipulation can be made naturally or artificially. At this time, the overall structure of the pathogen may have 80% to 100% homology with the wild pathogen. Preferably, the homology is 90 to 100%, more preferably 95 to 100%.

In one embodiment, the pathogen may be a virus belonging to the same family.

At this time, the same family may be the coronavirus family (Coronaviridae).

Also, the same family may be Arteriviridae.

Also, the same family may be Circoviridae.

Also, the same family may be Paramyxoviridae.

In one embodiment, the pathogen may be a pathogen of a disease targeting pigs.

At this time, the pathogen of the disease targeting pigs may be Porcine Epidemic Diarrhea Virus (PEDV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Porcine Circovirus (PCV).

In one embodiment, the pathogen may be a pathogen of a disease targeting poultry.

At this time, pathogens of diseases targeting poultry may be Infectious Bronchitis Virus (IBV) or Newcastle Disease Virus (NDV).

Pathogen structure

"Antigen protein" means a protein that causes immunity in vivo as part of a pathogen.

"Non-antigenic part" refers to any part of the structure of a pathogen except for an antigenic protein.

“Immunogenic portion” refers to a site in an antigenic protein that specifically causes an immune response.

The "non-immunogenic portion" refers to a portion of an antigenic protein excluding an immunogenic portion.

As shown in Fig. 1, the structure of the pathogen can be largely divided into an antigenic protein that causes immunity and a non-antigenic portion. An antigenic protein may be of more than one type in a pathogen.

Each antigenic protein is divided into an immunogenic site and a non-immunogenic site. There may be more than one type of immunogenic site within a type of antigenic protein.

The non-antigenic part refers to the nucleotide sequence/protein compartment of the pathogen excluding the antigenic protein portion in the full-length sequence of the pathogen, and includes the capsid protein of the pathogen.

2) antigenic protein

In the following specification, the following definitions are used.

"x-antigen protein" is an antigenic protein and refers to the xth of m kinds of antigenic proteins in a specific pathogen.

"x-immunogenic site-y" is an immunogenic site and is present on the x-th antigen protein among m types of antigenic proteins in a specific pathogen, and is the y-th immunity among n types of immunogenic sites on the x-th antigen protein. It means the original site.

"x-non-immunogenic site" refers to a non-immunogenic site present on the x-th antigen protein among m kinds of antigenic proteins in a specific pathogen as a non-immunogenic site.

At this time, if there is no specific description for x and y, it means that it is any one antigenic protein, immunogenic site, or non-immunogenic site.

An example of the present application may be a vaccine containing the antigenic protein as an immunogenic material.

In one embodiment, the antigenic protein may be one type of antigenic protein. In this case, the antigenic protein may be in a wild state.

In addition, the antigenic protein may have a specific site modified or manipulated. The transformation and manipulation can be made naturally or artificially. In this case, the specific site may be an immunogenic site.

In another embodiment, the antigenic protein may be a mixture of two or more selected from 1-antigen protein to m-antigen protein.

In one embodiment of the present application, the antigenic protein is an antigenic protein of PEDV.

The antigenic protein of PEDV is known as a spike protein. The PEDV Spike protein is a type I glycoprotein composed of 1,388 amino acids (aa). Spike proteins can be divided into S1 (1-794 aa) and S2 (794-1,388 aa) domains based on their homology with the spike proteins of other coronaviruses. Spike proteins in coronaviruses are surface antigens, where they regulate interactions with host cell receptor glycoproteins to mediate viral entry, and play a role in stimulating the induction of neutralizing antibodies in natural hosts. Thus, the spike glycoprotein is a primary target for the development of effective vaccines against PEDV.

SEQ ID NO: 1 is the protein sequence of the spike protein of the CV777 strain of PEDV. Unless otherwise specified, the description of the sequence of all antigenic proteins and the location of the immunogenic site is based on the CV777 strain (ncbi Accession no. JN599150.1). However, this is only a reference and the application is not limited to the CV777 share.

For example, the sequence of SEQ ID NO: 17 was used as a partial sequence of the Spike 1 protein.

For example, the sequence of SEQ ID NO: 18 was used as a partial sequence of the Spike 2 protein.

In the present application, when describing PEDV, 1-antigen protein refers to a spike protein. In addition, it is known that the M protein and N protein of PEDV can be used as antigenic proteins, and other antigenic proteins can be found. In this case, the new antigenic protein can only be naturally included as 3-antigen protein or x-antigen protein as needed, but it should not be considered that it is not the subject of the present application.

In another embodiment of the present application, the antigenic protein is an antigenic protein of PCV.

The antigenic protein may be a capsid protein.

The capsid protein of the PCV may include ORF1, ORF2, ORF3, ORF4, but is not limited thereto.

For example, the capsid protein of the PCV may be ORF2.

For example, SEQ ID NO: 47 was used as the sequence of the capsid protein.

The PCV may be classified into genotypes such as PCV2A, PCV2B, PCVm2B, PCV2C, and PCV2D, but is not limited thereto.

For example, the PCV of the present application may be any one or more selected from PCV2A, PCV2B, and PCVm2B.

In addition, antigenic proteins other than the capsid protein may be found. Such cases are also included as the subject of the present application.

Immunogenic site

As shown in Fig. 2, the antigenic protein specifically includes an immunogenic site, which is a site that strongly raises immunity. The immunogenic site may be a specific site of an antigenic protein, and varies in size from 6aa to 300aa. In general, the immunogenic site of a pathogen can be easily found through papers.

For example, the immunogenic sites of PEDV are known as 504 to 643aa (COE), 753 to 760 (SS2), 769 to 776 (SS6), and 1373 to 1379 (2C10) based on the CV777 strain (see Fig. 3). .

In an embodiment of the present application, the immunogenic site of the spike protein of PEDV is 504 to 643aa (COE, 1-immunogenic site-1), 753 to 760 (SS2, 1-immunogenic site- 2), 769~776 (SS6, 1-immunogenic site-3), 1373-1379 (2C10, 1-immunogenic site-4).

In addition, when there is a new antigenic protein of PEDV, the immunogenic site of the new antigenic protein may be included as x-immunogenic site-1 to x-immunogenic site-y, if necessary.

For example, the immunogenic site of PCV may be a fragment of any one or more proteins and/or polynucleotides selected from ORF1, ORF2, ORF3 and ORF4.

For example, the form of any one or more proteins and/or polynucleotides selected from ORF1, ORF2, ORF3 and ORF4 may be included, but is not limited thereto.

In addition, when there is a new antigenic protein of PCV, the immunogenic site of the new antigenic protein may be included as x-immunogenic site-1 to x-immunogenic site-y, if necessary.

3) antigen homologous protein

"Antigen homologous protein" means a protein that is homologous to the structure of an antigenic protein.

An example of the present application may be a vaccine containing the antigen homologous protein as an immunogenic material.

In one embodiment, the antigen homologous protein may include an immunogenic site.

In another embodiment, the antigen homologous protein may include two or more selected from immunogenic site-1 to immunogenic site-n. In this case, the sequence of the immunogenic sites may be different from that of the wild-state antigen protein.

In another embodiment, the antigenic homologous protein may include an immunogenic site and a non-immunogenic site.

In this case, the non-immunogenic site may be located in front of the N-terminal of the immunogenic site. In addition, the non-immunogenic site may be located behind the C-terminus of the immunogenic site. In addition, the non-immunogenic site may be located at both the N and C-terminals of the immunogenic site. 4 is an illustration of an antigen homologous protein comprising a 1-immunogenic site-1 and a 1-non-immunogenic site at both the N and C-terminals of the immunogenic site-1 and the immunogenic site.

In this case, the non-immunogenic site may be a specific nucleotide sequence. In this case, the specific nucleotide sequence may have a size of 18bp, 22bp, 28bp, 31bp, and 36bp. Preferably, the specific base sequence has a size of 18 to 22 bp.

In another embodiment, the antigen homologous protein may include two or more selected from 1-immunogenic sites to m-immunogenic sites.

In this case, the antigen homologous protein may have a non-immunogenic site located at both the N and C terminals. At this time, the non-immunogenic site may be a specific nucleotide sequence. In this case, the specific nucleotide sequence may have a size of 18bp, 22bp, 28bp, 31bp, and 36bp. Preferably, the specific base sequence has a size of 18 to 22 bp. 5 is an illustration of an antigen homologous protein comprising 1-non-immunogenic sites at both the N and C terminals of 1-immunogenic sites-1 and 2 and 1-immunogenic sites-1.

In another embodiment, the antigen homologous protein may include at least one selected from 1-immunogenic site to m-immunogenic site and at least one selected from 1-non-immunogenic site to m-non-immunogenic site. .

In this case, the non-immunogenic site may be located at both the N and C terminals. At this time, the non-immunogenic site may be a specific nucleotide sequence. In this case, the specific nucleotide sequence may have a size of 18bp, 22bp, 28bp, 31bp, and 36bp. Preferably, the specific base sequence has a size of 18 to 22 bp. Figure 6 shows 1-immunogenic site-2 and 2-immunogenic site-1 and 1-immunogenic site-2 at the N-terminus of 1-non-immunogenic site, and 2-immunogenic site-1 at the C-terminus. It is an example of an antigenic homologous protein containing a non-immunogenic site. 7 is an illustration of antigen homology proteins including 1-immunogenic site-1, 2-immunogenic site-1 and 2-immunogenic site-2, 1-non-immunogenic site and 2-non-immunogenic site .

In an embodiment of the present application,

The immunogenic site may include 1-immunogenic sites-1 to 4 of PEDV.

In addition, the antigenic homologous protein of PEDV may include COE.

In addition, the antigenic homologous protein of PEDV may contain SS2 and COE in order.

In addition, the antigenic homologous protein of PEDV may include SS2 and SS6.

In addition, the antigenic homologous protein of PEDV may include the S1 domain of the Spike protein.

In addition, the antigenic homologous protein of PEDV may include the COE of the spike protein and the immunogenic site of the PEDV M protein.

In another embodiment of the present application,

The immunogenic site may include the capsid protein of PCV.

For example, the capsid protein of the PCV may be an antigen homologous protein.

For example, the antigenic homologous protein of the PCV may include ORF.

For example, the antigenic homologous protein of the PCV may include any one or more of ORF1, ORF2, ORF3, and ORF4.

For example, the PCV antigen homologous protein may include ORF2 of the capsid protein.

4) antigen homologous protein-contained additive body

"Antigen homologous protein contained additive body" refers to a protein that simultaneously contains the structure of the antigenic protein and a site having no homology with the structure of the antigenic protein. In other words, the additional protein containing antigenic homology refers to a form in which a site having no homology with the antigenic protein is additionally included in the antigenic homologous protein. The term "additive protein including antigenic homology" is used herein interchangeably with the term "antigenic homology additional protein".

“Foreign portion” refers to a protein or base sequence introduced from outside that does not exist in the original pathogen in the wild state.

An example of the present application may be a vaccine containing an additional protein containing antigenic homology as an immunogenic material.

The additional protein containing antigenic homology includes a site having no homology with the antigenic protein, and in this case, the site without homology may be a non-antigenic or foreign part of a pathogen.

In one embodiment, the antigenic homology-containing additional protein may include a site homologous to the antigenic protein and a non-antigenic portion. FIG. 8 is an illustration of an additional protein containing antigen homology including 1-immunogenic sites-1 and 2, 1-non-immunogenic sites, and non-antigenic sites.

The non-antigenic portion may be homologous to the outer membrane protein of the pathogen. In addition, the antigenic homology-containing additional protein may function as a pathogen-like particle. The pathogen-like particle may be a virus like particle.

In addition, the non-antigenic portion may function as an immune aid. In this case, the immune auxiliary function may be to promote the secretion of cytokines related to the immune response in the living body or to suppress the secretion of cytokines that inhibit the immune response. In addition, the immune auxiliary function may be to degrade the membrane of immune cells.

In one embodiment of the present application, the outer membrane protein of the pathogen may be the E protein of PEDV.

In another embodiment, the antigenic homology-containing additional protein may include a site homologous to the antigenic protein and a foreign portion. 9 is an illustration of additional proteins including antigen homology including 1-immunogenic site-1 and 2-immunogenic site-2, 1-non-immunogenic site, 2-non-immunogenic site, and foreign portion.

The foreign part may be an immunogenic site on an antigenic protein of another pathogen. In addition, the foreign portion may be a non-immunogenic site or a non-antigenic portion on an antigenic protein of another pathogen. In this case, the antigenic homologous additional protein may function as a pathogen-like particle of another pathogen. The pathogen-like particle may be a virus-like particle.

In addition, the foreign part may function as an immune aid. In this case, the immune auxiliary function may be to promote the secretion of cytokines related to the immune response in the living body or to suppress the secretion of cytokines that inhibit the immune response. In addition, the immune auxiliary function may be to help the recognition of antigen-recognizing cells. In this case, the foreign part may be an Fc variable of the antibody. In addition, the immune auxiliary function may be to break down the membrane of immune cells. In this case, the immune auxiliary function may be to degrade the macrophage membrane. At this time, the foreign part may be Listeriolysine.

In another embodiment, the antigenic homologous additional protein may include a site homologous to the antigenic protein, a non-antigenic portion, and a foreign portion. 10 is an illustration of an additional protein containing antigen homology including 1-immunogenic site-2 and 2-non-immunogenic site, and different first and second foreign parts, and non-antigenic parts.

[Immunogenicity system]

The "system structure" refers to a structure that functions to deliver a target substance such as an immunogenic substance within a certain distance in a living body.

The “system” refers to a target substance that is transmitted while being located within a certain distance of the system structure; And it is a term that includes a system including a system structure that functions to deliver it into a living body, and a mechanism by which such a system acts.

“Immunogenic system” refers to a system that causes an immune response, consisting of immunogenic substances and system structures.

An example of the present application is a vaccine comprising an immunogenic system.

The immunogenic system has an essential configuration of an immunogenic substance and a system structure for delivering the immunogenic substance in a living body.

The structure and characteristics of the immunogenic substance are as mentioned above. Immunogenic substances and system structures are delivered as one system while being located within a certain distance from each other in vivo.

Vaccines using the immunogenic system are more stable and less risky than vaccines that use only immunogenic substances directly. In addition, it has the advantage of being able to control the effect that causes immunity through the regulation of the system.

In addition to immunogenic substances, known elements that aid in the function of vaccines, such as immune adjuvants, may be included and attached to the system structure of the immunogenic system.

System structure

The system structure functions to deliver immunogenic substances in vivo while being located within a certain distance.

The system structure may be, but is not limited to, a carrier for tissue engineering, a polymer, a particle, and a microorganism as long as it is a material capable of efficiently delivering an immunogenic material into a living body. A preferred embodiment is a microorganism such as bacteria. It is known that matching microorganisms with immunogenic substances of other pathogens has the advantage of inducing a much more sustained and strong immune response (Georgiou et al., 1997). In addition, when the system structure is a pathogen, there is an advantage that it can act as a multivalent vaccine together with an immunogenic substance.

It is preferable that the system structure has a size capable of being administered into an animal body, and for example, the system structure may have a size of about 0.02 μm to 5 μm.

If the system structure is excellent in physical and chemical stability, there is an advantage that the immunogenic system can generate immunity even under extreme conditions such as the stomach of a living body.

In an embodiment of the present application,

The system structure may be a virus. At this time, the virus may cause a complex disease with a pathogen.

The virus may be a bacteriophage.

The virus may be a poxvirus.

The virus may be an adenovirus.

The virus may be a herpes virus.

The virus may be a Newcastle disease virus.

The virus may be a virus in which the infected animal is livestock. Preferably, the livestock is a pig.

The virus may be a virus in which the infected animal is avian. Preferably, the algae are chickens.

In addition, the system construct may be bacteria. At this time, the bacteria may cause a complex disease with a pathogen.

The bacteria may be gram negative bacteria. At this time, the gram-negative bacteria may be gastrointestinal diseases. At this time, the gastrointestinal disease bacteria may be E. coli. In addition, the gastrointestinal disease bacteria may be Salmonella. In addition, the gram-negative bacteria may be lung disease bacteria. In this case, the gram-negative bacteria may be Pasteurella multocida.

The bacterium may be a gram-positive bacterium. At this time, the gram-positive bacteria may be lung disease bacteria. At this time, the lung disease bacteria may be Mycoplasma hyopneumonaie. In addition, the gram-positive bacteria may be lactobacillus. In addition, the gram-positive bacteria may be Bacillus. In this case, the Bacillus may be B. subtilis, B. anthrasis, B. thuringiensis, and B. cereus.

In addition, the system structure may be spores.

The spores may be spores of plants.

The spores may be spores of yeast.

The spores may be spores of fungi.

The spores may be spores of spore-forming bacteria. In this case, the sporic bacteria may be Clostridium, for example, C. difficile. The spore bacteria may be sporolactobacillus. The spore bacterium may be Bacilllus. In this case, the Bacillus may be, for example, B. subtilis, B. anthrasis, B. thuringiensis, B. cereus, and the like.

In addition, the system structure may be an artificial structure. In this case, the artificial structure may be a particle or a rigid body. In addition, the artificial structure may have an outer film coated with a phospholipid.

1) Immunogen internal-carried system

An example of the present application is a vaccine including an immunogenic internal support system.

The "internal carrying system" refers to a system in which a target material is supported in a system structure as a specific example of the system.

"Carrying structure" refers to a structure that carries and delivers an immunogenic substance as a system structure.

"Immunogenic internal support system" is a specific example of the immunogenic system, as shown in Fig. 11, means that the immunogenic material is supported in the system structure. In this case, the system structure can be expressed as a "carrier". At this time, the immunogenic substance can be expressed as "supported surface inverse substance".

-Carrying structure

The carrier encompasses the system structure of the immunogenic system.

The carrier may have an internal space greater than or equal to a specific size. Preferably, it may be larger than a size capable of containing an effective amount of an immunogenic substance capable of causing an immune response.

The carrier may have an electric charge therein. At this time, the charge inside the carrier may cause the charge and attraction of the material inversely to the supported surface.

The carrier may have an external charge. At this time, the charge outside the carrier can cause the charge and repulsion of the material inversely to the supported surface.

The carrier may have a porous outer membrane.

As for the carrier, the outer membrane may be degradable. In this case, the outer membrane may include a site of action of a specific restriction enzyme. In addition, the outer membrane may be in a state in which transformation or manipulation has occurred as a whole in a wild state.

-Interal-carried immunogen

The supported surface reversal material encompasses the immunogenic material described above.

The supported surface reversal material may be less than or equal to a specific size. Preferably, it may have a size enough to contain an effective amount of a supported surface inverse substance capable of causing an immune response in the carrier.

The supported surface reversal material may have an electric charge. At this time, the charge of the material inversely to the supported surface may be opposite to the charge inside the carrier.

In addition, the supported surface reversal material may include a portion that inactivates a carrier that is a living organism.

2) Immunogen-fused display system

"Display system" refers to a system having a form in which a target substance is disclosed outside the system structure as a specific example of the system. The display system includes, but is not limited to, a fusion display system, a coupling display system, and an attachment display system of the present specification.

An example of the present application is a vaccine including an immunogenic fusion display system.

"Immunogenicity display system" refers to the disclosure of an immunogenic substance outside the system structure as an embodiment of an immunogenic system. The immunogenic display system includes, but is not limited to, an immunogenic fusion display system, an immunogenic coupling display system, and an immunogenic attachment display system of the present specification.

"Convergence display system" is a specific example of a system, and refers to a system in which a target material and a surface initiator that initiates the target material outside the system structure are fused.

“Fusion displaying structure” refers to a structure that fuses and delivers a fusion immunogenic substance to the outside as a system structure.

"Surface displaying substructure" means a substructure of a fusion display system that is initiated outside the display body by fusion with a target material.

"Fused body" means a fusion of a surface initiator and an immunogenic substance.

"Fusing part" means a site in which a surface initiator and an immunogenic substance are fused in a fusion body.

"Immunogenic fusion display system" is a specific example of an immunogenic system, as shown in Fig. 12, a surface initiator initiated outside the system structure by fusion with a target substance; And a system in which an immunogenic substance appears in a fused form. In this case, "fusion" means that two substances are directly connected as a bonding relationship between substances. At this time, the system structure is defined as "fusion display body". In this case, the immunogenic material is defined as "fused immunogen".

-Fusion displaying structure

The fusion display body encompasses the system structure of an immunogenic system.

The fusion display body may have an external charge. In this case, the electric charge outside the fusion display body can cause the electric charge and attraction of the surface initiator. In addition, the charge outside the fusion display body can cause the electric charge and attraction of the fusion body.

The fusion display body may not have an external charge.

The fusion display body may have a porous outer film. At this time, the pores of the outer membrane may be similar in size to the surface initiation or may be slightly larger.

-Surface displaying substructure

The surface initiator is a substructure of the fusion display system, and its size is preferably smaller than that of the fusion display system. More preferably, the size is the same as the size of the outer membrane protein of the microorganism corresponding to the size of the fusion display body.

The surface initiator may be a wild-state protein of a microorganism when the fusion display body is a microorganism. In this case, the surface initiator may be an outer membrane protein. Alternatively, the surface initiator may be a modified or engineered wild-state protein.

For example, when the fusion display body is a spore of Bacillus, the surface initiator may be any one of spore exosporium protein, spore coat protein, transmembrane protein, spore appendage protein, and spore associated enzyme.

The surface initiator may be a protein that is homologous to the structure of the wild-state protein of the fusion display body.

The surface initiator may be a wild-state protein of a fusion display body belonging to the same genus. In this case, the surface initiator may be an outer membrane protein. In this case, the surface initiator may be a wild-state outer membrane protein modified or manipulated.

The surface initiator may be a protein that is homologous to the structure of a wild-state protein of a fusion display body belonging to the same genus.

Surface initiators may contain sites of action of specific restriction enzymes. In this case, the specific restriction enzyme may be, for example, a signal peptidase.

Surface initiators may be charged. For example, the charge of the surface initiator can cause electric charges and attraction outside the fusion display body.

The surface initiator may include a structure in which the same sequence is repeated. At this time, the repeated structure may be homologous to the structure of the wild-state protein. In addition, the repeated structure may have an electric charge. At this time, the repetitive structure of charge can cause electric charge and attraction outside the fusion display body.

-Fusing part

The fusion section refers to the site where the surface initiator and the immunogenic material are fused. Such a fusion portion may be a separate protein/base sequence, but may be only a site forming a single chemical bond.

The fusion portion may represent only the binding site between the surface initiator and the immunogenic substance without any special function, or may have a specific structural characteristic or a specific function in the immunity formation process.

The fusion portion may be a chemical bond. In this case, the chemical bond may be, for example, a polymerization bond. The polymerization bond may be a condensation polymerization bond or an addition polymerization bond. The dehydration condensation polymerization bond may be, for example, an amide bond.

The fusion may have any length necessary for the desired function. Surface initiators and immunogenic substances constituting the fusion body each have a suitable three-dimensional structure, for example, a folding structure, and the formation of such a correct folding structure allows the protein to function properly. If the length of the fusion part is too short, the fold structure of each substance may not be correctly formed due to steric hindrance between the surface initiator and the immunogenic substance. Therefore, it is preferable that the fusion part has a certain length or size, which is necessary for correctly forming the folded structure of the surface initiator and the immunogenic material. For example, the fusion portion may have a base sequence of about 10 bp, 15 bp, or 20 bp or more.

The fusion may comprise a specific amino acid sequence/base sequence. In an example of the present application, a specific nucleotide sequence 5'-GGAGGTGGGGGTTCACTCCAG-3' was used.

The fusion unit may have a specific electric charge. The specific charge may have the same charge characteristics as the surface initiator. For example, the fusion portion may be positively charged by (number of positively charged amino acids (arginine/histidine/lysine)): (number of total amino acids).

The fusion portion may be one having activity against a cleavage enzyme. The cleavage enzyme may be used interchangeably as a restriction enzyme or a restriction endonuclease, and they recognize a specific nucleotide sequence of a double-stranded DNA molecule and cleave the part or its surroundings. Refers to the enzyme that catalyzes it. It may be, but is not limited to, a protease.

-Fused immunogen

Fusion immunogenic substances encompass the aforementioned immunogenic substances.

Fusion immunogenic substances can have a specific size. Preferably, it may have an effective size or more capable of inducing an immune response. In this case, the fusion immunogenic material may have a specific size ratio with the surface initiator.

The fusion immunogenic substance may have a specific charge. The specific charge may have the same charge characteristics as the surface initiator.

-Fused body

Fusions can be those with a specific charge. At this time, a specific electric charge can cause electric charges and attraction outside the fusion display body. At this time, the fusion body can take on a positive charge.

The charge of the fusion may be caused by (number of positively charged amino acids (arginine/histidine/lysine)): (total number of amino acids). (Number of positively charged amino acids): (number of total amino acids) may be 0.1 to 0.8:1. In this case, the ratio may be 0.5:1, 0.6:1, and 0.7:1.

3) Immunogenic coupling display system

An example of the present application is a vaccine including an immunogenic coupling display system.

The “coupling display system” is a specific example of a system, comprising: a system structure having one coupling group on the outside; And a system in which a target material having two coupling groups forms a coupling bond.

"Coupling bond" means a chemical bond formed by the interaction of a display body coupling group and an immunogenic substance coupling group.

"Coupling group" means a site that forms a coupling bond by the interaction of two homogeneous or heterogeneous coupling groups.

"Coupling group on displaying structure" means a coupling group located on a coupling display body.

"Coupling part on immunogen" means a coupling group located on a coupling immunogen.

The "coupling part" refers to a coupled portion made by the interaction between the display body coupling group and the immunogenic substance coupling group.

"Coupling displaying structure" refers to a structure that is delivered by coupling with a coupling immunogenic substance as a system structure.

"Immunogenic coupling display system" is a specific example of the immunogenic system, as shown in Fig. 13, a system structure having one coupling group on the outside; And an immunogenic substance having two coupling groups to form a coupling bond. At this time, the system structure may be expressed as "coupling display body", and the immunogenic substance may be expressed as "coupled immunogen". The one coupling group may be expressed as a "display body coupling group", and the two coupling groups may be expressed as an "immunogenic substance coupling group".

-Coupling display body

The coupling display body encompasses the system structure of the immunogenic system.

-Coupling coupling

Coupling bonds can generally be understood as polymerization bonds resulting from the interaction of two or more functional groups. The polymerization bond may include condensation polymerization in which a part of the functional group is released, addition polymerization in which the functional group is maintained, and radical polymerization by radicals. The coupling bond referred to in the present specification is preferably a chemical bond formed by the interaction of the display body coupling group and the immunogenic substance coupling group. In the coupling bond, two or more coupling groups may be the same or different.

In an embodiment of the present application,

The coupling bond may be a polymeric bond.

The polymerization bond can be condensation polymerization. For example, the condensation polymerization may be dehydration condensation polymerization.

The dehydration condensation polymerization may be an amide bond.

The dehydration condensation polymerization may be an ester bond.

The dehydration condensation polymerization may be an ether bond.

The dehydration condensation polymerization may be an aldol bond.

The condensation polymerization may be a disulfide bond.

The polymerization bond can be an addition polymerization.

The addition polymerization may be maleimide-thiol polymerization.

The polymerization bond can be a radical polymerization.

The radical polymerization may be click chemistry.

-Display check coupling machine

The display body coupling group may include one or more types of functional groups for performing the coupling coupling.

For example, it may contain two types of functional groups for coupling bonding. In this case, the display body coupling group has a first coupling group including one type of functional group for performing the coupling coupling and a second coupling group including another type of functional group.

-Immunogenic substance coupling machine

The immunogenic material coupling group may include one or more functional groups different from the functional group of the display body coupling group.

For example, the immunogenic substance coupling group may include two types of functional groups for performing the coupling bond. In this case, the immunogenic substance coupling group may be a first coupling group including one type of functional group for performing the coupling bonding, and a second coupling group including a different type of functional group.

-Coupling immunogenic substance

In this case, the coupling immunogenic substance encompasses the aforementioned immunogenic substance.

-Coupling part

The coupling unit refers to a site in which a coupling display body and a coupling immunogenic substance are coupled to each other and includes a display body coupling group and an immunogenic coupling group. Such a coupling portion may be a separate protein/base sequence, but may be only a site including a functional group generated by one coupling bond.

The coupling unit may represent only the binding site between the coupling display body and the coupling immunogenic substance without any special function, or may have a separate structural feature or a specific function in the process of immunity formation.

The coupling portion may refer to a functional group forming a coupling bond or a site in which these groups are present.

In addition, the coupling portion may have a length of a certain amount necessary for the desired function. Each of the coupling immunogenic substances has a suitable three-dimensional structure, for example, a folding structure, and the formation of the correct folding structure allows the protein to function properly. If the length of the coupling part is too short, the folded structure of each substance may not be correctly formed due to steric hindrance between the coupling display body and the coupling immunogenic substance. Therefore, it is preferable that the fusion part has a certain length or size, which is necessary for the folding structure of the coupling immunogenic material to be correctly formed. For example, the fusion portion may have a base sequence of about 10 bp, 15 bp, or 20 bp or more.

The coupling portion may have a specific amino acid sequence/base sequence. In an example of the present application, 5'-GGAGGTGGGGGTTCACTCCAG-3' was used as a specific nucleotide sequence.

In addition, the coupling unit may have a specific charge. The specific charge may have the same charge characteristics as the coupling display body. For example, the coupling portion may be positively charged by (number of positively charged amino acids (arginine/histidine/lysine)): (total number of amino acids).

The coupling portion may be one having activity against a cleavage enzyme. The cleavage enzyme can be used interchangeably with the term restriction enzyme or restriction endonuclease, and they recognize a specific nucleotide sequence of a double-stranded DNA molecule and cleave the part or its surroundings. Refers to the enzyme that catalyzes it. It may be, but is not limited to, a protease.

4) Immunogenic attached display system

An example of the present application is a vaccine including an immunogenic adhesion display system.

"Attachment display system" is a specific example of the system and means that the target material is attached to the outside of the system structure.

"Attached displaying structure" refers to a structure that attaches and transmits an attached immunogenic substance to the outside as a system structure.

The "immunogenic attachment display system" refers to a system in which an immunogenic substance is attached to the outside of a system structure as shown in FIG. 14 as a specific example of an immunogenic system. In this case, "attachment" means that two substances are connected indirectly, for example, through a specific medium, as a bonding relationship between substances. At this time, the system structure can be expressed as "attached display body", and the immunogenic material can be expressed as "attached immunogen".

In an embodiment of the present application,

The attachment may be due to electrostatic attraction,

The attachment may be due to hydrogen bonds,

The attachment may be due to hydrophobic interactions.

-Attached displaying structure

The attachment display body encompasses the system structure of an immunogenic system.

The attached display body may have an electric charge therein. At this time, the charge inside the attachment display body can cause the charge and repulsion of the attached immunogenic material.

The attached display body may have an external charge. In this case, the charge outside the attached display body can cause the charge and attraction of the attached immunogenic material.

The attached display body may not have an external charge.

The attachment display body may have a porous outer film.

-Attached immunogen

Attached immunogenic substances encompass the immunogenic substances.

The adherent immunogenic substance may be up to a certain size. Preferably, it may have a size such that an effective amount of a supported surface reversal material capable of inducing an immune response can be sufficiently attached to the attachment display body.

Attached immunogenic substances may carry an electric charge. At this time, the charge of the adherent immunogenic material may cause an electric charge and attraction outside the adherent display.

5) Immunogenic cross-linked display system

An example of the present application is a vaccine including an immunogenic cross-linked display system.

A "cross-linked display system" is a specific example of a display system, comprising: a target material having a first cross-linking group on the outside; And a polymer having two or more second crosslinking groups crosslinking to form a crosslinking network structure.

"Cross-linked displaying structure" means a system structure used in a cross-linked display system.

"Cross-linking" refers to a chemical bond formed by the interaction of an immunogenic substance cross-linking group and a polymer cross-linking group.

"Cross-linking group" refers to a site that forms a cross-link by the interaction of two or more homogeneous or heterogeneous cross-linking groups.

"Cross-linking net structure" means a network structure by a target substance and a polymer formed by cross-links.

"Polymerizing part" means a part or bond that is polymerized between target substances in a cross-linking network structure.

"Cross-linking part" means a cross-linked part made by the interaction of an immunogenic substance cross-linker and a polymer cross-linker.

"Cross-linking group on immunogen" refers to a cross-linking group located on a cross-linking immunogen.

"Polymer (polymerizing body)" refers to a material that can cause a polymerization reaction by cross-linking with two or more immunogenic cross-linking groups because it has two or more polymer cross-linking groups.

"Cross-linking group on polymerizing body" means a cross-linking group located in a polymer.

The "immunogenic crosslinking display system" is a specific example of an immunogenic display system. As shown in FIG. 15, an immunogenic material having a first crosslinking group and a polymer having two or more second crosslinking groups are crosslinked. It refers to the formation of a cross-linked net structure. The immunogenic cross-linked display system has the advantage of high system stability due to a cross-linked network structure. In this case, the display body is defined as a "cross-coupled display body". In this case, the immunogenic substance is defined as "cross-linked immunogen". In this case, the first crosslinking group may be expressed as a "immunogenic substance crosslinking group", and the second crosslinking group may be expressed as a "polymer crosslinking group".

Basically, since the immunogenic crosslinking display system is characterized by the crosslinking net structure itself, the form of the display system is not limited. For example, it may be any one selected from a fusion display system, a coupling display system, and an attached display system.

-Cross-linked display body

The cross-linked display body may be any one selected from a fusion display system structure, a coupling display system structure, and an attached display system structure according to the aspect of the display system.

-Crosslinking

Cross-linking includes various types of known physical and chemical bonds such as the coupling bonds described above.

-Immunogenic substance cross linker

The immunogenic substance crosslinking group may include one or more kinds of functional groups for crosslinking.

For example, the immunogenic substance crosslinking group may be two types of functional groups for crosslinking. For different functional groups, it can be used as a first immunogenic substance cross-linking group and a second immunogenic substance cross-linking group, respectively.

The immunogenic substance crosslinker may contain an active site for a cleavage enzyme. In this case, the cleavage enzyme may be a protease.

-Polymer

Polymer refers to a material that undergoes a polymerization reaction to form a cross-linked network structure. In this case, the polymer preferably contains two or more crosslinking groups in order to cause a polymerization reaction.

The polymer may have any length necessary for the desired function. In order for the crosslinked immunogenic substances to polymerize, the polymer must be able to connect the crosslinked immunogenic substances. If the length of the polymer is too short, it can only form a single bond with the crosslinked immunogenic substance. Therefore, it is preferable that the polymer has a length or size of a certain length necessary to cause the desired polymerization reaction to occur.

In addition, the polymer may contain an active site for a cleavage enzyme. In this case, the cleavage enzyme may be a protease.

-Polymer cross linker

The polymer crosslinking group may include one or more types of functional groups for performing the crosslinking.

For example, the polymer crosslinking group may include two types of functional groups for performing the crosslinking. For different functional groups, it can be used as a first crosslinking group and a second crosslinking group, respectively.

The polymer crosslinking group may contain an active site for a cleavage enzyme. In this case, the cleavage enzyme may be a protease.

-Cross-linking part

The cross-linking portion may refer to a functional group generated by cross-linking or a site in which these groups are present.

The cross-linking portion may have an activity against a cleavage enzyme. In this case, the cleavage enzyme may be a protease.

-Cross-linked net structure

The cross-linked network structure refers to a network structure formed by the cross-links. Referring to FIG. 15, the network structure refers to a structure in which dots are connected by a line made of a polymerized portion using a crosslinked immunogenic material as a point. At this time, the net structure consists essentially of a crosslinked immunogenic substance and a polymerized portion. Such a mesh structure can also function as a supporting system that confines material therein by adjusting its size. In this case, the mesh structure may have a certain size so that a material larger than that cannot pass through.

The material encompasses the following x-th protein.

In addition, the material may be a crosslinked display.

-Polymerization section

In the immunogenic cross-linked display system, the polymerizing portion refers to a portion that polymerizes between one cross-linked immunogenic substance and another cross-linked immunogenic substance. In this case, the polymerized portion essentially has a structure of an immunogenic substance cross-linking group-cross-linking portion-polymer-cross-linking portion-immunogenic substance cross-linking group.

In addition, the polymerization section may have a length of a certain amount necessary for the desired function. In order for the crosslinked immunogenic substances to polymerize, the polymerized portion must be able to connect the crosslinked immunogenic substances. If the length of the polymerization portion is too short, only a single bond can be formed with the crosslinked immunogenic substance. Therefore, it is preferable that the length of the polymerization section has a certain length or size so that the desired polymerization reaction can occur. In this case, the lengths of the immunogenic material crosslinking group, the crosslinking portion, and the polymer may be respectively adjusted in consideration of the length of the polymerization portion.

The polymerization unit may have a specific charge.

The specific charge may cause charge and attraction of the cross-linked display body.

The specific charge may be by (number of positively charged amino acids (arginine/histidine/lysine)): (number of total amino acids). Charges of the immunogenic substance crosslinking group, the crosslinking portion, and the polymer may be adjusted so that the polymerized portion exhibits a specific charge.

In addition, the polymerized portion may include an active site for a cleavage enzyme. In this case, the cleavage enzyme may be a protease.

6) Immunogenic serial-connected system

An example of the present application is a vaccine including an immunogenic serial connection system.

"Serial connection system" is a specific example of the system, as shown in Fig. 16, refers to a system in which proteins are connected in series in the form of a target substance.

"Serial-connected system structure" means a system structure used in an immunogenic serial-connected system.

The "immunogenic serial-connected body" is an immunogenic material of an immunogenic serial-connected system, and has a form in which n proteins are connected in series.

The "immunogenic serial connection system" is a specific example of an immunogenic system, characterized in that the form of an immunogenic substance is a form in which proteins are connected in series. In this case, "series" means that two or more materials are connected in series as a bonding relationship between materials. When the form of the immunogenic substance is serial, the concentration of the immunogenic substance in the vaccine may increase, thereby increasing the immunity-inducing effect. In this case, the system structure can be expressed as a "serial connection system structure", and the immunogenic substance can be expressed as an "immunogenic serial connection body".

Basically, the immunogenic serial connection system is characterized by the linking structure of the immunogenic substance, and thus the system is not limited. For example, it may be any one selected from an internal support system, a fusion display system, a coupling display system, an attachment display system, and a cross-linking display system.

-Serial connection system structure

The serial connection system structure may be any one selected from an internal support system structure, a fusion display system structure, a coupling display system structure, an attached display system structure, and a cross-linked display system structure according to the aspect of the system.

-Immunogenic serial connector

"Xth protein" means the xth protein on the immunogenic tandem.

"Yth connecting part" means a site connecting the y-th protein and the (y+1)-th protein on the immunogenic serial connector.

Immunogenic tandem refers to a substance with two characteristics:

First, the form is a form in which n proteins are connected in series. That is, the first protein-the first connection part-the second protein-the second connection part... It forms the structure of the (n-1)th protein-the (n-1)th connector-nth protein. A serial connector consisting of n proteins has (n-1) connections.

In addition, it must contain at least one immunogenic substance among the n proteins. For example, it may consist of only an immunogenic substance that causes an immune response, or other auxiliary elements that enhance the immune response may be included in addition to the immunogenic substance.

The immunogenic serial connector is composed of an x-th protein whose x is 1 to n, and a y-th connector of which y is 1 to (n-1).

-Protein x

Protein x may be the immunogenic material.

The x-th protein may be one selected from a supported surface immunogenic substance, a fusion immunogenic substance, a coupling immunogenic substance, an adhesion immunogenic substance, and a cross-linked immunogenic substance.

Protein x may be the non-antigenic portion of a pathogen.

In this case, the non-antigenic portion may have homology with the outer membrane protein of the pathogen. In this case, the immunogenic serial connector may function as a pathogen-like particle. The pathogen-like particle may be a virus like particle.

In addition, the non-antigenic portion may function as an immune aid. In this case, the immune auxiliary function may be to promote the secretion of cytokines related to the immune response in the living body or to suppress the secretion of cytokines that inhibit the immune response. In addition, the immune auxiliary function may be to degrade the membrane of immune cells.

Protein x may be the foreign part of the pathogen.

The foreign part may be an immunogenic site on an antigenic protein of another pathogen.

The foreign part may be a non-immunogenic site or a non-antigenic site on an antigenic protein of another pathogen. In this case, the antigenic homologous additional protein may function as a pathogen-like particle of another pathogen. The pathogen-like particle may be a virus-like particle.

The foreign part may function as an immune aid. In this case, the immune auxiliary function may be to promote the secretion of cytokines related to the immune response in the living body or to suppress the secretion of cytokines that inhibit the immune response. In addition, the immune auxiliary function may be to help the recognition of antigen-recognizing cells. In addition, the immune auxiliary function may be to break down the membrane of immune cells.

The immunogenic substances among the first protein to the n-th protein may include a plurality of immunogenic sites of the pathogen.

The first protein to the n-th protein may all be the same immunogenic substance, or may be different immunogenic substances.

At least one of the first protein to the n-th protein must be an immunogenic substance.

-Y connector

The y-th connecting portion refers to a portion connecting the y-th protein and the (y+1)-th protein. The y-th connecting portion may be a separate protein/base sequence, but may be only a portion forming one chemical bond.

The y-th connector may not have a special function, but may have a separate structural feature or a specific function in the immunity formation process.

The y-th connection part includes the fusion part.

The y-th connection part includes the coupling part.

The y-th connection part encompasses the polymerization part.

In addition, all of the first to (n-1)th connecting portions may have the same activity against the same cleavage enzyme, or may have different activities against each other. In this case, the cleavage enzyme may be a protease.

7) Immunogenic parallel system

An example of the present application is a vaccine including an immunogenic parallel connection system.

The "parallel system" is a specific example of the system, characterized in that the system structure delivers n proteins in parallel, as shown in FIG. 17.

"Parallel system structure" means a system structure used in an immunogenic parallel system.

"Parallel body" means each of the n proteins delivered by the parallel system structure. Unless otherwise stated, “parallel” refers to any one of n parallel bodies.

The "immunogenic parallel system" is an embodiment of an immunogenic system, characterized in that the system construct delivers n proteins in parallel. In this case, "parallel" means that each protein is independently delivered by the system structure. The immunogenic parallel system has the advantage that one system can perform multiple functions. At this time, the system structure can be expressed as a "parallel system structure", and each protein delivered by the parallel system structure can be expressed as a "parallel body".

Basically, in a parallel system, the transmission of n parallel objects is independent, so one parallel system is similar to a combination of n different systems. At this time, the aspect of each system may be any one of the internal supporting system, fusion display system, coupling display system, attachment display system, and cross-linking display system.

-Parallel system structure

The parallel connection system structure may be any one selected from an internal support system structure, a fusion display system structure, a coupling display system structure, an attached display system structure, and a cross-linked display system structure.

-Parallel body

The parallel body may be the immunogenic material.

The parallel body may be one selected from a supported immunogenic substance, a fusion immunogenic substance, a coupling immunogenic substance, an adherent immunogenic substance, and a cross-linked immunogenic substance.

The parallel agent may be the non-antigenic portion of a pathogen.

In this case, the non-antigenic portion may have homology with the outer membrane protein of the pathogen. At this time, the immunogenic parallel system may function as pathogen-like particles. The pathogen-like particle may be a virus like particle.

In addition, the non-antigenic portion may function as an immune adjuvant. In this case, the immune auxiliary function may be to promote the secretion of cytokines related to the immune response in the living body or to suppress the secretion of cytokines that inhibit the immune response. In addition, the immune auxiliary function may be to degrade the membrane of immune cells.

The parallel body can be the extraneous part of the pathogen.

The foreign part may be an immunogenic site on an antigenic protein of another pathogen.

The foreign part may be a non-immunogenic site or a non-antigenic site on an antigenic protein of another pathogen. In this case, the antigenic homologous additional protein may function as a pathogen-like particle of another pathogen. The pathogen-like particle may be a virus-like particle.

The foreign part may function as an immune aid. In this case, the immune auxiliary function may be to promote the secretion of cytokines related to the immune response in the living body or to suppress the secretion of cytokines that inhibit the immune response. In addition, the immune auxiliary function may be to help the recognition of antigen-recognizing cells. In addition, the immune auxiliary function may be to break down the membrane of immune cells.

In addition, at least one of the n parallel bodies must be the immunogenic material. For example, it may consist of only an immunogenic substance that causes an immune response, or other auxiliary elements that enhance the immune response may be included in addition to the immunogenic substance.

[Immunogenic spore system]

8) Immunogenic spore system

An example of the present application is a vaccine containing an immunogenic spore system.

“Spore system” means that the system structure is a spore or a spore-like particle as an embodiment of a system.

The "spore system structure" refers to a spore or spore-like particle as a system structure of a spore system.

"Immunogenic spore system" is an example of an immunogenic system and means that the system structure is a spore.

The immunogenic spore system consists of an immunogenic substance and a spore system structure that delivers the immunogenic substance in a living body. At this time, the structure and characteristics of the immunogenic substance are as mentioned above. At this time, the immunogenic material and the spore system structure are delivered as one system while being located within a certain distance in the living body. The spore system structure has the advantage of having higher physical/chemical stability, weak virulence, and easy concentration than other cell and virus type system structures.

The spore system structure of the immunogenic spore system may contain and attach elements that help the function of the vaccine, such as an immune adjuvant, in addition to the immunogenic material.

Spore system structure

The spore system structure constituting the spore system may be spores or spore-like particles.

The spore system structure functions to deliver immunogenic substances into the living body while being located within a certain distance. It is preferable that the spore system structure has a branch size that can be administered into an animal body, and for example, the spore system structure may be about 0.02 μm to 5 μm in diameter, and may be about the size of a general microorganism.

In nature, spores are generally required to survive in harsh physical/chemical environments. For this reason, most spores have strong properties such as high temperature, change in pH, change in external osmotic pressure, and external impact. The characteristics of these spores give the immunogenic spore system the advantage of being able to induce immunity under extreme conditions compared to other cellular and viral system structures. Also, like other system structures, it has an excellent effect of causing immunity due to its appearance similar to that of microorganisms, and also has the advantage of being able to act as a multivalent vaccine with immunogenic substances when spores are pathogens.

The spore system is not limited to the form described below.

-Spore

"Spores" include spores and variations thereof that can be found in nature.

The spores may be spores of plants.

The spores may be spores of yeast.

The spores may be spores of fungi.

The spores may be spores of spore-forming bacteria. "Sporotic bacteria" refers to bacteria that grow in the form of bacteria at normal times and then temporarily sporulate when conditions difficult to survive to increase viability.

In this case, the sporic bacteria may be Clostridium. For example, the Clostridium may be C. difficile.

In this case, the spore bacteria may be sporolactobacillus.

In this case, the spore bacteria may be Bacilllus. The Bacillus may be, for example, B. subtilis, B. anthrasis, B. thuringiensis, or B. cereus.

The spores may be partially modified or manipulated.

The spores may have an overall structure modified or manipulated.

As a preferred embodiment of the present application, the spores of spore bacteria are, in particular, spores of B. subtilis.

-Spore like particle

"Spore like particle" means an artificially made particle that has a structure similar to that of a spore. For example, the spore-like particles may be composed of a "spore-like particle nucleus" forming the structure of the particle and a "spore-like particle" similar to the outer membrane of the spore.

The spore-like particle nucleus may have a hollow spherical structure.

The spore-like particle nucleus may have a porous structure.

The spore-like particle nucleus may be a solid body structure.

The spore-like particle nucleus may be composed of organic matter.

The spore-like particle nucleus may be composed of inorganic substances. In this case, the inorganic material may be, for example, silica (Si).

The spore-like particle nucleus may be composed of a mixture of organic and inorganic materials.

The spore-like particle nucleus may be similar in diameter to the spores of microorganisms that exist in nature. For example, the diameter may be 1 to 50 μm.

The spore-like desert may be a phospholipid membrane.

The spore-like particles may be composed only of spore outer membrane proteins.

8-1) Immunogenic spore carrying system

An example of the present application is a vaccine including an immunogenic intraspore support system.

The term "spore carrying system" is a specific example of a spore system, which means that a target substance is carried in the structure of the spore system.

The "carrying spore structure" is a spore system structure, which refers to a structure that carries and transmits a spore-carrying surface inverse substance.

"Immunogenic intraspore support system" is a specific example of the immunogenic spore system and means that an immunogenic substance is supported in the spore system structure. At this time, the spore system structure can be expressed as a "spore-carrying body", and the immunogenic material can be expressed as a "spore-bearing surface inverse-generating material".

-Carrying spore structure

The spore carrier encompasses the spore system structure of the immunogenic spore system.

The spore-carrier encompasses the aforementioned carrier.

-Spore carried immunogen

The spore-bearing surface reversal material encompasses the immunogenic material described above.

The spore-bearing surface inverse material may be less than or equal to a specific size. Preferably, it may be larger than a size capable of containing an effective amount of an immunogenic substance capable of causing an immune response.

The spore-bearing surface inverse material may have an electric charge. At this time, the charge of the spore-bearing surface inverse material may be opposite to the charge inside the spore-carrying body. For example, the charge of a spore-bearing surface inverse substance may be a negative charge.

The spore-bearing surface reversal material may include a part that inactivates spores.

The spore-bearing surface reversal material may be homologous to a protein present inside the spore. At this time, the homologous portion may be a signal sequence portion of the protein. In addition, the protein inside the spore may be a protein produced in the SpoI stage during spore differentiation. Preferably, the spore-carrying surface reversal material may be guided and supported inside the spore by the signal sequence of the protein.

8-2) Immunogenic spore fused display system

An example of the present application is a vaccine including an immunogenic spore fusion display system.

The "spore display system" refers to a specific example of the spore system and to disclose a target substance to the outside of the spore system structure.

"Immunogenic spore display system" refers to a specific example of an immunogenic spore system, which discloses an immunogenic substance outside the spore system structure.

The "spore fused display system" is a specific example of the system, and refers to a fusion of a target material and a spore surface initiating entity that discloses a target material to the outside of the spore system structure.

The "spore fusion displaying structure" is a spore system structure and means a structure that fusions and delivers a spore fusion immunogenic substance to the outside.

The "spore surface displaying substructure" means a substructure of a fusion display system that is fused with a target material and initiated outside the display body.

The term "spore fused body" refers to the fusion of a spore surface initiator and an immunogenic substance.

The "spore fusing part" refers to a site in which a spore surface initiator and an immunogenic substance are fused in a spore fusion body.

"Immunogenic fusion display system" is a specific example of an immunogenic spore system, which means that a spore surface initiator and an immunogenic material initiated outside the spore system structure are fused by fusion with a target material. In this case, "fusion" means that two substances are directly connected as a bonding relationship between substances. At this time, the spore system structure is defined as "spore fusion display body". In this case, the immunogenic material is defined as "spore fused immunogen".

-Spore fusion display body

The spore fusion display body encompasses the spore system structure of the immunogenic spore system.

The spore fusion display body may have an external charge. At this time, the electric charge outside the spore fusion display body can cause the electric charge and attraction of the spore surface initiator. In addition, the electric charge outside the spore fusion display body can cause the electric charge and attraction of the spore fusion body.

The charge outside the spore fusion display body can take on a stronger negative charge than the spore in the wild state.

The spore fusion display body may not have an external charge.

The spore fusion display body may have a porous outer membrane. At this time, the pores of the outer membrane may be similar in size to the spore surface initiation.

-Spore surface initiation

The "spore outer domain" refers to the space between the double phospholipid membrane of the spore and the outermost part of the spore.

"Spore outer protein" refers to the protein of the spore that exists in the outer region of the spore in its natural state. For example, the spore outer protein may be a protein expressed on the outer spore membrane.

The spore surface initiation is a substructure of the spore fusion display system, and its size is preferably smaller than that of the spore fusion display system. Preferably, the size is the same as the size of the spore external protein corresponding to the size of the spore fusion display body.

In this case, the spore surface initiator may be a wild-state protein of the spore when the spore fusion display body is a spore.

The spore surface initiator may contain a site of action of a specific restriction enzyme. In this case, the specific restriction enzyme may be, for example, a signal peptidase.

The spore surface initiator may be charged. At this time, the charge of the spore surface initiation can cause electric charges and attraction outside the spore fusion display body.

The spore surface initiator may include a structure in which the same sequence is repeated. At this time, the repeated structure may be homologous to the structure of the wild-state protein. In addition, the repeated structure may have an electric charge. At this time, the repetitive structure of charge can cause electric charges and attraction outside the spore fusion display body.

-Spore external protein

The spore surface initiator may be a spore external protein. In general, between the spores of microorganisms of the same genus, each other's spore proteins can be used.

As an embodiment, when the spore fusion display body is a spore of the genus Bacillus, the spore outer protein may be any one of spore exosporium protein, spore coat protein, transmembrane protein, spore appendage protein, and spore associated enzyme.

The spore exosporium protein may be, for example, BclA or InhA.

The spore coat protein may be, for example, CotC, CotD, CotB, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK, CotL, CotM, etc. have.

For example, the CotB, CotC, CotE, and CotG may be proteins having a high expression amount and a high ratio in a natural state of the spore foreign protein.

The transmembrane protein may be, for example, prkC, OppA, or the like.

The spore appendage protein may be, for example, P29a, P29b, P85, or the like.

The spore associated enzyme may be, for example, CotA (laccase), oxalate decarboxylase (oxdD), reticuline oxidase-like protein (CotQ), transglutaminase (tgI), and the like.

The spore surface initiation may be a modified or engineered spore foreign protein in a wild state.

- spores outside the homologous proteins

"Spore outer homologous protein" refers to a protein that is homologous to the structure of a specific spore outer protein. It can have 85% to 100% homology to the protein in the wild state. Preferably, the homology is 90 to 100%, more preferably 95 to 100%.

"Signal sequence" refers to a protein sequence that functions to guide a protein to a specific location in a cell during protein synthesis.

The "spore outer signal sequence" is a signal sequence in the protein of a spore and refers to a protein sequence that functions to guide the protein to the outer spore region.

The "outer localization motif" refers to a motif that allows the extraspore protein to be located in the external region of the spore.

The spore surface initiator may be a spore external homologous protein.

The extraspore protein may include an extraspore signal sequence consisting of about 20 amino acid sequences. The spore-external signal sequence included in the spore-external homologous protein may be obtained by removing an action site of a signal sequence restriction enzyme.

In particular, in the case of a spore external protein, a spore external positioning motif may be included to position the spore in an external region of the spore. In this case, the spore external positioning motif may be located at the N-terminus of the spore external protein, but is not limited thereto. Proteins homologous at these sites can be expressed in the extraspore region.

The number of amino acid sequences of the spore external homologous protein is not particularly limited as long as it is sufficient to express a protein capable of functioning as an immunogenic substance in the external region of the spore. For example, it may be 50aa, 100aa, 150aa.

The extraspore homologous protein may include an extraspore localization motif.

The extraspore homologous protein may include both the extraspore signal sequence and the extraspore localization motif. In this case, the signal sequence outside the spore may be the one in which the site of action of the signal sequence restriction enzyme has been removed.

In addition, the spore external homologous protein may include a structure in which the same sequence is repeated. In this case, the repeated structure may be the full length sequence of the spore external protein. In addition, the repeated structure may be a spore external positioning motif.

In addition, the repetitive structure of the extraspore protein can be positively charged.

For example, when the extraspore protein is CotB, the repeating structure may have a positive charge.

For example, when the extraspore protein is CotC, the repeating structure may have a positive charge.

For example, when the extraspore protein is CotG, the repeating structure may have a positive charge.

- spores include external homology additional protein (spore outer homologous protein-contained additive body)

The term "pore outer homologous protein-contained additive body" or "spore outer homologous protein-contained additive body" has some homology with the structure of the spore outer protein. It refers to a protein that contains both the absent part. That is, the additional protein containing spore external homology refers to a form in which a region having no homology with the spore external protein is additionally included in the spore external homology protein.

"Spore foreign body" refers to a protein or base sequence that is not present in a spore in a wild state.

"Spore of another species" means a heterogeneous microbial spore of the same genus. "Spore outer protein of another species" means a spore outer protein of a heterogeneous spore.

The spore surface initiator may be an additional protein containing spore external homology.

In one embodiment, the additional protein including spore external homology may have homology with other spore external proteins of the same spore in addition to the specific spore external protein.

The spore external homology additive protein may include a spore external signal sequence of another spore external protein. In this case, the signal sequence outside the spore may be the one in which the site of action of the signal sequence restriction enzyme has been removed. In addition, the site of homology with other spore foreign proteins may have the number of amino acid sequences, for example, 50aa, 100aa, 150aa.

The spore-external homologous additive protein may include a spore-external localization motif of other spore-external proteins.

The spore-external homology additive protein may include both the spore-external signal sequence and the spore-external localization motif of other spore-external proteins. In this case, the signal sequence outside the spore may be the one in which the site of action of the signal sequence restriction enzyme has been removed.

Spore external homology additive proteins may have homology with two or more other spore external proteins in the same form.

In another embodiment, the spore-external homologous additive protein may include a site homologous to the spore-external protein and a spore foreign portion.

The foreign part may have homology with the xenospore external protein.

The spore-external homology additive protein may include a spore-external signal sequence of the xenospore-external protein. In this case, the signal sequence outside the spore may be the one in which the site of action of the signal sequence restriction enzyme has been removed. In addition, the homologous site with the xenospore foreign protein may have an amino acid sequence number of 50aa, 100aa, or 150aa.

The spore external homology additive protein may include a spore external localization motif of a heterospore external protein. At this time, the homologous site with the xenospore foreign protein may have an amino acid sequence number of 50aa, 100aa, 150aa.

The spore-external homology additive protein may include both the spore-external signal sequence and the spore-external localization motif of the heterogeneous spore-external protein. In this case, the signal sequence outside the spore may be the one in which the site of action of the signal sequence restriction enzyme has been removed. In addition, the homologous site with the xenospore foreign protein may have an amino acid sequence number of 50aa, 100aa, or 150aa.

Spore external homology additive protein may have homology with two or more xenospore external proteins in the same form.

In another embodiment, the external portion may carry a charge of a specific sign. In general, the area outside the spore has a negative charge. Therefore, when the spore surface initiation has a positive charge, the electrostatic attraction with the external area of the spore is added, so that the spore surface can be positioned more stably. Therefore, it is preferable that the charge of the spore external homologous addition protein is a positive charge.

In this case, the charge of a specific sign may be a sign opposite to the charge outside the spore fusion display body.

In addition, the charge of the foreign portion may be a positive charge. At this time, the foreign part can be positively charged by (number of positively charged amino acids (arginine/histidine/lysine)): (number of total amino acids).

In addition, due to the charge of the foreign part, the spore external homologous additive protein may have a stronger positive charge than the wild-state spore external protein. In this case, the (number of positively charged amino acids): (number of total amino acids) in the spore external homologous addition protein may be 0.1 to 0.8:1. In this case, the ratio may be 0.5:1, 0.6:1, and 0.7:1.

-Spore fusing part

The spore fusion unit refers to the site where the spore surface initiation body and the spore fusion immunogenic substance are fused. The spore fusion unit may be a separate protein/base sequence, but may be only a site forming a single chemical bond.

The spore fusion unit may not have a special function, but may have a separate structural feature or a specific function in the process of immunity formation.

The spore fusion unit encompasses the fusion unit described above.

-Spore fused immunogen

Spore fusion immunogenic substances encompasses the aforementioned fusion immunogenic substances.

The spore fusion immunogenic substance may be one having a specific size ratio with the extraspore protein. In this case, the size ratio of the spore foreign protein and the spore fusion immunogenic substance may be 2:1 to 1:2.

-Spore fused body

The spore fusion body may have a specific charge. In general, the area outside the spore has a negative charge. Therefore, if the spore fusion body has a positive charge, the electrostatic attraction with the outer area of the spore is added, so that it can be positioned more stably. Therefore, it is preferable that the charge of the spore fusion body is a positive charge.

The specific charge may cause electric charges and attraction outside the spore fusion display body.

The spore fusion can be positively charged by (number of positively charged amino acids (arginine/histidine/lysine)): (number of total amino acids). In this case, the (number of positively charged amino acids): (the total number of amino acids) may be 0.1 to 0.8:1. In this case, the ratio may be 0.5:1, 0.6:1, and 0.7:1.

8-3) Immunogenic spore coupling display system

An example of the present application is a vaccine including an immunogenic spore coupling display system.

The "spore coupling display system" is a specific example of a spore system, and refers to a system in which a spore system structure having a first coupling group and a target material having a second coupling group form a coupling bond.

The "spore coupling displaying structure" is a spore system structure and means a structure that is coupled to and delivered with a spore coupling immunogenic material.

The "spore coupling bond" refers to a chemical bond formed by the interaction of a spore display body coupling group with a spore immunogenic substance coupling group.

"Coupling group" means a site that forms a coupling bond by the interaction of two or more homogeneous or heterogeneous coupling groups.

"Spore coupling group on displaying structure" means a coupling group located on the coupling display body.

"Spore coupling part on immunogen" refers to a coupling group located on a coupling immunogen.

The "spore coupling part" refers to a coupled portion formed by the interaction of a display body coupling group with an immunogenic substance coupling group.

"Immunogenic spore coupling display system" refers to a specific example of an immunogenic system in which a spore system structure having a first coupling group and an immunogenic substance having a second coupling group form a coupling bond. At this time, the system structure is defined as "spore coupling display body". In this case, the immunogenic material is defined as "spore coupled immunogen". In this case, the first coupling group is defined as a "spore display check coupling device". In this case, the second coupling group is defined as a "spore immunogenic substance coupling group".

-Spore coupling display body

The spore coupling display body encompasses the spore system structure of an immunogenic spore system.

-Spore coupling coupling

The spore coupling bond encompasses the aforementioned coupling bond.

-Spore display check coupling machine

The spore display check coupling machine encompasses the aforementioned display check coupling machine.

-Spore immunogenic substance coupling device

The spore immunogenic substance coupling group encompasses the aforementioned immunogenic substance coupling group.

-Spore coupling immunogenic substance

Spore coupling immunogenic substances encompass the aforementioned immunogenic substances.

The spore-coupling immunogenic substance may have homology with the extraspore protein. In this case, the homologous region may be the spore-external signal sequence of the spore-external protein. Preferably, the spore-coupling immunogenic material is guided to the outside of the spore by the spore-external signal sequence, thereby causing spore-coupling coupling with higher efficiency.

-Spore coupling part

The coupling unit refers to a site in which a coupling display body and a coupling immunogenic substance are coupled to each other and includes a display body coupling group and an immunogenic coupling group. Such a coupling portion may be a separate protein/base sequence, but may be only a functional group generated by one coupling bond. In addition, the coupling unit may not have a special function, but may have a separate structural feature or a specific function in the process of immunity formation.

The spore coupling portion encompasses the aforementioned coupling portion.

8-4) Immunogenic spore attached display system

An example of the present application is a vaccine including an immunogenic spore attachment display system.

The "spore attachment display system" is a specific example of the spore system, and means that the target material is attached to the outside of the spore system structure.

"Spore attached displaying structure" refers to a structure that attaches and transmits a spore-attached immunogenic material to the outside as a spore system structure.

"Immunogenic spore attachment display system" is a specific example of a spore immunogenic system, which means that an immunogenic substance is attached to the outside of the spore system structure. In this case, "attachment" means that two substances are indirectly connected as a bonding relationship between substances. In this case, the spore system structure is defined as "spore-attached display body". In this case, the immunogenic material is defined as "spore attached immunogen".

The attachment may be due to electrostatic attraction.

The attachment may be due to hydrogen bonding.

The attachment may be due to hydrophobic interactions.

-Spore attached displaying structure

The spore attachment display body encompasses the spore system structure of an immunogenic spore system.

The spore attachment display body encompasses the attachment display body.

-Spore attached immunogen

The spore-attached immunogenic substance encompasses the immunogenic substance.

The spore-attached immunogenic substance encompasses the above-described immunogenic substance.

The spore-attached immunogenic substance may have homology with the extraspore protein. In this case, the homologous region may be the spore-external signal sequence of the spore-external protein. Preferably, the spore-attached immunogenic material is guided to the outside of the spore by the spore-external signal sequence, so that it can be attached to the spore-attached display body with higher efficiency.

8-5) Other spore systems

In addition to the above spore systems, other types of spore systems for delivering a target substance may be used. As another example of the present application, there may be an aspect of a serial connection system and a parallel system not mentioned above.

[Method for genetic production of protein]

Genetic production method of protein

An example of the present application is an immunogenic material prepared by a genetic recombination method and various uses thereof for constructing the immunogenic system.

"Target nucleotide sequence" means a nucleotide sequence to be included in the recombinant nucleotide sequence.

"Recombinant protein" means a protein to be finally produced in the genetic production method.

"Recombinant nucleotide sequence" means a nucleotide sequence encoding a recombinant protein.

A "recombinant vector" is a carrier that functions to deliver a recombinant base sequence to a living body, and includes, for example, a plasmid, an episomal vector, a viral vector, and the like.

The "recombinant expression vector" is a specific example of a vector, and refers to a vector that shows the function of expressing a recombinant nucleotide sequence linked to the vector in vivo as a target substance. Using such a recombinant expression vector, it is possible to check whether the recombinant protein is expressed and produced. Such an expression vector may be, for example, in the form of a plasmid, but is not limited thereto.

"Incubating host cell" refers to a cell transformed with a recombinant expression vector and cultured to produce a recombinant protein.

The method for producing a recombinant protein includes obtaining the protein through a genetic recombination method. At this time, the protein to be produced is a desired recombinant protein, and the target base sequence may be a sequence of such a recombinant protein.

The genetic production method of a protein is a specific example, the first step of obtaining a target base sequence, a second step of producing a vector or polynucleotide having a recombinant base sequence including the target base sequence, and culturing the recombinant base sequence. A third step of transforming the host cell, a fourth step of culturing the transformed culture host cell, and a fifth step of obtaining a recombinant protein from the culture host cell.

Each step will be described below.

The first step is to obtain a target base sequence.

At this time, the base sequence of the protein in the wild state can be obtained by using a genbank of ncbi or by directly screening the protein, and a known method can be used.

The polynucleotide having the target base sequence can be prepared by conventional recombinant DNA technology.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer, for example, the primer is present at the 3'end of about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic material of interest It may be an oligonucleotide of about 20 base sequences.

The second step is a step of preparing a vector or polynucleotide having a recombinant base sequence including the target base sequence.

The vector or polynucleotide may be single-stranded or double-stranded DNA or RNA including a target base sequence. Hereinafter, the thus prepared polynucleotide is used in combination as a recombinant vector or a recombinant polynucleotide.

The method for producing a recombinant vector or a recombinant polynucleotide may include linking a polynucleotide having a target base sequence through a ligase.

The recombinant vector or recombinant polynucleotide may contain a promoter required for expression of the recombinant base sequence. The promoter may be derived from a host cell or may be artificially introduced separately.

In addition, the polynucleotide including the recombinant base sequence may be a recombinant expression vector into which the target base sequence is inserted. As a method of inserting the target base sequence into the recombinant expression vector, a known gene recombination technique can be used.

The third step is a step of transforming the culture host cells with the recombinant polynucleotide or the recombinant expression vector prepared in the second step.

The transformation can be classified into "transient transformation" in which expression of a recombinant base sequence occurs in a short term or "permanent transformation" inserted into the genome of a culture host cell by a recombinant expression vector.

In addition, transformation can be classified into "transformation by a reactant", "transformation by tools", and "transformation by a virus" by a method of inserting a base sequence into the cell membrane or nuclear membrane.

"Transformation by a reactant" refers to a transformation method in which a positively charged transformant and a base sequence are mixed to pass through a negatively charged membrane. Such transformation reaction products include Calcium phosphate, DEAE-Dextran, cationic lipid, cationic polymer, activated dendrimer, magnetic bead, and the like.

"Transformation by means of an instrument" means a transformation method using an experimental instrument developed for transformation. Such transformation methods include electroporation (EP), biolistic technology, microinjection, and laserfection/optoinjection.

"Transformation with a virus" refers to a transformation method using the property of a virus in which a host is infected and a nucleotide sequence is inserted.

In a preferred embodiment of the present application, the transformation method utilizes a heat shock transfection method, which is a kind of electroporation method. Heat shock transfection refers to a method of transforming competent cells prepared in advance to facilitate transformation by applying heat and electric shock. At this time, it is appropriate to transform the culture host cells into competent cells using a conventional method prior to transformation.

In this case, the culture host cells may be animal cells or microbial cells. Animal cells can use commonly used Vero cells and CHO cells, and when microbial cells are used e. coli can be used.

Steps 4 and 5 are steps of separating the recombinant protein after culturing the transformed culture host cells.

In the culturing step, known cultivation conditions may be used.

The separation step of the protein may be performed by a method such as cell lysis, centrifugation, gel electrophoresis, etc., according to a conventional gene recombination method.

In the practice of this application, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology, protein chemistry and immunology within the art may be used. These techniques are described through the literature. See, for example, the following literature [see Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning, Vols. I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Animal Cell Culture (R. K. Freshney ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Protein purification methods-a practical approach (E.L.V. Harris and S. Angal, eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell eds., 1986, Blackwell Scientific Publications]

Recombinant Expression Vector

An example of the present application includes a recombinant expression vector for expression of a target base sequence.

"Expression control element" refers to a nucleotide sequence that controls the expression of an expression target base sequence as a component of a recombinant expression vector.

"An expression target base sequence" means a recombinant base sequence to be expressed as a constituent element of a recombinant expression vector.

One specific example of a method for genetically producing a protein is to transform a culture host cell after preparing a recombinant expression vector.

First, the expression vector may be a plasmid, an episomal vector, or a viral vector. The form of a commonly used expression vector is a plasmid, but is not limited thereto. "Plasmid" means a closed circular double-stranded DNA sequence capable of inserting a recombinant base sequence.

The recombinant nucleotide sequence inserted into the recombinant expression vector may include an expression control element and an expression target nucleotide sequence as constituent elements. At this time, although the expression control element is an optional component, it is preferable to be included.

In this case, the expression control elements refer to elements that control expression in addition to initiating transcription of the expression target base sequence. Expression control elements include promoters, enhancers, silencers, insulators, and the like. "Promoter" refers to a sequence in which transcription is initiated on a nucleotide sequence. "Enhancer" refers to a sequence that promotes transcription of a nucleotide sequence when the activator binds as a distant regulatory element. "Silencer" refers to a sequence that inhibits transcription of a nucleotide sequence when a repressor binds as a distant control element. "Insulator" means a sequence that blocks the interaction between an enhancer and a promoter.

The expression target base sequence refers to the recombinant base sequence inserted into a recombinant expression vector.

In the recombinant expression vector, the expression control element is preferably the culture host cell codon-optimized.

In the recombinant expression vector, the expression target base sequence may be inserted in a step including the first step and the second step of the method for genetically producing the protein.

The method using the recombinant expression vector is only one specific example of the genetic production method. Therefore, it is obvious that the genetic production method below includes a method using a recombinant expression vector unless otherwise specified.

Method for preparing immunogenic substances

An example of the present application is a method of preparing an immunogenic material.

The immunogenic material produced can itself be a composition of a vaccine, or it can be used to prepare an immunogenic system. In addition, the method of manufacturing an immunogenic substance can be utilized in the manufacturing process of an immunogenic system.

Genetic manufacturing method of immunogenic material

"Immunogenic target nucleotide sequence" means a nucleotide sequence to be included in the immunogenic recombination nucleotide sequence.

"Immunogenic recombinant protein" means an immunogenic protein to be finally produced in a genetic production method.

"Immunogenic recombinant nucleotide sequence" means a nucleotide sequence encoding an immunogenic recombinant protein.

The "immunogenic recombinant expression vector" is a specific example of a vector, and means that the immunogenic recombinant nucleotide sequence linked to the vector is expressed in vivo. That is, when the immunogenic recombination expression vector is inserted, the generation of the immunogenic recombinant protein can be confirmed. Most of these expression vectors are in the form of plasmids, but are not limited thereto.

"Immunogen incubating host cell" means a cell transformed with an immunogenic recombinant expression vector for the production of an immunogenic recombinant protein.

As a specific example of a method for producing an immunogenic material, the manufacturing method provides for producing an immunogenic material through a genetic manufacturing method. At this time, the protein to be produced is an immunogenic recombinant protein, and the target immunogenic base sequence may be an immunogenic site, a non-immunogenic site, or a foreign site.

The method for genetically producing an immunogenic material is a specific example, the first step of obtaining an immunogenic target base sequence, the second step of producing a vector or polynucleotide having an immunogenic recombinant base sequence including the immunogenic target base sequence. , The third step of transforming the immunogenic recombinant base sequence into an immunogenic cultured host cell, the fourth step of culturing the transformed immunogenic cultured host cells, the fifth of extracting the immunogenic recombinant protein from the immunogenic cultured host cells It may include steps.

The first step is to obtain an immunogenic target base sequence.

The nucleotide sequence of the immunogenic substance in the wild state can be obtained by using the genbank of ncbi or by screening for pathogens directly.

Polynucleotides having an immunogenic target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer, for example, the primer is present at the 3'end of about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic material of interest It may be an oligonucleotide of about 20 base sequences.

The second step is a step of preparing a vector or polynucleotide having an immunogenic recombinant base sequence including an immunogenic target base sequence obtained in the first step.

The vector or polynucleotide may be single-stranded or double-stranded DNA or RNA including an immunogenic target sequence. In this case, the method of preparing a polynucleotide may be to link a polynucleotide having an immunogenic target base sequence through a ligase.

In this case, the immunogenic recombinant base sequence may include a promoter necessary for expression. The promoter may be derived from a host cell or may be artificially introduced separately.

In addition, the polynucleotide including the immunogenic recombination base sequence may be an immunogenic recombination expression vector into which an immunogenic target base sequence is inserted. A method of inserting an immunogenic target base sequence into an immunogenic recombination expression vector can use conventional gene recombination techniques.

The third step is a step of transforming the immunogenic cultured host cells with the immunogenic recombination polynucleotide or the immunogenic recombination expression vector prepared in the second step.

Transformation can be classified as "transient transformation" or "permanent transformation" by its effect. In an example of the present application, transient transformation was used.

In addition, transformation may be classified into "transformation by reactants", "transformation by tools", and "transformation by viruses" depending on the means. In an example of the present application, a heat shock transfection method was used.

Immunogenic cultured host cells encompass the cultured host cells.

Steps 4 and 5 are steps of culturing the transformed immunogenic cultured host cells and then separating the immunogenic recombinant protein.

In the culturing step, known cultivation conditions may be used.

The step of separating the immunogenic recombinant protein may be performed by a method such as cell lysis, centrifugation, gel electrophoresis, etc. by a conventional gene recombination method.

Immunogenic Recombinant Expression Vector

"Immunogenic expression regulatory element" refers to a nucleotide sequence that controls the expression of an immunogenic expression target base sequence as a component of an immunogenic recombination expression vector.

"Immunogenic expression target base sequence" means a recombinant base sequence to be expressed as a component of an immunogenic recombinant expression vector.

One specific example of a method for genetically producing an immunogenic material is to transform an immunogenic cultured host cell after preparing an immunogenic recombination expression vector.

The form of the immunogenic recombination expression vector may be a plasmid, but is not limited thereto.

The recombinant base sequence inserted into the immunogenic recombination expression vector may include an immunogenic expression regulatory element and an immunogenic expression target base sequence as constituent elements.

Immunogenic expression control elements encompass the expression control elements.

It is preferable that the immunogenic expression regulatory element is optimized for the codon of the immunogenic cultured host cell.

The immunogenic expression target base sequence refers to the immunogenic recombination base sequence, which is inserted into the immunogenic recombination expression vector.

The immunogenic expression target base sequence is the base sequence of the immunogenic substance. In this case, the immunogenic expression target base sequence may be inserted in a step including the first step and the second step of the method for genetically producing the immunogenic material.

The method using the immunogenic material recombinant expression vector is only one specific example of the genetic production method. Therefore, unless otherwise specified, it is obvious that the method for genetic production of pathogens, antigenic proteins, antigenic homologous proteins, and antigenic homologous addition proteins includes methods using recombinant expression vectors of immunogenic substances.

[Method for producing pathogens and antigens]

Methods of making pathogens

An example of the present application is a method of preparing a pathogen as an immunogenic substance for a vaccine.

-Wild state pathogen

In one embodiment, a method of preparing a pathogen in a wild state is provided.

In one embodiment, the manufacturing method includes collecting and culturing steps. In general, pathogens can be collected from secretions, excreta, and corpses of living organisms suffering from diseases. When these are cultured in culture medium or animal cells, they differentiate into a number of pathogens. If the pathogen is sufficiently differentiated into a large amount, it can be prepared as a vaccine composition. At this time, if some pathogens are stored and cultured, a large amount of vaccine can be provided.

In another embodiment, the method of manufacture may be a method of genetically producing a wild state pathogen. In this case, the genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material. In this case, the immunogenic target base sequence may be the full-length sequence of the wild-state pathogen or a partial sequence thereof.

-Pathogens with deletion/modification in specific areas

In another embodiment, a method of preparing a pathogen in which a specific site is deleted, modified or manipulated is provided.

In one embodiment, the manufacturing method may be a method of physically deleting, modifying, or manipulating the amino acid/peptide/base sequence constituting the pathogen. In this case, a known method may be used as the physical method.

In another embodiment, the manufacturing method may be a method of chemically deleting, modifying, or manipulating the amino acid/peptide/base sequence constituting the pathogen. In this case, the deletion, modification, or manipulation method may be to delete, modify, or manipulate a specific site by treating a pathogen with a specific chemical substance.

In another embodiment, a wild-state pathogen can be obtained or prepared and then treated with a chemical that causes a reaction to a specific site, such as a specific reagent or enzyme.

In this case, a known method may be used as a chemical method.

In another embodiment, the manufacturing method may be a method for genetically producing a deleted, modified or engineered pathogen.

The genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material. In this case, the immunogenic target base sequence may be the full-length sequence of the wild-state pathogen or a partial sequence thereof. Perform a point mutation through PCR in the first step described above, or use a mutation kit for the immunogenic recombination base sequence or the immunogenic recombination expression vector in the second step. It can cause manipulation.

-Pathogen with a modified overall structure

In another embodiment, a method of preparing a pathogen whose overall structure is modified is provided.

One example is a method of modifying a genetically produced pathogen.

In one embodiment, the manufacturing method is a physical transformation method. In this case, a known method may be used as the physical method.

In one embodiment, the manufacturing method is a chemical modification method. In this case, a known method may be used as a chemical method.

For example, if the virus is propagated to a high titer, after obtaining the virus, it is treated with formalin, betapropriolactone (BPL), binary ethyleneimine (BEI) or gamma ray, or by other methods known to those skilled in the art. Disable it. The inactivated virus is then mixed with a pharmaceutically acceptable carrier (such as saline solution) and any adjuvants. As a specific example, it may be inactivated at a final concentration of 0.1% formalin.

Another example is a method of producing a modified pathogen by a genetic modification method (genetic recombination method).

The genetic modification method encompasses a method of genetically producing the immunogenic material.

In this case, the immunogenic target base sequence may be the full-length sequence of the wild-state pathogen or a partial sequence thereof. The mutation PCR may be performed in the first step described above, or the deletion, modification, or manipulation of the immunogenic recombination base sequence or the immunogenic recombination expression vector in the second step may be caused as a whole using a mutation kit.

Method for producing antigenic protein

An example of the present application is a method of preparing an antigenic protein as an immunogenic material for a vaccine. At this time, two or more antigenic proteins of a pathogen may be prepared or mixed at the same time.

-Wild state antigen protein

In one embodiment, a method of preparing an antigenic protein in a wild state is provided.

In one embodiment, the manufacturing method may be a method of separating an antigenic protein from a pathogen in a wild state by a physical method.

In this case, the physical method may be a centrifugation method, but is not limited thereto. As the physical method, a known method may be used.

In another embodiment, the manufacturing method may be a method of separating an antigenic protein from a pathogen in a wild state by a chemical method. As the chemical method, a known method may be used.

In another embodiment, the method of manufacture may be a method of genetically producing a wild state antigenic protein. Typically, vaccines prepared in this way are referred to as subunit vaccines. In this case, the genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material. The target base sequence may be the full-length sequence of the wild-state antigen protein or a partial sequence thereof.

-Antigen protein with modified specific site

In one embodiment, a method for preparing an antigenic protein in which a specific site has been modified or engineered is provided.

In one embodiment, the manufacturing method may be a method of physically modifying an antigenic protein in a wild state. As the physical method, a known method may be used.

In another embodiment, the manufacturing method may be a method of chemically modifying an antigenic protein in a wild state. As the chemical method, a known method may be used.

In another embodiment, the production method may be a method of genetically producing an antigenic protein in which a specific site has been modified or engineered. In this case, the genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material.

The target base sequence can be a wild state antigenic protein. Perform mutation PCR in the first step described above, or use a mutation kit for the immunogenic recombination base sequence or the immunogenic recombination expression vector in the second step to select an antigenic protein whose specific site has been deleted, modified or manipulated. Can be obtained.

Method for producing antigen homologous protein

An example of the present application is a method of preparing an antigen homologous protein as an immunogenic material for a vaccine.

-An antigenic homologous protein containing one immunogenic site

In one embodiment, a method of preparing an antigen homologous protein including an immunogenic site is provided.

In one embodiment, the portion including the immunogenic site may be a method made by limiting the prepared antigenic protein. Methods for limiting antigenic proteins include physical methods such as centrifugation, and chemical methods using chemical reagents such as proteases.

In a preferred embodiment, the method for producing an antigenic homologous protein may be a method for genetically producing a portion including an immunogenic site. The genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material described above. Immunogenic recombinant proteins are antigenic homologous proteins that contain one or more immunogenic sites. The immunogenic target base sequence becomes the base sequence encoding the immunogenic site.

The first step encompasses obtaining the immunogenic site. The nucleotide sequence of the immunogenic site of the antigenic protein can be determined by using ncbi's genbank or by screening for pathogens directly.

Polynucleotides including the target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer, for example, the primer is present at the 3'end of about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic site of interest in the present application. It may be an oligonucleotide of about 20 base sequences.

In addition, the primers of the immunogenic target base sequence can be designed through multiple alignment.

"Multi-sort" means performing a sequence comparison between a plurality of protein sequences or base sequences.

"Common region" refers to a portion of a sequence that is common between a plurality of protein sequences or base sequences.

By performing multiple alignment between a plurality of strains of the same disease, a common region between antigen proteins of the same disease strains can be identified. Whenever a mutant strain of a pathogen occurs, it becomes a problem because there is no homology between the existing vaccine strain and the antigen protein of the mutant strain, so that the antibodies produced by the existing vaccine do not function. In particular, the immunogenic site of an antigenic protein is a particularly problematic region in many cases where mutations occur actively.

Therefore, in order to solve this problem, the present applicants sought to create an antigen by finding a common region present in the antigen protein of the existing strains and the mutant strain, and including an immunogenic region between the two common regions found.

At this time, two common regions are designed as primers. By performing PCR using the primer sequence at the 5'end and the primer sequence at the 3'end of the target base sequence, an immunogenic target base sequence is obtained. And using this, it is possible to clone a target base sequence including an immunogenic site without the need to design a new primer each time a mutant strain occurs. In this way, a primer designed through multiple alignment and composed of a common region is defined as a "common region primer".

The common region primer through multiple alignment can be a great advantage in the manufacture of the following master vaccines and complex disease master vaccines.

According to the existing vaccine technology, in particular, according to the vaccine technology using a pathogen as an immunogenic substance, there has been a problem in quickly securing an immunogenic substance when a mutant strain that does not have an immunity effect against the existing vaccine line occurs. When a pathogen is dead or attenuated as an immunogenic substance, it takes a long time to secure a large amount of pathogens by subculturing the mutant strain that has occurred. At this time, when the pathogen is a virus, cultivation is difficult and it takes a longer time. In addition, even when the antigen protein of each mutant strain is used as an immunogenic material, there are numerous steps such as obtaining a mutant strain, screening the mutant strain, designing and producing a primer at the end of the antigen protein, and obtaining a recombinant antigen protein. Steps are needed.

However, in the common region primer by multiple alignment, the step of screening for a mutant strain and the step of designing and manufacturing a primer can be omitted among the above steps, so that a more rapid response to the mutant strain is possible. This is very suitable for the purpose of master vaccines and complex disease master vaccines for the purpose of forming strong immunity against homologous or heterogeneous pathogens and their mutant strains.

In one example, the strains subject to multi-alignment may be strains of one or more pathogens found in a country.

Strains subject to multi-alignment are strains of pathogens occurring in one country, and may be of different types or types. For example, when the target disease is PRRS, strains subject to multi-alignment may include North American type and European type.

In another example, strains subject to multiple sorting may include outdoor strains imported from foreign countries in addition to strains found in one country.

The foreign country may be a neighboring country.

The foreign country may be a country in a specific region. For example, it could be East Asia, Southeast Asia, North America, and Eastern Europe.

The foreign country may be a country located within a certain distance from a country.

In addition, the foreign country may be a country with active exchanges. Preferably, it may be a country in which exchanges related to livestock are active. In addition, the foreign country may be a country through which migratory birds passing through a country pass.

In another example, strains subject to multi-alignment may be selected according to overall homology to a specific strain.

The strains may be selected from those having overall homology to a specific strain greater than or equal to a specific value.

The steps of selecting strains for multiple sorting include dividing a class according to the overall homology to a specific vaccine strain, classifying the strains by group, and selecting the strains belonging to each group to have a specific ratio. Can include.

At this time, the group may be divided according to the range of homology to a specific strain.

In addition, methods for selecting strains naturally include methods that are obvious to those skilled in the art.

The consensus primer by multiple alignment of the present application makes it possible to efficiently prepare an antigen homologous protein as an immunogenic material of a vaccine against such various strains and mutants thereof.

The common region primer may correspond to a non-immunogenic site. This is because most of the common regions between the antigenic proteins of the mutant strain correspond to the non-immunogenic regions. The antigen homologous protein produced using such a consensus primer inevitably includes an immunogenic site and a non-immunogenic site. At this time, the non-immunogenic sites exist at the N-terminus and C-terminus of the antigen homologous protein, and are the same as the sequence of the consensus primer.

Meanwhile, in the second step, the immunogenic recombination polynucleotide or the immunogenic recombination expression vector may be prepared by inserting the immunogenic target base sequence obtained in the first step. At this time, if necessary, an arbitrary number of immunogenic sites may be inserted. In one embodiment, the antigenic homologous protein thus produced may have the form of a serial connector.

-1-Immunogenic site-1... Method for producing an antigenic homologous protein containing two or more selected from

In one embodiment, it provides a method of preparing an antigenic homologous protein comprising at least two selected from immunogenic site-1 to immunogenic site-n.

An antigenic homologous protein comprising two or more different immunogenic sites of the antigenic protein can be prepared by a genetic method. In this case, the genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material.

The immunogenic recombinant protein may be an antigen homologous protein including at least two of the immunogenic site-1 to the immunogenic site-n. The immunogenic target base sequence may be a base sequence encoding each immunogenic site-x.

The first step encompasses obtaining each of the above immunogenic sites. The nucleotide sequence of the immunogenic site of the antigenic protein can be determined by using ncbi's genbank or by screening for pathogens directly.

Polynucleotides containing an immunogenic target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, those skilled in the art can design appropriate primers, for example, primers are about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of each immunogenic site, and 20 nucleotide sequences present at the 3'end. It may be an oligonucleotide of about a base sequence.

In addition, the primers of the target immunogenic base sequence may be designed using the multiple alignment. The primer of the immunogenic target base sequence may be a consensus primer for each immunogenic site.

The consensus primer may correspond to a non-immunogenic site. This is because most of the common regions between the antigenic proteins of the mutant strain correspond to the non-immunogenic regions. The antigen homologous protein prepared using such a consensus primer inevitably includes at least two selected from immunogenic site-1 to immunogenic site-n and non-immunogenic sites. At this time, the non-immunogenic sites exist at the 5'and 3'ends of each immunogenic target base sequence, and are the same as the sequence of the consensus primer.

In addition, the second step is a step of preparing an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector by inserting the immunogenic target base sequence obtained in the first step.

At this time, the sequence of the immunogenic site to be inserted may be different from the sequence of the nucleotide sequence of the immunogenic site in the wild state. Also, if necessary, an arbitrary number of immunogenic sites may be inserted.

- One… An antigenic homologous protein containing two or more selected from the immunogenic site

In one embodiment, a method for preparing an antigen homologous protein comprising at least two selected from the 1-immunogenic site to the m-immunogenic site is provided.

An antigen homologous protein comprising two or more immunogenic sites of different antigenic proteins can be produced by a genetic method.

The genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material. In this case, the immunogenic recombinant protein may be an antigen homologous protein including two or more of the 1-immunogenic site to the m-immunogenic site. The immunogenic target base sequence becomes a base sequence encoding each y-immunogenic site.

The first step encompasses obtaining each of the above immunogenic sites. The nucleotide sequence of the immunogenic site of the antigenic protein can be determined by using ncbi's genbank or by screening for pathogens directly.

In addition, polynucleotides containing an immunogenic target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, those skilled in the art can design appropriate primers, for example, primers are about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of each immunogenic site, and 20 nucleotide sequences present at the 3'end. It may be an oligonucleotide of about a base sequence.

In addition, the primers of the target immunogenic base sequence may be designed using the multiple alignment. The primer of the immunogenic target base sequence may be a consensus primer for each immunogenic site.

The consensus primer may correspond to a non-immunogenic site. This is because most of the common regions between the antigenic proteins of the mutant strain correspond to the non-immunogenic regions. Antigen homologous proteins prepared using these consensus primers are inevitably two or more selected from 1-immunogenic sites to m-immunogenic sites and 1-non-immunogenic sites to m-non-immunogenic sites. It includes the above. At this time, the non-immunogenic sites exist at the 5'and 3'ends of each target base sequence, and are the same as the sequence of the consensus primer.

The second step is a step of preparing an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector by inserting the immunogenic target base sequence obtained in the first step.

At this time, the sequence of the immunogenic site to be inserted may be different from the sequence of the nucleotide sequence of the immunogenic site in the wild state. Also, if necessary, an arbitrary number of immunogenic sites may be inserted.

It is obvious that an antigenic homologous protein including a plurality of immunogenic sites of a plurality of antigenic proteins can also be prepared by the above-described genetic production method.

Antigen homologous protein recombination expression vector

In one embodiment, an antigen homologous protein recombination expression vector for genetically producing an antigenic homologous protein is provided.

The antigenic homologous protein recombination expression vector encompasses the immunogenic recombination expression vector.

An antigenic homologous protein recombination expression vector made according to the'method for producing an antigenic homologous protein' can be provided.

In one embodiment, the immunogenic expression target base sequence may include the base sequence of the immunogenic site.

As the first configuration, the immunogenic expression regulatory element may be a promoter.

The promoter may be a wild-state promoter.

The promoter is preferably an immunogenic cultured host cell codon-optimized.

The promoter may be a wild-state promoter derived from an immunogenic cultured host cell, or may be a separately artificially introduced promoter.

The promoter may be a wild-state promoter modified at some sites. At this time, the modified promoter may have improved initiation efficiency.

As the second configuration, the target base sequence for expression of immunogenicity may include the base sequence of the immunogenic site.

The nucleotide sequence of the immunogenic site may include a non-immunogenic site corresponding to the consensus primer sequence at the 5′ and 3′ ends.

The immunogenic expression target base sequence may include multiple base sequences of one or more immunogenic sites.

It is preferable that the overall configuration is a promoter-immunogenic site. 18 is an illustration of an antigen homologous protein recombination expression vector comprising a promoter and a nucleotide sequence of 1-immunogenic site-1.

In another embodiment, the immunogenic expression target base sequence may include two or more base sequences selected from immunogenic site-1 to immunogenic site-n.

As the first configuration, the immunogenic expression regulatory element may be a promoter.

Promoter encompasses the aforementioned promoters. Hereinafter, "the promoter" encompasses all the promoters of the first embodiment.

As a second configuration, the immunogenic expression target base sequence may include two or more base sequences selected from immunogenic site-1 to immunogenic site-n.

The nucleotide sequence of the immunogenic site may include a non-immunogenic site corresponding to the consensus primer sequence at the 5′ and 3′ ends.

The immunogenic expression target base sequence may include multiple base sequences of one or more immunogenic sites.

It is preferable that the overall configuration is a promoter-(immunogenic site-x)z. z means the number of immunogenic sites included in the vector. 19 is an illustration of an antigenic homologous protein recombination expression vector comprising a promoter and the nucleotide sequences of 1-immunogenic site-1 and 1-immunogenic site-2.

In this case, the sequence of the immunogenic sites may be different from that of the wild-state antigen protein.

In another embodiment, the immunogenic expression target base sequence may include two or more base sequences selected from the 1-immunogenic site to the m-immunogenic site.

As the first configuration, the immunogenic expression regulatory element may be a promoter.

In this case, the promoter encompasses the promoter.

As a second configuration, the immunogenic expression target base sequence may include two or more base sequences selected from the 1-immunogenic site to the m-immunogenic site.

The nucleotide sequence of the immunogenic site may include a non-immunogenic site corresponding to the consensus primer sequence at the 5′ and 3′ ends.

The immunogenic expression target base sequence may include multiple base sequences of one or more immunogenic sites.

It is preferable that the overall configuration is a promoter-(y-immunogenic site)z. z means the number of immunogenic sites included in the vector. 20 is an illustration of an antigenic homologous protein recombination expression vector comprising a promoter and nucleotide sequences of 1-immunogenic site-1 and 2-immunogenic site-2.

In this case, the sequence of the immunogenic sites may be different from that of the wild-state antigen protein.

From the above-described configuration, it is apparent that an antigenic homologous protein recombination expression vector comprising a plurality of immunogenic sites of a plurality of antigenic proteins can also be constructed.

Antigen homology adjunct protein

An example of the present application is a method of preparing an antigenic homologous additive protein as an immunogenic material for a vaccine.

Hereinafter, the term "immunogenic site" used when describing the method for the genetic production of an antigenic homologous protein is in a broad sense encompassing antigenic proteins, not only the immunogenic site mentioned in the "method for producing an antigenic homologous protein" It's a concept. Hereinafter, "immunogenic site" refers to y-antigen protein or y-immunogenic site-x.

-Method for producing an antigenic homologous addition protein including an immunogenic site and a nonantigen part

In one embodiment, it provides a method of preparing an antigenic homologous addition protein comprising an immunogenic site and a non-antigenic portion.

An antigenic homologous addition protein including an immunogenic site and a non-antigenous portion can be prepared by a genetic method. In this case, the genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material. Immunogenic recombinant proteins are antigenic homologous addition proteins including immunogenic sites and non-antigenic sites. The immunogenic target base sequence includes the base sequence of the immunogenic site and the base sequence of the non-antigenic site.

The first step encompasses obtaining the immunogenic target base sequence.

The nucleotide sequence of the immunogenic site can be obtained by a method comprising the first step of the method for genetically producing the antigenic protein and the method for producing the antigenic homologous protein.

The nucleotide sequence of the non-antigenic part of the pathogen can be determined by using the genbank of ncbi or by screening the pathogen directly.

In addition, polynucleotides containing an immunogenic target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer, for example, the primer is present at the 3'end of about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic material of interest It may be an oligonucleotide of about 20 base sequences.

In addition, the primers of the target immunogenic base sequence may be designed using the multiple alignment. The primer of the immunogenic target base sequence may be a consensus primer for each immunogenic target base sequence. The immunogenic target base sequence may have a sequence of a consensus primer at the 5'end and the 3'end.

The second step is a step of preparing an immunogenic recombinant base sequence or an immunogenic recombinant expression vector by inserting the immunogenic target base sequence obtained in the first step.

At this time, the sequence of the immunogenic site to be inserted may be different from the sequence of the nucleotide sequence of the immunogenic site in the wild state. Also, if necessary, an arbitrary number of immunogenic sites or non-antigenic sites may be inserted.

In one embodiment, the non-antigenic portion may be a part of the outer membrane protein of the pathogen.

In another embodiment, the non-antigenic portion may be a part of a protein having an adjuvant function.

-Method for producing an antigenic homologous additive protein including an immunogenic site and a foreign part

In one embodiment, it provides a method of preparing an antigenic homologous addition protein including an immunogenic site and a foreign site.

An antigenic homologous addition protein including an immunogenic site and a foreign site can be prepared by a genetic method. In this case, the genetic manufacturing method encompasses the genetic manufacturing method of the immunogenic material. The immunogenic recombinant protein is an antigenic homologous addition protein including an immunogenic site and a foreign site. The target base sequence for immunogenicity becomes the base sequence of the immunogenic site and the base sequence of the foreign part. At this time, the foreign part can be largely classified as one derived from a protein of another pathogen or a completely separate foreign protein. Hereinafter, for convenience, an outpatient part derived from a protein of another pathogen is defined as a "other pathogen foreign part", and an outpatient part derived from a separate foreign protein is defined as a "external part of consultation".

The first step encompasses obtaining the immunogenic target base sequence.

The method of obtaining the nucleotide sequence of the immunogenic site encompasses the first step of the method for producing the antigenic protein and the method for producing the antigenic protein.

The extraneous base sequence of other pathogens can be known by using ncbi's genbank or by screening other pathogens directly. In addition, the nucleotide sequence of the foreign part of the consultation can be found by using the genbank of ncbi or by screening after directly separating and purifying the protein.

Polynucleotides containing an immunogenic target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer, for example, the primer is present at the 3'end of about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic material of interest It may be an oligonucleotide of about 20 base sequences.

In addition, the primers of the target immunogenic base sequence may be designed using the multiple alignment. The primer of the immunogenic target base sequence may be a consensus primer for each immunogenic target base sequence. In this case, the immunogenic target base sequence may have a sequence of a consensus primer at the 5'end and the 3'end.

The second step is a step of preparing an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector by inserting the immunogenic target base sequence obtained in the first step.

At this time, the sequence of the immunogenic site to be inserted may be different from the sequence of the nucleotide sequence of the immunogenic site in the wild state. Also, if necessary, an arbitrary number of immunogenic sites or foreign parts may be inserted.

In one embodiment, the outpatient unit may be another pathogen outpatient unit.

The foreign part of the other pathogen may be an immunogenic site on the antigen protein of the other pathogen.

The outpatient part of another pathogen may be a non-immunogenic site or a non-antigenic part of another pathogen.

In another embodiment, the external unit may be an external unit of consultation.

It is obvious that an antigenic homologous adjunct protein including at least one immunogenic region, at least one non-antigenic region, and at least one foreign region can also be prepared by the above-described genetic preparation method.

Antigen homologous addition protein recombination expression vector

In one embodiment, an antigenic homologous addition protein recombination expression vector for genetically producing an antigenic homologous addition protein is provided.

The antigenic homologous additional protein recombination expression vector encompasses the immunogenic recombination expression vector.

It is possible to provide an antigenic homologous addition protein recombination expression vector made according to the'method of preparing an antigenic homologous addition protein'.

In one embodiment, the immunogenic expression target base sequence may include a base sequence of an immunogenic site or a non-antigenic site.

As the first configuration, the immunogenic expression regulatory element may be a promoter.

In one aspect, the promoter may be a wild-state promoter.

The promoter is preferably an immunogenic cultured host cell codon-optimized.

The promoter may be a wild-state promoter of immunogenic cultured host cells, or may be a separately artificially introduced promoter.

The promoter may be a wild-state promoter modified at some sites. At this time, the modified promoter may have improved initiation efficiency.

As the second configuration, the target base sequence for expression of immunogenicity may include a base sequence of an immunogenic site or a non-antigenic site.

The nucleotide sequence of the immunogenic site encompasses the nucleotide sequence obtained in the first step of the genetic production method of the antigenic protein and the genetic production method of the antigenic homologous protein.

In addition, the immunogenic expression target base sequence may include a plurality of immunogenic sites and non-antigenic sites.

It is preferable that the overall configuration is a promoter-(immunogenic site-non-antigenic site)z. z means that immunogenic sites and non-antigenic sites can be included in any number and order.

In one embodiment, when the non-antigen part is a part of the outer membrane protein of the pathogen, the recombinant expression vector is defined as a "pathogen-like particle recombinant expression vector". 21 is an illustration of a pathogen-like particle recombination expression vector comprising a promoter, 1-immunogenic site-1, and nucleotide sequences of outer membrane proteins.

In another embodiment, when the non-antigen part is a part of a protein having an adjuvant function, the recombinant expression vector is defined as a "complementary immune adjunct recombinant expression vector". 22 is an example of an auxiliary immune adjunct recombination expression vector comprising a promoter, 1-immunogenic site-1, and a nucleotide sequence of a non-antigenic portion having an adjuvant function.

In other embodiments, the immunogenic expression target base sequence may include a base sequence of an immunogenic site or a foreign site.

As the first configuration, the immunogenic expression regulatory element may be a promoter.

In this case, the promoter encompasses the promoter. Hereinafter, "the promoter" encompasses all the promoters of the first embodiment.

As a second configuration, the target base sequence for expression of immunogenicity may include a base sequence of an immunogenic site or a foreign site.

The nucleotide sequence of the immunogenic site encompasses the nucleotide sequence obtained in the first step of the genetic production method of the antigenic protein and the genetic production method of the antigenic homologous protein.

The immunogenic expression target base sequence may include a plurality of immunogenic sites and foreign parts.

It is preferable that the overall configuration is a promoter-(immunogenic site-exogenous site)z.

In one embodiment, when the foreign part is an immunogenic site on an antigen protein of another pathogen, the recombinant expression vector is defined as a "multivalent immunogenic recombinant expression vector". 23 is an example of a multivalent immunogenic recombination expression vector including a promoter, 1-immunogenic site-1, and nucleotide sequences of immunogenic sites of other pathogens.

In one embodiment, when the foreign part is a non-immunogenic site or a non-antigenic site of another pathogen, the recombinant expression vector is defined as a "multivalent pathogen-like particle recombination expression vector". FIG. 24 is an illustration of a multivalent pathogen-like particle recombination expression vector including a promoter, 1-immunogenic site-1, and non-immunogenic sites and non-antigenic parts of other pathogens.

In another embodiment, when the foreign part is a part of a protein with an adjuvant function, the recombinant expression vector is defined as a "complementary immune adjunct recombinant expression vector".

[Method of manufacturing immunogenicity system]

Method of manufacturing an immunogenic system

An example of the present application is a method of manufacturing an immunogenic system.

“Immunogenic system component” is a component constituting an immunogenic system and includes system structures, immunogenic substances, surface initiators, fusions, polymers, and the like.

As a method of manufacturing the immunogenic system, for example, there are two methods as follows.

First, each of the components of the immunogenic system can be prepared and then combined into an immunogenic system. This includes making each component of the immunogenic system separate and then assembling the immunogenic system.

Alternatively, the immunogenic system can be prepared as a whole. This method is a method in which the immunogenic system is manufactured in all stages without distinction of separate stages through a genetic manufacturing method without manufacturing each component.

The resulting immunogenic system can itself be a composition of a vaccine.

Method for manufacturing immunogenic system components

As a method of manufacturing an immunogenic system, in the case of using a method in which the immunogenic system components are separately prepared and the immunogenic system is subsequently assembled, each immunogenic system component is prepared first.

-Manufacturing method of system structure

In one embodiment, a method of manufacturing a system structure is provided.

If the system structure is a virus, bacteria, or spore, it can be prepared through subculture. It can also be manufactured by genetic manufacturing methods.

When the system structure is an artificial structure, an artificial structure having a size similar to that of a microorganism can be manufactured by a conventional method. For example, the method of manufacturing an artificial structure may include adding the step of applying the artificial structure to a phospholipid solution and applying it with a phospholipid.

-Genetic manufacturing method of immunogenic system components

"Component target nucleotide sequence" means a nucleotide sequence to be included in the component recombination nucleotide sequence.

"Recombinant system component" means an immunogenic system component manufactured by a genetic manufacturing method.

"Component recombinant nucleotide sequence" means a nucleotide sequence that encodes a component of a recombinant system.

The "component recombinant expression vector" is a specific example of a component recombinant vector, which means that the component recombinant nucleotide sequence linked to the vector is expressed in vivo. Most of these expression vectors are in the form of plasmids, but are not limited thereto.

"Component incubating host cell" means a cell transformed and cultured with a component recombination expression vector for the manufacture of a recombination system component.

In one embodiment, the immunogenic system provides a method of manufacturing an immunogenic system component through a genetic manufacturing method. At this time, the protein to be produced is a component of the recombination system, and the target base sequence of the component becomes the base sequence of the component of the recombination system. The recombination system component may be a system construct, an immunogenic substance, a surface initiator, a fusion substance, a polymer, or the like.

The method for genetically producing components of the immunogenic system is a specific example, the first step of obtaining a component target base sequence, the second step of producing a polynucleotide having a component recombination base sequence including the component target base sequence. , The third step of transforming the component recombinant base sequence into the component cultured host cells, the fourth step of culturing the transformed component cultured host cells, the fifth step of extracting the recombination system components from the component cultured host cells It may include steps.

The first step is to obtain a constituent target base sequence. The sequence of the immunogenic system components in the wild state can be determined by using the genbank of ncbi or by screening the immunogenic system components directly.

In addition, polynucleotides including the constituent target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, those skilled in the art can design appropriate primers. For example, primers are about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic system component, and 20 nucleotide sequences present at the 3'end. It may be an oligonucleotide of about a base sequence.

In addition, primers of the constituent target base sequence can be designed through multiple alignment.

The second step is a step of preparing a polynucleotide having a component recombination base sequence including the component target base sequence obtained in the first step.

The polynucleotide including the component recombination base sequence may be single-stranded or double-stranded DNA or RNA including the component target base sequence.

In this case, the method of preparing a polynucleotide may be to link a polynucleotide having a constituent target base sequence through a ligase.

The component recombination base sequence may include a promoter of the component culture host cell required for expression.

The polynucleotide including the component recombination base sequence may be a component recombination expression vector into which the component target base sequence is inserted. A method of inserting a component target base sequence into a component recombination expression vector can use conventional gene recombination techniques.

The third step is a step of transforming the component cultured host cells with the component recombination polynucleotide or component recombination expression vector prepared in the second step.

Transformation can be classified as "transient transformation" or "permanent transformation" by its effect. In an example of the present application, transient transformation was used.

In addition, transformation may be classified into "transformation by reactants", "transformation by tools", and "transformation by viruses" depending on the means. In an example of the present application, a heat shock transfection method was used.

The component culture host cells encompass the culture host cells.

Steps 4 and 5 are steps of culturing the transformed component culture host cells and then separating the recombination system components.

The cultivation step may be carried out through conventional cultivation conditions.

The step of separating the recombination system components can be accomplished by conventional gene recombination techniques.

-Component recombinant expression vector

"Constituent expression control element" refers to a nucleotide sequence that controls the expression of a constituent expression target base sequence as a constitution of a component recombination expression vector.

"Constituent expression purpose base sequence" means a component recombination base sequence to be expressed as a constitution of a component recombination expression vector.

One specific example of a method for genetically producing an immunogenic system component is to transform the component culture host cells after preparing a component recombinant expression vector.

The form of the component recombinant expression vector may be a plasmid, but is not limited thereto.

The component recombinant base sequence inserted into the component recombinant expression vector may include a component expression control component and a component expression target base sequence.

The component expression control element encompasses the expression control element.

The component expression purpose base sequence refers to the component recombination base sequence inserted into the component recombination expression vector.

It is preferable that the component expression control component is optimized for the component culture host cell codon.

The immunogenic expression target base sequence is the base sequence of the component of the immunogenic system.

At this time, the expression target base sequence may be inserted in a step including the first step and the second step of the method for genetically producing the immunogenic system component.

The method using the component recombinant expression vector is only one specific example of the genetic production method. Therefore, it is obvious that the method for genetically producing immunogenic system components mentioned below, unless otherwise specified, includes a method using a component recombinant expression vector.

Genetic manufacturing method of immunogenic system

"System target nucleotide sequence" means the nucleotide sequence of an immunogenic system component to be included in the system recombination nucleotide sequence.

"Immunogenic system component" is a component constituting an immunogenic system and means a system structure, an immunogenic substance, a surface initiator, a fusion substance, a polymer, and the like.

"Recombinant system" means any immunogenic system to be finally manufactured in a genetic manufacturing method.

"System recombinant nucleotide sequence" means a nucleotide sequence encoding a recombinant system.

"System recombinant vector" is a specific example of a recombinant vector, which means that the recombinant nucleotide sequence linked to the vector is a system recombinant nucleotide sequence.

The "system recombinant expression vector" is a specific example of a system recombinant vector, and means that the system recombinant base sequence linked to the vector has a function of expressing the entire system structure in a recombinant system. That is, when the system recombination expression vector is inserted, the generation of the recombination system can be confirmed. Most of these expression vectors are in the form of plasmids, but are not limited thereto.

"Pre-system structure" refers to a system structure transformed with a system recombinant expression vector and expressed in a recombinant system.

In one embodiment, the immunogenic system provides a method of manufacturing through a genetic manufacturing method. At this time, the recombination system to be produced is an immunogenic system, and the system target base sequence becomes an element of the immunogenic system.

The genetic manufacturing method of the immunogenic system includes the first step of obtaining the system target base sequence, the second step of producing a polynucleotide having the system recombination base sequence including the system target base sequence, and the system recombination base sequence in the entire system structure. A third step of transforming, a fourth step of culturing the transformed whole system construct, and a fifth step of extracting a successfully expressed recombinant system from the unexpressed whole system construct.

The first step is to obtain a system target base sequence.

The sequence of the immunogenic system components in the wild state can be obtained by using the genbank of ncbi or by screening the immunogenic system components directly.

Polynucleotides including the system target base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer. For example, the primer is about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic system component identified in the above process, and at the 3'end. It may be an oligonucleotide of about 20 base sequences present.

The second step is a step of preparing a polynucleotide having a system recombination base sequence including the system target base sequence obtained in the first step.

The polynucleotide containing the system recombinant base sequence may simply be single-stranded or double-stranded DNA or RNA including the system target base sequence.

In this case, the method of preparing a polynucleotide may be to link a polynucleotide having a system target base sequence through a ligase.

The system recombinant base sequence may contain a promoter of the entire system construct required for expression.

In addition, the polynucleotide including the system recombination base sequence may be a system recombination expression vector into which the target base sequence is inserted. As a method of inserting a target base sequence into a system recombination expression vector, a conventional gene recombination technique can be used.

The third step is a step of transforming the entire system structure with the system recombination polynucleotide or system recombination expression vector prepared in the second step.

Transformation can be classified as "transient transformation" or "permanent transformation" by its effect. In an example of the present application, transient transformation was used.

In addition, transformation is classified into "transformation by reactants", "transformation by tools", and "transformation by viruses" depending on the means. In an example of the present application, a heat shock transfection method was used.

The entire system structure encompasses the system structure.

Steps 4 and 5 are steps of culturing the transformed whole system construct to express the recombinant system and then isolating the successfully expressed recombinant system.

The culturing step can be cultured through conventional culture conditions.

The separation step of the recombination system may be performed by a method such as classification using antibiotic resistance by a conventional gene recombination method.

-System recombinant expression vector

"System expression control element" refers to a nucleotide sequence that controls the expression of a system expression target nucleotide sequence as a component of the system recombination expression vector.

"System expression target base sequence" means a system recombination base sequence to be expressed as a component of the system recombination expression vector.

One specific example of a method for genetically producing an immunogenic system is to transform the entire system structure after preparing a system recombinant expression vector.

The form of the system recombination expression vector may be a plasmid, but is not limited thereto.

The system recombination base sequence inserted into the system recombination expression vector may include a system expression control element and a system expression purpose base sequence.

System expression control elements encompass the expression control elements.

The system expression target base sequence refers to the system recombination base sequence inserted into the system recombination expression vector.

It is preferable that the system expression control element is optimized for the codon of the entire system structure.

The target base sequence for system expression is the immunogenic system.

The system expression target base sequence may be inserted in a step including the first step and the second step of the method for genetic production of the immunogenic system.

The method using the system recombination expression vector is only one specific example of the genetic production method. Therefore, unless otherwise noted, it is obvious that the method for genetic production of the immunogenic system below includes a method using a system recombination expression vector.

Manufacturing method of immunogenic internal support system

An example of the present application is a method of manufacturing an immunogenic internal support system as an immunogenic system for a vaccine.

Methods of manufacturing an immunogenic internal support system include, for example, two methods.

As one method, there is a method of preparing a carrier and a supported surface inverse material, respectively, and carrying the supported material inversely on the carrier. This includes making each component separately and then assembling it into a system.

Alternatively, it is a method of manufacturing an immunogenic internal support system as a whole. This method is a method in which the internal support system is manufactured in all stages without distinction of stages through the genetic manufacturing method without manufacturing each component.

-Method of manufacturing a carrier

In one embodiment, a method of manufacturing a carrier is provided.

The method of manufacturing the carrier encompasses the method of manufacturing the system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a carrier having an electric charge inside the carrier.

The charge inside the carrier may be generated by a material carrying an electric charge. The charged material may be a recombinant protein by a genetic method.

In addition, the charged material may be injected into the carrier from the outside. In this case, the injection method may be a conventional method in microbiology, and specifically, may be microfection.

In another embodiment, the manufacturing method is a method of manufacturing a carrier having an external charge.

The charge outside the carrier may be generated by a material having a charge. In this case, a material having a charge may be adsorbed on the carrier. The adsorption method may be to mix the carrier with an electrically charged material and leave it at a constant temperature.

-Manufacturing method of supported surface reversal material

As a specific example, it provides a method for preparing a supported surface inverse material.

The method for preparing a supported immunogenic substance encompasses the method for preparing the immunogenic substance.

In one embodiment, the manufacturing method may be a method of manufacturing an immunogenic substance having a charge.

The charge of an immunogenic substance may be due to a charged substance. At this time, a material carrying an electric charge may be adsorbed to the material inversely when supported. The adsorption method may be to mix a supported surface inverse material with a charged material and leave it at a constant temperature.

-Loading method of inverse material

As a specific example, it provides a method of loading a supported surface inverse material on a carrier.

The supported surface reversal material may be injected into the carrier from the outside. In this case, the injection method may be a conventional method in microbiology, and a specific example may be microfection.

-Genetic manufacturing method of immunogenic internal support system

In one embodiment, a method for genetically producing an immunogenic internal support system is provided.

The genetic manufacturing method of the immunogenic internal support system encompasses the genetic manufacturing method of the immunogenic system.

The system target base sequence contains the supported surface inverse substances. The system target base sequence may include a substance carrying an electric charge.

The sequence of the carrier-reversible substance may include a signal sequence of an internal protein of the carrier.

-Immunogenic internal bearing system recombination expression vector

As an embodiment, an immunogenic internal load system recombination expression vector for genetically manufacturing an immunogenic internal load system is provided.

The immunogenic internally supported system recombination expression vector encompasses the system recombination expression vector.

The base sequence for the purpose of system expression includes a material that is a supported surface inversion. In this case, the base sequence for the purpose of system expression may include a material having a charge.

Manufacturing method of immunogenic fusion display system

An example of the present application is a method of manufacturing an immunogenic fusion display system as an immunogenic system for a vaccine.

There are two methods of manufacturing an immunogenic fusion display system, for example.

As a method, there is a method of manufacturing the fusion display body and the fusion body, respectively, and attaching the fusion body to the outside of the fusion display body. This includes making each component separately and then assembling it into a system.

Alternatively, it is a method of manufacturing an immunogenic fusion display system as a whole. This method is a method in which the fusion display system is manufactured in all stages without distinction of stages through the genetic manufacturing method, even without manufacturing individual components.

-Manufacturing method of fusion display body

In one embodiment, a method of manufacturing a fusion display body is provided.

The method of manufacturing the fusion display body encompasses the method of manufacturing the system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a fusion display body that has an electric charge outside the fusion display body.

Charges outside the fusion display body may be generated by a material that has a charge outside the fusion display body. At this time, a material having an electric charge may be adsorbed on the fusion display body. The adsorption method may be to put the fusion display body in a solution of an electrically charged material and leave it at a constant temperature.

-Manufacturing method of fusion body

In one embodiment, a method of preparing a fusion body is provided.

The method for preparing the fusion encompasses the method for preparing the immunogenic system component.

In one embodiment, a method of preparing a fusion body comprises preparing a surface initiator and a fusion immunogenic material by the method of producing the immunogenic system component, and coupling the surface initiator and the fusion immunogenic substance. I can.

The manufacturing method of the surface initiator may be a genetic manufacturing method.

The manufacturing method of the fusion immunogenic material may be a genetic manufacturing method.

The method for preparing a fusion immunogenic substance encompasses a method for producing the immunogenic substance.

In another embodiment, the method of preparing the fusion may be a method of genetically producing components of the immunogenic system.

In the genetic manufacturing method, the target base sequence includes a fusion immunogenic substance and a surface initiator. In addition, the target base sequence may include a fusion immunogenic substance, a surface initiator, and a fusion portion.

-How to connect fusion display body of fusion body

In one embodiment, a method of linking the fusion body to the fusion display body is provided.

The association method may be to leave the fusion body at constant temperature in the same solution as the fusion display body. Preferably, the fusion body may be initiated outside the fusion display body by the function of the surface initiator of the fusion body.

- genetic method of producing an immunogenic fusion display systems

In one embodiment, a method for genetically producing an immunogenic fusion display system is provided.

The genetic manufacturing method of the immunogenic fusion display system encompasses the genetic manufacturing method of the immunogenic system. In this case, the system target base sequence includes surface initiators and fusion immunogenic substances. In this case, the system target base sequence may include a fusion part.

The promoter of the surface initiator and the surface initiator can be integrated into the system target base sequence.

-Immunogenic fusion display system recombination expression vector

In one embodiment, an immunogenic fusion display system recombination expression vector for genetically manufacturing an immunogenic fusion display system is provided.

The immunogenic fusion display system recombination expression vector encompasses the system recombination expression vector.

The system expression regulatory element may be a promoter that initiates transcription of the surface initiator in the wild state.

The target base sequence for system expression includes surface initiators and fusion immunogenic substances. In this case, the target base sequence for system expression may include a fusion portion.

The promoter of the surface initiator and the surface initiator can be integrated into the system target base sequence.

Immunogenic coupling display system manufacturing method

An example of the present application is a method of manufacturing an immunogenic coupling display system as an immunogenic system for a vaccine.

The method of manufacturing an immunogenic coupling display system includes the steps of preparing a coupling display body including a coupling group and a coupling immunogenic substance, respectively, and causing a coupling bond between the coupling display body and the coupling immunogenic substance. Includes.

-Manufacturing steps of a coupling display body including a display body coupling machine

As a specific example, a method of manufacturing a coupling display body including a display body coupling group is provided.

The manufacturing method of the coupling display body may include manufacturing a system structure and forming a display body coupling group in the system structure.

The system structure can be manufactured by the method of manufacturing the system structure.

In addition, the display chain coupling group may be formed by a conventional method used to cause a cross-link between proteins. In addition, the display check coupling device may be included in the system structure in the wild state. The display chain coupling group may be a thiol group of cysteine.

-Manufacturing method of coupling immunogenic material including immunogenic material coupling group

In one embodiment, it provides a method for preparing a coupling immunogenic substance comprising an immunogenic substance coupling group.

The method of preparing a coupling immunogenic substance may include preparing an immunogenic substance and forming an immunogenic substance coupling group in the immunogenic substance.

The immunogenic material may be prepared by the method for preparing the immunogenic material.

In addition, the immunogenic substance coupling group may be formed by a conventional method used to cause cross-link.

In addition, the immunogenic substance coupling group may be included in the immunogenic substance in the wild state. The immunogenic substance coupling group may be a thiol group of cysteine.

-Coupling bonding step

In one embodiment, there is provided a step of causing a coupling bond between a coupling display body and a coupling immunogenic substance.

In this case, it is sufficient if the coupling bond occurs under normal coupling reaction conditions.

Immunogenic adhesion display system manufacturing method

An example of the present application is a method of manufacturing an immunogenic adhesion display system as an immunogenic system for a vaccine.

Methods of manufacturing the immunogenic attachment display system include, for example, the following two methods.

As one method, there is a method of preparing an attachment display body and an attachment immunogenic material, respectively, and attaching the attachment immunogenic material to the attachment display body. This includes making each component separately and then assembling it into a system.

Alternatively, it is a method of manufacturing an immunogenic adhesion display system as a whole. This method is a method in which an attached display system is manufactured in all stages without distinction of stages through a genetic manufacturing method without manufacturing individual components.

-Manufacturing method of attached display body

In one embodiment, a method of manufacturing an attached display body is provided.

The method of manufacturing the attached display body encompasses the method of manufacturing the system structure.

In one embodiment, the manufacturing method may be a method of manufacturing an attached display body having an electric charge inside the attached display body.

The electric charge inside the attachment display body may be generated by a material having an electric charge inside the attachment display body. In this case, the charged material may be a protein produced by genetic recombination. In addition, a material having a charge can be injected into the attachment display body from the outside. In this case, the injection method may be a conventional method in microbiology, and a specific example may be microfection.

In another embodiment, the manufacturing method may be a method of manufacturing an attached display body having an electric charge outside the attached display body.

In this case, the electric charge outside the attachment display body may be generated by a material having an electric charge outside the attachment display body. The charged material may be adsorbed on the attachment display body. The adsorption method may be to put the attached display body in a solution of a substance having an electric charge and leave it at a constant temperature.

-Manufacturing method of adherent immunogenic substance

In one embodiment, it provides a method for preparing an adherent immunogenic substance.

The method of preparing an adherent immunogenic substance encompasses the method of preparing the immunogenic substance.

In one embodiment, the manufacturing method may be a method of manufacturing an adherent immunogenic material having an electric charge.

The charge of the adherent immunogenic substance may be due to a substance carrying an electric charge. The charged material may be adsorbed onto the adherent immunogenic material. The adsorption method may be to put an attached immunogenic substance into a solution of a substance having a charge and leave it at a constant temperature.

-Attachment method of attached immunogenic substance

In one embodiment, a method of attaching an adherent immunogenic substance to an adherent display body is provided.

The attachment method may be a method of putting an attached immunogenic substance in the same solution as the attachment display body and leaving it at a constant temperature. At this time, the adhering immunogenic material and the adherent display body interact, so that the adhering immunogenic material adheres to the adherent display body.

-Genetic manufacturing method of immunogenic attachment display system

In one embodiment, a method for genetically manufacturing an immunogenic adhesion display system is provided.

The genetic manufacturing method of the immunogenic attachment display system encompasses the genetic manufacturing method of the immunogenic system. In this case, the target base sequence for the system includes an attached immunogenic substance. The system target base sequence may include an electrically charged material.

-Immunogenic attachment display system recombination expression vector

As an embodiment, an immunogenic attachment display system recombination expression vector for genetically manufacturing an immunogenic attachment display system is provided.

Immunogenically attached display system recombination expression vectors encompass system recombination expression vectors. At this time, the base sequence for the purpose of system expression includes an attached immunogenic substance. The system expression target base sequence may include a material to be charged.

Method of manufacturing immunogenic cross-linked display system

An example of the present application is a method of manufacturing an immunogenic cross-linked display system as an immunogenic system for a vaccine.

A method of manufacturing an immunogenic cross-linked display system includes the steps of preparing a display system in which the cross-linked immunogenic material is disclosed; And adding a polymer to the display system to form a crosslinked network structure.

-Manufacturing method of display system

As a specific example, first, a method of manufacturing a display system in which a cross-linked immunogenic material is disclosed is provided.

The method of manufacturing the display system may be a method of manufacturing an immunogenic fusion display system.

The method of manufacturing the display system may be a method of manufacturing an immunogenic coupling display system.

The method of manufacturing the display system may be a method of manufacturing an immunogenic attached display system.

It is preferable that the immunogenic material of the display system has a crosslinking group. The crosslinking group may be included in the immunogenic material in the wild state. For example, the crosslinking group is a hydroxy group. In addition, the crosslinking group may be a coupling group. The coupling group may be formed by a known method used to induce a cross-link between proteins.

-Method of forming cross-linked net structure

In one embodiment, a method of forming a cross-linked network structure is provided.

The cross-linked network structure is formed by adding a polymer to the resulting display system to cause cross-linking.

The cross-linking may occur under conventional coupling reaction conditions.

In addition, the polymer may be a conventional reagent used to cause cross-link between proteins. For example, the polymer is glutaraldehyde, and the cross-linking reaction may be an aldol condensation reaction.

Manufacturing method of immunogenic serial connection system

An example of the present application is a method of manufacturing an immunogenic serial connection system as an immunogenic system for a vaccine.

There are two main methods for manufacturing an immunogenic serial connection system, for example.

As one method, there is a method of manufacturing an immunogenic serial connector and linking it with a serial connection system structure. This includes making each component separately and then assembling it into a system. At this time, since the serial connection system is characterized by the structure of the immunogenic material, the type of the serial connection system structure is not limited, and the manufacturing method thereof may vary depending on the mode of the system.

Alternatively, it is a method of manufacturing an immunogenic tandem system as a whole. This method is a method in which a series connection system is manufactured in all stages without distinction of stages through a genetic manufacturing method without manufacturing individual components.

-Manufacturing method of protein x

In one embodiment, a method of preparing an immunogenic serial connector provides a method of preparing each of the x-th protein and then forming the y-th connector to bind.

As a first step, a method of preparing the x-th protein is provided.

When the x-th protein is an immunogenic substance, the method of preparing the x-th protein encompasses the method of preparing the immunogenic substance.

It is preferable to manufacture the x-th protein by a genetic manufacturing method.

When the x-th protein is an immunogenic substance, the method of preparing the x-th protein encompasses the method of preparing the immunogenic substance.

When the x-th protein is not an immunogenic substance, the method for producing the x-th protein encompasses a method of genetically producing the protein or a method of genetically producing the components of the immunogenic system.

-How to form the y-th connector

As a second step, a method of combining the y-th protein and the (y+1) protein is provided by forming the y-th connection part.

The protein binding method may be by a conventional coupling reaction.

The protein binding method may be to form a polymerized portion using an appropriate crosslinking group and a polymer.

The method of forming the y-th connector may be sequentially forming the first connector to the (n-1)th connector.

-Genetic manufacturing method of immunogenic serial connector

In one embodiment, a method for genetically producing an immunogenic tandem is provided.

The genetic production method of the immunogenic serial connector encompasses the genetic production method of the immunogenic system component.

The genetic manufacturing method of the immunogenic serial connector is a genetic manufacturing method in which the immunogenic serial connector is used as a component recombination base sequence, and the x-th protein is used as a component target base sequence. In this case, the component target base sequence may selectively include y-th connectors.

When the x-th protein is an immunogenic material, the step of obtaining the base sequence of the x-th protein encompasses the first step of the method for genetically producing the immunogenic material.

In addition, when the x-th protein is not an immunogenic substance, the step of obtaining the base sequence of the x-th protein encompasses the first step of a method for genetically producing a protein or a method for genetically producing an immunogenic system component.

In the second step of preparing a polynucleotide, the constituent recombination base sequence of the polynucleotide is the first protein-the first connection part-the second protein-the second connection part-(……the (n-1) The constituent target base sequences of the connecting portion-n-th protein may be arranged in ascending order.

-Immunogenic serial linkage recombination expression vector

In one embodiment, an immunogenic tandem recombination expression vector for genetically producing an immunogenic tandem is provided.

The immunogenic fusion display format recombination expression vector encompasses the component recombination expression vector.

For convenience, the recombinant expression vector was expressed as including the nucleotide sequence of the y-th connection portion, but the y-th connection portion referred to herein may be merely a peptide bond, and in this case, a specific nucleotide sequence may not exist separately.

As a second configuration, the target base sequence for component expression may include a base sequence of the x-th protein and the y-th connection.

The base sequence for the purpose of constituent expression is a form arranged in ascending order of the first protein-the first connection part-the second protein-the second connection part-(……the (n-1)th connection part-the n-th protein) by definition of the serial connector. I can.

The overall configuration is preferably a promoter-first protein-first connector-second protein-second connector-(……(n-1)th linker-n-th protein. FIG. 25 shows a promoter and a first protein. To a fifth protein and an immunogenic serial linker recombination expression vector comprising a nucleotide sequence of the first linking portion to the fourth linking portion connecting the protein.

-How to connect immunogenic serial connector and serial connection system structure

In one embodiment, there is provided a method of associating an immunogenic serial connector made by the above manufacturing method with a serial connection system structure.

Since the serial connection system is characterized by the structure of the immunogenic material, there is no limitation on the type of the system, and the connection method to the serial connection system may vary depending on the aspect of the system.

-Genetic manufacturing method of immunogenic serial connection system

In one embodiment, a method for genetically manufacturing an immunogenic tandem system is provided.

The method of genetically producing an immunogenic tandem system encompasses a method of genetically producing the immunogenic system.

The genetic manufacturing method of an immunogenic serial-connected system is a genetic manufacturing method in which the mode of a selective system is a system recombination base sequence, and the immunogenic serial-connected system is a system target base sequence.

The system target base sequence may contain essential components depending on the aspect of the optional system. For example, when an immunogenic fusion display system is selected as the aspect of the system, the target base sequence of the system may essentially include the base sequence of the surface initiator.

In addition, the system target base sequence may include an optional configuration according to an aspect of the optional system. For example, when an immunogenic fusion display system is selected as an aspect of the system, the system target base sequence may selectively include the base sequence of the fusion part.

The method of obtaining the nucleotide sequence of the immunogenic tandem in the first step of the method for genetically producing the immunogenic system may be by the method of genetically producing the immunogenic tandem.

-Immunogenic serial connection system recombination expression vector

In one embodiment, an immunogenic serial connection system recombination expression vector for genetically manufacturing an immunogenic serial connection system is provided.

The immunogenic serial-linked system recombination expression vector encompasses the system recombination expression vector.

The system expression target base sequence may include a base sequence of an immunogenic serial connector.

The system target base sequence may contain essential components depending on the aspect of the optional system. For example, when an immunogenic fusion display system is selected as the aspect of the system, the target base sequence of the system may essentially include the base sequence of the surface initiator. In this case, a desirable configuration arrangement may be required depending on the aspect of the system.

For better understanding, it is assumed that an immunogenic system as shown in FIG. 27 is prepared. FIG. 27 is an illustration of an immunogenic serial connection system in which an immunogenic serial connector including a base sequence of a first connection part to a fourth connection part connecting the first protein to the fifth protein and the protein is matched as an aspect of a fusion display system.

In the above example, it is preferable that the nucleotide sequence of the surface initiator appears before the nucleotide sequence of the immunogenic serial connector.

In addition, the system target base sequence may include an optional configuration according to an aspect of the optional system. For example, when an immunogenic fusion display system is selected as an aspect of the system, the system target base sequence may selectively include the base sequence of the fusion part.

As a second configuration, the target base sequence for system expression may include a base sequence of a series connector.

In this case, the nucleotide sequence of the serial connector encompasses the component expression target nucleotide sequence of the "immunogenic serial connector recombination expression vector".

The overall configuration is preferably a promoter-[(essential configuration)-(immunogenic serial linker)-(selective configuration)]. FIG. 26 is an immunogenic serial connector for preparing the immunogenic system of FIG. 27 including a promoter, a surface initiator, and a nucleotide sequence of the first to fourth linkages connecting the first protein to the fifth protein and the protein. This is an example of a combination expression vector.

Manufacturing method of immunogenic parallel system

An example of the present application is a method of manufacturing an immunogenic parallel system as an immunogenic system for a vaccine.

There are two main methods of manufacturing an immunogenic parallel system, for example.

One way is to first manufacture a parallel body and then associate it with the parallel system structure. This includes making each component separately and then assembling it into a system. At this time, since the parallel system is independent of the transmission of each parallel body, the method of manufacturing the parallel system structure varies according to the system mode.

Another way is to create an immunogenic parallel system as a whole. This method is a method in which an immunogenic parallel system is manufactured in all stages without distinction of stages through a genetic manufacturing method without manufacturing individual components.

-Manufacturing method of parallel body

First, the method of manufacturing an immunogenic parallel system provides a method of manufacturing each parallel body and then connecting it to the parallel system structure.

As a first step, a method of manufacturing a parallel body is provided.

When any parallel body is an immunogenic substance, the method of preparing the parallel body encompasses the method of preparing the immunogenic substance. At this time, it is preferable to manufacture the parallel body by a genetic manufacturing method.

When any parallel body is not an immunogenic substance, for example, a substance that assists the immune response and the like can be prepared by a known method.

-How to connect parallel bodies

As a second step, we provide a method of linking the parallel body to the parallel system structure.

In a parallel system, the transfer of each parallel body is independent, so the method of association may vary depending on the aspect of the system selected for each parallel body. The attaching method encompasses the attaching method described in the internal support system or the attachment system.

-Genetic manufacturing method of immunogenic parallel system

In one embodiment, a method for genetically producing an immunogenic parallel system is provided.

The genetic production method of the immunogenic parallel system encompasses the genetic production method of the immunogenic system.

There are two main methods for genetically manufacturing an immunogenic parallel system, for example.

As a method, first, there is a method of performing the genetic manufacturing method of a system in which the system of each parallel body is a system recombination base sequence once.

For better understanding, it is assumed that an immunogenic parallel system as shown in FIG. 29 is manufactured. 29 is an example of an immunogenic parallel system in which three parallel bodies are each composed of an internal support system, a fusion display system, and a fusion display system.

The immunogenic system of FIG. 29 can be manufactured through the genetic manufacturing method of the first parallel body internal supporting system, the second parallel body fusion display system genetic manufacturing method, and the third parallel body fusion display system genetic manufacturing method. have.

In this case, a method of manufacturing one or more systems may be a method of associating components. For example, in the above example, the method of manufacturing the internal support system may be microfection.

The method of manufacturing a plurality of systems may be a one-time genetic manufacturing method in which each system is a system target base sequence. For example, in the above example, the method of manufacturing the fusion display system of the second parallel body and the fusion display system of the third parallel body inserts a parallel fusion display system recombination expression vector including two fusion display system expression target base sequences. It can be.

As another method, the second method is to perform a genetic manufacturing method using a plurality of systems as system target base sequences.

The genetic manufacturing method of the immunogenic parallel system is a genetic manufacturing method in which the immunogenic parallel system is used as the system recombination base sequence, and the immunogenic system of each parallel entity is the system target base sequence. For example, in the above example, the system of the first parallel body, the system of the second parallel body, and the system of the third parallel body correspond to the system target base sequence and become part of the immunogenic parallel system, which is the system recombination base sequence.

At this time, the first step is to obtain the target base sequence for each system.

The method of obtaining the system target base sequence encompasses a method of obtaining the system recombinant base sequence in the genetic production method of the internal support system or the attachment system. For example, in the above example, the method of obtaining the system target base sequence corresponding to the system of the second parallel body is to be obtained through the first and second steps of the genetic manufacturing method of the immunogenic fusion display system. I can.

In this case, the second step is a step of obtaining a polynucleotide having a system recombination base sequence.

The system recombination base sequence including the system target base sequence obtained in the first step can be obtained by a conventional method.

-Immunogenic parallel system recombinant expression vectors (restriction sites)

As an embodiment, an immunogenic parallel system recombination expression vector for genetically producing an immunogenic parallel system is provided.

The immunogenic parallel system recombination expression vector encompasses the system recombination expression vector.

The system expression target base sequence may include a base sequence of an immunogenic parallel body.

In one embodiment, the immunogenic parallel system recombination expression vector may be a plurality of system recombination expression vectors using the system of each parallel entity as a system expression target base sequence. For example, the immunogenic parallel system recombination expression vector for preparing the immunogenic system of FIG. 29 is a recombination expression vector for the immunogenic internal support system of the first parallel body, It may be a third parallel immunogenic fusion display system recombination expression vector.

In another embodiment, the immunogenic parallel system recombination expression vector may be a single system recombination expression vector using a system of multiple parallel entities as a system expression target base sequence.

The system nucleotide sequence of each parallel body encompasses the system expression target nucleotide sequence in the system recombination expression vector of the internal support system or the attachment system. The system nucleotide sequence of each parallel body is preferably inserted into a restriction enzyme site at each insulated position.

It is preferable that the nucleotide sequence of the promoter is in front of the system nucleotide sequence of each parallel.

The arrangement of the overall configuration is (first promoter-system of the first parallel body)-(area to be insulated)-(second promoter-system of the second parallel body)-(area to be insulated)-(third promoter- System of the third parallel body)-(area to be insulated)... It is preferably an nth promoter-nth parallel system).

28 is an immunogenic parallel system of FIG. 29, and FIG. 28 is a (internal support system consisting of a first promoter and a first parallel body), (a second promoter and a first surface initiator and a first fusion unit, and a second parallel body). Convergence display system consisting of), (fusion display system consisting of a third promoter, a second surface initiator, a second fusion unit, and a third parallel body), and the nucleotide sequence of (selective configuration consisting of a selective promoter and optional elements). , Figure 29 is an illustration of an immunogenic parallel system recombinant expression vector for preparing the immunogenic system.

Method of manufacturing immunogenic spore system

An example of the present application is a method of manufacturing an immunogenic spore system as an immunogenic system for a vaccine.

-Method of manufacturing immunogenic spore system components

"Immunogenic spore system component (immunogenic spore system component)" as a component of the immunogenic spore system refers to a spore system structure, immunogenic material, spore surface initiator, spore fusion body, and the like.

In the case of a method of manufacturing an immunogenic spore system, each of the components of the immunogenic spore system is prepared first and then combined with the immunogenic spore system afterwards, the preparation of the components of the immunogenic spore system is essential.

-Manufacturing method of spore system structure

In one embodiment, a method of manufacturing a spore system structure is provided.

If the spore system structure is spore, it can be prepared through subculture.

If the spore system structure is a spore, it can be produced by a genetic manufacturing method. Methods for the genetic production of spore system constructs are described in Methods for genetic production of immunogenic spore system components below.

If the spores are spores of spore bacteria, the method of producing spores may include inducing the formation of spores. Since spores of spore bacteria are formed only under conditions where the survival of the bacteria is difficult, a separate spore formation induction step may be required.

In this case, the step of inducing spore formation may include, for example, culturing with Schaeffer's sporulation media. The composition of the shaper culture medium may include, for example, 2 to 20 g/L of Difco nutrient broth. In this case, the preferred composition (concentration) of Difco nutrient broth in the present application may be 7g/L. Conventional culture medium often has a higher concentration of Difco nutrient broth.

In one embodiment, the composition of the shaper culture was used 7g / L Difco nutrient broth, 0.25g / L MgSO ₄ 7H ₂ O, 1g / L KCl. The step of inducing spore formation may include adding 1 ml of a solution of _{FeSO 4} 7H ₂ O 10 ^-3 M, MnCl ₂ 4H2O 10 ^-2 M, and CaCl ₂ 2H _{2 O 1M after the culture is finished.}

The method for producing spores may include the step of inactivating spores.

Spores of spore bacteria become bacteria again when conditions that are difficult to survive disappear, making it an obstacle to the formation of a stable spore system. The spore inactivation step can be a way to address these disorders and maintain the shape of the spores.

The spore deactivation step may be a physical method.

In this case, the physical method may be, for example, applying heat to deactivate it. For example, the temperature for deactivation may be 40 to 300°C. In one embodiment, the preferred deactivation temperature is 120°C.

In this case, the deactivation time may be, for example, 5 to 60 minutes. In one embodiment, the preferred deactivation time is 15 minutes.

The spore inactivation step can be a chemical method.

In this case, a known method may be used as a chemical method. For example, the chemical method may be a method of changing the pH condition. Also, the chemical method may be a method using a specific chemical substance.

The spore inactivation step can be a genetic method.

In this case, a known method may be used as a genetic method.

In the case of fabrication of the prespore system structure, the step of deactivating spores may be unnecessary.

When the spore system structure is a spore-like particle, the manufacturing method may include preparing a spore-like particle nucleus and applying a spore-like particle nucleus to the spore-like particle nucleus. At this time, the spore-like particle nucleus can be prepared by conventional physical/chemical methods. In addition, spore-like particle nuclei can be added to a phospholipid solution and allowed to stand at a constant temperature for application.

The method for preparing spore-like particles may include a genetic method. In this case, the method for producing spore-like particles may be a method for genetically producing an immunogenic system component in which the constituent target base sequence is used as a spore outer membrane protein.

-Genetic manufacturing method of immunogenic spore system components

In one embodiment, the immunogenic spore system provides a method of manufacturing an immunogenic spore system component through a genetic method.

The genetic manufacturing method encompasses the genetic manufacturing method of the components of the immunogenic system.

The component recombinant base sequence is a component of the immunogenic spore system.

When the recombination system component is spores, the method for genetic production of spores may include the step of inducing spore formation or step of inactivating spores in addition to the step of obtaining spores through the genetic production method described above.

-Recombinant expression vector of immunogenic spore system components

One specific example of a method for genetically producing an immunogenic spore system component is to transform a component culture host cell after preparing a component recombination expression vector.

Recombinant expression vectors of immunogenic spore system components encompass component recombination expression vectors. The target base sequence for component expression is a component of the immunogenic spore system.

-Genetic manufacturing method of immunogenic spore system

"Spore system target nucleotide sequence" means the nucleotide sequence of an immunogenic system component to be included in the spore system recombination nucleotide sequence.

The term "spore recombinant system" refers to any immunogenic spore system that is ultimately intended to be manufactured in a genetic manufacturing method.

"Spore system recombinant nucleotide sequence" means a nucleotide sequence encoding a spore recombination system.

The "spore system recombinant vector" is a specific example of a recombinant vector, and means that the recombinant base sequence linked to the vector is a spore system recombinant base sequence.

The term "spore system recombinant expression vector" is a specific example of a spore system recombinant vector, meaning that the spore system recombination base sequence linked to the vector even functions to express the whole spore system structure as a spore recombination system. do. That is, when the spore system recombination expression vector is inserted, it is possible to confirm the creation of the spore recombination system. Most of these expression vectors are in the form of plasmids, but are not limited thereto.

"Pre-spore system structure" means a spore system structure transformed with a spore system recombination expression vector and expressed by a spore recombination system. At this time, the spore system structure is a spore.

As an embodiment, the immunogenic spore system is provided as a method of manufacturing through a genetic manufacturing method. The recombination system to be produced is an immunogenic spore system, and the target base sequence of the spore system becomes an element of the immunogenic spore system.

The method for genetic production of an immunogenic spore system includes, for example, a first step of obtaining a spore system target base sequence, a second step of producing a polynucleotide having a spore system recombination base sequence including a spore system target base sequence, and spores. The third step of transforming the system recombination base sequence into the prospore system construct, the fourth step of culturing the transformed prospore system construct, and extracting the successfully expressed spore recombination system from the unexpressed prospore system construct It can contain 5 steps.

The first step is to obtain the target base sequence for the spore system. The nucleotide sequence of the immunogenic spore system component in the wild state can be obtained by using the genbank of ncbi or by screening the immunogenic spore system component directly.

In addition, polynucleotides containing the target base sequence of the spore system can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotide can be prepared through PCR cloning.

For PCR cloning, a person skilled in the art can design an appropriate primer. For example, the primer is about 20 nucleotide sequences present at the 5'end of the nucleotide sequence of the immunogenic spore system component, and 20 nucleotide sequences present at the 3'end. It may be an oligonucleotide of about a dog's base sequence.

The second step is a step of preparing a polynucleotide having a spore system recombination base sequence including the spore system target base sequence obtained in the first step.

The polynucleotide containing the spore system recombinant base sequence may simply be single-stranded or double-stranded DNA or RNA containing the spore system target base sequence.

In this case, the method of preparing the polynucleotide may be to link the polynucleotide having the target base sequence of the spore system through a ligase.

The spore system recombinant base sequence may contain a prospore system construct necessary for expression, that is, a promoter of a spore.

The polynucleotide including the spore system recombination base sequence may be a spore system recombination expression vector into which the spore system target base sequence is inserted. The method of inserting the target base sequence of the spore system into the spore system recombination expression vector can use conventional gene recombination techniques.

The third step is a step of transforming the prespore system structure with the spore system recombination polynucleotide or the spore system recombination expression vector prepared in the second step.

Transformation can be classified as "transient transformation" or "permanent transformation" by its effect. In an example of the present application, transient transformation was used.

In addition, transformation is classified into "transformation by reactants", "transformation by tools", and "transformation by viruses" depending on the means. In an example of the present application, a heat shock transfection method was used.

The prespore system structure means spores among the spore system structures.

Steps 4 and 5 are steps of culturing the transformed prospore system structure and isolating the successfully expressed recombinant system.

The cultivation step may be performed through conventional cultivation conditions.

The fifth step may include the step of inducing spore formation or step of inactivating spores prior to the step of separating the recombination system.

The separation step of the recombination system may be by a conventional gene recombination method.

-Spore system recombination expression vector

The "spore system expression control element" refers to a base sequence that controls the expression of a spore system expression target base sequence as a constitution of a spore system recombination expression vector.

The "spore system expression target base sequence" means a spore system recombination base sequence to be expressed as a constitution of a spore system recombination expression vector.

One specific example of a method for genetic production of an immunogenic spore system is to transform the prespore system structure after preparing a spore system recombination expression vector.

The form of the spore system recombination expression vector may be a plasmid, but is not limited thereto.

The spore system recombination base sequence inserted into the spore system recombination expression vector may include a spore system expression control element and a spore system expression target base sequence.

The spore system expression control element encompasses the expression control element.

The promoter may be a spore promoter.

The promoter may be a promoter of a spore microorganism. For example, it may be the promoter of Bacillus.

The spore system expression target base sequence refers to the spore system recombination base sequence, which is inserted into the spore system recombination expression vector.

It is preferable that the spore system expression control element and the spore system expression target base sequence are optimized for the spore codon.

The target base sequence for expression of the spore system is the immunogenic spore system.

The target base sequence for expression of the spore system contains the components of the immunogenic spore system.

The target base sequence for expression of the spore system may be inserted in a step including the first step and the second step of the method for genetic production of the immunogenic spore system.

The method using the spore system recombination expression vector is only one specific example of the genetic production method. Therefore, unless otherwise specified, it is obvious that the method for genetic production of the immunogenic spore system below includes a method using a spore system recombination expression vector.

Manufacturing method of immunogenic intraspore support system

An example of the present application is a method of manufacturing an immunogenic intraspore support system as an immunogenic system for a vaccine.

There are two main methods of manufacturing the immunogenic intraspore support system, for example.

As a method, first, there is a method of preparing a spore-carrying body and a supported surface-reversing material, respectively, and carrying the supported surface-reversing material on the support. This includes making each component separately and then assembling it into a system.

As another method, there is a method of preparing an immunogenic intraspore support system as a whole. This method is a method in which the internal spore-carrying system is manufactured in all stages without distinction of stages through a genetic manufacturing method without manufacturing individual components.

-Manufacturing method of spore support

As an embodiment, it provides a method of preparing a spore support.

The method of manufacturing the spore support encompasses the method of manufacturing the spore system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a spore carrier having an electric charge therein. The charge inside the spore carrier may be generated by a material having an electric charge. In this case, a material having a charge may be injected into the carrier from the outside. The injection method may be a conventional method in microbiology, and a specific example may be microfection.

Alternatively, the charged material may be a recombinant protein by a genetic method.

The genetic manufacturing method encompasses the genetic manufacturing method of the components of the immunogenic spore system.

In the genetic manufacturing method, the target base sequence for spores contains charged substances. The charged material may include a signal sequence inside spores. The "spore internal signal sequence" refers to a protein sequence that functions to guide the protein into the spore as a signal sequence in the inner spore protein. The method of including the intraspore signal sequence in a charged material includes, for example, obtaining a site containing the signal sequence located in the intraspore protein, and inserting the spore-bearing surface inversely with the base sequence of the material. I can.

The third step is a step of transforming a spore carrier with a component recombination polynucleotide or component recombination expression vector.

In another embodiment, the manufacturing method may be a method of manufacturing a spore support having an external charge.

The charge outside the spore-carrier may be generated by a material carrying an electric charge. At this time, a material carrying an electric charge may be adsorbed on the spore carrier. The adsorption method may be to mix the spore-carrying body with a material having a charge and leave it at a constant temperature.

-Method of manufacturing spore-supported surface inverse material

In one embodiment, it provides a method of preparing a spore-supported surface inverse material.

The spore-bearing surface inverse substance may include a signal sequence inside the spore.

The method of preparing the spore-supported surface inverse agent encompasses the method of preparing the immunogenic substance.

The method for preparing the spore-supported surface inverse material may be a method for genetically producing the immunogenic material.

In the genetic production method, the immunogenic target base sequence may include an intraspore signal sequence.

In addition, the manufacturing method may be a method of manufacturing a spore-bearing surface inverse material having an electric charge.

The charge of the spore-bearing surface inverse material may be due to a material carrying an electric charge. The charged material may be adsorbed on the spore-bearing material. The adsorption method may be to mix a spore-carrying surface inverse material with an electrically charged material and leave it at a constant temperature.

-Spore-bearing surface inverse material loading method

As a specific example, it provides a method of supporting a spore-carrying surface inverse material on a spore-carrying body.

The spore-bearing surface reversible material can be injected into the spore-carrying body from the outside. In this case, the injection method may be a conventional method in microbiology, and a specific example may be microfection.

If the spore-bearing surface reversible material includes the spore internal signal sequence, the spore-bearing surface reversible substance may be carried on the spore-bearing body by the spore internal signal sequence.

-Genetic manufacturing method of immunogenic spore support system

In one embodiment, a method for genetically producing an immunogenic intraspore support system is provided.

The genetic production method of the immunogenic spore support system encompasses the genetic production method of the immunogenic spore system. The target base sequence of the spore system contains substances that are inverted to the spore-bearing surface.

In one embodiment, the spore system target base sequence may include only spore-bearing surface inverse substances.

In this case, the first step is a step of obtaining the nucleotide sequence of the spore-bearing surface inverse material. The second step is a step of preparing a polynucleotide having a spore system recombination base sequence by inserting the base sequence of a spore-bearing surface inverse material. At this time, the nucleotide sequence of the spore-bearing surface inverse substance may be inserted together with the spore inner signal sequence.

In other embodiments, the spore system target base sequence may include a charged material.

In this case, the first step is a step of obtaining a base sequence of a spore-bearing surface inverse substance and a substance having a charge. The second step is to prepare a polynucleotide having a spore system recombination base sequence by inserting the base sequence of the spore-bearing surface inverse material and the base sequence of the charged material. Each substance is preferably inserted into a separate restriction enzyme site so as not to interfere with expression. The nucleotide sequence of the spore-carrying surface inverse substance may be inserted together with the spore inner signal sequence. In addition, the base sequence of the charged material may be inserted together with the signal sequence inside the spore.

-Immunogenic spore support system recombination expression vector

As an embodiment, an immunogenic intraspore support system recombination expression vector for genetically producing an immunogenic intraspore support system is provided.

The immunogenic intraspore support system recombination expression vector encompasses the spore system recombination expression vector. It includes a spore system recombination expression vector made according to the'genetic manufacturing method of an immunogenic intraspore-bearing system'.

In one embodiment, the target base sequence for expression of the spore system may include the base sequence of the spore-carrying surface inverse material.

As a first configuration, the spore system expression regulatory element may be a promoter of an intraspore protein.

The promoter may be a wild-state promoter.

The promoter may be a wild-state promoter modified at some sites. At this time, the modified promoter may have improved initiation efficiency.

The promoter may be a promoter of an intraspore protein used to obtain an intraspore signal sequence.

In another embodiment, the spore system expression regulatory element may be a promoter of another protein.

The promoter may have an overexpression effect of the target base sequence for expression of the spore system.

For example, the promoter may be PCry. The promoter may be PSpac.

As the second configuration, the target base sequence for expressing the spore system may include the base sequence of a spore-bearing surface inverse substance.

The nucleotide sequence of the spore-carrying surface reversible material may include a spore-internal signal sequence. In this case, the signal sequence inside the spore is preferably located at the 5'end.

The overall configuration of the arrangement is preferably a promoter-spore-carrying surface reversal material. FIG. 30 is an illustration of an immunogenic spore-bearing system recombination expression vector comprising a promoter and a nucleotide sequence of a spore-carrying surface inverse material.

In another embodiment, the target base sequence for expressing the spore system may include a base sequence of a spore-supported surface inverse material and a material having a charge.

As a first configuration, the spore system expression regulatory element may be a promoter of an intraspore protein. The promoter of the intraspore protein encompasses the promoter described above.

As a second configuration, the target base sequence for expressing the spore system may include a base sequence of a spore-bearing surface inverse material and a base sequence of a material having a charge.

The nucleotide sequence of the spore-carrying surface reversible material may include a spore-internal signal sequence. It is preferable that the signal sequence inside the spore is located at the 5'end of the nucleotide sequence of the substance inversely supporting the spore.

The base sequence of the charged material may include a signal sequence inside the spore. It is preferable that the signal sequence inside the spore is located at the 5'end of the base sequence of the material having a charge.

In the overall arrangement, it is preferable that a promoter-spore-carrying surface reversal material and a promoter-charged material are located at mutually insulated positions. FIG. 31 is an example of a recombination expression vector of an immunogenic spore-bearing system comprising a base sequence of a first promoter and a spore-carrying surface inverse substance, and a second promoter and a substance having a charge.

Method of manufacturing immunogenic spore fusion display system

An example of the present application is a method of manufacturing an immunogenic spore fusion display system as an immunogenic system for a vaccine.

Methods of manufacturing an immunogenic spore fusion display system are largely exemplified in two ways.

As a method, first, there is a method of preparing a spore fusion display body and a spore fusion body, respectively, and then attaching the spore fusion body to the spore fusion display body.

Alternatively, there is a method of manufacturing an immunogenic spore fusion display system as a whole. This method is a method in which a spore fusion display system is manufactured in all stages without distinction of stages through a genetic manufacturing method without manufacturing individual components.

-Manufacturing method of spore fusion display body

As a specific example, it provides a method of manufacturing a spore fusion display body.

The method of manufacturing the spore fusion display body encompasses the method of manufacturing the spore system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a spore fusion display body having an electric charge outside the spore fusion display body. The electric charge outside the spore fusion display body may be generated by a material having an electric charge outside the spore fusion display body. At this time, a material having an electric charge may be adsorbed on the fusion display body. The adsorption method may be to put the fusion display body in a solution of an electrically charged material and leave it at a constant temperature.

-Manufacturing method of spore fusion body

In one embodiment, it provides a method of preparing a spore fusion body.

The spore fusion body is a fusion of a spore fusion immunogenic substance and a spore surface initiator. The spore surface initiator may include an external spore signal sequence.

The method of preparing the spore fusion body encompasses the method of preparing the immunogenic spore system component.

In one embodiment, a method of preparing a spore fusion body comprises the steps of, for example, preparing a spore surface initiator and a spore fusion immunogenic material by the method of manufacturing the immunogenic spore system component; And it may include the step of coupling the spore surface initiator and the spore fusion immunogenic material. The coupling bonding step may be performed using a method commonly used for cross-linking of proteins.

The method for preparing spore surface initiators may be a genetic method.

The method for preparing the spore fusion immunogenic material may be a genetic method.

The method for preparing a spore fusion immunogenic substance encompasses a method for producing the immunogenic substance.

In another embodiment, the method for preparing spore fusion may be a genetic method.

The genetic manufacturing method encompasses the genetic manufacturing method of the components of the immunogenic spore system. In the genetic production method, the spore target base sequence includes a spore fusion immunogenic substance and a spore surface initiator. In this case, the spore surface initiator may include an external spore signal sequence.

In addition, the spore target base sequence may include a spore fusion immunogenic substance, a spore surface initiator, and a spore fusion part.

-How to connect spore fusion display body of spore fusion body

As a specific example, it provides a method of linking the spore fusion body to the spore fusion display body.

The bonding method may be to leave the spore fusion body in the same solution as the spore fusion display body at constant temperature.

The association may be caused by adsorption, electrostatic attraction, or hydrophobic interactions.

For example, if the spore surface initiator of the spore fusion body includes the spore external signal sequence, the spore fusion body may be associated with the spore fusion display body by the spore external signal sequence.

-Genetic manufacturing method of immunogenic spore fusion display system

In one embodiment, a method for genetically producing an immunogenic spore fusion display system is provided.

The genetic manufacturing method of the immunogenic spore fusion display system encompasses the genetic manufacturing method of the immunogenic spore system. The target base sequence of the spore system includes spore surface initiators and spore fusion immunogenic substances. In addition, the target base sequence for the spore system may include a spore fusion portion. At this time, it is obvious that the spore surface initiator can be substituted with a heterospore surface initiator.

In one embodiment, the spore surface initiator may be an extraspore protein.

In this case, the first step is a step of obtaining the base sequence of the spore foreign protein and the spore fusion immunogenic substance. The obtained spore foreign protein may be, for example, any one or more of CotB, CotC, CotE, CotG, and CotG, and known base sequences may be used.

For example, the sequence of SEQ ID NO: 15 was used for the sequence of CotG.

For example, the sequence of SEQ ID NO: 49 was used as the sequence of CotB.

For example, the sequence of SEQ ID NO: 50 was used as the sequence of CotC.

For example, the obtained spore foreign protein may additionally use a promoter. The promoter may be the same or a different promoter from the spore foreign protein.

The second step is to prepare a polynucleotide having a system recombination base sequence by inserting the base sequence of the spore foreign protein and the base sequence of the spore fusion immunogenic material.

In other embodiments, the spore surface initiator may be a spore exohomologous protein.

In one embodiment, the spore external homologous protein may include a spore external signal sequence.

In this case, the first step is a step of obtaining a portion of the spore-external protein including the spore-external signal sequence, and the base sequence of the spore-fusion immunogenic substance. The nucleotide sequence of a portion of the obtained spore-external protein including the spore-external signal sequence may be 150 to 450 bp in size. At this time, the site of action of the signal sequence restriction enzyme can be removed by a conventional gene recombination method.

The second step is a step of preparing a polynucleotide having a system recombination base sequence by inserting a partial nucleotide sequence including the spore external signal sequence of the spore external protein and the nucleotide sequence of a spore fusion immunogenic substance.

In another embodiment, the spore external homologous protein may include a spore external localization motif.

In this case, the first step is a step of obtaining the nucleotide sequence of the spore fusion immunogenic substance, a portion including the spore external localization motif.

The second step is a step of preparing a polynucleotide having a system recombination base sequence by inserting a part of the base sequence including the spore external localization motif and the base sequence of the spore fusion immunogenic material.

In another embodiment, the spore external homologous protein may have a structure in which the same nucleotide sequence is repeated.

The same nucleotide sequence may be the nucleotide sequence of the extraspore protein.

In this case, the first step is a step of obtaining the base sequence of the spore foreign protein and the spore fusion immunogenic substance.

The second step is to prepare a polynucleotide having a system recombination base sequence by inserting the base sequence of the spore fusion immunogenic substance after repeatedly inserting the base sequence of the spore external protein.

The same nucleotide sequence may be a partial nucleotide sequence including a spore external localization motif.

In this case, the first step is a step of obtaining the nucleotide sequence of the spore fusion immunogenic substance, a portion including the spore external localization motif.

The second step is to prepare a polynucleotide having a system recombination base sequence by inserting the nucleotide sequence of a spore fusion immunogenic substance repeatedly after inserting a part of the nucleotide sequence including the spore external localization motif repeatedly.

In other embodiments, the spore surface initiator may be a spore external homologous addition protein.

In one embodiment, the spore external homology additive protein may have homology with other spore external proteins of the same spore in addition to the specific spore external protein.

The spore external homology additional protein may include a spore external signal sequence of another protein.

In this case, the first step is a step of obtaining a portion of the other protein including the spore external signal sequence, the spore external homology region, and the nucleotide sequence of the spore fusion immunogenic substance.

The second step is to recombine the system by inserting an arbitrary number of nucleotide sequences including the spore external signal sequence of other proteins and the nucleotide sequence of the spore external homology region regardless of the order, and inserting the nucleotide sequence of the spore fusion immunogenic substance. This is a step of preparing a polynucleotide having a base sequence.

The spore external homology additional protein may include a spore external positioning motif of another spore external protein.

In this case, the first step is a step of obtaining a part of the other protein including the spore external localization motif, the spore external homology region, and the nucleotide sequence of the spore fusion immunogenic substance.

In addition, the second step is to insert a part of the nucleotide sequence including the spore external localization motif of the other protein and the nucleotide sequence of the spore external homology site in any order, and insert the nucleotide sequence of the spore fusion immunogenic substance. This is a step of preparing a polynucleotide having a system recombination base sequence.

In another embodiment, the spore external homology additive protein may include a site homologous to the spore external protein and a spore foreign portion.

In one exemplary embodiment, the spore exogenous unit may include a spore extrinsic signal sequence of a heterospore exogenous protein.

In this case, the first step is to obtain a part of the heterospore external protein including the spore external signal sequence, the spore external homology region, and the nucleotide sequence of the spore fusion immunogenic substance.

In addition, in the second step, a part of the nucleotide sequence including the spore external signal sequence of the heterospore external protein and the nucleotide sequence of the spore external homology region are inserted in any order regardless of the order, and the nucleotide sequence of the spore fusion immunogenic substance is inserted. This is a step of preparing a polynucleotide having a system recombination base sequence.

In another exemplary embodiment, the spore exogenous portion may include a spore extrinsic localization motif of a heterospore exogenous protein.

In this case, the first step is a step of obtaining a portion of the heterospore external protein including the spore external localization motif, the spore external homology region, and the nucleotide sequence of the spore fusion immunogenic substance.

In addition, the second step is to insert a part of the nucleotide sequence, including the spore external localization motif of the heterospore external protein, and the nucleotide sequence of the spore external homology region, regardless of the order, and insert the nucleotide sequence of the spore fusion immunogenic substance. This is a step of preparing a polynucleotide having a system recombination base sequence by inserting.

In another exemplary aspect, the spore extraneous portion may carry a charge of a specific sign.

In this case, the first step is a step of obtaining the nucleotide sequence of the spore external homology site and the spore fusion immunogenic substance, and securing the nucleotide sequence of the spore foreign part bearing a charge of a specific code. The nucleotide sequence of the extraspore part bearing a specific sign can be obtained by obtaining a protein in the wild state, but can also be obtained by designing and ordering a protein having a positive charge. For example, CotG of B. subtilis has a particularly high ratio of positively charged amino acids (arginine/histidine/lysine), and sequence information can be easily obtained and can be easily obtained, so it is worth considering as an object to be obtained.

In addition, the second step is to recombine the system by inserting the nucleotide sequence of the extraspore part and the nucleotide sequence of the spore external homology part, which bears a specific code, in any order, and inserting the nucleotide sequence of the spore fusion immunogenic substance. This is a step of preparing a polynucleotide having a base sequence. At this time, it is preferable to set the order of insertion of the nucleotide sequence of the spore foreign part between the spore-external homology site and the spore fusion immunogenic substance so as not to prevent the spore fusion from being attached outside the spore.

-Immunogenic spore fusion display system recombination expression vector

As an embodiment, an immunogenic spore fusion display system recombination expression vector for genetically manufacturing an immunogenic fusion display system is provided.

In this case, the immunogenic fusion display system recombination expression vector encompasses the spore system recombination expression vector.

For convenience, a spore system recombination expression vector created according to the flow of the'genetic manufacturing method of an immunogenic spore fusion display system' is provided.

Although omitted for convenience, the spore fusion portion may be included between the spore surface initiator and the spore fusion immunogenic substance of all the spore fusion display recombination expression vectors mentioned here.

In this case, it is obvious that the spore surface initiator can be substituted with a heterospore surface initiator.

In one embodiment, the target base sequence for expression of the spore system may include a base sequence of a spore foreign protein and a spore fusion immunogenic substance.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

In this case, the promoter may be a promoter in a wild state.

In addition, the promoter may be a wild-state promoter modified at some sites. At this time, the modified promoter may have improved initiation efficiency.

Alternatively, the spore system expression regulatory element may be a promoter of another protein.

For example, the promoter may be PCotG even when the spore foreign protein is not CotG.

For example, the promoter may be PCotB even when the spore foreign protein is not CotB.

For example, the promoter may be PCotC even when the spore foreign protein is not CotC.

As a second configuration, the base sequence for the purpose of expressing the spore system may include the base sequence of a spore foreign protein and a spore fusion immunogenic substance.

The overall configuration is preferably a promoter-spore foreign protein-spore fusion immunogenic material.

In another embodiment, the target base sequence for expression of the spore system may include a base sequence of a spore external homologous protein and a spore fusion immunogenic material.

In one embodiment, the spore external homologous protein may be a part of the protein sequence of the spore external protein including the spore external signal sequence.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect. Hereinafter, "the embodiment promoter" means that all encompass the same promoter.

The overall configuration is preferably a part of the nucleotide sequence including the promoter-spore external signal sequence of the spore-external protein-spore fusion immunogenic material.

In another embodiment, the spore external homologous protein may be a part including the spore external localization motif.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expressing the spore system may include a partial base sequence including a spore external localization motif and a base sequence of a spore fusion immunogenic substance.

It is preferable that the overall configuration of the sequence is a part of the nucleotide sequence including the promoter-spore external localization motif-spore fusion immunogenic material.

FIG. 32 is an illustration of a spore fusion display recombination expression vector including a promoter, a spore surface initiator, and a nucleotide sequence of a spore fusion immunogenic substance.

In another embodiment, the spore external homologous protein may have a structure in which the same nucleotide sequence is repeated.

In an exemplary embodiment, the same nucleotide sequence may be the nucleotide sequence of a spore foreign protein.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expression of the spore system may include a base sequence of a plurality of spore foreign proteins and a base sequence of a spore fusion immunogenic substance.

It is preferable that the overall configuration is a promoter-(base sequence of spore foreign protein) n-spore fusion immunogenic material.

In another exemplary embodiment, the same nucleotide sequence may be a partial nucleotide sequence including a spore external localization motif.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expression of the spore system may include a partial nucleotide sequence including a plurality of spore external localization motifs and a nucleotide sequence of a spore fusion immunogenic substance.

The overall configuration is preferably a promoter-(part of the nucleotide sequence including the spore-external localization motif)n-spore fusion immunogenic material.

FIG. 33 is an example of a spore fusion display recombination expression vector including a promoter, a nucleotide sequence of the same spore external homology region three times, and a nucleotide sequence of a spore fusion immunogenic substance.

In another embodiment, the target base sequence for expression of the spore system may include a base sequence of a spore external homologous additive protein and a spore fusion immunogenic material.

In one embodiment, the spore external homology additive protein may have homology with other spore external proteins of the same spore in addition to the specific spore external protein.

In one exemplary embodiment, the spore-extrinsic homologous adjunct protein may include a spore-external signal sequence of another protein.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expression of the spore system may include a portion including the spore-external signal sequence of other proteins, the spore-external homology site, and the base sequence of a spore fusion immunogenic substance.

The overall configuration of the arrangement is preferably a promoter-(part including spore external signal sequence of other proteins, spore external homology region) m,n-spore fusion immunogenic material. m and n refer to the number of parts including the spore-external signal sequence and the number of spore-external homology sites of other proteins.

34 is an example of a spore fusion display recombination expression vector including a promoter, a spore external signal sequence of another protein, a spore external homology addition protein including a spore external homology site, and a nucleotide sequence of a spore fusion immunogenic substance.

In another exemplary embodiment, the spore external homologous additive protein may include a spore external localization motif of another spore external protein.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expression of the spore system may include a portion including the spore-external localization motif of other proteins, the spore-external homology site, and the base sequence of a spore fusion immunogenic substance.

The overall configuration of the arrangement is preferably a promoter-(part including the spore-external localization motif of other proteins, spore-external homology site)m,n-spore fusion immunogenic material. m and n refer to the number of parts including the spore-external signal sequence and the number of spore-external homology sites of other proteins.

35 is an example of a spore fusion display recombination expression vector including a promoter, a spore external localization motif of another protein, a spore external homology addition protein including a spore external homology site, and a nucleotide sequence of a spore fusion immunogenic substance. .

In another embodiment, the spore-external homologous additive protein may include a site homologous to the spore-external protein and a spore foreign portion.

In one exemplary embodiment, the spore exogenous unit may include a spore extrinsic signal sequence of a heterospore exogenous protein.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expression of the spore system may include a part including the spore external signal sequence of the heterospore external protein, the spore external homology site, and the base sequence of the spore fusion immunogenic substance.

The overall configuration of the arrangement is preferably a promoter-(a part including a spore external signal sequence of a heterogeneous spore protein, a spore external homology region) m,n-spore fusion immunogenic material.

In another exemplary embodiment, the spore exogenous portion may include a spore extrinsic localization motif of a heterospore exogenous protein.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for expression of the spore system may include a part including the spore external localization motif of the heterospore external protein, the external spore homology site, and the base sequence of the spore fusion immunogenic substance.

The overall configuration of the arrangement is preferably a promoter-(part including the spore-external localization motif of the heterologous spore protein, the spore-external homology site) m,n-spore fusion immunogenic material.

FIG. 36 is a spore including a promoter, a spore external homology addition protein including a spore external localization motif of another protein, a spore external homology site, a heterospore external spore localization motif, and a nucleotide sequence of a spore fusion immunogenic substance. This is an example of a fusion display recombination expression vector.

In another exemplary aspect, the spore extraneous portion may carry a charge of a specific sign.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

At this time, the promoter of the spore foreign protein encompasses the promoter of the above aspect.

As a second configuration, the target base sequence for the expression of the spore system may include a spore foreign part carrying a charge of a specific sign, a spore external homology site, and a nucleotide sequence of a spore fusion immunogenic substance.

It is preferable that the overall configuration is a promoter-(spore external homology site)m-(spore foreign part carrying a specific code)-spore fusion immunogenic material.

Figure 37 is a spore external homology addition protein including a promoter, a spore external homology site, a sequence of a heterogeneous spore surface initiator, a sequence of a spore surface initiator, a foreign portion bearing a charge of a specific code, and a spore fusion immunogenic substance. It is an example of a spore fusion display recombination expression vector containing the nucleotide sequence of.

Method of manufacturing immunogenic spore coupling display system

An example of the present application is a method of manufacturing an immunogenic spore coupling display system as an immunogenic system for a vaccine.

A method of manufacturing an immunogenic spore coupling display system includes, for example, preparing a spore coupling display body including a coupling group and a spore coupling immunogenic substance, respectively; And causing a spore-coupling bond between the spore-coupling display body and the spore-coupling immunogenic material.

-Manufacturing method of spore coupling display body

As an embodiment, a method of manufacturing a spore coupling display body including a spore display body coupling group is provided. The manufacturing method of the coupling display body encompasses the manufacturing method of the coupling display body.

-Method of manufacturing spore coupling immunogenic material

In one embodiment, it provides a method of preparing a spore coupling immunogenic material comprising a spore immunogenic material coupling group.

The method of preparing the spore coupling immunogenic material encompasses the method of preparing the coupling immunogenic material.

The immunogenic material may be prepared by the method for preparing the immunogenic material. The immunogenic material may include an external spore signal sequence. If the spore-coupling immunogenic material includes the spore-external signal sequence, the spore-coupling immunogenic material is induced to the outside of the spore by the spore-external signal sequence, thereby facilitating coupling coupling.

-Coupling bonding step

As an embodiment, there is provided a step of causing a spore-coupling bond between a spore-coupling display body and a spore-coupling immunogenic substance. The spore coupling bonding may occur under conventional coupling reaction conditions.

Method for manufacturing immunogenic spore attachment display system

An example of the present application is a method of manufacturing an immunogenic spore attachment display system as an immunogenic system for a vaccine.

Methods of manufacturing an immunogenic spore attachment display system are largely exemplified in two ways.

As a method, first, there is a method of preparing a spore-attached display body and an adherent immunogenic material, respectively, and attaching the adherent immunogenic material to the spore-attached display body. This includes making each component separately and then assembling it into a system.

Alternatively, there is a method of manufacturing an immunogenic spore attachment display system as a whole. This method is a method in which the spore-attached display system is manufactured in all stages without distinction of stages through a genetic manufacturing method without manufacturing individual components.

- The method of mounting the display element spores

In one embodiment, a method of manufacturing a spore-attached display body is provided.

The method of manufacturing the spore-attached display body encompasses the manufacturing method of the spore system structure.

The method of manufacturing the spore-attached display body encompasses the method of manufacturing the spore-carrying member. The spore-attached display body shares the same characteristics as the spore-carrying body in that it can carry an electric charge. The reason for sharing this characteristic is that the purpose of linking the immunogenic material to the system by electrostatic attraction is the same.

-Manufacturing method of spore-attached immunogenic material

In one embodiment, it provides a method of preparing a spore-adhering immunogenic material.

The spore-attached immunogenic material may include a spore-external signal sequence.

The method of preparing the spore-attached immunogenic substance encompasses the method of preparing the immunogenic substance.

The method of preparing the spore-adhering immunogenic material may be a method of genetically producing the immunogenic material. In the genetic preparation method, the target immunogenic base sequence may include an external spore signal sequence.

The manufacturing method may be a method of manufacturing a spore-attached immunogenic material having an electric charge. The charge of the spore-adhering immunogenic substance may be due to a substance carrying an electric charge. The charged material may be adsorbed onto the spore-attached immunogenic material. The adsorption method may be to mix a spore-adhering immunogenic material with a charged material and leave it at a constant temperature.

-How to attach spore-attached immunogenic substances

In one embodiment, a method of attaching a spore-attached immunogenic material to a spore-attached display body is provided.

The attachment method may be to mix a spore-attached immunogenic material with a spore-attached display body and leave at a constant temperature.

In addition, if the spore-adhering immunogenic material includes the spore inner signal sequence, the spore-bearing surface inverse material may be carried on the spore carrier by the spore inner signal sequence.

-Genetic manufacturing method of immunogenic spore attachment display system

In one embodiment, a method for genetically producing an immunogenic spore attachment display system is provided.

The genetic manufacturing method of the immunogenic spore attachment display system encompasses the genetic manufacturing method of the immunogenic spore system. The target base sequence for the spore system contains spore-attached immunogenic substances.

In one embodiment, the spore system target base sequence may include only spore-attached immunogenic substances.

At this time, the first step is a step of obtaining a spore-adhering immunogenic material.

The second step is a step of preparing a polynucleotide having a spore system recombination base sequence by inserting the base sequence of a spore-attached immunogenic material. The base sequence of the spore-attached immunogenic material may be inserted together with the spore-external signal sequence.

In other embodiments, the spore system target base sequence may include a charged material.

In this case, the first step is a step of obtaining a base sequence of a spore-attached immunogenic substance and a substance having a charge.

The second step is to prepare a polynucleotide having a spore system recombination base sequence by inserting the base sequence of the spore-attached immunogenic material and the base sequence of the charged material. At this time, each material is preferably inserted into a separate restriction enzyme site so as not to interfere with expression. The base sequence of the spore-attached immunogenic material may be inserted together with the spore-external signal sequence. In addition, the base sequence of the charged material may be inserted together with the signal sequence inside the spore.

-Immunogenic spore attachment display system recombination expression vector

As an embodiment, an immunogenic spore attachment display system for genetically manufacturing an immunogenic spore attachment display system is provided.

The immunogenic spore attachment display system recombination expression vector encompasses the spore system recombination expression vector. It includes a spore system recombination expression vector made according to the'genetic manufacturing method of an immunogenic spore attachment display system'.

In one embodiment, the target base sequence for expression of the spore system may include the base sequence of the spore-attached immunogenic material.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein.

In one embodiment, the promoter may be a wild-state promoter.

The promoter may be a wild-state promoter modified or manipulated at some sites. At this time, the modified promoter may have improved initiation efficiency. In addition, the promoter may be a promoter of a spore foreign protein used to obtain a spore-external signal sequence.

In another embodiment, the spore system expression regulatory element may be a promoter of another protein.

The promoter may have an overexpression effect of the target base sequence for expression of the spore system. For example, the promoter may be PCry. In addition, the promoter may be PSpac.

As the second configuration, the target base sequence for expression of the spore system may include the base sequence of a spore-attached immunogenic substance.

The base sequence of the spore-attached immunogenic substance may include a spore-external signal sequence. At this time, it is preferable that the signal sequence outside the spore is located at the 5'end.

The overall configuration is preferably a promoter-spore-attached immunogenic material. 38 is an illustration of a spore-attached display system recombination expression vector comprising a promoter and a nucleotide sequence of a spore-attached immunogenic substance.

In another embodiment, the target base sequence for expression of the spore system may include a base sequence of a spore-adhering immunogenic material and a charged material.

As a first configuration, the spore system expression regulatory element may be a promoter of a spore foreign protein. The promoter of the spore foreign protein encompasses the promoter of the above aspect.

As the second configuration, the target base sequence for expressing the spore system may include a base sequence of a spore-attached immunogenic material and a base sequence of a material having a charge.

The base sequence of the spore-attached immunogenic substance may include a spore-external signal sequence. In this case, the external signal sequence of spores is preferably located at the 5'end of the nucleotide sequence of the spore-attached immunogenic material.

The base sequence of the charged material may include a signal sequence inside the spore. It is preferable that the signal sequence inside the spore is located at the 5'end of the base sequence of the material having a charge.

In the overall arrangement, it is preferable that a promoter-spore-attached immunogenic substance and a promoter-charged substance are located at mutually insulated positions. 39 is an example of a spore-attached display system recombination expression vector including the base sequences of (a first promoter and a spore-adhering immunogenic material) and (a material having a charge with a second promoter).

[Vaccine composition]

An example of the present application is a vaccine composition including the immunogenic system described above and various uses thereof.

Vaccines consist essentially of immunogenic components.

The immunogenic component may be the immunogenic substance or an immunogenic system.

Depending on the composition of the immunogenic component, the form of the vaccine may vary. To categorize the types of vaccines, they can be divided into conventional vaccines, multivalent vaccines, master vaccines, and complex disease master vaccines. However, this classification is not essential and the present application is not limited thereto.

In general, a dose of 2 to 5 ml per dose of the vaccine is adequate. In the current vaccine market, most vaccines use the pathogen itself as an immunogenic substance.

Subcutaneous injection, intravenous injection, intradermal injection, parenteral injection, intramuscular injection, needle free injection, electroporation, oral delivery, intranasal delivery, oronasal delivery, or any combination thereof It can be administered by. The composition to be administered may further comprise a therapeutically acceptable carrier. Such therapeutically acceptable carriers can be selected from the group consisting of proteins, buffers, surfactants, and polyethylene glycol polymers, or any combination thereof.

At this time, it is obvious to those skilled in the art that an adjuvant component that helps the function of the vaccine can be included in the composition.

Conventional vaccine

"Typical vaccine" refers to an embodiment for the purpose of forming an acquired immunity against a single vaccine line of a single pathogen as an embodiment of a vaccine.

One specific example of the present application is the conventional vaccine.

Conventional vaccine is a form of vaccine that is mainly used in the past. It is an aspect of a vaccine that is made by determining the target disease and the most prevalent vaccine strains of the target disease pathogen. Conventional vaccines have the advantage of being inexpensive because they only need to include a single immunogenic substance or an immunogenic system, and have an excellent effect of forming an acquired immunity due to the high concentration of the immunogenic substance. However, only outdoor strains with high homology to a single vaccine strain can be prevented, so the range of immunity is narrow. The conventional vaccine is suitable as a form of a vaccine against diseases in which outdoor strains do not occur much.

The conventional vaccine may contain a single immunogenic substance.

The conventional vaccine may include a single immunogenic system.

Polyvalent vaccine

"Multivalent vaccine" refers to an embodiment for the purpose of forming an acquired immunity against a single vaccine line of a plurality of pathogens as an embodiment of a vaccine.

One specific example of the present application is the multivalent vaccine.

The multivalent vaccine is an aspect of a vaccine that can be selected to form simultaneous immunity against multiple diseases in vivo. In this case, the pathogens targeted for the multivalent vaccine may be pathogens that cause complex diseases in vivo, and in this case, the multivalent vaccine has the advantage of preventing complex diseases. In addition, pathogens targeted for multivalent vaccines can cause major diseases that cause the most major damage to the living body, and in this case, multivalent vaccines have the advantage of being able to form immunity against the most dangerous diseases. However, if one of the immunogenic substances of the multivalent vaccine is highly pathogenic or toxic, there may be a disadvantage of increasing the risk of the vaccine, but the immunogenic system of the present application is significantly low in pathogenicity or toxicity, so it has an advantage in creating a multivalent vaccine. have.

Multiple pathogens that are the target of the multivalent vaccine may be pathogens that cause multiple diseases.

The plurality of pathogens may be pathogens of major diseases occurring in a living body.

In this case, the living body may be a pig.

At this time, the pathogen of the major disease may be, for example, porcine epidemic diarrhea virus (PEDV), porcine reproductive, respiratory syndrome virus (PRRSV), porcine circovirus (PCV).

The multivalent vaccine may be a mixture of immunogenic substances targeting multiple pathogens. In addition, a multivalent vaccine may be a mixture of immunogenic systems targeting multiple pathogens.

A multivalent vaccine may be a mixture of an immunogenic substance and an immunogenic system targeting multiple pathogens.

The multivalent vaccine is an immunogenic serial connection system, and the serial connection may include immunogenic substances targeting a plurality of pathogens.

The multivalent vaccine is an immunogenic parallel system, and the parallel body may be immunogenic substances targeting a plurality of pathogens.

Master vaccine

"Master vaccine" refers to an embodiment for the purpose of forming an acquired immunity against a plurality of vaccine lines of a single pathogen as an embodiment of a vaccine.

One specific example of the present application is a master vaccine.

The master vaccine is an aspect of the vaccine that can be selected when building strong and broad immunity against a single disease. The master vaccine has the advantage of easy cross-protection against mutant or outdoor strains because it can form acquired immunity against several vaccine strains with different homology. The master vaccine is suitable as a form of a vaccine against diseases in which mutant strains or outdoor strains occur frequently.

Since the amount of immunogenic substances that can be contained within a single dose of a vaccine is limited, the types of vaccine strains subject to the master vaccine are also limited. In order to make the most desirable master vaccine, it is desirable to form the widest cross-protection range. However, with current vaccine technology, there is no good way to select the most suitable vaccine strain.

In the present application, a phylogenetic tree by multiple alignment may be used to select vaccine strains that are the target of the master vaccine. The multi-alignment process is a process of examining homology between strains based on one strain, and a phylogenetic tree can be produced according to the degree of homology obtained as a result. Mixing vaccine strains with various homology has the advantage of expanding the range of cross-protection.

As a specific example of the present application, the method of selecting vaccine strains subject to the master vaccine is the first step of producing a phylogenetic tree by multiple sorting, the second step of dividing the homology criterion group from the phylogenetic tree, and belonging to the homology criterion classification. It may include a third step of selecting each vaccine strain. 40 is a system diagram showing an exemplary method for selecting a vaccine strain to aid understanding.

The first step is to create a tree. Phylogenetic trees can be created by multiple sorting. The lines shown on the left of FIG. 40 are phylogenetic trees created by multiple alignment, and the lines shown in the middle represent classified strains.

The second step is to divide the homology-based classification group. The "homology based clust" is defined as a group that classifies strains in a phylogenetic tree according to homology. At this time, a homology range in which cross-protection is possible is determined and the homology standard classification group is divided. In general, no matter how much mutation occurs, the homology between strains is 85% or more.

The homology criterion classification group may be classified according to a specific homology interval. For example, the homology-based classification group can be divided into a first group with 100-95% homology, a second group with 95-90% homology, a third group with 90-85%, and a fourth group with less than that.

The right side of FIG. 40 shows that the strains are divided into the homology standard classification groups of Clust 1 to Clust 4. Based on any one strain, Clust 1 has 99-100% homology, Clust 2 has 95-99% homology, Clust 3 has 86.5-95% homology, and Clust 4 has 50-86.5% homology. Have been classified to have.

The third step is a step of selecting one or more strains from each homology-based classification group. After that, the immunogenic substances or immunogenic systems of the selected vaccine strains are mixed and prepared as a master vaccine.

The master vaccine may be a mixture of immunogenic substances targeting one or more strains according to each homology standard classification group. For example, in the case of FIG. 40, a master vaccine may be prepared by mixing at least one strain selected from Clust 1 to Clust 4.

In addition, the master vaccine may be a mixture of an immunogenic system targeting one or more strains according to each homology-based classification group. In this case, the immunogenic system may be, for example, an immunogenic spore system.

In addition, the master vaccine may be a mixture of immunogenic substances and immunogenic systems targeting one or more strains according to each homology standard classification group.

In addition, the step of selecting a vaccine line encompasses the criteria for selecting a strain to be subjected to multiple alignment from the "antigen homologous protein containing one immunogenic site".

Complex Disease Master Vaccine

"Complex disease master vaccine" refers to an embodiment for the purpose of forming an acquired immunity against a plurality of vaccine lines of a plurality of pathogens as an embodiment of a vaccine.

The combined disease master vaccine is an aspect of a vaccine that functions as a master vaccine against multiple diseases. In the case of manufacturing a complex disease master vaccine using existing vaccine technology, there is a problem that the amount of one dose is too large, or the inoculation method is too complex and takes a long time. This is because the existing vaccine technology had a limited concentration of immunogenic substances, so as the types of immunogenic substances increased, the amount of inoculation had to be increased.

However, this problem can be solved according to the immunogenic spore system, which is an embodiment of the present application.

When the immunogenic substance is used as a viral pathogen, the concentration of virus in a conventional dead poison or attenuated vaccine is limited. Viruses are more difficult to culture than bacteria that form multi-layer colonies because they form a single layer of plaque when cultured. The maximum concentration of virus that can be achieved by subculture is known to be ^{about 10 7 cells/ml.} If the concentrated virus solution was more is generally increases the pathogenicity of the virus is increased that the virus concentration of the toxic substance for inactivation viewing about 10 ⁷ / ml as a maximum concentration.

However, when using the immunogenic spore system, which is a specific example of the present application, about 10 to ^{10 without the above-mentioned risk} It has the advantage of being able to concentrate up to 10 to ^{12 pcs/ml.} Since it ^{can have a concentration concentration of 10 3} to 10 ⁵ times at the same dose, it is possible to maintain a dose of about 2 to 3 ml, preferably 2 ml, even for a plurality of pathogens or a plurality of vaccine lines. Therefore, the immunogenic spore system of the present application may have a remarkable effect of enabling a commercialized complex disease master vaccine that was not possible in the past.

As a preferred example, the complex disease master vaccine may be a mixture of an immunogenic spore system targeting each disease and each vaccine line.

In this case, the multiple pathogens that are the target of the multiple disease master vaccine may be pathogens that cause multiple diseases.

In addition, a plurality of pathogens that are the target of the complex disease master vaccine may be pathogens of major diseases occurring in vivo.

In addition, multiple vaccine strains that are the target of the combined disease master vaccine encompass the criteria for selecting a vaccine strain in "Master Vaccine".

[Example]

Hereinafter, the present application will be described in more detail through examples.

The following examples of the present application relate to the preparation of antigens, antibodies and vaccines against PEDV.

Another example below of the present application relates to the preparation of antigens, antibodies and vaccines against PCV.

These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present application is not construed as being limited by these examples.

[PEDV vaccine production]

Example 1: Preparation of a common region primer

The following materials were used for the experiment:

Temporary specimen (animal tissue): revival farm

0.2 micron syringe filter: Millpore

nPFU-forte (enzynomics company)

nTaq polymerase (enzynomics company)

Restriction enzymes SacI, PstI, and BamHI (enzynomics company)

pGEM T easy vector system: (Promega company)

PCR machine: (BioRad company)

Tissues from pigs exhibiting diarrhea were obtained at the Korean Reconstruction Farm. Homogenates were generated from this tissue, and the filtrate was obtained through 0.2 micron syringe filter filtration.

Base sequences encoding PEDV spike proteins (SEQ ID NO: 19 to SEQ ID NO: 36) obtained through GenBank of about 18 NCBIs were compared by multiple alignment, and the following common regions where mutations do not occur through analysis It was obtained (Strain, GenBank accession no. SEQ ID NO: 19: 83P-5 p34th, AB548619, SEQ ID NO: 20: 83P-5 p61st, AB548620, SEQ ID NO: 21: 83P-5 p100th, AB548621, SEQ ID NO: 22: 83P-5 parent , AB548618, SEQ ID NO: 23: Br1/87, Z25483, SEQ ID NO: 24: Chinju99, AY167585, SEQ ID NO: 25: DR13 attenuated, DQ462404, SEQ ID NO: 26: DR13 parent, DQ862099, SEQ ID NO: 27: JS-2004-2, AY653204 , SEQ ID NO: 28: KNU-0801, GU180142, SEQ ID NO: 29: KNU-0802, GU180143, SEQ ID NO: 30: KNU-0901, GU180144, SEQ ID NO: 31: KNU-0902, GU180145, SEQ ID NO: 32: KNU-0903, GU180146 , SEQ ID NO: 33: KNU-0904, GU180147, SEQ ID NO: 34: KNU-0905, GU180148, SEQ ID NO: 35: LJB_03, DQ985739, SEQ ID NO: 36: Spk1, AF500215).

Spike 1 over forward: CCATTCAGCGTATTCTTTATTGTGATGA (SEQ ID NO: 1)

Spike 1 over reverse: CCTATGTTACTATACACCAACACAGGCTCTG (SEQ ID NO: 2)

Spike 2 over forward: CTGTTAATGATTACCTGTCTTTAGCAAATTTTGTG (SEQ ID NO: 3)

Spike 2 over reverse: CAATCAACACTAACAGGCGTGTTGTAAAGC (SEQ ID NO: 4)

Of these, the CDNA of PEDV was made using Accuscript Hi-Fi Reverse transcriptase (Ailgent) using the nearest primer SEQ ID NO: 4 to the 3'end.

Using the prepared cDNA, the immunodetermining site was cloned under the following PCR conditions using primers SEQ ID NOs: 1 and 2 and primers SEQ ID NOs: 3 and 4.

Step 1: 90℃ 10min,

Step 2: 90℃ 30sec,

Step 3: 62℃ 30sec,

Step 4: 72℃ 2min,

Step 5: go to Step 2 (x39),

Step 6: 72℃ 10min,

Step 7: 12℃ hold.

In order to insert the cloned immunodeterminant site into the gene recombination vector, the following primers were used to attach a PstI restriction enzyme site at the 5'end and a BamHI restriction enzyme site at the 3'end, followed by ligation after cleavage. (ligation).

Spike 1 forward PstI: CTGCAGATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 5)

Spike 1 reverse BamHI: GCGCGGATCCTTATATGTTACTATACACC (SEQ ID NO: 6)

Spike 2 forward PstI: GGCTGCAGGTTAATGATTACCTGTCTTT (SEQ ID NO: 7)

Spike 2 reverse BamHI: GGATCCTTAATCAACACTAACAGGCGT (SEQ ID NO: 8)

PCR conditions for this were the same as those described above.

Example 2: Vector production

Bacillus subtilis 168 strain (KCTC 1327) was used. To create a vector for expressing the immunodetermining site on the spore surface of B. subtilis, cut the pHT-01 vector (BioSharp, Inc.) with SacI and BamHI, and cut this part at the 5'end of the SacI restriction enzyme site, and at the 3'end. PCotG-CotG-linker-MCS, PCotB-CotB-linker-MCS and PCotC-CotC-linker-MCS to which the BamHI restriction enzyme site was attached were respectively substituted.

In the genomic DNA of B. subtilis of PCotG-CotG, PCotB-CotB and PCotC-CotC, each of the following primers (SEQ ID NOs: 9, 10, 37, 38, 39, 40) was added to the 5'end with a SacI restriction enzyme site. After attaching, a linker was attached as a BamHI restriction enzyme site and a fusion site at the 3'end. In this case, the linker sequence was used in common with SEQ ID NO: 16.

Linker sequence GGAGGTGGGGGTTCACTCCAG (SEQ ID NO: 16) CotG forward GAGCTCAGTGTCCCTAGCTCCGAG (SEQ ID NO: 9) Liker reverse CTGCAGTGAACCCCCACCTCCTTTGTATTTCTTTTTGACTA
(SEQ ID NO: 10) CotB forward ATAGAGCTCCTTCCAATCTCTT (SEQ ID NO: 37) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAAAATTTACGTTTC (SEQ ID NO: 38) CotC forward ATAGAGCTCTGTAGGATAAATCGT (SEQ ID NO: 39) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAGTAGTGTT (SEQ ID NO: 40)

A PstI restriction enzyme site was attached to the 3'end of the linker and replaced with an immunodetermining site in the future.

In order to transfer the cloned immunodeterminant site to the gene recombination vector, a PstI restriction enzyme site was attached to the 5'end and a BamHI restriction enzyme site was attached to the 3'end using the primers of SEQ ID NOs: 5, 6, 7, and 8. PCR conditions for this were the same as those described above.

Example 3: Bacillus transformation

Bacillus transformation was carried out in a conventional manner using electroporation (EP) (BIO-RAD Gene Pulser II) among the above-mentioned methods.

Specifically, B. subtilis DB104 strain grown with a growth medium (LB medium plus 0.5M sorbitol (Sigma-Aldrich Inc)) was used as an electroporation medium (LB medium plus 0.5M sorbitol, 0.5M mannitol (Sigma-Aldrich Inc), 10% glycerol). (Sigma-Aldrich)). At this time, the dilution concentration was diluted so that the constant time was 5 msec when 60 μl was dispensed into E.Coli Pulser Cuvett (BIO-RAD) 0.1cm electrode and given with Gene Pulser II (BIO-RAD) 200Ω2.1kV, 0.25μF. The diluted competent cells were stored at -80℃.

Transformation was performed under the above conditions by putting 10 ng of DNA plasmid in the prepared competent cell.

Immediately after electric shock, 1 ml of outgrowth medium (LB medium plus 0.5M sorbitol and 0.38M mannitol) was added and incubated in a 37°C shaker incubator for 3 hours. Subsequently, transformed Bacillus colonies were obtained in chloramphenicol (Sigma-Aldrich Inc) LB plate.

Example 4: Production of Bacillus Spore Display System

To confirm the self-produced genetic recombination vector, a GFP nucleotide sequence with a PstI restriction enzyme site attached to the 5'end and a BamHI restriction enzyme site attached to the 3'end was transferred to the genetic recombination vector with a primer set of SEQ ID NOs: 11 and 12. .

eGFP forward PstI: CTGCAGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 11)

eGFP reverse BamHI: CCATGGGGATCCTTACTTGTACAGCTCGTCCATGCCG (SEQ ID NO: 12)

Transformed Bacillus was obtained by the transformation method presented above using the created genetic recombination vector.

Transformed Bacillus exhibits a GFP signal during sporulation. To confirm this, the transformed Bacillus was grown in Schaeffer's sporulation medium and the GFP signal was confirmed by fluorescence microscope and flow cytometry at 24 hours, 48 hours, and 72 hours. In addition, spore expression was confirmed by Malachite green staining.

In the case of using CotG, fluorescence microscope, flow cytometry, and Malachite green staining are shown in Figs. 41, 42, and 43, respectively.

In the case of using CotB, fluorescence microscope, flow cytometry, and Malachite green staining are shown in Figs. 47, 48, and 49, respectively.

In the case of using CotC, fluorescence microscope, flow cytometry, and Malachite green staining are shown in Figs. 52, 53, and 54, respectively.

In addition, when an experiment was performed to remove the surface protein by treating Pronase (Sigma-Aldrich, Inc.) to confirm the expression of the spore surface of the antigen, it was found that the GFP protein was expressed on the spore surface through a decrease in the GFP signal. Confirmed.

In the case of using CotG, the results of the Pronase treatment experiment to confirm that GFP was expressed on the spore surface are shown in FIG. 44.

Through this, it was found that the antigen linked to CotG through the linker was presented on the spore surface.

Example 5: Vaccine preparation method

Transformed B. subtilis was incubated in 2 ml of LB medium for 3 hours, and then 500 ul per 1 L of Schaeffer's sporulation medium was added to induce sporulation for 48 hours.

If more than 90% of spores are formed through the malachite green staining mentioned above, the spore inactivation step is performed. If sporulation is insufficient, the spore inactivation step is performed after 6 to 12 hours of additional culture.

Spore inactivation was carried out through a sterilization process at 120° C. for 15 min. For spore inactivation, a part of the obtained sample was placed in an LB plate or LB medium, and cultured overnight at 37°C shaker incubator and 37°C, and determined by colony or proliferation.

Spores that were not inactivated as a control were cultured together. Also, at this time, serial dilution was performed to check the number of spores. When spore inactivation was confirmed, washing and centrifugation were performed 5 times with sterilized cold destilled water (DW) to prevent any suspended matter. After the washing process, the spores are ^{dispensed with PBS at a concentration of 10 8} mice/200 ul and 10 ¹² pigs/ml and stored in a refrigerator at -80°C until use.

Example 6: Master vaccine

Currently, PEDV spread to Korea is largely divided into three types: indigenous domestic type, Chinese-originated type, and European type. It is known that the cross-protection between these three types of PEDV vaccines is not good. It is known that the reason is that the immunodetermining site is different for each type of PEDV virus due to mutations in the immunodetermining site. Therefore, by cloning the immunodetermining sites of the three types of PEDV viruses into the gene recombination vectors presented above, a vaccine could be produced that generates defense against PEDV spread in Korea.

Example 7: Confirmation of immune response

Confirmation of the immune response of the produced genetically modified bexin was confirmed as follows. In the c57BL/6 strain of mice, 10 ⁸ doses/200 ul of the recombinant vaccine was injected intraperitoneally at intervals of 2 weeks, and changes in body weight and blood IgG concentration were measured before each injection or 40 days after the first injection.

The results of the test for confirming the immune response using CotG, CotB, and CotC are shown in FIGS. 45, 50, and 55, respectively.

Mice inoculated with the genetic recombination vaccine should increase the concentration of IgG in the blood without any change in body weight compared to non-vaccinated mice. In addition, in order to confirm the generation of antigen-specific antibodies, Spike2 antigen was cloned with the following primer sets of SEQ ID NOs: 13 and 14, put into pET28a vector, and purified using AKTA pure L1, 40 days after inoculation of the recombinant vaccine. The immunoblotting assay was performed using the blood obtained from the mouse.

forward: GCTAGCATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 13)

reverse: GGATCCTTATATGTTACTATACACCAACACAGG (SEQ ID NO: 14)

To purify and verify the antigen, His-tagging was performed on the N-terminus of the antigen. The identification of the antigen-specific antibody can be confirmed that the band is detected at the same position as the anti-His antibody when performing an immunoblotting assay.

The results of the test for confirming the immune response using CotG, CotB, and CotC are shown in Figs. 46, 51, and 56, respectively.

Materials

pET28a vector: Addgene

AKTA pure L1: GE Healthcare

Anti-His antibody: Santa-Cruz

Example 8: Neutralizing antibody

The method of verifying the effect of the recombinant vaccine was carried out by confirming the change in the concentration of IgG in the blood obtained by the method for confirming the immune response presented above. The concentration of IgG in the blood was measured using a conventional ELISA method. In this case, an ELISA kit (Goma Biotech) was used.

It can be seen that the blood of mice vaccinated with the genetic recombination vaccine produced higher levels of IgG than the blood of mice that were not vaccinated.

In order to confirm whether the pigs inoculated with the recombinant vaccine of the present application are protected from PEDV, a total of 8 pigs (4-5 weeks of age in D-1) were randomly assigned to two groups and each placebo or recombinant vaccine was administered to D0. , 14, and 28 were inoculated intramuscularly.

Clinical signs were monitored daily until D40. The injection site and weight change were measured. ELISA was performed using serum samples collected before each injection to measure changes in IgG values.

[PCV vaccine production]

The following relates to the preparation of antigens, antibodies and vaccines against PCV as another example.

Example 9: Preparation of a common region primer

The following materials were used for the experiment:

Temporary specimen (animal tissue): revival farm

0.2 micron syringe filter: Millpore

nPFU-forte (enzynomics company)

nTaq polymerase (enzynomics company)

Restriction enzymes SacI, PstI, and BamHI (enzynomics company)

pGEM T easy vector system: (Promega company)

PCR machine: (BioRad company)

Tissues from pigs exhibiting diarrhea were obtained at the Korean Reconstruction Farm. Homogenates were generated from this tissue, and the filtrate was obtained through 0.2 micron syringe filter filtration.

Three PCV subtypes (PCV-2A, PCV-2B, PCV-m2B) obtained through NCBI's GenBank were compared by multiple alignment. Three types of capsid primers of SEQ ID NOs: 41 to 46, which can obtain useful antigens, were obtained through the above three types of analysis.

PCV-2A
Capsid forward CTGCAGACGTATCCAAGGAG (SEQ ID NO: 41) reverse CCATGGGGATCCTTAGGGTTTAAGT (SEQ ID NO: 42) PCV-2B
Capsid forward CTGCAGACGTATCCAAGGAG (SEQ ID NO: 43) Liker reverse CCATGGGGATCCTTAAGGGTTAA (SEQ ID NO: 44) PCV-m2B
Capsid forward CTGCAGACGTATCCAAGGAG (SEQ ID NO: 45) Liker reverse CCATGGGGATCCTCACTTAGGGT (SEQ ID NO: 46)

ORF2 antigen, which is an antigenic protein of PCV, was generated with any one or more selected from the three capsid primers.

Therefore, the cDNA of PCV using Accuscript Hi-Fi Reverse transcriptase (Ailgent) using 5'CCCCCCCATGCCCTGAATTTCCATA 3'(SEQ ID NO: 48) at the end of the stop codon of the gene encoding the capsid protein for any one or more of the three capsid primers I made it.

Using the prepared cDNA, the immunodetermining site was cloned under the following PCR conditions using SEQ ID NO: 41 to SEQ ID NO: 46.

Step 1: 90℃ 10min,

Step 2: 90℃ 30sec,

Step 3: 62℃ 30sec,

Step 4: 72℃ 2min,

Step 5: go to Step 2 (x39),

Step 6: 72℃ 10min,

Step 7: 12℃ hold.

In order to insert the cloned immunodeterminant site into the gene recombination vector, the following primers were used to attach a PstI restriction enzyme site at the 5'end and a BamHI restriction enzyme site at the 3'end, followed by ligation after cleavage. (ligation).

forward PstI: CTGCAGATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 5)

reverse BamHI: GCGCGGATCCTTATATGTTACTATACACC (SEQ ID NO: 6)

PCR conditions for this were the same as those described above.

Example 10: Vector production

Bacillus subtilis 168 strain (KCTC 1327) was used. To create a vector for expressing the immunodetermining site on the spore surface of B. subtilis, cut the pHT-01 vector (BioSharp, Inc.) with SacI and BamHI, and cut this part at the 5'end of the SacI restriction enzyme site, and at the 3'end. PCotG-CotG-linker-MCS, PCotB-CotC-linker-MCS and PCotC-CotC-linker-MCS to which the BamHI restriction enzyme site was attached were respectively substituted.

In the genomic DNA of B. subtilis of PCotG-CotG, PCotB-CotB and PCotC-CotGC, each of the following primers (SEQ ID NOs: 9, 10, 37, 38, 39, 40) was added to the 5'end with a SacI restriction enzyme site. After attaching, a linker was attached as a BamHI restriction enzyme site and a fusion site at the 3'end. In this case, the linker sequence was used in common with SEQ ID NO: 16.

Linker sequence GGAGGTGGGGGTTCACTCCAG (SEQ ID NO: 16) CotG forward GAGCTCAGTGTCCCTAGCTCCGAG (SEQ ID NO: 9) Liker reverse CTGCAGTGAACCCCCACCTCCTTTGTATTTCTTTTTGACTA
(SEQ ID NO: 10) CotB forward ATAGAGCTCCTTCCAATCTCTT (SEQ ID NO: 37) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAAAATTTACGTTTC (SEQ ID NO: 38) CotC forward ATAGAGCTCTGTAGGATAAATCGT (SEQ ID NO: 39) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAGTAGTGTT (SEQ ID NO: 40)

A PstI restriction enzyme site was attached to the 3'end of the linker and replaced with an immunodetermining site in the future.

In order to transfer the cloned immunodeterminant site to the gene recombination vector, a PstI restriction enzyme site was attached to the 5'end and a BamHI restriction enzyme site was attached to the 3'end using the primers of SEQ ID NOs: 5 and 6. PCR conditions for this were the same as those described above.

Example 11: Bacillus transformation

Bacillus transformation was carried out in a conventional manner using electroporation (EP) (BIO-RAD Gene Pulser II) among the above-mentioned methods.

Specifically, B. subtilis DB104 strain grown with a growth medium (LB medium plus 0.5M sorbitol (Sigma-Aldrich Inc)) was used as an electroporation medium (LB medium plus 0.5M sorbitol, 0.5M mannitol (Sigma-Aldrich Inc), 10% glycerol). (Sigma-Aldrich)). At this time, the dilution concentration was diluted so that the constant time was 5 msec when 60 μl was dispensed into E.Coli Pulser Cuvett (BIO-RAD) 0.1cm electrode and given with Gene Pulser II (BIO-RAD) 200Ω2.1kV, 0.25μF. The diluted competent cells were stored at -80℃.

Transformation was performed under the above conditions by putting 10 ng of DNA plasmid in the prepared competent cell.

Immediately after electric shock, 1 ml of outgrowth medium (LB medium plus 0.5M sorbitol and 0.38M mannitol) was added and incubated in a 37°C shaker incubator for 3 hours. Subsequently, transformed Bacillus colonies were obtained in chloramphenicol (Sigma-Aldrich Inc) LB plate.

Example 12: Production of Bacillus Spore Display System

To confirm the self-produced genetic recombination vector, a GFP nucleotide sequence with a PstI restriction enzyme site attached to the 5'end and a BamHI restriction enzyme site attached to the 3'end was transferred to the genetic recombination vector with a primer set of SEQ ID NOs: 11 and 12. .

eGFP forward PstI: CTGCAGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 11)

eGFP reverse BamHI: CCATGGGGATCCTTACTTGTACAGCTCGTCCATGCCG (SEQ ID NO: 12)

Transformed Bacillus was obtained by the transformation method presented above using the created genetic recombination vector.

Transformed Bacillus exhibits a GFP signal during sporulation. To confirm this, the transformed Bacillus was grown in Schaeffer's sporulation medium and the GFP signal was confirmed by fluorescence microscope and flow cytometry at 24 hours, 48 hours, and 72 hours. In addition, spore expression was confirmed by Malachite green staining.

Malachite green staining experiment results using CotG, CotB, and CotC are shown in Figs. 57, 58, and 59, respectively.

Example 13: Vaccine manufacturing method

Transformed B. subtilis was incubated in 2 ml of LB medium for 3 hours, and then 500 ul per 1 L of Schaeffer's sporulation medium was added to induce sporulation for 48 hours.

If more than 90% of spores are formed through the malachite green staining mentioned above, the spore inactivation step is performed. If sporulation is insufficient, the spore inactivation step is performed after 6 to 12 hours of additional culture.

Spore inactivation was carried out through a sterilization process at 120°C for 15 min. For spore inactivation, a part of the obtained sample was placed in an LB plate or LB medium, and cultured overnight at 37°C shaker incubator and 37°C, respectively, and determined by colony or proliferation.

Spores that were not inactivated as a control were cultured together. Also, at this time, serial dilution was performed to check the number of spores. When spore inactivation was confirmed, washing and centrifugation were performed 5 times with sterilized cold destilled water (DW) to prevent any suspended matter. After the washing process, the spores are ^{dispensed with PBS at a concentration of 10 8} mice/200 ul and 10 ¹² pigs/ml and stored in a refrigerator at -80°C until use.

Example 14: Confirmation of immune response

Confirmation of the immune response of the produced genetically modified bexin was confirmed as follows. In the c57BL/6 strain of mice, 10 ⁸ doses/200 ul of the recombinant vaccine was injected intraperitoneally at intervals of 2 weeks, and changes in body weight and blood IgG concentration were measured before each injection or 40 days after the first injection.

The results of the test for confirming the immune response using CotG, CotB, and CotC are shown in FIGS. 60, 61, and 62, respectively.

Mice inoculated with the genetic recombination vaccine should increase the concentration of IgG in the blood without any change in body weight compared to non-vaccinated mice. In addition, in order to confirm the generation of antigen-specific antibodies, PCV-2A, PCV-2B, and PCV-m2B antigens were cloned with the following primer sets of SEQ ID NOs: 13 and 14, put into pET28a vector, and purified using AKTA pure L1. And, immunoblotting assay was performed using blood obtained from mice 40 days after inoculation of the recombinant vaccine.

forward: GCTAGCATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 13)

reverse: GGATCCTTATATGTTACTATACACCAACACAGG (SEQ ID NO: 14)

To purify and verify the antigen, His-tagging was performed on the N-terminus of the antigen. The identification of the antigen-specific antibody can be confirmed that the band is detected at the same position as the anti-His antibody when performing an immunoblotting assay.

The results of the immune response confirmation experiment using CotG, CotB, and CotC are shown in Figs. 63, 64, and 65, respectively.

Materials

pET28a vector: Addgene

AKTA pure L1: GE Healthcare

Anti-His antibody: Santa-Cruz

Example 15: Neutralizing antibody

The method of verifying the effect of the recombinant vaccine was carried out by confirming the change in the concentration of IgG in the blood obtained by the method for confirming the immune response presented above. The concentration of IgG in the blood was measured using a conventional ELISA method. In this case, an ELISA kit (Goma Biotech) was used.

It can be seen that the blood of mice vaccinated with the genetic recombination vaccine produced higher levels of IgG than the blood of mice that were not vaccinated.

In order to confirm whether the pigs inoculated with the recombinant vaccine of the present application are protected from PEDV, a total of 8 pigs (4-5 weeks of age in D-1) were randomly assigned to two groups and each placebo or recombinant vaccine was administered to D0. , 14, and 28 were inoculated intramuscularly.

Clinical signs were monitored daily until D40. The injection site and weight change were measured. ELISA was performed using serum samples collected before each injection to measure changes in IgG values.

The present application provides various aspects and various uses of an immunogenic substance, an immunogenic system, and an animal vaccine composition including the same, targeting pathogens of specific diseases in animals.

As a preferred example, it can be usefully used for vaccines, medicines and feeds for the prevention, improvement, and treatment of swine infectious diseases.

<110> JBbiotech <120> Immunogen, immunogenic system and vaccine composition thereof <130> CP17-151 <160> 54 <170> KoPatentIn 3.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> spike1 forward primer <400> 1 ccattcagcg tattctttat tgtgatga 28 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> spike1 reverse primer <400> 2 cctatgttac tatacaccaa cacaggctct g 31 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> spike2 forward primer <400> 3 ctgttaatga ttacctgtct tttagcaaat tttgtg 36 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> spike2 reverse primer <400> 4 caatcaacac taacaggcgt gttgtaaagc 30 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Spike1 forward PstI primer <400> 5 ctgcagattc agcgtattct ttattgtga 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Spike 1 reverse BamHI primer <400> 6 gcgcggatcc ttatatgtta ctatacacc 29 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Spike 2 forward PstI primer <400> 7 ggctgcaggt taatgattac ctgtcttt 28 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Spike 2 reverse BamHI primer <400> 8 ggatccttaa tcaacactaa caggcgt 27 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CotG forward primer <400> 9 gagctcagtg tccctagctc cgag 24 <210> 10 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> CotG Liner reverse primer <400> 10 ctgcagtgaa cccccacctc ctttgtattt ctttttgact a 41 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> eGFP forward PstI primer <400> 11 ctgcaggtga gcaagggcga ggagctg 27 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> eGFP reverse BamHI primer <400> 12 ccatggggat ccttacttgt acagctcgtc catgccg 37 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Spike2 purification forward primer <400> 13 gctagcattc agcgtattct ttattgtga 29 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Spike2 purification reverse primer <400> 14 ggatccttat atgttactat acaccaacac agg 33 <210> 15 <211> 585 <212> DNA <213> Bacillus subtilis <400> 15 ttgggccact attcccattc tgacatcgaa gaagcggtga aatccgcaaa aaaagaaggt 60 ttaaaggatt atttatacca agagcctcat ggaaaaaaac gcagtcataa aaagtcgcac 120 cgcactcaca aaaaatctcg cagccataaa aaatcatact gctctcacaa aaaatctcgc 180 agtcacaaaa aatcattctg ttctcacaaa aaatctcgca gccacaaaaa atcatactgc 240 tctcacaaga aatctcgcag ccacaaaaaa tcgtaccgtt ctcacaaaaa atctcgcagc 300 tataaaaaat cttaccgttc ttacaaaaaa tctcgtagct ataaaaaatc ttgccgttct 360 tacaaaaaat ctcgcagcta caaaaagtct tactgttctc acaagaaaaa atctcgcagc 420 tataagaagt catgccgcac acacaaaaaa tcttatcgtt cccataagaa atactacaaa 480 aaaccgcacc accactgcga cgactacaaa agacacgatg attatgacag caaaaaagaa 540 tactggaaag acggcaattg ctgggtagtc aaaaagaaat acaaa 585 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Linker sequence <400> 16 ggaggtgggg gttcactcca g 21 <210> 17 <211> 891 <212> DNA <213> porcine epidemic diarrhea virus <400> 17 attcagcgta ttctttattg tgatgatcct gttagccaac tcaagtgttc tcaggttgct 60 tttgaccttg acgatggttt ttaccctatt tcttctagaa accttctgag tcatgaacag 120 ccaatttctt ttgttactct gccatcattt aatgatcatt cttttgttaa cattactgta 180 tctgcttcct ttggtggtca tagtggtgcc aaccttattg catctgacac tactatcaat 240 gggtttagtt ctttctgtgt tgacactaga caatttacca tttcactgtt ttacaacgtt 300 acaaacagtt atggttatgt gtctaaatca caggacagta attgcccctt caccttgcaa 360 tctgttaatg attacttgtc ttttagcaaa ttttgtgttt ccaccagcct tttggctagt 420 gcctgtacca tagatctttt tggttaccct gagtttggta gtggtgttaa gtttacgtcc 480 ctttactttc aattcacaaa gggtgagttg attactggca cgcctaaacc acttgaaggt 540 gtcacggacg tttcttatat gactctggat gtgtgtacca agtatactat ctatggcttt 600 aaaggtgagg gtgtcattac ccttacaaat tctagctttt tggcaggtgt ttattacaca 660 tctgattctg gacagttgtt agcctttaag aatgttacta gtggtgctgt ttattctgtt 720 acgccatgtt ctttttcaga gcaggctgca tatgttgatg atgatatagt gggtgttatt 780 tctagtttgt ctagctccac ttttaacagt actagggagt tgcctggttt cttctaccat 840 tctaatgatg gctctaattg tacagagcct gtgttggtgt atagtaacat a 891 <210> 18 <211> 687 <212> DNA <213> porcine epidemic diarrhea virus <400> 18 gttaatgatt acctgtcttt tagcaaattt tgtgtttcca ccagcctttt ggctagtgcc 60 tgtaccatag atctttttgg ttaccctgag tttggtagtg gtgttaagtt tacgtccctt 120 tactttcaat tcacaaaggg tgagttgatt actggcacgc ctaaaccact tgaaggtgtc 180 acggacgttt cttatatgac tctggatgtg tgtaccaagt atactatcta tggctttaaa 240 ggtgagggtg tcattaccct tacaaattct agctttttgg caggtgttta ttacacatct 300 gattctggac agttgttagc ctttaagaat gttactagtg gtgctgttta ttctgttacg 360 ccatgttctt tttcagagca ggctgcatat gttgatgatg atatagtggg tgttatttct 420 agtttgtcta gctccacttt taacagtact agggagttgc ctggtttctt ctaccattct 480 aatgatggct ctaattgtac agagcctgtg ttggtgtaca gtaacatagg tgtttgtaaa 540 tctggcagta ttggctacgt cccttctcag tctggccaag tcaagattgc acccatggtt 600 actgggaata ttagtattcc caccaacttt agtatgagta ttaggacaga atatttacag 660 ctttacaaca cgcctgttag tgttgat 687 <210> 19 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 19 acgtaaacaa atgaggtctt taatttactt ctggttgctc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ctaggtgcca gtctactact aactttaggc ggttcttttc 120 aaaatttaat gttcaggcac ctgccgtcgt cgttttgggt ggttacctac ctagtatgaa 180 ctcttctagc tggtactgtg gcacaggcat tgaaactgct agtggcgttc atggtatttt 240 tctcagctac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacataa ggccactaat ggtaacacta atgctattgc 360 acgactgcgc atttgccagt ttcccgataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gcttatatgc gtgatggaaa 480 agatattgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaatcgcag 600 aagttgtgct atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc 660 aggtgaggat ggcatttatt atgaaccctg tacagctaat tgcactggtt acgctgccaa 720 tgtatttgcc actgattcca atggccatat accagaaggt tttagtttta ataattggtt 780 tcttttatcc aatgactcca ctttgttgca tggtaaagtg gtttccaacc aacccttgtt 840 ggtcaattgt cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa 900 tcacacgatg gatggcgttt gtaatggagc tgctgtggat cgtgccccag aggctctgag 960 gtttaatatt aatgacacct ccgtcattct tgctgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcatt tagccatctt 1080 tgccatacct ctgggtgcta ctgaagtacc ctactattgc tttcttaaag tggatactta 1140 caactccact gtttataaat tcttggctgt tttacctcct actgtcaggg aaattgtcat 1200 caccaagtat ggtgatgttt atgtcaatgg gtttggctat ttgcatctcg gtttgttgga 1260 tgctgtcaca attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac 1320 catagcatcg actaattttg ttgatgcact catcgaggtt caaggaactt ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct 1440 tgacgatggt ttttacccca tctcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tctctgcggc 1560 ttttggtggt cttagtagtg ccaatctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatttac cattacactg ttttataatg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag taattgtcct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgcgttcgg tagtggtgtt aagttgacgt ccctttattt 1860 tcaattcaca aaaggtgagt tgattactgg cacgcctaaa ccacttgaag gtatcacaga 1920 cgtttctttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccac ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactc acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttacc atttctgaag aggctttaca 2580 gttagctacc atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgc 2640 ttccgtgtac gatcctgcaa gtggcagggt ggtacaaaaa aggtctgtta ttgaagactt 2700 gctttttaat aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgatctagt ctgtgcgcag tattactctg gtgtcatggt 2820 actacctggc gttgttgacg ctgagaagct tcacatgtac agtgcgtctc tcataggtgg 2880 tatggcgcta ggaggtataa ctgctgcagc ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttctacag cggaaccagc aattgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc 3060 tattagtcaa acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga 3120 ggttgttaat tcgcagggtt cagctttgaa ccaacttacc gtacagctgc aacacaactt 3180 ccaagccatt tctagttcta ttgatgacat ttattcccga ctggacattc tttcagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgccca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta cggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctg gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc 3480 gggtgatttt gtaaatgttc ttgccatcgc tggcttatgc gttaatggtg aaattgcctt 3540 gactctacgt gagcctggct tagtcttgtt tacgcatgaa cttcaaaatt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt gagagttgtg tggtcaccta tgtcaatctg actagcgacc agctaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaaat ggtccaagtc ttcccctaga tgtttttaat gccacttatc ttaatcttac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctc attaacaaca tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacatac atcaagtggc cgtggtgggt ttggttgatc atttttattg ttctcatctt 4020 tgttgtgtca ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 20 <211> 4152 <212> DNA <213> porcine epidemic diarrhea virus <400> 20 atgaagcctt taatttactt ctggttgttc ttaccagtac ttctaacact tagcctacca 60 caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc aaaatttaat 120 gttcaggcac ctgccgtcgt cgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt tctcagttac 240 atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga tcctagtggt 300 taccagcttt atttacacaa ggccactaat ggtaacacta gtgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacaa agccattcca gcttatatgc aggatggaaa aaatattgtt 480 gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat ctatcatttt 540 tatattaaaa atgattggtc ccgtgttgcg acaagatgtt acaataaaag aagttgtgcc 600 atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc aggtgaggat 660 ggcatttact atgaaccttg tacagctaat tgcagtggtt acgctgccaa tgtatttgcc 720 actgattcca atggccatat accagaaggt tttagtttta ataattggtt tcttttgtcc 780 aatgactcca ctttgttgca tggtaaagtg gtttcaaacc aacctttgtt ggtcaactgc 840 ctttgggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa tcaaacgatg 900 gatggcgttt gtaacggagc cgctgcgcag cgtgccccag aggctctgag gtttaatatt 960 aatgacactt ttgtcattct tgctgaaggc tcaattgtac ttcatactgc tttaggaaca 1020 aatctttctt ttgtttgcag taattcctca gatcctcaca aagccatctt taccatacct 1080 ttgggtgtta ctgaagtacc ctactattgc tttcttaaag tggatactta caaatccact 1140 gtttataaat tcttggctgt tttacctcct actgtcaagg aaattgtcat caccaagtac 1200 ggtgatgttt atgtcaacgg gtttggctat ttgcatctcg gtttgttgga tgctgtcaca 1260 attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac cgtagcatcg 1320 actaattttg ttgatgcact catcgaggtt caaggaactg ccattcagcg tattctttat 1380 tgtgatgacc ctgttagcca acttaagtgt tctcaggttt cttttgacct tgatgatggt 1440 ttttacccta tttcttctag aaaccttctg agtcatgaac agccaatttc ttttgttact 1500 ttgccatcat tcaatgatca ttcttttgtt aatattactg tctctgcggc ttttggtggt 1560 catagtggtg ccaacctcat tgcatctgac actactatca atgggtttag ttctttctgt 1620 gttgacacta gacaatttac cattacactg ttttataacg ttacaaacag ttatggttat 1680 gtgtctaagt cacaggatag taattgccct ttcaccttgc aatctgttaa tgattacctg 1740 tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac catagatctt 1800 tttggttacc ctgagttcgg tagtggtgtt aagtttacgt ccctttattt tcaattcaca 1860 aagggtgagt tgattactgg cacgcctaaa ccacttcaag gtgtcacgga cgtttctttt 1920 atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga gggtattatt 1980 acccttacaa attctagctt tttggcaggt gtttattata catctgattc tggacagttg 2040 ttagccttta agaatgtcac tagtggtgct gtttattctg ttacgccatg ttctttttca 2100 gagcaggctg catatgttga tgatgatata gtgggtgtta tttctagttt gtctaactcc 2160 acttttaaca ataccaggga gttgcctggt ttcttctacc attctaatga tggctccaat 2220 tgtacagagc ctgtgttggt gtatagtaac ataggtgtct gtaaatctgg cagtattggc 2280 tatgtcccac ttcaggatgg ccaagtcaag attgcaccca cggttactgg gaatattagt 2340 attcccacca actttagtat gagtattaga acagaatatt tacagcttta caacacgcct 2400 gttagtgttg attgcgttac atatgtttgt aatggtaact ctcgttgtaa acaattactc 2460 acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag cgctaggctt 2520 gagtctgttg aagttaactc tatgcttact atttctgaag aggctctaca gttagctacc 2580 atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgt ttccgtgtac 2640 gatcctgcaa gtggcagggt ggtacaaaaa aggtctttta ttgaagacct gctttttaat 2700 aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg ttctaatggt 2760 cgctctgtgg cagatctagt ctgtgcgcag tattactctg gtgtcatggt actacctggc 2820 gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg tatggcgcta 2880 ggaggtttta ctactgcagc ggcattgcct tttagccatg ctgttcaagc gaggctcaat 2940 tatcttgctt tacagacgga tgttctacag cgcaaccagc aattgcttgc tgagtctttt 3000 aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc tattagtcaa 3060 acttccaatg gtttgaacac tgtggctcat gcgcttacta aggttcaaga ggttgttaat 3120 tcgcagggtt cagctttgac ccaacttacc atacagctgc aacacaactt ccaagccatt 3180 tctagttcta ttgatgacat ttactcccga ctggacattc tttcagccga tgttcaggtt 3240 gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca aaccctcact 3300 aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa tgagtgcgtc 3360 aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat cttctctctg 3420 gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc gggtgatttt 3480 gtaaatgtta ttgccatcga tggcttatgc gttaatggtg atattgcctt gactctacgt 3540 gagcctggct tagtcttgtt tacgcatgaa cttcaaactt atactgcgac ggaatatttt 3600 gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt tgttcaaatt 3660 gagagttgtg tggtcaccta tgtcaatctg actagcgacc aactaccaga tgtaatccca 3720 gattacatcg atgttaacaa aacacttgat gagattctag cttctctgcc caatagaatt 3780 ggtcctagtc ttcccctaga tgtttttaat gccacttatc ttaatctcac tggtgaaatt 3840 gcagatttag agcagcgttc agagtctctc cgtaatacta cagaagagct ccgaagtctc 3900 atatataata tcaacaacac acttgttgac cttgagtggc tcaaccgagt tgagacatat 3960 atcaagtggc cgtggtgggt ttggttgatt atttttattg ttctcatctt tgttgtgtca 4020 ttattagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg ttgcggtgct 4080 tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt tgaaaaggtc 4140 cacgtgcagt ga 4152 <210> 21 <211> 4149 <212> DNA <213> porcine epidemic diarrhea virus <400> 21 atgacgcctt taatttactt ctggttgttc ttaccagtac ttctaacact tagcctacca 60 caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc aaaatttaat 120 gttcaggcac ctgccgtcgt tgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt tctcagttac 240 atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga tcctagtggt 300 taccagcttt atttacacaa ggccactaat ggtaacacta gtgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacaa agccattcca gctttgcagg atggaaaaaa tattgttgtc 480 ggcataacat gggataatga tcgtgtcact gtttttgctg acaagatcta tcatttttat 540 attaaaaatg attggtcccg tgttgcgaca agatgttaca ataaaagaag ttgtgccatg 600 caatatgttt atacacctac ctactacatg cttaatgtta ctagtgcagg tgaggatggc 660 atttactatg aaccttgtac agctaattgc agtggttacg ctgccaatgt atttgccact 720 gattccaatg gccatatacc agaaggtttt agttttaata attggtttct tttgtccaat 780 gactccactt tgttgcatgg taaagtggtt tcaaaccaac ctttgttggt caactgcctt 840 tgggccattc ctaagattta tggactaggc caatttttct cattcaatca aacgatggat 900 ggcgtttgta acggagccgc tgcgcagcgt gccccagagg ctctgaggtt taatattaat 960 gacacttttg tcattcttgc tgaaggctca attgtacttc atactgcttt aggaacaaat 1020 ctttcttttg tttgcagtaa ttcctcagat cctcacaaag ccatctttac catacctttg 1080 ggtgttactg aagtacccta ctattgcttt cttaaagtgg atacttacaa atccactgtt 1140 tataaattct tggctgtttt acctcctact gtcaaggaaa ttgtcatcac caagtacggt 1200 gatgtttatg tcaacgggtt tggctatttg catctcggtt tgttggatgc tgtcacaatt 1260 aatttcactg gtcatggcac tgacgatgac gtttcaggtt tctggaccgt agcatcgact 1320 aattttgttg atgcactcat cgaggttcaa ggaactgcca ttcagcgtat tctttattgt 1380 gatgaccctg ttagccaact taagtgttct caggtttctt ttgaccttga tgatggtttt 1440 taccctattt cttctagaaa ccttctgagt catgaacagc caatttcttt tgttactttg 1500 ccatcattca atgatcattc ttttgttaat attactgtct ctgcggcttt tggtggtcat 1560 agtggtgcca acctcattgc atctgacact actatcaatg ggtttagttc tttctgtgtt 1620 gacactagac aatttaccat tacactgttt tataacgtta caaacagtta tggttatgtg 1680 tctaagtcac aggatagtaa ttgccctttc accttgcaat ctgttaatga ttacctgtct 1740 tttagcaaat tttgtgtttc aaccagcctt ttggctggtg cttgtaccat agatcttttt 1800 ggttaccctg agttcggtag tggtgttaag tttacgtccc tttattttca attcacaaag 1860 ggtgagttga ttactggcac gcctaaacca cttcaaggtg tcacggacgt ttcttttatg 1920 actctggatg tgtgtaccaa gtatactatc tatggcttta aaggtgaggg tattattacc 1980 cttacaaatt ctagcttttt ggcaggtgtt tattatacat ctgattctgg acagttgtta 2040 gcctttaaga atgtcactag tggtgctgtt tattctgtta cgccatgttc tttttcagag 2100 caggctgcat atgttgatga tgatatagtg ggtgttattt ctagtttgtc taactccact 2160 tttaacaata ccagggagtt gcctggtttc ttctaccatt ctaatgatgg ctccaattgt 2220 acagagcctg tgttggtgta tagtaacata ggtgtctgta aatctggcag tattggctat 2280 gtcccacttc aggatggcca agtcaagatt gcacccatgg ttactgggaa tattagtatt 2340 cccaccaact ttagtatgag tattagaaca gaatatttac agctttacaa cacgcctgtt 2400 agtgttgatt gcgttacata tgtttgtaat ggtaactctc gttgtaaaca attactcacc 2460 cagtacactg cagcatgtaa gaccatagag tcagcattac aactcagcgc taggcttgag 2520 tctgttgaag ttaactctat gcttactatt tctgaagagg ctctacagtt agctaccatc 2580 agttcgttta atggtgatgg atataacttt actaatgtgc tgggtgtttc cgtgtacgac 2640 cctgcaagtg gcagggtggt acaaaaaagg tcttttattg aagacctgct ttttaataaa 2700 gtggttacta atggccttgg tactgttgat gaagactata agcgctgttc taatggtcgc 2760 tctgtggcag atctagtctg tgcgcagtat tactctggtg tcatggtact acctggcgtt 2820 gttgacgctg agaagcttca catgtatagt gcgtctctca tcggtggtat ggcgctagga 2880 ggtcttacta ctgcagcggc attgcctttt agccatgctg ttcaagcgag gctcaattat 2940 cttgctttac agacggatgt tctacagcgc aaccagcaat tgcttgctga gtcttttaac 3000 tctgctattg gtaatataac ttcagccttt gagagtgtta aagaggctat tagtcaaact 3060 tccaatggtt tgaacactgt ggctcatgcg cttactaagg ttcaagaggt tgttaattcg 3120 cagggttcag ctttgaccca acttaccata cagctgcaac acaacttcca agccatttct 3180 agttctattg atgacattta ctcccgactg gacattcttt cagccgatgt tcaggttgat 3240 cgtctcatca ccggcagatt atcagcactt aatgcttttg ttgctcaaac cctcactaag 3300 tatactgagg ttcaggctag caggaagcta gcacagcaaa aggttaatga gtgcgtcaaa 3360 tcgcaatctc agcgttatgg tttttgtggt ggtgatggcg agcacatctt ctctctggta 3420 caggccgcac ctcagggcct gctgttctta catacagtac ttgtaccggg tgattttgta 3480 aatgttattg ccatcgatgg cttatgcgtt aatggtgata ttgccttgac tctacgtgag 3540 cctggcttag tcttgtttac gcatgaactt caaacttata ctgcgacgga atattttgtt 3600 tcatcgcgac gtatgtttga acctagaaaa cctaccgtta gtgattttgt tcaaattgag 3660 agttgtgtgg tcacctatgt caatctgact agcgaccaac taccagatgt aatcccagat 3720 tacatcgatg ttaacaaaac acttgatgag attctagctt ctctgcccaa tagaattggt 3780 cctagtcttc ccctagatgt ttttaatgcc acttatctta atctcactgg tgaaattgca 3840 gatttagagc agcgttcaga gtctctccgt aatactacag aagagctccg aagtctcata 3900 tataatatca acaacacact tgttgacctt gagtggctca accgagttga gacatatatc 3960 aagtggccgt ggtgggtttg gttgattatt tttattgttc tcatctttgt tgtgtcatta 4020 ttagtgttct gctgcatttc cacgggttgt tgtggatgct gcggttgttg cggtgcttgt 4080 ttttcaggtt gttgtagggg tcctagactt caaccttacg aagcttttga aaaggtccac 4140 gtgcagtga 4149 <210> 22 <211> 4152 <212> DNA <213> porcine epidemic diarrhea virus <400> 22 atgaagcctt taatttactt ctggttgttc ttaccagtac ttctaacact tagcctacca 60 caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc aaaatttaat 120 gttcaggcac ctgccgtcgt cgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt tctcagttac 240 atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga tcctagtggt 300 taccagcttt atttacacaa ggccactaat ggtaccacta atgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacaa agccattcca gcttatatgc aggatggaaa aaatattgtt 480 gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat ctatcatttt 540 tatattaaaa atgattggtc ccgtgttgcg acaagatgtt acaataaaag aagttgtgcc 600 atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc aggtgaggat 660 ggcatttact atgaaccttg tacagctaat tgcagtggtt acgctgccaa tgtatttgcc 720 actgattcca atggccatat accagaaggt tttagtttta ataattggtt tcttttgtcc 780 aatgactcca ctttgttgca tggtaaagtg gtttcaaacc aacctttgtt ggtcaactgc 840 ctttgggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa tcaaacgatg 900 gatggcgttt gtaacggagc cgctgcgcag cgtgccccag aggctctgag gtttaatatt 960 aatgacactt ttgtcattct tgctgaaggc tcaattgtac ttcatactgc tttaggaaca 1020 aatctttctt ttgtttgcag taattcctca gatcctcaca aagccatctt taccatacct 1080 ttgggtgtta ctgaagtacc ctactattgc tttcttaaag tggatactta caaccccact 1140 gtttataaat tcttggctgt tttacctcct actgtcaagg aaattgtcat caccaagtac 1200 ggtgatgttt atgtcaacgg gtttggctat ttgcatctcg gtttgttgga tgctgtcaca 1260 attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac cgtagcatcg 1320 actaattttg ttgatgcact catcgaggtt caaggaactg ccattcagcg tattctttat 1380 tgtgatgacc ctgttagcca acttaagtgt tctcaggttt cttttgacct tgatgatggt 1440 ttttacccta tttcttctag aaaccttctg agtcatgaac agccaatttc ttttgttact 1500 ttgccatcat tcaatgatca ttcttttgtt aatattactg tctctgcggc ttttggtggt 1560 catagtggtg ccaacctcat tgcatctgac actactatca atgggtttag ttctttctgt 1620 gttgacacta gacaatttac cattacactg ttttataacg ttacaaacag ttatggttat 1680 gtgtctaagt cacaggatag taattgccct ttcaccttgc aatctgttaa tgattacctg 1740 tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac catagatctt 1800 tttggttacc ctgagttcgg tagtggtgtt aagtttacgt ccctttattt tcaattcaca 1860 aagggtgagt tgattactgg cacgcctaaa ccacttgaag gtgtcacgga cgtttctttt 1920 atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga gggtattatt 1980 acccttacaa attctagctt tttggcaggt gtttattata catctgattc tggacagttg 2040 ttagccttta agaatgtcac tagtggtgct gtttattctg ttacgccatg ttctttttca 2100 gagcaggctg catatgttga tgatgatata gtgggtgtta tttctagttt gtctaactcc 2160 acttttaaca ataccaggga gttgcctggt ttcttctacc attctaatga tggctccaat 2220 tgtacagagc ctgtgttggt gtatagtaac ataggtgtct gtaaatctgg cagtattggc 2280 tatgtcccac ttcaggatgg ccaagtcaag attgcaccca cggttactgg gaatattagt 2340 attcccacca actttagtat gagtattaga acagaatatt tacagcttta caacacgcct 2400 gttagtgttg attgcgttac atatgtttgt aatggtaact ctcgttgtaa acaattactc 2460 acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag cgctaggctt 2520 gagtctgttg aagttaactc tatgcttact atttctgaag aggctctaca gttagctacc 2580 atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgt ttccgtgtac 2640 gatcctgcaa gtggcagggt ggtacaaaaa aggtctttta ttgaagacct gctttttaat 2700 aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg ttctaatggt 2760 cgctctgtgg cagatctagt ctgtgcgcag tattactctg gtgtcatggt actacctggc 2820 gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg tatggcgcta 2880 ggaggtttta ctgctgcagc ggcattgcct tttagctatg ctgttcaagc gaggctcaat 2940 tatcttgctt tacagacgga tgttctacag cgcaaccagc aattgcttgc tgagtctttt 3000 aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc tattagtcaa 3060 acttccaatg gtttgaacac tgtggctcat gcgcttacta aggttcaaga ggttgttaat 3120 tcgcagggtt cagctttgac ccaacttacc atacagctgc aacacaactt ccaagccatt 3180 tctagttcta ttgatgacat ttactcccga ctggacattc tttcagccga tgttcaggtt 3240 gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca aaccctcact 3300 aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa tgagtgcgtc 3360 aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat cttctctctg 3420 gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc gggtgatttt 3480 gtaaatgtta ttgccatcgc tggcttatgc gttaatggtg atattgcctt gactctacgt 3540 gagcctggct tagtcttgtt tacgcatgaa cttcaaactt atactgcgac ggaatatttt 3600 gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt tgttcaaatt 3660 gagagttgtg tggtcaccta tgtcaatctg actagcgacc aactaccaga tgtaatccca 3720 gattacatcg atgttaacaa aacacttgat gagattctag cttctctgcc caatagaact 3780 ggtcctagtc ttcccctaga tgtttttaat gccacttatc ttaatctcac tggtgaaatt 3840 gcagatttag agcagcgttc agagtctctc cgtaatacta cagaagagct ccgaagtctc 3900 atatataata tcaacaacac acttgttgac cttgagtggc tcaaccgagt tgagacatat 3960 atcaagtggc cgtggtgggt ttggttgatt atttttattg ttctcatctt tgttgtgtca 4020 ttattagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg ctgcggtgct 4080 tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt tgaaaaggtc 4140 cacgtgcagt ga 4152 <210> 23 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 23 acgtaaacaa atgaggtctt taatttactt ctggttgctc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ctaggtgcca gtctactact aactttaggc ggttcttttc 120 aaaatttaat gttcaggcac ctgccgtcgt cgttttgggt ggttacctac ctagtatgaa 180 ctcttctagc tggtactgtg gcacaggcat tgaaactgct agtggcgttc atggtatttt 240 tctcagctac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacataa ggccactaat ggtaacacta atgctactgc 360 acgactgcgc atttgccagt ttcccgataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gcttatatgc gtgatggaaa 480 agatattgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaatcgcag 600 aagttgtgct atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc 660 aggtgaggat ggcatttatt atgaaccctg tacagctaat tgcactggtt acgctgccaa 720 tgtatttgcc actgattcca atggccatat accagaaggt tttagtttta ataattggtt 780 tcttttatcc aatgactcca ctttgttgca tggtaaagtg gtttccaacc aacccttgtt 840 ggtcaattgt cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa 900 tcacacgatg gatggcgttt gtaatggagc tgctgtggat cgtgccccag aggctctgag 960 gtttaatatt aatgacacct ccgtcattct tgctgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcatt tagccatctt 1080 tgccatacct ctgggtgcta ctgaagtacc ctactattgc tttcttaaag tggatactta 1140 caactccact gtttataaat tcttggctgt tttaccttct actgtcaggg aaattgtcat 1200 caccaagtat ggtgatgttt atgtcaatgg gtttggctat ttgcatctcg gtttgttgga 1260 tgctgtcaca atttatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac 1320 catagcatcg actaattttg ttgatgcact catcgaggtt caaggaactt ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct 1440 tgacgatggt ttttacccca tctcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tctctgcggc 1560 ttttggtggt cttagtagtg ccaatctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatttac cattacactg ttttataatg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag taattgtcct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgcgttcgg tagtggtgtt aagttgacgt ccctttattt 1860 tcaattcaca aaaggtgagt tgattactgg cacgcctaaa ccacttgaag gtatcacaga 1920 cgtttctttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccat ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactc acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttacc atttctgaag aggctttaca 2580 gttagctacc atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgc 2640 ttccgtgtac gatcctgcaa gtggcagggt ggtacaaaaa aggtctgtta ttgaagactt 2700 gctttttaat aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgatctagt ctgtgcgcag tattactctg gtgtcatggt 2820 actacctggc gttgttgacg ctgagaagct tcacatgtac agtgcgtctc tcataggtgg 2880 tatggcgcta ggaggtataa ctgctgcagc ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttctacag cggaaccagc aattgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc 3060 tattagtcaa acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga 3120 ggttgttaat tcgcagggtt cagctttgaa ccaacttacc gtacagctgc aacacaactt 3180 ccaagccatt tctagttcta ttgatgacat ttattcccga ctggacattc ttttagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgccca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta cggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctg gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc 3480 gggtgatttt gtaaatgttc ttgccatcgc tggcttatgc gttaatggtg aaattgcctt 3540 gactctacgt gagcctggct tagtcttgtt tacgcatgaa cttcaaactt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt gagagttgtg tggtcaccta tgtcaatctg actagcgacc agctaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaact ggtccaagtc ttcccctaga tgtttttaat gccacttatc ttaatcttac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctc attaacaaca tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacatac atcaagtggc cgtggtgggt ttggttgatc attgttattg ttctcatctt 4020 tgttgtgtca ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 24 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 24 acgtaaacaa atgaggtctt taatttattt tttgttgttc gtaccagtac ttccaacact 60 cagcctacca caagatgtct ataggtgctc agctaacact aactttaggc ggttcttttc 120 aaaatttaat gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtgtgaa 180 acacgctggt tggtactgtg ctgccgacat ccaaactgct agtggcgttc atggtatctt 240 ccttagccat attagaggtg gtcatggctt tgagattggc atttcgcaag agccgtttga 300 ccctagtggt taccagcttt atttacataa ggccactaac ggtaacacta atgctactgc 360 gcgactgcgt atttgccagt ttcccagcag taaaacattg ggccccactg ctaatgatgt 420 tacaacaggt cgtaattgcc tatttaacaa agccattcca gctcatatga gtgatggaaa 480 acatagtgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaaactgtt acaacagtgg 600 aggttgtgct atgcaatatg tttacgaacc tatttactac atgcttaatg ttactagtgc 660 tggtgaggat ggtatttctt atcaaccctg tacagctaat tgcattggtt atgctgccaa 720 tgtatttgcc actgagtcca atggccacat accagaaggt tttagtttta ataattggtt 780 tcttttgtcc aatgattcca ctttgtttca tggtaaagtg gtttccaacc aacctttgtt 840 ggtcaactgt ctttgggcca ttcctaagat ttacggacta ggccactttt tctcatttaa 900 tcaaacgatg gatggcgttt gtaacggagc tactgcgtat cgtgccccac aggctctgag 960 gtttaatatt aatgacactt ctgtcattct tgccgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcaca aagccatctt 1080 ctccatacct ctgggtgcta cccaagtacc ctactattgc tttcttaaag ttgatactta 1140 caactccact gtctataaat ttcctgctgt tttaccttct actgtcaggg aaattgtcat 1200 cacaaagtac ggtgatgttt atgtcaacgg gtttggctac ttgcatctcg gtttgttgga 1260 tgctgtcaca attaatttca ctggccatgg cactaacgat gacgtctcag gtttctggac 1320 catagcatcg actaatttta ttgatgcact catcgaggtt caagcaactg ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttt cttttgacct 1440 tgatgatggt ttttacccta tttcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tatctgcggc 1560 ttttggtgat tctggtggtg ccaacctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatatac cattagactg ttttacaacg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag caattgccct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgctttcgg tagtggtgtt aattacaggt ccctctattt 1860 tcaattcaca aaaggtgagt ggattacttg ggcacctaaa cccttaaacg gccttttaaa 1920 ggggggtttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccat ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactt acccagtaca ctgcagcatg taagaccata gagtcagcat tagaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttact atttctgaag aggccttaca 2580 gttagctacc atcagttcgt ttaatggtga tgggtataac tttactaatg tgttgggtgt 2640 ttctgtgtac gattctcaaa gtggcagggt gatacacgaa aggtctttta ttgaagacct 2700 gctttttaat aaggtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgataaagt ctgtgcgcag tattactctg gtctcatggt 2820 actacctggg gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg 2880 tatggcgcta ggaggtttta ctgccgcagt ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttttacag cggaaccagc aactgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacctcagcc tttgcgagtg ttaaagaggc 3060 tatcagtcaa acttctaagg gtttgaatac tgtggctcat gcgcttacta aagttcaaga 3120 ggttgttaat tcgcagggtt cagctttgac tcaacttacc atacagctgc aacataactt 3180 ccaagccatt tctagttcta ctgatgacat ttactcccga ctggacattc tttcagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctt gtacaggccg caccccaggg cctgctgttc ttacacacag tacttgtacc 3480 gggtgatttt gtaaatgtta ttgccatcgc aggcttatgc gttaatggtg atattgcctt 3540 gactctacgt gagcctggct tagtcttggt tacgcatgaa cttcaaactt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt cagagttgtg tggtcaccta tgtcaatctg actagcgacc aactaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaact ggtccaaatc ttcccctaga tgtttttaat gccacttatc ttaatctcac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctt atatacaata tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacttat atcaagtggc cgtggtgggt ttggttgatt atttttattg gtctcatctt 4020 tgttgtgtca ttattagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttggag gggtcctaga cttcaacctt acgaaggttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 25 <211> 4159 <212> DNA <213> porcine epidemic diarrhea virus <400> 25 acgtaaacaa atgacgcctt taatttactt ctggttgttc ttaccagtac ttctaacact 60 tagcctacca caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc 120 aaaatttaat gttcaggcac ctgccgtcgt tgttttgggt ggttatctac ctagtatgaa 180 ctcttctagc tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt 240 tctcagttac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacacaa ggccactaat ggtaacacta gcgctattgc 360 acgactgcgc atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gctttgcagg atggaaaaaa 480 tactgttgtc ggcataacat gggataatga tcgtgtcact gtttttgctg acaagatcta 540 tcatttttat attaaaaatg attggtcccg tgttgcgaca agatgttaca ataaaagaag 600 ttgtgccatg caatatgttt atacacctac ctactacatg cttaatgtta ctagtgcagg 660 tgaggatggc atttactatg aaccttgtac agctaattgc agtggttacg ctgccaatgt 720 atttgccact gattccaatg gccatatacc agaaggtttt agttttaata attggtttct 780 tttgtccaat gactccactt tgttgcatgg taaagtggtt tcaaaccaac ctctgttggt 840 caactgcctt tgggccattc ctaagattta tggactagga caatttttct cattcaatca 900 aacgatggat ggcgtttgta acggagccgc tgcgcagcgt gccccagagg ctctgaggtt 960 taatattaat gacacttttg tcattcttgc tgaaggctca attatacttc atactgcttt 1020 aggaacaaat ctttcttttg tttgcagtaa ttcctcagat cctcacaaag ccatctttac 1080 catacctttg ggtgttactg aagtacccta ctattgcttt cttaaagtgg atacttacaa 1140 atccactgtt tataaattct tggctgtttt acctcctact gtcaaggaaa ttgtcatcac 1200 caagtacggt gatgtttatg tcaacgggtt tggctatttg catctcggtt tgttggatgc 1260 tgtcacaatt aatttcactg gtcatggcac tgacgatgac gtttcaggtt tctggaccgt 1320 agcatcgact aattttgttg atgcactcat cgaggttcaa ggaactgcca ttcagcgtat 1380 tctttattgt gatgaccctg ttagccaact taagtgttct caggttgctt ttgaccttga 1440 tgatggtttt taccctattt cttctagaaa ccttctgagt catgaacagc caatttcttt 1500 tgttactttg ccatcattca atgaccattc ttttgttaat attactgtct ctgcggcttt 1560 tggtggtcat agtggtgcca acctcattgc atctgacact actatcaatg ggtttagttc 1620 tttctgtgtt gacactagac aatttaccat tacactgttt tataacgtta caaacagtta 1680 tggttatgtg tctaagtcac aggatagtaa ttgccctttc accttgcaat ctgttaatga 1740 ttacctgtct tttagcaaat tttgtgtttc aaccagcctt ttggctggtg cttgtaccat 1800 agatcttttt ggttaccctg agttcggtag tggtgttaag tttacgtccc tttattttca 1860 attcacaaag ggtgagtcga ttactggcac gcctaaacca cttcaaggtg tcacggacgt 1920 ttcttttatg actctggatg tgtgtaccaa gtatactatc tatggcttta aaggtgaggg 1980 tattattacc cttacaaatt ctagcttttt ggcaggtgtt tattatacat ctgattctgg 2040 acagttgtta gcctttaaga atgtcactag tggtgctgtt tattctgtta cgccatgttc 2100 tttttcagag caggctgcat atgttgatga tgatatagtg ggtgttattt ctagtttgtc 2160 taactccact tttaacaata ccagggagtt gcctggtttc ttctaccatt ctaaggatgg 2220 ctccaattgt acagagcctg tgttggtgta tagtaacata ggtgtctgta aatctggcag 2280 tattggctat gtcccacttc aggatggcca agtcaagatt gcacccatgg ttactgggaa 2340 tattagtatt cccaccaact ttagtatgag tattagaaca gaatatttac agctttacaa 2400 cacgcctgtt agtgttgatt gcgttacata tgtttgtaat ggtaactctc gttgtaaaca 2460 attactcacc cagtacactg cagcatgtaa gaccatagag tcagcattac aactcagcgc 2520 taggcttgag tctgttgaag ttaactctat gcttactatt tctgaagagg ctctacagtt 2580 agctaccatc agttcgttta atggtgatgg atataacttt actaatgtgc tgggtgtttc 2640 cgtgtacgac cctgcaagtg gcagggtggt acaaaaaggg tcttttattg aagacctgct 2700 ttttaataaa gtggttacta atggccttgg tactgttgat gaagactata agcgctgttc 2760 taatggtcgc tctgtggcag atctagtctg tgcgcagtat tactctggtg tcatggtact 2820 acctggcgtt gttgacgctg agaagcttca catgtatagt gcgtctctca tcggtggtat 2880 ggcgctagga ggtcttacta gtgcagcggc attgtctttt agccatgctg ttcaagcgag 2940 gctcaattat cttgctttac agacggatgt tctacagcgc aaccagcaat tgcttgctga 3000 gtcttttaac tctgctattg gtaatataac ttcagccttt gagagtgtta aagaggctat 3060 tagtcaaact tccaatggtt tgaacactgt ggctcatgcg cttactaagg ttcaagaggt 3120 tgttaattcg cagggttcag ctttgaccca acttaccata cagctgcaac acaacttcca 3180 agccatttct agttctattg atgacattta ctcccgactg gacattcttt cagccgatgt 3240 tcaggttgat cgtctcatca ccggcagatt atcagcactt aatgctttcg ttgctcaaac 3300 cctcactaag tatactgagg ttcaggctag caggaagcta gcacagcaaa aggttaatga 3360 gtgcgtcaaa tcgcaatctc agcgttatgg tttttgtggt ggtgatggcg agcacatctt 3420 ctctctggta caggccgcac ctcagggcct gctgttttta catacagtac ttgtaccggg 3480 tgattttgta aatgttattg ccatcgatgg cctatgcgtt aatggtgata ttgccttgac 3540 tctacgtgag cctggcttag tcttgtttac gcatgaactt caaacttata ctgcgacgga 3600 atattttgtt tcatcgcgac gtatgtttga acctagaaaa cctaccgtta gtgattttgt 3660 tcaaattgag agttgtgtgg tcacctatgt caatctgact agcgaccaac taccagatgt 3720 aatcccagat tacatcgatg ttaacaaaac acttgatgag attctagctt ctctgcccaa 3780 tagaattggt cctagtcttc ccctagatgt ttttaatgcc acttatctta atctcactgg 3840 tgaaattgca gatttagagc agcgttcaga gtctctcagt aatactacag aagagctccg 3900 aagcctcata tataatatca acaacacact tgttgacctt gagtggctca accgagttga 3960 gacatatatc aagtggccgt ggtgggtttg gttgattatt tttattgttc tcatctttgt 4020 tgtgtcatta ttagtgttct gctgcatttc cacgggttgt tgtggatgct gcggttgttg 4080 cggtgcctgt ttttcaggtt gttgtagggg tcctagactt caaccttacg aagcttttga 4140 aaaggtccac gtgcagtga 4159 <210> 26 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 26 acgtaaacaa atgaggtctt taatttactt ctggttgctc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ctaggtgcca gtctactact aactttaggc ggttcttttc 120 aaaatttaat gttcaggcac ctgccgtcgt cgttttgggt ggttacctac ctagtatgaa 180 ctcttctagc tggtactgtg gcacaggcat tgaaactgct agtggcgttc atggtatttt 240 tctcagctac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacataa ggccactaat ggtaacacta atgctattgc 360 acgactgcgc atttgccagt ttcccgataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gcttatatgc gtgatggaaa 480 agatattgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaatcgcag 600 aagttgtgct atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc 660 aggtgaggat ggcatttatt atgaaccctg tacagctaat tgcactggtt acgctgccaa 720 tgtatttgcc actgattcca atggccatat accagaaggt tttagtttta ataattggtt 780 tcttttatcc aatgactcca ctttgttgca tggtaaagtg gtttccaacc aacccttgtt 840 ggtcaattgt cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa 900 tcacacgatg gatggcgttt gtaatggagc tgctgtggat cgtgccccag aggctctgag 960 gtttaatatt aatgacacct ccgtcattct tgctgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcatt tagccatctt 1080 tgccatacct ctgggtgcta ctgaagtacc ctactattgc tttcttaaag tggatactta 1140 caactccact gtttataaat tcttggctgt tttacctcct actgtcaggg aaattgtcat 1200 caccaagtat ggtgatgttt atgtcaatgg gtttggctat ttgcatctcg gtttgttgga 1260 tgctgtcaca attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac 1320 catagcatcg actaattttg ttgatgcact catcgaggtt caaggaactt ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct 1440 tgacgatggt ttttacccca tctcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tctctgcggc 1560 ttttggtggt cttagtagtg ccaatctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatttac cattacactg ttttataatg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag taattgtcct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgcgttcgg tagtggtgtt aagttgacgt ccctttattt 1860 tcaattcaca aaaggtgagt tgattactgg cacgcctaaa ccacttgaag gtatcacaga 1920 cgtttctttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccac ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactc acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttacc atttctgaag aggctttaca 2580 gttagctacc atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgc 2640 ttccgtgtac gatcctgcaa gtggcagggt ggtacaaaaa aggtctgtta ttgaagactt 2700 gctttttaat aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgatctagt ctgtgcgcag tattactctg gtgtcatggt 2820 actacctggc gttgttgacg ctgagaagct tcacatgtac agtgcgtctc tcataggtgg 2880 tatggcgcta ggaggtataa ctgctgcagc ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttctacag cggaaccagc aattgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc 3060 tattagtcaa acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga 3120 ggttgttaat tcgcagggtt cagctttgaa ccaacttacc gtacagctgc aacacaactt 3180 ccaagccatt tctagttcta ttgatgacat ttattcccga ctggacattc tttcagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgccca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta cggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctg gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc 3480 gggtgatttt gtaaatgttc ttgccatcgc tggcttatgc gttaatggtg aaattgcctt 3540 gactctacgt gagcctggct tagtcttgtt tacgcatgaa cttcaaaatt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt gagagttgtg tggtcaccta tgtcaatctg actagcgacc agctaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaaat ggtccaagtc ttcccctaga tgtttttaat gccacttatc ttaatcttac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctc attaacaaca tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacatac atcaagtggc cgtggtgggt ttggttgatc atttttattg ttctcatctt 4020 tgttgtgtca ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 27 <211> 4152 <212> DNA <213> porcine epidemic diarrhea virus <400> 27 atgaagtctt taacttactt ctggttgtta ttaccagtac tttcaacact cagcctacca 60 caagatgtca ctaggtgcca gtccactatt aacttcaggc ggttcttttc aaaatttaat 120 gtgcaggcac ctgctgtcgt tgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggtct tgaaactgct agtggcgtgc atggtatttt cctcagttac 240 atcgatgctg gtcagggctt tgagattggc atttcacagg agccgtttga tcctagtggt 300 taccagcttt atttacataa ggctactaat ggtaatacta atgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacag agccattcca gcttatatgc aggatggaaa aaatattgtt 480 gtcggcataa catgggataa tgatcgcgtc actgtttttg ctgacaagat ctatcatttt 540 tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaataaaag gagttgtgct 600 atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc aggtgaggat 660 ggcatttatt atgaaccatg tacagctaat tgcagtggtt acgctgctaa tatatttgcc 720 actgattcta atggccatat accagaaggt tttagtttta ataattggtt tcttttgtcc 780 aatgattcca ctttgttgca tggtaaggtg gtttccaacc aacctttgtt ggtcaattgt 840 cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa tcaaacgatg 900 gatggcgttt gtaatggagc tgctgcgcag cgtgcaccag aggctctgag gtttaatatt 960 aatgacacct ctgtcattct tgctgaaggc tcaattgtac ttcatactgc tttaggaaca 1020 aatctttctt ttgtttgcag taattcctca gatcctcatt tagccacctt cgccatacct 1080 ctgggtgcta cccaagtacc ctattattgt tttcttaaag tggatactta caactccact 1140 gtttataaat tcttggctgt tttacctcct accgtcaggg aaattgtcat caccaagtat 1200 ggtgatgttt atgtcaatgg gtttggctac ttgcatctcg gtttgttgga tgctgtcaca 1260 attaatttca ctggtcatgg cactgacgat gacgtttctg gtttttggac catagcatcg 1320 actaattttg ttgatgcact catcgaagtt caaggaactg ccattcagcg tattctttat 1380 tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct tgacgatggt 1440 ttttacccta tttcttctag aaaccttctg agtcatgaac agccaatttc ttttgttact 1500 ttgccatcat ttaatgatca ttcttttgtt aacattactg tctctgcgtc ctttggtggt 1560 catagtggtg ccaacctcat tgcatctgac actactatca atgggtttag ttctttctgt 1620 gttgacacta gacaatttac catttcactg ttttataacg ttacaaacag ttatggttat 1680 gtgtctaaat cacaggacag taattgccct ttcaccttgc aatctgttaa tgattacctg 1740 tcttttagca aattttgtgt ttctaccagc cttttggcta gtgcctgtac catagatctt 1800 tttggttacc ctgagtttgg tagtggtgtt aagtttacgt ccctttactt tcaattcaca 1860 gagggtgagt tgattactgg cacgcctaaa ccacttgaag gtgtcacgga cgtttctttt 1920 atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga gggtatcatt 1980 acccttacaa attctagctt tttggcaggt gtttattata catctgattc tggacagttg 2040 ttagccctta agaatgtcac tagtggtgct gtttattctg ttacgccatg ttctttttca 2100 gagcaggctg catatgttga tgatgatata gtgggtgtta tttctagttt gtctagctcc 2160 acttttaaca gtactaggga gttgcctggt ttcttctacc attctaatga tggctctaat 2220 tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg cagtattggc 2280 tatgtcccat ctcagtctgg ccaagtcaag attgcaccca cggttactgg gaatattagt 2340 attcccacca actttagtat gagtattagg acagaatatt tacagcttta caacacgcct 2400 gttagtgttg attgtgccac atatgtttgt aatggtaact ctcgttgcaa acaattactc 2460 acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag cgctaggctt 2520 gagtctgttg aagttaactc tatgcttact atttctgaag aggctctaca gttagctacc 2580 atcagttcgt ttaatggtga tggatataat tttactaatg tgctgggtgt ttccgtgtat 2640 gatcctgcaa gtggcagggt ggtacacaaa aggtctttta ttgaagacct gctttttaat 2700 aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg ttctaatggt 2760 cgctctgtgg cagatctagt ctgtgcacag tattactctg gtgtcatggt actacctggt 2820 gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg tatggcgcta 2880 ggaggtttta ctgttgcagc ggcattgcct tttagctatg ctgttcaagc tagactcaat 2940 tatcttgctc tacagacgga tgttctacag cggaaccagc aattgcttgc tgagtctttt 3000 aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc tattagtcaa 3060 acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga ggttgttaat 3120 tcgcagggtg cagctttgac ccaacttacc gtacagctgc aacacaactt ccaagccatt 3180 tctagttcta ttgatgacat ttactcccga ctggacattc tttcagccga tgttcaggtt 3240 gaccgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca aaccctcact 3300 aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa tgagtgcgtt 3360 aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat tttctctctg 3420 gtacaggcag cacctcaggg cctgctgttt ttacatacag tacttgtacc gggtgatttt 3480 gtagatgtta ttgccatcgc tggcttatgc gttaacgatg aaattgcctt gactctacgt 3540 gagcctggct tagtcttgtt tacgcatgaa cttcaaaatc atactgcgac ggaatatttt 3600 gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt tgttcaaatt 3660 gagagttgtg tggtcaccta tgtcaatttg actagagacc aactaccaga tgtaatccca 3720 gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc ctatagaacg 3780 ggtccaagtc ttcctttaga tgtttttaat gccacttatc ttaatctcac tggtgaaatt 3840 gcagatttag agcagcgttc agagtctctc cgtaatacta cagaagagct ccaaagtctt 3900 atatataata tcaacaacac actagttgac cttgagtggc tcaaccgagt tgagacatat 3960 atcaagtggc cgtggtgggt ttggttgatt attttcattg ttctcatctt tgttgtgtca 4020 ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg ctgctgtgct 4080 tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt tgaaaaggtc 4140 cacgtgcagt ga 4152 <210> 28 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 28 acgtaaacaa atgaggtctt taatttattt tttgttgttc gtaccagtac ttccaacact 60 cagcctacca caagatgtct ataggtgctc agctaacact aactttaggc ggttcttttc 120 aaaatttaat gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga 180 aacacaggct gggtcaagac cttggtactg tgctggccga catccaactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgccact gcgcgactgc gtatttgcca gtttcccagc agtaaaacat tgggccccac 420 tgctaatgat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgcgttgcga caaactgtta 600 caacagtgga ggttgtgcta tgcaatatgc ttacgaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta 720 tgccgccaat gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca 840 acctttgttg gtcaactgtc tttgggccat tcctaagatt tacggactag gccacttttt 900 ctcatttaat caaacgatgg atggcgtttg taacggagct actgcgtatc gtgccccaga 960 ggctctgagg tttaatatta atgacacttc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcacaa 1080 agccatcttc tccatacctc tgggtgctac ccaagtaccc tactattgct ttcttaaagt 1140 tgatacttac aactccactg tctataaatt tcttgctgtt ttacctccta ctgtcaggga 1200 aattgtcatc accaagtacg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaacttcac tggccatggc actaacgatg acgtctcagg 1320 tttctggacc atagcatcga ctaattttat tgatgcactc atcgaggttc aagcaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggtttc 1440 ttttgacctt gatgatggtt tttaccctat ttcttctaga aaccttctta gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt 1560 atctgcggct tttggtgatt ctggtggtgc caacctcgtt gcatctgaca ctactatcaa 1620 tgggttcagt tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt 1680 tacaaacagt tatggttatg tgtctaaatc acaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg 1800 tgcttgtacc atagatcttt ttggttaccc tgctttcggt agtggtgtta agtttacgtc 1860 cctctatttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttcaagg 1920 tgtcacggac gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtattatta cccttacaaa ttctagcttt ttggcaggtg tttattatac 2040 atctgattct ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacaa tactagggag ttgcccggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtctg 2280 taaatctggt agtattggct atgtcccact tcaggatggc caagtcaaaa ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagaa cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgctaca tatgtttgta atggtaactc 2460 tcgttgtaaa caattgctta cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 agaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggccttacag ttagctacca tcagttcgtt taatggtgat gggtataact ttactaatgt 2640 gttgggtgtt tctgtgtacg attctcaaag tggcagggtg atacacgaaa ggtcttttat 2700 tgaagacctg ctttttaata aggtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc tgatctagtc tgtgcgcagt attactctgg 2820 tatcatggta ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctag gaggttttac tgccgcagtg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttttacagc ggaaccagca 3000 actgcttgct gagtctttta actctgctat tggtaatata acctcagcct ttgcgagtgt 3060 taaagaggct atcagtcaaa cttctcaagg tttgaatact gtggctcatg cgcttactaa 3120 agttcaagag gttgttaatt cgcagggttc agctttgact caacttacca tacagctgca 3180 acataacttc caagccattt ctagttctat tgatgacatt tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctcttg tacaggccgc accccagggc ctgctgttct tacacacagt 3480 acttgtaccg ggtgattttg taaatgttat tgccatcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaactta 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattc agagttgtgt ggtcacctat gtcaatctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc 3780 ttctctgccc aatagaactg gtccaaatct tcctctagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac 3900 agaagagctc cgaagtctta tatacaatat caacaacaca cttgttgacc ttgagtggct 3960 caaccgagtt gagacttata tcaagtggcc gtggtgggtt tggttgatta tttttattgt 4020 tctcatcttt gttgtgtcat tattagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggttgt tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 29 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 29 acgtaaacaa atgaggtctt taatttattt tttgttgttc gtaccagtac ttccaacact 60 cagtctacca caagatgtcc ataggtgctc agctaacact aattttaggc ggttcttttc 120 aaaatttaat gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga 180 aaaccagggt gtgaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgctact gcgcgactgc gcatttgcca gtttcccagc agtaaaacat tgggccccac 420 tgctaatgat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca tcccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgttttttc 540 tgacaagatc tatcattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacgaaccc acttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttcgta tcaaccctgt acagttaatt gcattggtta 720 tgctgccaat gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttggtgcat ggtaaggtgg tttccaacca 840 acctttgttg gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt 900 ctccttcaat caaacgatcg atggtgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct cagttgtact 1020 tcatactgct ttaggaacaa atttttcttt tgtttgcagt aattcctcaa atcctcattt 1080 agccaccttt gccatacttc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggatacttac aattccactg tttataaatt cttggctgtt ttacctccta ctgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcaatggg tttggttatt tgcatctcgg 1260 tttgttggac gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttcagg 1320 tttctggacc atagcatcga ctaattttgt tgatgctctc atcgaagttc aaggaaccgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat atcttctaga aacctcctga gtcatgaaca 1500 gccaacttct tttgttactt cgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtct tttggtggtc atagtggtgc caacctcgtt gcatctgaca ctactatcaa 1620 tggattcagt tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt 1680 tacaaacagt tatggttatg tgtctaattc acaggacagt aattgccctt ttaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tctaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgatttcggt agtggtgtta agtttacgtc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgtcacggac gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattatac 2040 atctgattct ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc atatgttgat gacgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacaa tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgtcccatc tcagtctggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc 2460 tcgttgcaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta cttctgaaga 2580 ggctctacag ttagctacca tcagttcgtt taatggtgat ggatataatt ttactaatgt 2640 gctgggtgtt tccgtgtatg attctgcaag tggcagggtg gtacacaaaa ggtctttcat 2700 tgaagacctg ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggcc gctctgtggc tgatctagtc tgtgcgcagt attactctgg 2820 tgtcatggta ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggtgctag gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct ttgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaacact gtggctcatg cgcttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgacc caacttaccg tacagctgca 3180 acacaacttt caagccattt ctagttctat tgatgacatt tattcccgac ttgacattct 3240 ttcagccgat gttcaggttg accgtctcat cactggcaga ttatcagcac ttaacgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcagtc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgaacacatt ttttccctgg tacaggccgc acctcagggc ctgctgttct tacacgcagt 3480 acttgtaccg ggtgattttg taaatgttat tgctatcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcctgttt acgcatgaac ttcaaactca 3600 tacggcgaca gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaatctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttggc 3780 ttctctgccc aatagaactg gtccaagtct tcccctagat gtttttaatg ctacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc aaaatatcac 3900 agaagagctc cgaagtctca tatataacat caacaacaca cttgttgacc ttgagtggct 3960 caaccgcgtt gagacatata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tttcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 30 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 30 acgtaaacaa atgaggtctt taacctattt ctggttgttc ttaccagtac ttccaatact 60 cagcctacca caagatgtct ataggtgctc agctaacact aactttaggc ggttcttttc 120 aaaatttaat gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga 180 aacacaggcc gggtcaagac cttggtactg tgctggccga catccaactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgccact gcgcgactgc gtatttgcca gtttcccagc agtaaaacat tgggccccac 420 tgctaatgat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgcgttgcga caaactgtta 600 caacagtgga ggttgtgcta tgcaatatgc ttacgaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta 720 tgccgccaat gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca 840 acctttgttg gtcaactgtc tttgggccat tcctaagatt tacggactag gccacttttt 900 ctcatttaat caaacgatgg atggcgtttg taacggagct actgcgtatc gtgccccaga 960 ggctctgagg tttaatatta atgacacttc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcacaa 1080 agccatcttc tccatacctc tgggtgctac ccaagtaccc tactattgct ttcttaaagt 1140 tgatacttac aactccactg tctataaatt tcttgctgtt ttacctccta ctgtcaggga 1200 aattgtcatc accaagtacg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcgcaa ttaacttcac tggccatggc actaacgatg acgtctcagg 1320 tttctggacc atagcatcga ctaattttat tgatgcactc atcgaggttc aagcaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggtttc 1440 ttttgacctt gatgatggtt tttaccctat ttcttctaga aaccttctta gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt 1560 atctgcggct tttggtgatt ctggtggtgc caacctcgtt gcatctgaca ctactatcaa 1620 tgggttcagt tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt 1680 tacaaacagt tatggttatg tgtctaaatc acaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg 1800 tgcttgtacc atagatcttt ttggttaccc tgctttcggt agtggtgtta agtttacgtc 1860 cctctatttt caattcacaa agggtgagct gattactggc acgcctaaac cacttcaagg 1920 tgtcacggac gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtattatta cccttacaaa ttctagcttt ttggcaggtg tttattatac 2040 atctgattct ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacaa tactagggag ttgcccggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtctg 2280 taaatctggt agtattggct atgtcccact tcagtatggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagaa cagaatatct 2400 acagctttac aacacgcctg ttagtgttga ttgtgctaca tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagctacca tcagttcgtt taatggtggt ggatataatt ttactaatgt 2640 gctgggtgtt tccgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtctattat 2700 tgaagacctg ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggcc gctctgtggc agatctagtc tgtgcgcagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 cgtcggtggt atggtgctag gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaatcagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacta tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgacatt tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcaatc acagcgttat ggtttttgtg gtggtgatgg 3420 tgaacacatt ttttctctgg tacaggccgc acctcagggc ctgctgtttt tacacacagt 3480 acttgtaccg ggtgattttg taaatgttat tgctatcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaactca 3600 tactgcgatg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gttaatttga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttggc 3780 ttctctgccc aatagaactg gtccaagtct tccattagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgtgca gagtctctcc gtaataccac 3900 agaagagctc cgaagtctta tatataacat caacaacaca cgtgtagacc ttgagtggct 3960 caaccgtgtt gagacatata tcaagtggcc gtggtgggtt tggttggtta tttttattgt 4020 tctcatcttt gttgtgtcat tattagtgtt ctgctgcatt tccactggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 31 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 31 acgtaaacaa atgaggtctt taacctactt ctggttgttc ttaccagtac tttcaacact 60 cagcctacca caagatgtcg ccaggtgctc agctaacact aattttaggc ggttcttttc 120 aaaatttaat gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga 180 aaaccacggt gtcaattcaa cttggcactg tgctggccaa catccaactg ctagtggcgt 240 tcatggtatt tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagcg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgctact gcgcgactgc gcatttgcca gtttcccagc attaaaacat tgggccccac 420 tgctaataat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca tcccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc 540 tgacaagatc tattattttc attttaaaaa tgattggtcc cgtgttgcga caaagtgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacgaaccc acttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtattcctta ccaaccctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgttgcat ggtaagatgg tttccaacca 840 accattgttg gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt 900 ctcattcaat caaacgatgg atggcgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccatacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt cttggctgtt ttacctccta tcgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcgatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tatggttatg tgtctaactc gcaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgattttggt agtggtgtta agctcacatc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgttacggac gtttcttttt tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtatcatta cccttacaaa ttctagcttt ttggcaggtt tttattatac 2040 atctgattct ggacagttgt tagcttttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttccg agcaggctgc atatgttgat gatgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacag tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgtcccatc tcagtctggc caagccaaga ctgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagccacca tcagttcgtt taatggtgat ggatataact ttactaatgt 2640 gctgggtatt tccgtgtacg agcctgcaag tggcagggtg gtacacaaaa ggtcttttat 2700 tgaagacctg ctttttaaca aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc agatctagtc tgtgcacagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctag gaggttttac cgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attactcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacca tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgatatc tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaggc tagcgcagca 3360 aaaggttaat gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctctgg tacaggccgc acctcagggc ctgctgtttt tacacacagt 3480 acttgtaccg ggtgattttg taaatgttac tgccatcgct ggcttatgcg ttaatgatga 3540 tattgccttg actctgcgtg agcctggctt agtcttgttt acacatgaac ttcaaactca 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaacctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acgcttgatg agattttagc 3780 ctctctgccc aatagaactg atccaagttt tccactaggt gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gcaataccac 3900 agaagagctc cgaagtctca tatataatat caacaacaca ctagttgacc ttgagtggct 3960 caaccgagtt gagacgtata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tttcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 32 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 32 acgtaaacaa atgaggtctt taacctattt ctggttgttc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ataggtgctc agctgtgact aactttaggc agttcttttc 120 aaaatttaat gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga 180 aaaacaggtt gatgcaccac gttggtactg tgctggccga tatgatactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacca acggtaacac 360 taattctact gcgcgtctgc gtatttgcca gtttcccagc aataaaacat tgggccccac 420 tgctaatgat gatgtcacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgtgttgcgt caaaatgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacaaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaactctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgaacccaa tggccacata ccagaaagtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgctccat ggtaaagtgg tttccaacca 840 acctttgttg gtcaattgtc tttgggccat tcctaagatt tatggactag gccaattttt 900 ctcattcaat caaacgatgg atggcgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccatacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt cttggctgtt ttacctccta tcgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcgatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tatggttatg tgtctaactc gcaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgattttggt ggtgctgtta agttcacatc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgttacggac gtttctttta tgactctgta tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtgtcatta cccccacaaa ttctagcttt ttggcaggta tttattatac 2040 atctgattcc ggacagttgt tagcctttaa gaatgttact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttccagtttg tctaactcca cttttaacaa tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgttccatc tcagtctggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaaa tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagccacca tcagttcgtt taatggtgat ggctataact ttactaatgt 2640 gctgggtgtt tccgtgtacg agcctgcaag tggcagggtg gtacacaaaa ggtcttttat 2700 tgaagacctg ctttttaaca aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc agatctagtc tgtgcacagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctgg gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacca tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgatatc tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatacaga ggttcaggct agcaggaggc tagcgcagca 3360 aaaggttaat gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctctgg tacaggccgc acctcagggc ctgctgttct tacacacagt 3480 acttgtaccg ggtgattttg taaatgttac tgccatcgct ggcttatgcg ttaatgatga 3540 tattgccttg actctgcgtg agcctggctt agtcttgttt acacatgaac ttcaaactca 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaacctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc 3780 ctctctgccc aatagaactg atctaagttt tccactagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gcaataccac 3900 agaagagctc cgaagtctca tatataatat caacaacaca ctagttgacc ttgagtggct 3960 caaccgagtt gagacgtata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tctcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 33 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 33 acgtaaacaa atgaggtctt taacctattt ctggttgttc ttaccagtac ttccaatact 60 cagcctacca caagatgtca ataggtgctc agctgtgact aactttaggc agttcttttc 120 aaaatttaat gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga 180 aaaacaggtt gatgcaccaa gttggtactg tgctggccga tatgatactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacca acggtaacac 360 taattctact gcgcgcctgc gtatttgcca gtttcccagc aacaaaacat tgggccccac 420 tgctaatgat gatgtcacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctta 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgtgttgcgt caaaatgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacaaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaactctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgagcccaa tggccacata ccagaaagtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca 840 acctttgttg gtcaattgtc tttgggccat tcctaagatt tacggactag gccacttttt 900 ctcttttaat caaacgatgg atggcgtttg taacggagct actgcttatc gtgccccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccttacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt tttggctgtt ttacctccta ccgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aacctcctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc ataatggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tacggttatg tgtctaactc gcaggatagc aattgccctt tcaccttgcg 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg 1800 tgcttgtacc atagatcttt ttggtcaccc tgcttttggt agtagtgtta agtttacgtc 1860 cctctatttt caattcacaa agggtgattt gattactggc acgcctaaat cacttgaagg 1920 tgtcacggac gtttctttta tgactatgga tgtgtgtact aagtatacta tctatggctt 1980 taaaggtgag ggtattatta cccttacaaa ttctagcttt ttggcaggta tttattatac 2040 atctgattcc ggacagttgt tagcctttaa gaatgttact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttccagtttg tctaactcca cttttaacaa tactagggag ttgcccggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggcc atgtcccttc tcagtctggc ccagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc 2460 tcgttgcaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagctacca tcagttcgtt taatggtgat ggatataatt ttactaatgt 2640 gctgggtgtt tccgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtctttcat 2700 tgaagacctg ctttttaata aagtggttac taatggtctt ggtactgttg atgaagacta 2760 caagcgctgt tctaatggcc gctctgtggc tgatctagtc tgtgcgcagt attactctgg 2820 tgtcatggta ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggtgctag gaggttttac tgctgcagcg gcactgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 actgcttgct gagcctttta actctgctat tggtaatata acttcagcct ttgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaacact gtggctcatg cgcttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgact caacttaccg tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgacatt tattcccgac ttgacattct 3240 ttcagccgat gttcaggttg accgtctcat cactggcaga ttatcagcac ttaacgcttt 3300 tgttgctcaa actctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcagtc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgaacacatt ttttccctgg tacaggccgc acctcagggc ctgctgttct tacacacagt 3480 acttgtaccg ggtgattttg taaatgttat tgctgtcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcctgttt acgcatgaac ttcaaactca 3600 tacggcggca gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaatctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttggc 3780 ctctctgccc aatagaactg gtccaagtct tccactagat gtttttaatg ctacttatct 3840 taatctcact ggtgaaattg cagatttaca gcagcgttca gagtctcttc aaaatatcat 3900 agaagagctc cgaagtttca tttatagcat caacaacaca cgtgttgacc ttgagtggct 3960 caaccgcgtt gagacatata tcaagtggcc gtggtgggtt tggttgattc tttttattgt 4020 tctcatcttt gttgtgtcat tactagtgtt ctgctgcatt tctacgggtt gctgtggatg 4080 ctgcggttgc tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 34 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 34 acgtaaacaa atgaggtctt taacttactt ctggttgtta ttaccagtac ttccaatact 60 cagcctacca caagatgtca ataggtgctc agctgtgact aactttaggc agttcttttc 120 aaaatttaat gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga 180 aaaacaggtt gatgcaccac gttggtactg tgctggccga tatgatactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacca acggtaacac 360 taattctact gcgcgtctgc gtatttgcca gtttcccagc aataaaacat tgggccccac 420 tgctaatgat gatgtcacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgtgttgcgt caaaatgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacaaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaactctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgagcccaa tggccacata ccagaaagtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgctccat ggtaaagtgg tttccaacca 840 acctttgttg gtcaattgtc tttgggccat tcctaagatt tatggactag gccaattttt 900 ctcattcaat caaacgatgg atggcgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccatacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt cttggctgtt ttacctccta tcgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgaagcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tatggttata tgtctaactc gcaagatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgattttggt ggtgctgtta agttcacatc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgttacggac gtttctttta tgactctgta tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtgtcatta cccccacaaa ttctagcttt ttggcaggta tttattatac 2040 atctgattcc ggacagttgt tagcctttaa gaatgttact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttccagtttg tctaactcca cttttaacaa tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgttccatc tcagtctggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaaa tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagccacca tcagttcgtt taatggtgat ggctataact ttactaatgt 2640 gctgggtgtt tccgtgtacg agcctgcaag tggcagggtg gtacacaaaa ggtcttttat 2700 tgaagacctg ctttttaaca aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc agatctagtc tgtgcacagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctgg gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacca tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgatatc tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatacaga ggttcaggct agcaggaggc tagcgcagca 3360 aaaggttaat gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctctgg tacaggccgc acctcagggc ctgctgttct tacacacagt 3480 actcgtaccg ggtgattttg taaatgttac tgccatcgct ggcttatgcg ttaatgatga 3540 tattgccttg actctgcgtg agcctggctt agtcttgttt acacatgaac ttcaaactca 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaacctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc 3780 ctctctgccc aatagaactg atctaagttt tccactagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gcaataccac 3900 agaagagctc cgaagtctca tatataatat caacaacaca ctagttgacc ttgagtggct 3960 caaccgagtt gagacgtata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tctcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 35 <211> 4207 <212> DNA <213> porcine epidemic diarrhea virus <400> 35 tttgtggctt ttctaatcat ttggtcaacg taaacaaatg aagtctttaa cttacttctg 60 gttgttctta ccagtatttt caacactcag cctaccacaa gatgtcacta ggtgccagtc 120 cactattaac ttcaggcggt tcttttcaaa atttaatgtg caagcacctg ctgtcgttgt 180 tttgggtggt tatctaccta gtatgaactc ttctagctgg tactgtggca caggccttga 240 aactgctagt ggcgttcatg gtatttttct tagttacatc gattctggtc agggctttga 300 gattggcatt tcgcaagagc cgtttgatcc tagtggttac cagctttatt tacataaggc 360 caccaatggt aacactaatg ctattgcacg actgcgtatt tgccagtttc caaataataa 420 aacattgggc cccgctgtta atgatgttac aacaggtcgt aactgcctat tcaacaaagc 480 tattccagct catatgcagg atgggaaaaa tattgttgtc ggcataacat gggacaatga 540 tcgtgtcact gtttttgctg acaagatcta tcatttttat cttaaaaatg attggtcccg 600 cgttgcgaca agatgttaca ataaaaggag ttgtgctatg caatatgttt atacacccac 660 ctactacatg cttaatgtta ctagtgcagg tgaggatggc atttattatg aaccctgtac 720 agctaattgc agtggttacg ctgccaatgt atttgccact gattctaatg gccatatacc 780 agaaggtctt agttttaata attggtttct tttgtccaat gattccactt tgttgcatgg 840 taaggtggtt tccaaccaac ccttgttggt caattgtctt ttggccattc ctaagattta 900 tggactaggc caatttttct cattcaatca aacgatgtat ggcgtttgta atggagctgc 960 tgcgcagcgt gcaccagagg ctctgaggtt taatattaat gacacctctg tcattcttgc 1020 tgaaggctca attgtacttc atactgcttt aggaacaaat ctttcttttg tttgcagtaa 1080 ttcctcagat cctcatttag ccaccttcgc catacctctg ggtgctaccc aagtacccta 1140 ttattgtttt cttaaagtgg atacttacaa ctccactgtt tataaattct tggctgtttt 1200 acctcctacc gtcagggaaa ttgtcatcac caagtatggt gatgtttatg tcaatgggtt 1260 tggctacttg catctcggtt tgttggatgc tgtcacaatt aatttcactg gtcatggcac 1320 tgacgatgac gtttcaggtt tttggaccat agcatcgact aattttgttg atgcactcat 1380 cgaagttcaa ggaactgcca ttcagcgtat tctttattgt gatgatcctg ttagccaact 1440 caagtgttct caggttgctt ttgaccttga cgatggtttt taccctattt cttctagaaa 1500 ccttctgagt catgaacagc caatttcttt tgttactttg ccatcgttta atgatcattc 1560 ttttgttaac attactgtct ctgcgtcctt tggtggtcat agtggtgcca acctcattgc 1620 atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac aatttaccat 1680 ttcactgttt tataacgtta caaacagtta tggttatgtg tccaaatcac aggatagtaa 1740 ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat tttgtgtttc 1800 taccagcctt ttggctagtg cctgtaccat agatcttttt ggttaccctg agttcggtag 1860 tggtgttaag tttacgtccc tttactttca attcacaaag ggtgagttga ttactggcac 1920 gcctaaacca ctcgaaggtg tcacggacgt ttcttttatg actctggatg tgtgtaccaa 1980 gtatactatc tatggcttta aaggtgaggg tatcattacc cttacaaatt ctagcttttt 2040 ggcaggtgtt tattatacat ctgattctgg acagttgtta gcctttaaga atgtcactag 2100 tggtgctgtt tattctgtta cgccatgttc tttttcagag caggctgcat atgttgatga 2160 tgatatagtg ggtgttattt ctagtttgtc tagctccact tttaacagta ctagggagtt 2220 gcctggtttc ttctaccatt ctaatgatgg ctctaattgt acagagcctg tgttggtgta 2280 tagtaacata ggtgtttgta aatctggcag tattggctat gtcccatctc agtctggcca 2340 agtcaagatt gcacccacgg ttactgggaa tatcagtatt cccaccaact ttagtatgag 2400 tattaggaca gaatatttac agctttacaa cacgcctgtt agtgttgatt gtgccacata 2460 tgtttgtaat ggtaactctc gttgtaaaca actacttacc cagtacactg cagcatgtaa 2520 gaccatagag tcagcattac aactcagcgc taggcttgag tctgttgaag tcaactctat 2580 gcttactatt tctgaagagg ctctacagtt agctaccgtc agttcgttta atggtgatgg 2640 atataacttt actaatgtgc tgggcgtttc cgtgtacgat cctgcaagtg acagggtggt 2700 acaaaaaagg tcttttattg aagacctgct ttttaacaaa gtggttacta atggccttgg 2760 tactgttgat gaagactata agcgctgttc taatggtcgc cctgtggcag atctagtctg 2820 tgcgcagtat tactctggtg tcatggtact acctggtgtt gttgacgctg agaagcttca 2880 catgtatagt gcgtctctca tcggtggtat ggtgctagga ggttttactg ctgcagcggc 2940 attgcctttt agctatgctg ttcaagcgag actcaatgaa attgctctac agacggatgt 3000 tctacagcgg aaccagcaat tgcttgctga gtcttttaac tctgctattg gtaatataac 3060 ttcagccttt gagagtgtta aagaggctat tagtcatact tccaagggtt tgaacactgt 3120 ggcacatgcg cttactaagg ttcaagaggt tgttaattcg cagggtgcag ctttgaccca 3180 acttaccgta cagctgcaac acaacttcca agccatttct agttctattg atgacattta 3240 ctcccgactg gacagtcttt cagctgatgt tcaggttggc cgtctcatca ccggcagatt 3300 atcagtactt aatgcttttg ttgctcaaac ccttactaag tatactgagg ttcaggctag 3360 caggaaacta gcacagcaaa aggttaatga gcgtgttaaa tcgcaatctc agcgttatgg 3420 tttttgtggt ggtgatggcg agcacatttt ctctctggta caggcagcac ctcagggctt 3480 gctgttttta cacacagtac ttgtaccggg tgattttgta gatgttattg ccatcgctgg 3540 cttatgcgtt aacgatgaaa ttgccttgac tctacgtgag cctggcttag tcttgtttac 3600 gcatgaactt caaaattata ctgcgacgga atattttgtt tcatcgcgac gtatgtttga 3660 acctagaaaa cctaccgtta gtgattttgt tcaaattgag agttgtgtgg tcacctatgt 3720 caatttgact agagaccaac taccagatgt aatcccagat tacatcgatg ttaacaaaac 3780 acttgatgag atattagctt ctctgcccaa tagaactggt ccaagtcttc ctctagatgc 3840 ttttaatgcc acttatctta atctcactgg tgaaattgca gatttagagc agcgttcaga 3900 gtctctccgt aatactctag aagagctcca aagtcttata tataatatca acaacacact 3960 tgtcgacctt gagtggctca accgagttga gacatatatc aagtggccgt ggtgggtttg 4020 gttgattatt ttcattgttc tcatctctgt tgtgtcatta ctagtgttct gctgcatttc 4080 cacgggttgc tgtggatgct gcggttgctg cggtgcttgt ttttcaggtt gttgtagggg 4140 tcctagactt caaccttacg aagcttttga aaaggtccac gtgcagtgat gtttcttgga 4200 ctttttc 4207 <210> 36 <211> 4161 <212> DNA <213> porcine epidemic diarrhea virus <400> 36 atgaggtctt taatttactt ttggttgtcc ttaccagtac ttccaacact cagcctacca 60 caagatgtct ataggtgctc agctaggact aactttaggc ggttcttttc aaagtttaat 120 gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga aacacagggt 180 ggggcaccac gttggtactg tgctggccga catgaaactg ctagtggcgt tcatggtatc 240 tttcttagcc atattagagg tggtcacggc tttgagattg gcatttcgca agagccgtta 300 gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac taatgctact 360 gcgcgactgc gtatttgcca gtttcccagc aataaaacat tgggccccac tgctaatgat 420 gatgttacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca tatgagtgaa 480 catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc tgacaagatc 540 tatcattttt atcttaaaaa tgagtggtcc cgtgttgcga caaaatgtta caacagtgga 600 ggttgtgcta tgcaatatgt ttacgaacct atttactaca tgcttaatgt tactagtgct 660 ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720 gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780 cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca acctttgttg 840 gtcaactgtc tttgggccat tcctaagatt tacggactag gccacttttt ctcattcaac 900 caaacgatgg atggcgtttg taacggagct actgcgtatc gtgccccaga ggctctgagg 960 tttaatatta atgacacttc tgtcattctt gccgaaggct caattgtact tcatactgct 1020 ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcacaa agccatcttt 1080 tccatacctc tgggtgctac ccaagtaccc tactattgct ttcttaaagt tgatacttac 1140 aactccactg tctataaatt tcttgctgtt ttacctccta ctgtcaggga aattgtcatc 1200 accaagtacg gtgatgttta tgtcaatggg tttggctact tgcatctcgg tttgttggat 1260 gctgtcacaa ttaacttcac tggccatggc actaacgatg acgtctcagg tttctggacc 1320 atagcatcga ctaattttat tgatgcactc gtcgaggttc gagcaactgc cattcagcgt 1380 attctttatt gtgatgatcc tgtttgccaa ctcaagtgtt ctcaggtttc ttttgacctt 1440 gatgatggtt tttaccctat ttcttctaga aaccttctta gtcatgaaca gccaatttct 1500 tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt gtctgcggct 1560 tttggtgatt ctggtggtgc caacctcgtt gcatctgaca ctactatcaa tgggttcagt 1620 tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt tacaagcagt 1680 tatggttatg tgtctaaatc acaggatagc aattgccctt tcaccttgca atctgttaat 1740 gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg tgcttgtacc 1800 atagatcttt ttggttaccc tgctttcggt agtggtgtta agtttacgtc cctctatttt 1860 caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg tgtcacggac 1920 gtttctttta tgactctgga tgtgtgtacc aagtatacta tttatggctt taaaggtgag 1980 ggtattatta cccttacaaa ttctagcttt ttggcaggtg tttattatac atctgattct 2040 ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100 tctttttcag agcaggctgc ttatgtagat gatgatatag tgggtggtat ttctagtttg 2160 tctaactcca cttttaacaa tnntagggat tttcccggtt tcttctacca ttctaatgac 2220 ggctccaatt gcacagagcc tgtgttggtg tatagtaaca taggtgtctg taaatctggt 2280 agtattggct atgtcccact tcaggatggc caagtcaaga ttgcacccac ggttattggg 2340 aatattagta ttcccaccaa ctttagtatg agtattagaa cagaatattt acagctttac 2400 aacacgcctg ttagtgttga ttgtgctaca tatgtttgta atggtaactc tcgttgtaaa 2460 caattactta cccagtacac tgcagcatgt aagaccatag agtcagcatt agaactcagc 2520 gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga ggccttacag 2580 ttagctacca tcagttcgtt taatggtgat gggtataact ttactaatgt gttgggtgtt 2640 tctgtgtacg attctgaaag tggcagggtg gtacacgaaa ggtcttttat tgaagacctg 2700 ctttttaata aggnggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760 tctaatggtc gctctgtggc tgatctagtc tgtgcgcagt attactctgg tatcatggta 2820 ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct catcggtggt 2880 atggcgctag gaggttttac tgccgcagtg gcattgcctt ttagctatgc tgttcaagcg 2940 agactcaatt atcttgcttt acagacggat gttctacagc ggaaccagca actgcttgct 3000 gagtctttta actctgctat tggtagtata acctcagcct ttgagagtgt taatgaggct 3060 atcagtcaaa cttctaaggg tttgaatact gtggctcatg cgcttactaa agttcaagag 3120 gttgttaatt cgcagggttc agctttgact caacttacca tacagctgca acataacttc 3180 caagccattt ctagttctat tgatgacatt tactcccgac tggacattct ttcagccgat 3240 gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300 accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca aaaggttaat 3360 gagtgcgtca aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatt 3420 ttctctcttg tacaggccgc accccagggc ctgctgttct tacacacagt acttgtaccg 3480 ggtgattttg taaatgttat tgccatcgca ggcttgtgcg ttaatggtga tattgccttg 3540 actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaactca tactgcgacg 3600 gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt tagtgatttt 3660 gttcaaattc agagttgtgt ggtcacctat gtcaatctga ctagcgacca actaccagat 3720 gtaatcccag attacgtcga tgttaacaaa acacttgatg agattttagc ttctctgccc 3780 aatagaactg gtccaaatct tcctctagat gtttttaatg ccacttatct taatctcact 3840 ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac agaagagctc 3900 cgaagtctta tatataatat caacaacaca cttgttgacc ttgagtggct caaccgagtt 3960 gagacttata tcaagtggcc gtggtgggtt tggttgattg tttttattgt tctcatcttt 4020 gttgtgtcat tattagtgtt ctgctgcatt tccacgggtt gttgtggatg ctgcggttgc 4080 tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta cgaagctttt 4140 gaaaaggtcc acgtgcagtg a 4161 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 37 ccattcagcg tattctttat tgtgatga 28 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 38 tatctgcagt gaacccccac ctccttaaaa tttacgtttc 40 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 39 atagagctct gtaggataaa tcgt 24 <210> 40 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 40 tatctgcagt gaacccccac ctccttagta gtgtt 35 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 41 ctgcagacgt atccaaggag 20 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 42 ccatggggat ccttagggtt taagt 25 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 43 ctgcagacgt atccaaggag 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 44 ccatggggat ccttaagggt taa 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 45 ctgcagacgt atccaaggag 20 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 46 ccatggggat cctcacttag ggt 23 <210> 47 <211> 702 <212> DNA <213> Porcine circovirus <400> 47 atgacgtatc caaggaggcg ttaccgaagg agaagacacc gcccccgcag ccatcttggc 60 cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120 aaaaatggca tcttcaacgc ccgcctctcc cgcaccttcg gatatactgt caaggctacc 180 acagtcagca cgccctcctg ggcggtggac atgctgagat ttaatcttga cgactttgtt 240 cccccgggag gggggaccaa caaaatctct ataccctttg aatactacag aataagaaag 300 gttaaggttg aattctggcc ctgctccccg atcacccagg gtgacagggg agttggatcc 360 agtgctatta ttctagatga caactttgta ataaaggcca cagcccaaac ctatgacccc 420 tatgtaaact actcctcccg ccatacaatc ccccaaccct tctcctacca ctcccgttac 480 ttcacaccca aacctgttct tgattccact attgattact tccaaccaaa taacaaaagg 540 aatcagctgt ggatgagact acaaaccagt agaaatgtgg accacgtagg cctcggcact 600 gcgttcgaaa acagtaaata cgaccaggac tacaatatcc gtgtaaccat gtatgtacaa 660 ttcagagaat ttaatcttaa agacccccca cttaaaccct aa 702 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 48 cccccccatg ccctgaattt ccata 25 <210> 49 <211> 1143 <212> DNA <213> Bacillus subtilis <400> 49 atgagcaaga ggagaatgaa atatcattca aataatgaaa tatcgtatta taactttttg 60 cactcaatga aagataaaat tgttactgta tatcgtggag gtccggaatc taaaaaagga 120 aaattaacag ctgtaaaatc agattatata gctttacaag ctgaaaaaaa aataatttat 180 tatcagttgg agcatgtgaa aagtattact gaggatacca ataatagcac cacaacaatt 240 gagactgagg aaatgctcga tgctgatgat tttcatagct taatcggaca tttaataaac 300 caatcagttc aatttaacca agggggtccg gaatctaaaa aaggaagatt ggtctggctg 360 ggagatgatt acgctgcgtt aaacacaaat gaggatgggg tagtgtattt taatatccat 420 cacatcaaaa gtataagtaa acacgagcct gatttgaaaa tagaagagca gacgccagtt 480 ggagttttgg aagctgatga tttaagcgag gtttttaaga gtctgactca taaatgggtt 540 tcaattaatc gtggaggtcc ggaagccatt gagggtatcc ttgtagataa tgccgacggc 600 cattatacta tagtgaaaaa tcaagaggtg cttcgcatct atccttttca cataaaaagc 660 atcagcttag gtccaaaagg gtcgtacaaa aaagaggatc aaaaaaatga acaaaaccag 720 gaagacaata atgataagga cagcaattcg ttcatttctt caaaatcata tagctcatca 780 aaatcatcta aacgatcact aaaatcttca gatgatcaat catccaaatc tggtcgttcg 840 tcacgttcaa aaagttcttc aaaatcatct aaacgatcac taaaatcttc ggattatcaa 900 tcatccaaat ctggccgttc gtcacgttca aaaagttctt caaaatcatc taaacgatca 960 ttaaaatctt cagattatca atcatcaaaa tcatctaaac gatcaccaag atcttcagat 1020 tatcaatcat caagatcacc aggctattca agttcaataa aaagttcagg aaaacaaaag 1080 gaagattata gctatgaaac gattgtcaga acgatagact atcactggaa acgtaaattt 1140 taa 1143 <210> 50 <211> 201 <212> DNA <213> Bacillus subtilis <400> 50 atgggttatt acaaaaaata caaagaagag tattatacgg tcaaaaaaac gtattataag 60 aagtattacg aatatgataa aaaagattat gactgtgatt acgacaaaaa atatgatgac 120 tatgataaaa aatattatga tcacgataaa aaagactatg attatgttgt agagtataaa 180 aagcataaaa aacactacta a 201 <210> 51 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> conserved sequence(1) of SEQ ID NO.19~36 <400> 51 ccattcagcg tattctttat tgtgatga 28 <210> 52 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> conserved sequence(2) of SEQ ID NO.19~36 <400> 52 cagagcctgt gttggtgtat agtaacatag g 31 <210> 53 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> conserved sequence(3) of SEQ ID NO.19~36 <400> 53 ctgttaatga ttacctgtct tttagcaaat tttgtg 36 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> conserved sequence(4) of SEQ ID NO.19~36 <400> 54 gctttacaac acgcctgtta gtgttgattg 30

Claims (5)

i) spores of Bacillus subtilis;
ii) one or more spore coat proteins selected from CotB, CotC, and CotG present in the spore outer region of the spores;
iii) a fusion portion encoded by SEQ ID NO: 16 consisting of a peptide linked to the spore coat protein;
iv) an immunogenic site of Porcine Epidemic Diarrhea Virus (PEDV) comprising SEQ ID NO: 51, which is a consensus sequence of SEQ ID NOs: 19 to 36 linked to the fusion site;
Including,
The composition further comprises a carrier,
For the whole composition, characterized in that the concentration of spores is 10 ¹² ~ 10 ¹⁴ / ml
A vaccine composition for preventing or treating PEDV.
The method of claim 1,
The carrier is a vaccine composition for preventing or treating PEDV, characterized in that it comprises a PBS buffer.
A method of treating a PEDV infected animal other than a human, comprising administering the composition of claim 1 to a subject.
The method of claim 3, wherein
And said animal is a pig.
The method of claim 3, wherein
The administration is a method for the treatment of PEDV infected animals, characterized in that performed at least one selected from intravenous administration, oral administration, muscle administration, intraperitoneal administration, subcutaneous administration.

Images