KR20190011687A - Immunogenic system and Animal vaccine thereof - Google Patents

Abstract

The present application provides various embodiments and uses of an immunogenic material targeting pathogens of a particular animal disease, an immunogenic system, and an animal vaccine composition comprising the same. In a preferable embodiment, use can be effectively made in a vaccine, a medicinal drug, and a feedstuff for preventing, alleviating, and treating a porcine infectious disease.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an immunogenic system and an animal vaccine,

The present application relates to immunogenic substances, immunogenic systems, and animal vaccine compositions comprising them, which are directed to pathogenic agents of certain diseases of animals.

Animal vaccine-related technologies are used not only for the prevention of livestock diseases but also for pandemic zoonosis such as biological weapons (bruises, anthrax), SARS (Severe Acute Respiratory Syndrome) and AI (avian influenza) It has contributed greatly to the development of countermeasure technologies and is recognized as a strategic industry nationwide.

Rapid development of vaccines is required in order to reduce the damage of a disease when a new disease is identified and the cause is identified and cancellation is impossible. In this case, inactivated vaccines are generally developed and commercialized. If the gene of the disease causative agent is easily mutated, the effect of the existing vaccine is reduced, so the pathogen gene mutation must be continuously monitored.

In the case of PED (Porcine Epidemic Diarrhea) virus, which is a pandemic diarrhea virus disease, which has been emphasized as a homework in domestic pig farms, both live virus, sodom and oral vaccine have been developed and used in Korea. However, It is difficult to eradicate easily because of mutation. In other words, the vaccine using the PEDV pathogen has a problem that the immunological effect is low due to protein denaturation during the attenuation of the pathogen, and the vaccine can not effectively respond to the mutant strain of PEDV. PEDV fluctuations in swine farms around September 2014 are caused by PEDV outdoor influenza in Korea in October 2013, which is a typical case of the problem of PEDV vaccine.

Porcine CircoVirus (PCV) has been found worldwide in the United States, France, Spain, Ireland, Denmark, the United Kingdom and Germany, starting in Canada in 1991. In Asia, . PCV is known to be one of the causative agents of postweaning multi-systemic wasting syndrome (PMWS) caused by infection, and it is a virus that is hard to eradicate when contaminated in pig farms.

The PRRS virus, which is an outdoors mutation, is also one of the most troublesome variant diseases. Newcastle Disease (IB), Infectious Bronchitis (IB), Infectious Bronchitis Disease (IBD) and AI (Avian Influenza) virus, which are problems in the poultry industry, have been developed in Korea as well. As a result, a new subtype of genotype and anti-circularity has been reported. The key to technological development is to reduce the disparity between outdoor disease agents and vaccine antigens

The development of live vaccines is essential to compensate for ineffective vaccine use, but it takes a lot of time and money to acquire a master seed that is capable of live vaccination from pathogenic outdoor viruses.

Thus, existing killed inactivated vaccines and live attenuated vaccines have many problems and limitations in the process of eliminating livestock diseases. In addition, the interactions between countries are rapidly expanding and the border of livestock infectious diseases In a situation where the concept is getting thinner, the competition between technology development in the country is becoming more intense and intellectual ownership for technology preoccupation is strengthened.

Therefore, there is a need to develop a vaccine that minimizes side effects and maximizes efficacy by harmonizing existing conventional vaccine manufacturing methods with advanced molecular biological methods.

1. Korean Patent No. 10-0578395 2. Korean Patent No. 10-0267745 3. Japanese Patent Laid-Open No. 2008-231063 4. WO 2016-140702

1. Microbiol Spectr. 2014 Oct; 2 (5). doi: 10.1128 / microbiolspec.TBS-0011-2012. 2. J Bacteriol. 2001 Nov; 183 (21): 6294-6301. Surface Display of Recombinant Proteins on Bacillus subtilis Spores 3. Vaccine. 2004 Mar 12; 22 (9-10): 1177-87. Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner. 4. Microbiology. 2009 Feb; 155 (Pt 2): 338-46, Phagocytosis, germination and killing of Bacillus subtilis spores presenting heterologous antigens in human macrophages. 5. Sun D et al., Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet Microbiol. 2008; 131 (1-2): 73-81. 6. Gallagher TM, Buchmeier MJ. Coronavirus spike proteins in viral entry and pathogenesis. Virology. 2001; 279 (2): 371-4. 7. Tsuda T. Porcine epidemic diarrhea: its diagnosis and control. Proc Jpn Pig Vet Soc. 1997; 31: 21-8. 8. Georgiou, G. et al., Display of heterologous proteins on the surface of microorganisms: From the screening of combinatorial libraries to live recombinant vaccines. Nature Biotechnology 15: 29-34 (1997)

The object of the present application is to provide a variety of sunscreens and various uses of immunogenic materials, immunogenic systems and animal vaccine compositions comprising them, which are directed against pathogenic agents of particular disease in animals.

One purpose is to provide animal vaccines against disease causing pathogens and methods for their manufacture.

Another goal is to provide an immunogenicity system for disease causing pathogens.

Another goal is to provide an immunogenic spore system.

Another object is to provide a vaccine against PEDV and an immunogenicity system therefor.

In addition, it includes all available uses in connection with immunogenic materials, immunogenic systems and animal vaccine compositions directed against pathogenic agents of a particular disease of an animal.

In order to achieve the above object,

i) spores of spore-forming bacteria,

ii) a spore coat protein present in the outer region of the spore of the spore,

ii) a porcine disease virus immune region fused to the spore coat protein

Including the

Wherein the porcine disease virus is at least one of porcine epidemic diarrhea virus (PEDV) and porcine circovirus (PCV).

In addition,

i) an immunogenic spore fusion display system characterized in that an immunogenic site derived from porcine epidemic diarrhea virus (PEDV) and porcine circovirus (PCV) is fused to spore coat protein,

ii) a carrier for delivering said immunogenic spore fusion display system

Wherein the concentration of the immunogenic spore fusion display system is 10 < ¹² > to 10 < ¹⁴ > cells / ml.

The present application also provides two sets of primers selected from SEQ ID NOS: 1-4 for obtaining immunogenic regions of porcine epidemic diarrhea virus (PEDV) outdoor strains.

The present application also provides two sets of primers selected from SEQ ID NOS: 41-46 for obtaining immunogenic regions of Porcine Circovirus (PCV) outdoor strains.

In addition, the present application relates to a method for producing a spore-

i) a spore coat protein present in the outer region of the spore of the spore, and

ii) an immunogenic portion (s) of any one or more of porcine epidemic diarrhea virus (PEDV) or porcine circovirus (PCV) fused to the spore coat protein

Lt; RTI ID = 0.0 > a < / RTI > spore system recombinant expression vector.

The present application also relates to an immunogenic spore fusion display system characterized in that an immunogenic site derived from porcine epidemic diarrhea virus (PEDV) or Porcine Circovirus (PCV) is fused to spore coat protein. ^The present invention provides a method for treating a PEDV-infected animal other than a human, which comprises administering 2 ml of the vaccine composition containing the compound at a concentration of ¹² to 10 ¹⁴ cells / ml.

To an animal disease inducer (antigen) with enhanced immunogenicity and a method of using the same. Through the compositions and methods described herein, the immunogenic response of an animal, preferably a domestic animal, such as a pig, to an antigen is enhanced, thereby also enhancing animal protection against certain disease infections

The use of the technology of this application is superior in the expression rate and the acquisition rate as compared with the existing expression system. In addition, when the recombinant protein produced from the recombinant cell line is used as an antigen, an immune response can be effectively induced, and it is useful for vaccines, medicines and feeds for prevention, improvement and treatment of diseases of domestic animals (for example, pigs) Can be used to make.

1 is a schematic diagram showing the structure of an agent.
2 is a schematic diagram showing the structure of a 1-antigen protein and a 2-antigen protein on a pathogen.
Figure 3 is a graph showing the location of the immunogenic site of the 1-antigen protein (spike protein) of the PEDV pathogen
Figure 4 is an exemplary graph of antigen homologous proteins comprising immunogenic sites.
Figure 5 is an exemplary graph of antigen homologous proteins comprising two or more selected from immunogenic site-1 to immunogenic site-n.
Figure 6 is an exemplary graph of antigen homologous proteins comprising non-immunogenic sites, including immunogenic sites.
Figure 7 is an exemplary graph of antigen homologous proteins comprising two or more selected from the 1-immunogenic site to the m-immunogenic site.
Figure 8 is an exemplary graph of an antigen homologous protein comprising a site that is homologous to an antigenic protein and a non-antigenic moiety.
FIG. 9 is an exemplary graph of an antigen homologous protein comprising a site and an exon portion that is homologous to the antigen protein.
FIG. 10 is an exemplary graphical representation of the antigen homologous portion of a protein comprising a region that is homologous to the antigen protein and a non-antigenic portion and an exogenous portion.
11 is a schematic diagram showing the structure of an immunogenic inner support system in an immunogenic system.
12 is a schematic diagram showing the structure of an immunogenic fused display system in an immunogenic system.
Figure 13 is a schematic diagram illustrating the structure of an immunogenic coupled display system in an immunogenic system.
Figure 14 is a schematic diagram illustrating the structure of an immunogenic attachment display system in an immunogenic system.
15 is a schematic diagram illustrating the structure of an immunogenic cross-coupled display system in an immunogenic system.
16 is a schematic diagram of a serial connection system that exemplary illustrates an embodiment of a fused display system in a system.
Figure 17 is a schematic diagram of a parallel system exemplary of an embodiment of a fusion display system.
18 is an exemplary schematic diagram of an antigen-homologous protein recombinant expression vector in which the immunogenic expression objective base sequence comprises an immunogenic site.
19 is an exemplary schematic diagram of an antigen-homologous protein recombinant expression vector in which the immunogenic expression objective base sequence comprises two or more base sequences selected from immunogenic site-1 to immunogenic site-n.
20 is an exemplary schematic diagram of an antigen-homologous protein recombinant expression vector in which the immunogenic expression objective base sequence comprises two or more base sequences selected from the 1-immunogenic site to the m-immunogenic site.
21 is an exemplary schematic diagram of a pathogen-like particle recombinant expression vector in which the immunogenicity expression objective base sequence is an immunogenic site, and the antigen-homologous portion including the base sequence of the non-invasive portion is an example of a protein recombinant expression vector.
22 is an exemplary schematic diagram of an accessory immunostimulatory recombinant expression vector in which the immunogenic expression objective base sequence is an immunogenic site, and the antigen-homologous portion including a base sequence of a non-antigenic portion is an example of a protein recombinant expression vector.
23 is an exemplary schematic diagram of a multivalent immunogenic recombinant expression vector in which the immunogenicity expression objective base sequence is an immunogenic site, and the antigen-homologous portion including the foreign base sequence is an example of a protein recombinant expression vector.
24 is an exemplary schematic diagram of a multivalent pathogen-like particle recombinant expression vector in which the immunogenicity expression target base sequence is an immunogenic site, and the antigen-homologous portion including the foreign base sequence is an example of a protein recombinant expression vector.
25 is an exemplary schematic diagram of an immunogenic serial-linkage format expression vector in which the component expression target base sequence comprises the base sequence of the x-th protein and the y-th junction;
a-1: first protein, b-1: first connection, a-2: second protein, b-2: second connection, a- 4: fourth protein, b-4: fourth junction, a-5: fifth protein
FIG. 26 is a schematic diagram of a system recombinant expression vector of an immunogenic serial-linkage system, which exemplifies an embodiment of a fusion display system in the system, wherein the system objective base sequence includes a nucleotide sequence of a surface integrator, a fusion site, Lt; RTI ID = 0.0 > recombinant < / RTI > expression vector.
Figure 27 is a schematic diagram of an immunogenic serial linkage system expressed by the immunogenic serial-linked system recombinant expression vector of Figure 26;
28 shows an example of a single immunogenic parallel system recombinant expression vector in which a system of a plurality of parallel bodies is a system expression target sequence, wherein the first parallel body is an internal carrying system, the second parallel body and the third parallel body are fusion display systems Lt; / RTI > recombinant expression vector.
Figure 29 is a schematic diagram of an immunogenic parallel system expressed by the immunogenic parallel system recombinant expression vector of Figure 28;
30 is an exemplary schematic diagram of an immunogenic spore internal carrier system recombinant expression vector in which the spore system expression target base sequence comprises the base sequence of spore-bearing immunogenic material.
FIG. 31 is an exemplary schematic diagram of an immunogenic spore internal carrier system recombinant expression vector in which the spore system expression target base sequence comprises a base sequence of a substance charged with a spore-bearing immunogenic substance.
32 is an exemplary schematic diagram of an immunogenic spore fusion display system recombinant expression vector in which the spore system expression target base sequence comprises a spore surface construct and a base sequence of a spore fusion immunogenic material.
33 to 37 are examples of Fig. 32. Fig.
33 is an exemplary schematic diagram of an immunogenic spore fusion display system recombinant expression vector in which the spore system expression target base sequence comprises a plurality of spore external homology regions and a base sequence of spore fusion immunogenic material.
Figure 34 shows an example of an immunogenic spore fusion display system recombinant expression vector comprising a spore system expression target base sequence comprising a spore external signal sequence of a tachypse, a spore exogenous homology region, and a base sequence of a spore fusion immunogenic material It is a schematic diagram.
35 shows an example of an immunogenic spore fusion display system recombinant expression vector comprising a spore system expression target base sequence comprising a spore outermost locating motif of a taut protein, a spore outer homology region, and a base sequence of spore fusion immunogenic material It is a schematic diagram.
FIG. 36 shows an immunogenic spore fusion display system comprising a spore system expression target base sequence comprising a spore outer locating motif of a heterosporum outer protein, a spore outer homology region, and a base sequence of a spore fusion immunogenic material. Fig.
37 shows an exemplary schematic diagram of an immunogenic spore fusion display system recombinant expression vector comprising a spore outline, a spore outer homology region, and a base sequence of a spore fusion immunogenic material, wherein the spore system expression base sequence is charged with a specific sign; to be.
38 is an exemplary schematic diagram of an immunogenic spore-attached display system recombinant expression vector in which the spore system expression target base sequence comprises the base sequence of spore-attaching immunogenic material.
39 is an exemplary schematic diagram of an immunogenic spore-attached display system recombinant expression vector in which the spore-system expression base sequence comprises a base sequence of a substance charged with a spore-bearing immunogenic substance.
FIG. 40 is a system diagram showing a procedure for selecting vaccine strains to be master vaccination using a phylogenetic tree by multiple sorting.
FIG. 41 is a fluorescence microscope photograph to determine whether Bacillus transformed when CotG was used in the production of PEDV vaccine.
FIG. 42 is a graph showing the results of flow cytometry experiments to determine whether Bacillus transformed when CotG was used in the production of PEDV vaccine. FIG.
FIG. 43 is an optical microscope photograph of Bacillus taken after Malachite green statining in order to examine whether bacillus was expressed in spores when CotG was used in the production of PEDV vaccine.
44 is a graph showing the results of the Pronase treatment experiment to confirm that GFP was expressed on the spore surface when CotG was used in the production of PEDV vaccine.
45 is a graph showing the results of an immunoreaction confirmation experiment when CotG is used in the production of a PEDV vaccine.
FIG. 46 is a graph showing the results of immunoblotting assay for confirming the generation of an antigen-specific antibody when CotG was used in the production of PEDV vaccine.
FIG. 47 is a fluorescence microscope photograph to determine whether Bacillus transformed when CotB was used in the production of PEDV vaccine.
48 is a graph showing the results of flow cytometry experiments to determine whether Bacillus transformed when CotB was used in the production of PEDV vaccine.
FIG. 49 is an optical microscope photograph of Bacillus taken after performing Malachite green statining in order to determine whether Bacillus was expressed in spores when CotB was used in the production of PEDV vaccine.
50 is a graph showing the results of an immunoreaction confirmation experiment when CotB is used in the production of a PEDV vaccine.
51 is a graph showing the results of an immunoblotting assay test for confirming the generation of an antigen-specific antibody when CotB is used in the production of a PEDV vaccine.
FIG. 52 is a fluorescence microscope photograph showing whether Bacillus transformed when CotC was used in the production of PEDV vaccine. FIG.
53 is a graph showing the results of flow cytometry experiments to determine whether Bacillus transformed when CotC was used in the production of PEDV vaccine.
54 is an optical microscope photograph of Bacillus photographed after Malachite green statining in order to examine whether Bacillus was expressed in spores when CotC was used in the production of PEDV vaccine.
55 is a graph showing the results of an immunoreaction confirmation experiment when CotC is used in the production of a PEDV vaccine.
FIG. 56 is a graph showing the results of immunoblotting assay for confirming the generation of an antigen-specific antibody when CotC is used in the production of PEDV vaccine.
FIG. 57 is a graph showing the results of flow cytometry experiments to determine whether Bacillus transformed when CotG was used in the production of a PCV vaccine. FIG.
FIG. 58 is a graph showing the results of flow cytometry experiments to determine whether Bacillus transformed when CotB was used in the production of PCV vaccine. FIG.
FIG. 59 is a graph showing the results of flow cytometry experiments to determine whether Bacillus transformed when CotC was used in the production of a PCV vaccine. FIG.
FIG. 60 is a graph showing the results of an immunoreaction confirmation experiment when PCV-2A was used in the production of a PCV vaccine. FIG.
61 is a graph showing the results of an immunoreaction confirmation experiment when PCV-2B was used in the production of a PCV vaccine.
62 is a graph showing the results of an immunoreaction confirmation experiment when PCV-m2B was used in the production of PCV vaccine.
63 is a graph showing the results of an immunoblotting assay test for confirming the generation of an antigen-specific antibody when using PCV-2A in the production of a PCV vaccine.
64 is a graph showing the results of an immunoblotting assay test for confirming the production of an antigen-specific antibody when using PCV-2B in the production of PCV vaccine.
65 is a graph showing the results of an immunoblotting assay test for confirming the generation of an antigen-specific antibody when using PCV-m2B in the production of a PCV vaccine.

The present application relates to materials, systems and methods involved in the immune response. In particular, it is involved in the mechanism of the immune response caused by infection by pathogens.

Diseases caused by pathogens have been a major cause of death for living organisms, including humans and animals, in both history and geography.

When a living organism infects a pathogen, an immune process occurs which kills or neutralizes the pathogen. In general, the immune process progresses to cellular immunity and humoral immunity. Cell-mediated immunity is an immunity that cytotoxic T cells kill cells infected individually by pathogens. First, the cells infected with the pathogen start MHC-I protein on the surface of the pathogen, and cytotoxic T cells recognize it and induce apoptosis. Humoral immunity is an immune system that produces antibodies to the antigen and kills the pathogen. First, dendritic cells, macrophages, and B cells that have ingested antigens of pathogens begin to express antigens on the cell surface using MHC-II proteins. Helper T cells recognize and activate the antigen, Cytokines release B cells and cytotoxic T cells. Activated B cells are differentiated into plasma cells and memory B cells and are involved in the production of antibodies. B cells differentiated into plasma cells function to kill the pathogen by generating antibodies against the antigen. B cells differentiated into memory B cells do not produce antibodies but are present in body fluids, and when the pathogen invades again, they differentiate into plasma cells and memory B cells.

The immune response exhibits a unique pattern of primary immunity and secondary immunity when the organism is first infected with a pathogen and when it is secondary infected. When the virus is first infected with a pathogen, a small number of plasma cells are produced because memory B cells are not present. Therefore, a primary immunity with a slowly increasing antibody concentration occurs. However, when the pathogen is infected after the first immunization, the memory B cells formed in the first immunization process are directly differentiated into plasma cells, resulting in a second immunization, that is, a second immunization in which the antibody concentration rapidly increases. Therefore, if the organism undergoes first immunization by the first infection, it will cope with the pathogen more efficiently through the acquired immunity. Vaccines function to induce host immune responses to pathogens by generating these memory B cells without infection of the pathogen.

Significantly lower threats of disease caused by pathogens are coupled with the development of these vaccines.

Existing vaccines can be classified according to which immunogenic material they contain. First, there is a form that uses the pathogen itself. The first vaccine was a diluted solution of a wild-type pathogen in the solution, but the risk of infection was high. To address this, existing vaccines use pathogens with reduced pathogenicity by chemical treatment and genetic modification of pathogens. Second, there is a form that uses only the antigen protein or surface protein of the pathogen. Antigen proteins are less virulent than pathogens. Antigen proteins are either isolated from pathogens or produced by genetic engineering.

The present application relates to immunogenic substances, immunogenic systems, and animal vaccine compositions comprising them, which are directed to pathogenic agents of certain diseases of animals.

Preferably, the present invention relates to a recombinant immunogenic system using only an antigenic protein or surface protein of a pathogen, and a recombinant animal vaccine composition containing the recombinant immunogenic system. But,

One aspect of the present application relates to a vaccine.

By " vaccine " is meant a substance or antigen that forms an acquired immunity against a particular disease in a given organism.

&Quot; Adaptive immune system " means a cellular immune system of the living body, which means immune state present in memory B cells differentiated by specific antigen.

&Quot; Immunogen " means a substance that causes immunity in vivo as a component of a vaccine.

&Quot; Native " refers to a state in which a material is obtained in the natural world without artificial manipulation.

[Immunogen]

One embodiment of the present application is a vaccine comprising an immunogenic agent.

The immunogenic material includes all substances capable of causing an acquired immune response, and may be, for example, a pathogen, an antigen protein, an antigen homologous protein, an antigen homologous additive protein.

1) Pathogen

&Quot; Pathogen " is a term collectively referred to as a disease causing organism, including viruses, bacteria, fungi, and algae.

A " virulence portion " means a site that is virulent as part of a pathogen.

A " maintenance portion " means a portion of a pathogen that participates in metabolism or proliferation.

One example of the present application may be a vaccine comprising the pathogen itself as an immunogenic substance.

The pathogen may disclose one or more antigenic proteins in the outer membrane of the pathogen, and the antigenic proteins may be only one kind, but various kinds of proteins may function as antigen proteins. The pathogen containing such an antigen protein itself can be used as an immunogenic substance of the vaccine.

In one embodiment, the pathogen may be in a wild state.

In other embodiments, the pathogen may be a deletion / modification of a particular site. At this time, the specific site may be a virulent site. Also, a particular site may be a viable site. Also, the specific site may be an immunogenic site within the antigen protein.

In other embodiments, the pathogen may be one whose structure has been modified or engineered. The modification and manipulation can be done naturally or artificially. The overall structure of the pathogen may be 80% to 100% homologous to the wild-type pathogen. Preferably, the homology is 90 to 100%, more preferably 95 to 100%.

In one embodiment, the pathogen may be a virus belonging to the same family.

The same term may be Coronaviridae.

The same may also be the Arteriviridae.

The same may also be the Circoviridae.

The same may also be Paramyxoviridae.

In one embodiment, the pathogen may be a pathogen of a swine-target disease.

At this time, the pathogen of the swine disease can be Porcine Epidemic Diarrhea Virus (PEDV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and Porcine Circovirus (PCV).

In one embodiment, the pathogen may be a pathogen of a poultry-related disease.

At this time, the pathogen of the poultry disease may be Infectious Bronchitis Virus (IBV) or Newcastle Disease Virus (NDV).

Structure of Pathogen

&Quot; Antigen protein " means a protein that is part of a pathogen and causes immunity in vivo.

&Quot; Non-invasive " refers to any part of the structure of the pathogen except the antigen protein.

An " immunogenic portion " refers to a site that specifically causes an immune response in an antigen protein.

A " nonimunogenic portion " refers to a portion of an antigenic protein that excludes an immunogenic portion.

As shown in Fig. 1, the structure of the pathogen can be roughly divided into antigenic proteins and non-antigenic components that cause immunity. In one pathogen, the antigen protein may be more than one species.

Each antigen protein is divided into immunogenic and non-immunogenic regions. In one kind of antigenic protein, the immunogenic site may be one or more species.

The non-antigenic portion refers to the nucleotide sequence / protein compartment of the pathogen, excluding the antigen protein portion in the full length sequence of the pathogen, and includes the capsid protein of the pathogen.

2) antigen protein

The following definitions are used in the following description.

An " x-antigen protein " is an antigenic protein and refers to the xth of the m kinds of antigenic proteins in a particular pathogen.

The " x-immunogenic site-y " is an immunogenic site and is present on the xth antigen protein of the m kinds of antigen proteins in the specific pathogen, and the yth immunity among the n kinds of immunogenicity sites on the xth antigen protein It means the original site.

An " x-non-immunogenic site " refers to a non-immunogenic site present on the x-th antigen protein of the m types of antigenic proteins in a particular pathogen as non-immunogenic sites.

Means that it is any one antigenic protein, immunogenic site or non-immunogenic site, unless otherwise stated with respect to x, y.

One example of the present application may be a vaccine containing the antigenic protein as an immunogenic substance.

In one embodiment, the antigenic protein may be one kind of antigenic protein. Wherein the antigen protein may be in a wild state.

In addition, the antigen protein may be a specific site modified or modified. The modification and manipulation can be done naturally or artificially. Wherein the specific site may be an immunogenic site.

In another embodiment, the antigen protein may be a mixture of two or more selected from 1-antigen protein to m-antigen protein.

In one embodiment of the present application, the antigen protein is an antigenic protein of PEDV.

The antigen protein of PEDV is known as a spike protein. The PEDV spike protein is an I-type glycoprotein consisting of 1,388 amino acids (aa). Spike proteins can be divided into S1 (1-794 aa) and S2 (794-1,388 aa) domains based on their homology with the spike proteins of other coronaviruses. In coronavirus, spike proteins are surface antigens, where they regulate the interaction with host cell receptor glycoproteins to mediate viral entry and serve to stimulate the induction of neutralizing antibodies in the natural host. Thus, spike glycoprotein is the primary target for the development of an effective vaccine against PEDV.

SEQ ID NO: 1 is the protein sequence of the spike protein of CV777 of PEDV, and unless otherwise stated, the sequence of all the antigenic proteins and the location of the immunogenic site is described by reference to CV777 (ncbi Accession No. JN599150.1) One, this is only a guideline, so the application is not limited to CV777 weeks.

For example, the sequence of SEQ ID NO: 17 was used as a partial sequence of the spike 1 protein.

For example, the sequence of SEQ ID NO: 18 was used as a partial sequence of the spike 2 protein.

In the present application, when describing PEDV, a 1-antigen protein refers to a spike protein. In addition, it is known that the M protein and N protein of PEDV can be antigen proteins, and other antigen proteins can be found. In this case, the new antigen protein may be naturally contained as a 3-antigen protein or an x-antigen protein as necessary, but it should not be regarded as an object of the present application.

In another embodiment of the present application, the antigen protein is an antigenic protein of PCV.

The antigen protein may be a capsid protein

The capsid protein of the PCV may include, but is not limited to, ORF1, ORF2, ORF3, ORF4, and the like.

For example, the capsid protein of the PCV may be ORF2.

For example, SEQ ID NO: 47 was used for the sequence of the capsid protein.

The PCV may be classified into genotypes such as PCV2A, PCV2B, PCVm2B, PCV2C and PCV2D, but is not limited thereto.

For example, the PCV of the present application may be any one or more selected from among PCV2A, PCV2B and PCVm2B.

Also, antigenic proteins other than the capsid protein can be found. Such a case is also included as an object of the present application.

Immunogenic site

As shown in Fig. 2, the antigenic protein includes immunogenic regions, which are sites that strongly induce immunity. The immunogenic site may be a specific site of the antigen protein and may vary in size from 6aa to 300aa. In general, immunogenic regions of pathogens can be easily found in theses.

For example, the immunogenic region of PEDV is known as 504-643aa (COE), 753-760 (SS2), 769-776 (SS6), 1373-1379 (2C10) based on the CV777 strain (see Figure 3) .

In one embodiment of the present application, the immunogenic portion of the spike protein of PEDV comprises 504-643 aa (COE, 1-immunogenic portion-1), 753-760 (SS2, 1-immunogenic portion- 2), 769 to 776 (SS6, 1-immunogenic site-3), 1373 to 1379 (2C10, 1-immunogenic site-4).

In addition, if there is a new antigen protein of PEDV, the immunogenic portion of the new antigen protein may be included as an x-immunogenic portion-1 to an x-immunogenic portion -y as needed.

For example, the immunogenic site of PCV may be a fragment of at least one protein selected from ORF1, ORF2, ORF3, and ORF4 and / or a fragment of a polynucleotide.

For example, it may include, but is not limited to, forms of one or more proteins selected from ORF1, ORF2, ORF3 and ORF4 and / or a part of a polynucleotide (truncation, substitution, etc.).

In addition, if there is a new antigenic protein of PCV, the immunogenic region of the new antigen protein may optionally include x-immunogenic site-1 to x-immunogenic site-y.

3) antigen homologous protein

&Quot; Antigen homologous protein " means a protein having homology to the structure of an antigenic protein.

One example of the present application may be a vaccine containing the antigen homologous protein as an immunogenic substance.

In one embodiment, the antigen homologous protein may comprise an immunogenic site.

In another embodiment, the antigen homologous protein may comprise two or more selected from immunogenic site-1 to immunogenic site-n. The sequence of the immunogenic site may be different from the wild-type antigen protein.

In other embodiments, the antigen homologous protein may comprise a non-immunogenic region including an immunogenic site.

Wherein the non-immunogenic portion may be located in front of the N-terminus of the immunogenic portion. The non-immunogenic site may also be located after the C-terminus of the immunogenic site. The non-immunogenic portion may also be located at both the N and C termini of the immunogenic portion. Figure 4 is an example of an antigen homologous protein comprising a 1-non-immunogenic site at both the 1-immunogenic site-1 and the N, C -terminus of the immunogenic site.

In this case, the non-immunogenic site may be a specific base sequence. The specific nucleotide sequence may be 18 bp, 22 bp, 28 bp, 31 bp or 36 bp. Preferably, the specific nucleotide sequence has a size of 18 to 22 bp.

In other embodiments, the antigen homologous protein may comprise at least two selected from the 1-immunogenic site to the m-immunogenic site.

In this case, the antigen-homologous protein may have a non-immunogenic site at both the N and C terminals. The non-immunogenic site may be a specific base sequence. The specific nucleotide sequence may be 18 bp, 22 bp, 28 bp, 31 bp or 36 bp. Preferably, the specific nucleotide sequence has a size of 18 to 22 bp. Figure 5 is an illustration of an antigen homologous protein comprising a 1-non-immunogenic site at both the 1-immunogenic sites-1 and 2 and the N, C-terminus of the 1-immunogenic site-1.

In other embodiments, the antigen homologous protein may comprise one or more selected from the 1-immunogenic site to the m-immunogenic site and the 1-non-immunogenic site to the m-non-immunogenic site .

At this time, non-immunogenic regions may be located at both N and C termini. The non-immunogenic site may be a specific base sequence. The specific nucleotide sequence may be 18 bp, 22 bp, 28 bp, 31 bp or 36 bp. Preferably, the specific nucleotide sequence has a size of 18 to 22 bp. FIG. 6 shows a schematic representation of a 1-non-immunogenic portion at the N-terminus of the 1-immunogenic portion-2 and the 2-immunogenic portion-1 and the 1-immunogenic portion- Is an example of an antigen homologous protein comprising a non-immunogenic region. Figure 7 is an example of an antigen homologous protein comprising a 1-immunogenic portion-1, a 2-immunogenic portion-1 and a 2-immunogenic portion-2 and a 1-non-immunogenic portion and a 2-non-immunogenic portion .

In one embodiment of the present application,

The immunogenic portion may comprise the 1-immunogenic portions -1 to 4 of PEDV.

In addition, the antigen-homologous protein of PEDV may comprise COE.

In addition, the antigen-homologous protein of PEDV may comprise SS2 and COE in that order.

In addition, the antigen-homologous protein of PEDV may comprise SS2 and SS6.

In addition, the antigen-homologous protein of PEDV may comprise the S1 domain of the spike protein.

In addition, the antigen-homologous protein of PEDV may comprise the COE of the spike protein and the immunogenic site of the PEDV M protein.

In yet another embodiment of the present application,

The immunogenic site may comprise a capsid protein of PCV.

For example, the capsid protein of the PCV may be an antigen homologous protein.

For example, the antigen-homologous protein of the PCV may comprise an ORF.

For example, the antigen-homologous protein of the PCV may comprise any one or more of ORF1, ORF2, ORF3 and ORF4.

For example, the antigenic homologous protein of the PCV may comprise an ORF2 of a capsid protein.

4) antigen homologous protein-contained additive body

&Quot; antigen homologous protein contained additive body " means a protein that simultaneously contains a site that is not homologous to the structure of an antigen protein having some homology with the structure of the antigen protein. That is, the antigen-homologous inclusion-added protein refers to a form in which the antigen-homologous protein is additionally contained in a site that is not homologous to the antigenic protein. The term " antigen homologous inclusion addition protein " is used herein interchangeably with the term " antigen homologous addition protein ".

&Quot; Foreign portion " refers to an exogenously introduced protein or base sequence that is not present in the wild-type original pathogen.

One example of the present application may be a vaccine comprising an antigen homologous inclusion-adding protein as an immunogenic substance.

The antigen-containing inclusion proteins include sites that are not homologous to the antigen protein, and sites that are not homologous may be non-antigenic or exogenous to the pathogen.

In one embodiment, the antigen-homologous inclusion-adding protein may comprise a site that is homologous to the antigen protein and a non-antigenic moiety. Figure 8 is an example of an antigen homology inclusion-adding protein comprising 1-immunogenic portions-1 and 2 and 1-non-immunogenic portions, and non-antigenic portion.

The non-antigenic portion may be homologous to the outer membrane protein of the pathogen. In addition, the antigen homologous inclusion-adding protein may function as a pathogen-like particle. The pathogen-like particle may be a virus-like particle.

The non-antigenic portion may also function as an immunosuppressive function. At this time, the immune assistant function may be to suppress the secretion of cytokines that promote the secretion of cytokines related to the immune response or inhibit the immune response in the living body. In addition, the immunocompetent function may be to degrade the membrane of the immune cell.

In one embodiment of the present application, the outer membrane protein of the pathogen may be the E protein of PEDV.

In other embodiments, the antigen-homologous inclusion-adding protein may comprise a site and an exogenous portion that is homologous to the antigen protein. Figure 9 is an example of an antigen homology inclusion additional protein comprising 1-immunogenic locus-1 and 2-immunogenic locus-2 and 1-non-immunogenic locus, 2-non-immunogenic locus, and exogenous locus.

The foreign part may be an immunogenic site on the antigen protein of another pathogen. The foreign part may be a non-immunogenic part or a non-antigenic part on the antigen protein of another pathogen. Wherein the antigen homologous protein may function as a pathogen-like particle of another pathogen. The pathogen-like particle may be a virus-like particle.

The foreign part can also function as an immune assistant. At this time, the immune assistant function may be to suppress the secretion of cytokines that promote the secretion of cytokines related to the immune response or inhibit the immune response in the living body. The immune-assisted function may also aid in the recognition of antigen-recognizing cells. The foreign part may be an Fc variant of the antibody. Immunosuppressive function may also be the degradation of the membrane of immune cells. At this time, the immune helping function may be to degrade the macrophage membrane. At this time, the outpatient department can be a listeria orchid.

In other embodiments, the antigenic homologous protein may comprise a region that is homologous to the antigenic protein, a non-antigenic portion and an extraneous portion. Figure 10 is an illustration of an antigen-homologous inclusion-adding protein comprising a 1-immunogenic site-2 and a 2-non-immunogenic site, as well as different first and second foreign and non-antigenic moieties.

[Immunogenic system]

&Quot; System structure " means a structure that functions to transmit a target substance such as an immunogenic substance in a living body while positioning the target substance within a certain distance.

&Quot; System " means a target material that is delivered while being located within a certain distance of the system structure; And a system structure including a system structure that functions to transfer the same into a living body, and a mechanism in which such a system operates.

&Quot; Immunogenic system " means an immune response system consisting of an immunogenic material and a system construct.

One example of the present application is a vaccine comprising an immunogenic system.

The immunogenic system has an essential constitution of a system structure for delivering an immunogenic substance and an immunogenic substance in vivo.

The structure and characteristics of the immunogenic substance are as mentioned above. The immunogenic material and the system structure are transferred as a system, positioned within a certain distance from each other in vivo.

Vaccines using immunogenic systems are more stable and less risky than vaccines that only use immunogenic substances directly. In addition, there is an advantage that the effect of the system can be controlled by controlling the immunity.

In addition to the immunogenic material, the system structure of the immunogenic system can include known elements that aid in the function of the vaccine, such as immunosuppressants.

System structure

The system structure functions to transmit the immunogenic material in vivo while being located within a certain distance.

The system structure may be, for example, a carrier for tissue engineering, a polymer, a particle, a microorganism, and the like, as long as it is capable of efficiently delivering an immunogenic substance in vivo. A preferred embodiment is a microorganism such as bacteria. It is known that the matching of microorganisms with immunogenic substances of other pathogens has the advantage of generating a more persistent and powerful immune response (Georgiou et al., 1997). In addition, when the system structure is a pathogen, there is an advantage that it can act as a multivalent vaccine together with an immunogenic substance.

The system structure preferably has a size such that it can be administered into an animal, for example, its diameter can be on the order of about 0.02 탆 to about 5 탆.

When the system structure is excellent in physical and chemical stability, the immunogenic system has an advantage that it can cause immunity even in an extreme condition such as a stomach of a living body.

In one embodiment of the present application,

The system structure may be a virus. At this time, the virus may cause a complex disease with the pathogen.

The virus may be a bacteriophage.

The virus may be a poxvirus.

The virus may be an adenovirus.

The virus may be a herpes virus.

The virus may be a Newcastle disease virus.

The virus may be a virus in which the infected animal is a livestock. Preferably, the animal is a pig.

The virus may be a virus in which the infected animal is a bird. Preferably, the alga is a chicken.

Also, the system structure may be bacteria. At this time, the bacterium may cause a complex disease with a pathogen.

The bacteria may be gram-negative homogeneous. At this time, the gram negative bacteria may be homogenous gastric diseases. Wherein the gastrointestinal bacterium can be E. coli. The gastrointestinal disease bacterium may also be Salmonella. The gram negative bacteria may be a lung disease homogeneous. The gram negative bacteria may be Pasteurella multocida.

The bacteria may be gram positive homogeneous. At this time, the gram-positive bacteria may be a lung disease homogeneous. Wherein the lung germ can be Mycoplasma hyopneumoniae. The gram positive bacteria may also be lactobacillus. The gram-positive bacteria may also be Bacillus. Wherein the Bacillus may be B. subtilis, B. anthrasis, B. thuringiensis, or B. cereus.

The system structure may also be a spore.

The spores may be plant spores.

The spores may be spores of yeast.

The spores may be spores of fungi.

The spore may be a spore of spore-forming bacteria. Wherein the spore bacterium may be Clostridium, for example, C. difficile, and the like. The spore bacterium may be sporolactobacillus. The sporozoite bacteria may be Bacillus. The Bacillus may be, for example, B. subtilis, B. anthrasis, B. thuringiensis, B. cereus, and the like.

The system structure may also be an artificial structure. The artificial structure may be a particle or a rigid body. Further, the artificial structure may be one in which the outer membrane is coated with a phospholipid.

1) Immunogen internal-carrying system

One example of the present application is a vaccine comprising an immunogenic internal support system.

&Quot; Internal carrying system " means a system having a form in which a target material is supported in a system structure as one embodiment of the system.

&Quot; Carrying structure " refers to a structure that carries an immunogenic substance carried therein as a system structure.

&Quot; Immunogenic internal carrying system " means that the immunogenic material is carried in the system structure, as shown in Fig. 11, as an example of the immunogenic system. In this case, the system structure can be expressed as a "carrier". At this time, the immunogenic substance can be expressed as " supported immunogenic substance ".

- carrying structure

The carrier comprises the system structure of the immunogenic system.

The interior of the carrier may have a specific size or larger. Preferably an amount capable of containing an effective amount of an immunogenic substance capable of causing an immune response.

The carrier may have an internal charge. At this time, electric charge inside the carrier can cause charge and attractive force of the supported immunogenic substance.

The carrier may have an external charge. At this time, charges outside the carrier can cause charge and repulsion of the carrier immunogen.

The outer membrane of the carrier may be porous.

The carrier may be degradable in its outer membrane. At this time, the outer membrane may contain an action site of a specific restriction enzyme. In addition, the outer film may be in a state where the film is entirely deformed or manipulated in the wild state.

- an interal-carried immunogen

The supported immunogenic material encompasses the immunogenic material described above.

The carrier immunogenic material may be of a specific size or less. Preferably an amount sufficient to contain an effective amount of the supported immunogenic material capable of causing an immune response in the carrier.

The carrier immunogenic material may be charged. At this time, the charge of the supported immunogenic material may be opposite to the charge inside the carrier.

In addition, the carrier immunogenic material may include a portion which deactivates the carrier which is an organism.

2) Immunogen-fused display system

&Quot; Display system " refers to a system having a form in which a target material is disclosed outside the system structure as one embodiment of the system. The display system includes, but is not limited to, the fused display system, the coupling display system, and the attachment display system of the present disclosure.

One example of the present application is a vaccine comprising an immunogenic fusion display system.

&Quot; Immunogenic display system " refers to initiating an immunogenic substance outside the system structure as one embodiment of the immunogenic system. Immunogenic display systems include, but are not limited to, immunogenic fusion display systems, immunogenic coupled display systems, immunogenic attachment display systems, as described herein.

As used herein, the term " fusion display system " refers to a system in which a surface object and a target material, which disclose a target material outside a system structure, appear in a fused form.

&Quot; Fusion displaying structure " means a structure that fuses exogenously fused immunogenic substances to the outside as a system structure.

&Quot; Surface displaying substructure " means a substructure of a fused display system that is fused with a target material and is disclosed outside the display body.

&Quot; Fused body " means a fusion of a surface protein and an immunogenic substance.

&Quot; Fusing part " means a site where a surface construct and an immunogenic substance are fused in a fusion body.

An " immunogenic fused display system " is an embodiment of an immunogenic system, which includes a surface construct introduced into the system structure by fusing with a target material as shown in Fig. 12; And a system in which the immunogenic material is expressed in a fused form. The term "fusion" here refers to the direct connection of two substances as a bond of matter. In this case, the system structure is defined as a " fusion display body ". In this case, the immunogenic substance is defined as a "fused immunogen".

- Fusion displaying structure

Fused display bodies encompass system structures of immunogenic systems.

The fused display body may have an external charge. At this time, charges outside the fused display body may cause charge and attraction of the surface body. Also, charges outside the fused display body can cause charge and attraction of the fused body.

The fused display body may not be electrically charged outside.

The outer membrane of the fused display body may be porous. At this time, the pore of the outer membrane may be similar in size to or slightly larger than the surface opening body.

- Surface displaying substructure

Preferably, the surface construct is a sub-structure of a fused display system, the size of which is smaller than the fused display body. More preferably, the size is equal to the size of the outer membrane protein of the microorganism corresponding to the size of the fusion display body.

The surface construct may be a wild-state protein of the microorganism when the fusion display body is a microorganism. At this time, the surface protein may be an outer membrane protein. Or the surface protein may be one in which the wild-state protein is modified or engineered.

For example, if the fusion display body is a spore of Bacillus, the surface construct may be one of spore exosporium protein, spore coat protein, transmembrane protein, spore appendage protein, or spore associated enzyme.

The surface construct may be a protein that is homologous to the structure of the wild-type protein of the fusion display body.

The surface construct may be a wild-state protein of the fusion display body belonging to the same genus. At this time, the surface protein may be an outer membrane protein. At this time, the surface protein may be a modified or manipulated wild-type outer membrane protein.

The surface construct may be a protein that is homologous to the structure of the wild-type protein of the fusion display body belonging to the same genus.

Surface constructs may include the site of action of a particular restriction enzyme. The specific restriction enzyme may be, for example, a signal peptidase.

The surface can be charged. For example, charge on the surface construct can cause charge and attraction outside the fused display body.

Surface constructs may include structures in which the same sequence is repeated. Wherein the repeated structure may be homologous to the structure of the wild-type protein. Also, the repeated structure may be charged. At this time, charge of the repeated structure may cause charge and attractive force outside the fusion display body.

- fusing part

The fusion moiety refers to a site where the surface protein and the immunogenic substance are fused. Such a fusion site may be a separate protein / base sequence but may be only a site forming a single chemical bond.

The fusion moiety may exhibit only the binding site between the surface construct and the immunogenic material without special function, or may have a specific structural characteristic or a specific function in the immune formation process.

The fusion moiety may be a chemical bond. The chemical bond may be, for example, a polymer bond. The polymerization bond may be a condensation polymerization bond or an addition polymerization bond. The dehydration condensation polymerization bond may be, for example, an amide bond.

The fusion portion may have a certain length required for the desired function. Surface constructs and immunogenic materials that make up the fusions each have a suitable three-dimensional structure, e.g., a folding structure, which allows the protein to function properly. If the length of the fusion site is too short, the folding structure of each material may not be formed properly due to steric hindrance between the surface construct and the immunogenic material. Therefore, it is preferable that the fusion portion necessary for the folding structure of the surface construct and the immunogenic material to be formed properly has a certain length or size. For example, the fusion moiety may be about 10 bp, 15 bp, or 20 bp or more.

The fusion moiety may comprise a specific amino acid sequence / base sequence. In one embodiment of the present application, the specific base sequence 5'-GGAGGTGGGGGTTCACTCCAG-3 'was used.

The fusion portion may be one having a specific charge. The particular charge may have the same charge characteristics as the surface charge. For example, the fusion moiety can be positively charged by (number of positively charged amino acids (arginine / histidine / lysine)): (total number of amino acids).

The fusion moiety may be one having activity against the cleavage enzyme. The terminating enzyme may be used in combination with a restriction enzyme (restriction enzyme) or a restriction endonuclease. These enzymes recognize a specific nucleotide sequence of a double-stranded DNA molecule and cleave the part or its periphery Lt; / RTI > But may be, without limitation, proteases.

Fused immunogens (fused immunogens)

Fusion immunogenic substances encompass the above-mentioned immunogenic substances.

The fused immunogenic material may have a specific size. Preferably greater than or equal to the effective size capable of causing an immune response. Wherein the fused immunogenic material may have a specific size ratio with the surface protein.

A fused immunogenic material may be one that has a specific charge. The particular charge may have the same charge characteristics as the surface charge.

- fused body

Fusions may be those with a specific charge. At this time, a specific electric charge can cause charges and attractive forces outside the fused display body. At this time, the fusions can be positively charged.

The charge of the fusant (number of positively charged amino acids (arginine / histidine / lysine)): (number of total amino acids). (Number of positive amino acids): (number of total amino acids) may be 0.1 to 0.8: 1. The ratio may be 0.5: 1, 0.6: 1, 0.7: 1.

3) Immunogenic coupling display system

One example of the present application is a vaccine comprising an immunogenic coupled display system.

&Quot; Coupling display system " is one embodiment of a system, comprising: a system structure having one coupling unit on the outside; And a coupling system in which a target substance having two coupling groups forms a coupling bond.

&Quot; Coupling bond " means a chemical bond formed by the interaction of a display body coupler and an immunogenic material coupling unit.

&Quot; Coupling group " means a moiety that forms a coupling bond by the interaction of two homologous or heterogeneous coupling groups.

&Quot; Coupling group on displaying structure " means that it is located on a coupling display body as a coupling unit.

&Quot; Coupling part on immunogen " means that it is located in a coupling immunogenic material as a coupling group.

&Quot; Coupling part " means a coupled site created by interaction of a display body coupling unit and an immunogenic material coupling unit.

&Quot; Coupling display structure " means a structure that is coupled to and coupled with a coupling immunogenic material as a system structure.

An " immunogenic coupling display system " is an embodiment of an immunogenic system comprising: a system structure having one external coupling unit as shown in FIG. 13; And an immunogenic substance having two coupling groups form a coupling bond. At this time, the system structure can be expressed as a " coupling display body ", and the immunogenic material can be expressed as a " coupled immunogen ". The one coupling unit can be expressed as a " display body coupling unit ", and the two coupling unit can be expressed as an " immunogenic material coupling unit ".

- coupling display body

The coupling display body encompasses the system structure of the immunogenic system.

Coupling Coupling

Coupling bonds are generally understood to be polymeric bonds resulting from the interaction of two or more functional groups. The polymerization bond may include condensation polymerization in which a part of the functional group is released, addition polymerization in which the functional group is retained, and radical polymerization in the radical. The coupling bond as referred to herein is preferably a chemical bond formed by the interaction of the display body coupler and the immunogenic material coupling agent. The coupling coupling may be that two or more coupling units are the same or different.

In one embodiment of the present application,

The coupling bond may be a polymeric bond.

The polymerization linkage may be condensation polymerization. For example, the condensation polymerization may be a dehydration condensation polymerization.

The dehydration condensation polymerization may be an amide bond.

The dehydration condensation polymerization may be an ester bond.

The dehydration condensation polymerization may be an ether bond.

The dehydration condensation polymerization may be an aldol bond.

The condensation polymerization may be a disulfide bond.

The polymerization linkage may be addition polymerization.

The addition polymerization may be maleimide-thiol polymerization.

The polymerization linkage may be a radical polymerization.

The radical polymerization may be click chemistry.

- Display body coupler

The display body coupling unit may include one or more kinds of functional groups for coupling coupling.

For example, it may contain two kinds of functional groups for coupling coupling. At this time, the display body coupling unit has a first coupling unit including one kind of functional group for coupling coupling and a second coupling unit including another kind of functional group.

- immunogenic material coupling machine

The immunogenic material coupling unit may comprise at least one functional group different from the functional group of the display body coupling group.

For example, the immunogenic agent coupling group may comprise two types of functional groups for making the coupling bond. In this case, the immunogenic material coupling unit may be a second coupling group including a first coupling group including one kind of functional group for coupling coupling and a different kind of functional group.

- Coupling immunogenic material

Wherein the coupling immunogenic material encompasses the immunogenic material mentioned above.

- Coupling portion

The coupling moiety refers to a site including a display body coupling unit and an immunogenic coupling unit as a coupling-coupled site of the coupling display body and the coupling immunogenic substance. Such a coupling portion may be a separate protein / base sequence, but may be a region containing a functional group generated by one coupling bond.

The coupling moiety may exhibit only a binding site between the coupling display body and the coupling immunogenic material without any special function, or may have a specific structural feature or a specific function in the immune formation process.

The coupling moiety can refer to a functional group that forms a coupling bond or to the presence thereof.

The coupling portion may also have a certain length required for the desired function. Coupled immunogenic materials each have a suitable three-dimensional structure, for example a folding structure, and the formation of the correct folding structure allows the protein to function properly. If the length of the coupling part is too short, the folding structure of each material may not be formed properly due to steric hindrance between the coupling display body and the coupling immunogenic material. Therefore, it is preferable that the fusion portion necessary for the folding structure of the coupling immunogenic material to be formed properly has a certain length or size. For example, the fusion moiety may be about 10 bp, 15 bp, or 20 bp or more.

The coupling moiety may have a specific amino acid sequence / base sequence. In one embodiment of the present application, the specific base sequence was 5'-GGAGGTGGGGGTTCACTCCAG-3 '.

In addition, the coupling portion may be one having a specific charge. The particular charge may have the same charge characteristics as the coupling display body. For example, the coupling moiety can be positively charged by (the number of positively charged amino acids (arginine / histidine / lysine)): (the total number of amino acids).

The coupling moiety may be one having activity against the cleavage enzyme. The cleavage enzyme can be used in combination with a restriction enzyme (restriction endonuclease) or a restriction endonuclease. These cleavage enzymes recognize a specific base sequence of a double-stranded DNA molecule and cleave the part or its periphery Lt; / RTI > But may be, without limitation, proteases.

4) Immunogenic attached display system

One example of the present application is a vaccine comprising an immunogenic attachment display system.

&Quot; Attached display system " means that a target material is attached to the outside of the system structure as one embodiment of the system.

&Quot; Attached displaying structure " means a structure that attaches and externally attaches an attachment immunogenic material as a system structure.

 &Quot; Immunogenic attachment display system " means a system in which an immunogenic material is attached to the outside of the system structure, as shown in Fig. 14, as an embodiment of the immunogenic system. In this context, "attachment" means the bonding relationship of a substance followed by the indirect connection of two substances, eg via a specific mediator. In this case, the system structure can be expressed as an " attached display body ", and the immunogenic substance can be expressed as an " attached immunogen ".

In one embodiment of the present application,

The attachment may be by electrostatic attraction,

The attachment may be by hydrogen bonding,

The attachment may be by hydrophobic interaction.

- Attached displaying structure

The attached display body encompasses the system structure of the immunogenic system.

The attached display body may have electric charge inside. At this time, electric charge inside the attached display body may cause charge and repulsion of the attachment immunogenic material.

The attached display body may have an external charge. At this time, charges outside the attached display body may cause charge and attraction of the attached immunogenic material.

The attached display body may not have an external charge.

The attached display body may have a porous outer membrane.

- Attached immunogen

The attachment immunogenic substance encompasses the immunogenic substance.

The attachment immunogenic material may be below a certain size. Preferably, an effective amount of the supported immunogenic material capable of causing an immune response can be of sufficient size to be adhered to the attached display body.

 The attachment immunogenic material may be charged. At this time, charge of the attachment immunogenic material can cause charge and attraction outside the attachment display.

5) Immunogenic cross-linked display system

One example of the present application is a vaccine comprising an immunogenic cross-linked display system.

&Quot; Cross-linked display system " refers to a target material having a first cross-linker on the outside as one embodiment of a display system; And a polymer having two or more second cross-linking moieties cross-link to form a cross-linked network structure.

&Quot; Cross-linked displaying structure " means a system structure used in a cross-coupled display system.

&Quot; Cross-linking " means a chemical bond formed by the interaction of an immunogenic material cross-linker with a polymeric cross-linker.

&Quot; Cross-linking group " means a moiety that cross-links by the interaction of two or more homologous or heteromeric cross-linking groups.

&Quot; Cross-linking net structure " means a network structure of a target material and a polymer formed by cross-linking.

&Quot; Polymerizing part " means a moiety or bond that is polymerized between the target materials in a cross-linked network structure.

&Quot; Cross-linking part " means a cross-linked moiety made by the interaction of an immunogenic material cross-linker and a polymeric cross-linker.

&Quot; Cross-linking group on immunogen " refers to a cross-linking agent located in a cross-linking immunogenic material.

&Quot; Polymerizing body " refers to a material that has two or more polymeric cross-linkers and is capable of cross-linking with two or more immunogenic cross-linkers to effect polymerization.

&Quot; Cross-linking group on polymerizing body " means located on a polymer as a cross-linker.

An " immunogenic cross-linked display system " is an embodiment of an immunogenic display system in which an immunogenic material having a first cross-linker externally and a polymer having two or more second cross-linkers cross- To form a cross-linked net structure. The immunogenic cross-linked display system has a high stability of the system due to the cross-linked net structure. At this time, the display body is defined as a " cross-linked display body ". The immunogenic substance is defined as a " cross-linked immunogen ". Wherein the first cross-linker can be expressed as an " immunogenic material cross-coupler ", and the second cross-coupler can be expressed as a " polymer cross-coupler ".

Since the immunogenic cross-linked display system is basically characterized by the cross-linked net structure itself, the form of the display system is not limited. For example, a fusion display system, a coupling display system, or an attachment display system.

- a cross-coupled display element

The cross-linked display body may be any one of a fused display system structure, a coupled display system structure, and an attached display system structure according to aspects of the display system.

- Cross-linking

Cross-linking includes various types of known physical and chemical bonds, such as the coupling bonds described above.

- immunogenic cross-linker

The immunogenic material cross-linker may comprise one or more functional groups for cross-linking.

For example, an immunogenic material cross-linker may be two types of functional groups for cross-linking. Can be used as the first immunogenic material cross-coupler and the second immunogenic material cross-coupler, respectively, for different functional groups.

The immunogenic material cross-linker may comprise an active site for the cleavage enzyme. Wherein the cleavage enzyme may be a protease.

- polymer

Polymer refers to a material that causes a polymerization reaction to form a cross-linked network structure. It is preferred that the polymer comprises two or more cross-linking groups to cause a polymerization reaction.

The polymer may have a certain length required for the desired function. In order for the cross-linked immunogenic materials to polymerize, the polymer must be able to bridge between the cross-linked immunogenic materials. If the length of the polymer is too short, only a single bond with the cross-linked immunogenic material can be formed. Therefore, it is preferable that the polymer has a certain length or size necessary to cause the desired polymerization reaction to take place.

In addition, the polymer may comprise an active site for the cleavage enzyme. Wherein the cleavage enzyme may be a protease.

- polymer cross coupler

The polymeric cross-linker may comprise one or more functional groups for cross-linking.

For example, a polymeric cross-linker may comprise two types of functional groups for cross-linking. Can be used as a first cross-linker and a second cross-linker, respectively, for different functional groups.

The polymeric cross-linker may comprise an active site for the cleavage enzyme. Wherein the cleavage enzyme may be a protease.

- cross-

Cross-linking moieties may refer to functional groups or sites of their occurrence resulting from cross-linking.

The cross-linking moiety may be one having activity against the cleavage enzyme. Wherein the cleavage enzyme may be a protease.

- Cross-connect net structure

The cross-connect network structure refers to the net structure formed by the cross-links. Referring to FIG. 15, the net structure refers to a structure in which points are crossed by a line composed of a polymerized portion, with the cross-linked immunogenic material as a point. At this time, the net structure essentially consists of a cross-linked immunogenic material and a polymeric moiety. Such a net structure may also function as a loading system that controls the size and confines the material therein. At this time, the net structure may be that the mesh is a certain size, so that a larger material can not pass through it.

This material encompasses the following protein x.

The material may also be a cross-linked display body.

- Polymerization

In an immunogenic cross-linked display system, a polymeric moiety refers to a moiety that polymerizes between one cross-linked immunogenic material and another cross-linked immunogenic material. Wherein the polymeric moiety will essentially have the structure of an immunogenic material cross-linker-cross-linking-polymer-cross-linking moiety-immunogenic cross-linker.

The polymerized portion may also have a certain length required for the desired function. In order for the cross-linked immunogenic materials to polymerize, the polymeric moiety should be able to bridge between the cross-linked immunogenic materials. If the length of the polymerized portion is too short, only a single bond with the cross-linked immunogenic substance can be formed. Therefore, it is preferable that the length of the polymerization portion has a certain length or size so that the desired polymerization reaction can take place. At this time, the lengths of the immunogenic material cross-linking unit, the cross-linking unit, and the polymer may be adjusted in consideration of the length of the polymerization unit.

The polymerized portion may be one having a specific charge.

This particular charge can cause charge and attraction of the cross-linked display body.

The specific charge can be (by the number of positively charged amino acids (arginine / histidine / lysine)) :( total amino acids). The charge of the immunogenic material cross-linker, the cross-linking moiety, and the polymer can each be adjusted so that the polymeric moiety has a specific charge.

In addition, the polymerisation moiety may comprise an active site for the cleavage enzyme. Wherein the cleavage enzyme may be a protease.

6) Immunogenic serial-connected system

One example of the present application is a vaccine comprising an immunogenic cascade system.

As used herein, the term " serial connection system " means a system in which a form of a target material has a form in which proteins are connected in series, as shown in FIG.

&Quot; Serial-connected system structure " means a system structure used in an immunogenic serial-connected system.

An " immunogenic serial-connected body " is an immunogenic substance of an immunogenic series-linked system, in which n proteins are connected in series.

&Quot; Immunogenicity cascade system " is an embodiment of the immunogenic system wherein the form of the immunogenic substance is in the form of serially connected proteins. In this case, "serial" means a combination of two or more substances connected in series. If the form of the immunogenic substance is in-line, the immunogenic effect may be enhanced by increasing the concentration of the immunogenic substance in the vaccine. At this time, the system structure can be expressed as a " serial connection system structure ", and the immunogenic material can be expressed as an " immunogenic serial connector ".

Basically, immunogenic serial-linking systems are characterized by the linkage structure of the immunogenic material, so that there is no limit to the mode of the system. For example, it can be any one of an internal carrying system, a fusion display system, a coupling display system, an attachment display system, and a cross-linked display system.

- Serial connection system structure

The series connection system structure may be any one selected from an internal supporting system structure, a fused display system structure, a coupling display system structure, an attached display system structure, and a cross-coupled display system structure according to aspects of the system.

- immunogenicity serial linker

&Quot; xth protein " refers to the xth protein on the immunogenic series link.

&Quot; yth connecting part " means a site connecting the yth protein and the (y + 1) protein on the immunogenicity serial link.

Immunogenicity Serial linkers refer to substances with two characteristics:

First, it is in the form of n proteins connected in series. That is, the first protein-first connecting portion-second protein-second connecting portion ... (N-1) -conjugate-n-th protein. The serial link consisting of n proteins has (n-1) linkages.

In addition, at least one of the n proteins should be included in the immunogenic substance. For example, it may be achieved with only an immunogenic substance that causes an immune response, or it may include other auxiliary factors that enhance the immune response in addition to the immunogenic substance.

The immunogenicity serial link consists of a first x protein of x 1 to n and a y link connecting y 1 to (n-1).

- x protein

The x-protein may be the immunogenic substance.

The x-protein may be selected from among a supported immunogenic substance, a fused immunogenic substance, a coupled immunogenic substance, an adhesion immunogenic substance, and a cross-linked immunogenic substance.

Protein x can be a non-antigenic part of the pathogen.

Wherein the non-antigenic portion may be homologous to the outer membrane protein of the pathogen. Wherein the immunogenic serially-linked construct can function as a pathogen-like particle. The pathogen-like particle may be a virus-like particle.

The non-antigenic portion may also function as an immunosuppressive function. At this time, the immune assistant function may be to suppress the secretion of cytokines that promote the secretion of cytokines related to the immune response or inhibit the immune response in the living body. In addition, the immunocompetent function may be to degrade the membrane of the immune cell.

Protein x can be the exogenous part of the pathogen.

The foreign part may be an immunogenic site on the antigen protein of another pathogen.

The foreign part may be a non-immunogenic part or a non-antigenic part on the antigen protein of another pathogen. Wherein the antigen homologous protein may function as a pathogen-like particle of another pathogen. The pathogen-like particle may be a virus-like particle.

The foreign part may function as an immune assistant. At this time, the immune assistant function may be to suppress the secretion of cytokines that promote the secretion of cytokines related to the immune response or inhibit the immune response in the living body. The immune-assisted function may also aid in the recognition of antigen-recognizing cells. Immunosuppressive function may also be the degradation of the membrane of immune cells.

Immunogenic substances among the first to n < th > proteins may comprise multiple immunogenic sites of the pathogen.

The first to n < th > proteins may all be the same immunogenic substance or different immunogenic substances.

At least one of the first proteinase n protein is an immunogenic substance.

- y connection

The y-th linkage refers to a site connecting the y-th protein and the (y + 1) protein. Such a y-connection may be a separate protein / base sequence, but may be merely a site forming a single chemical bond.

The y-connection may not have a particular function, but may have a separate structural feature or specific function in the process of immunization.

The y-th connecting portion encompasses the fusion portion.

The y-th coupling portion encompasses the coupling portion.

The y-th connecting portion includes the above-mentioned polymerized portion.

In addition, the first to (n-1) connecting parts may have activity on the same cleavage enzyme or may have activity on different cleavage enzymes. Wherein the cleavage enzyme may be a protease.

7) Immunogenic parallel system

One example of the present application is a vaccine comprising an immunogenic parallel connection system.

&Quot; Parallel system " is an embodiment of the system, wherein the system structure transfers n proteins in parallel as shown in FIG.

&Quot; Parallel system structure " means a system structure used in an immunogenic parallel system.

&Quot; Parallel body " refers to each of the n proteins delivered by the parallel system structure. Unless otherwise stated, "parallel" refers to any one of the n paralleles.

An " immunogenic parallel system " is one embodiment of an immunogenic system wherein the system constructs deliver n proteins in parallel. "Parallel" means that each protein is independently delivered by the system structure. An immunogenic parallel system has the advantage that one system can perform several functions. In this case, the system structure can be expressed as a "parallel system structure", and each protein delivered by the parallel system structure can be expressed as "parallel".

Basically, in a parallel system, the transfer of n parallel objects is independent, so one parallel system is similar to a system of n different modes combined. At this time, aspects of each system may be any one of the internal supporting system, the fusion display system, the coupling display system, the attachment display system, and the cross-coupling display system.

- parallel system structure

The parallel connection system structure may be any one selected from among an internal supporting system structure, a fused display system structure, a coupling display system structure, an attached display system structure, and a cross-coupled display system structure.

- Parallel

The parallel body may be the immunogenic substance.

The conjugate may be selected from a supported immunogenic substance, a fused immunogenic substance, a coupled immunogenic substance, an adhesion immunogenic substance, and a cross-linked immunogenic substance.

Parallel bodies may be non-antigenic parts of the pathogen.

Wherein the non-antigenic portion may be homologous to the outer membrane protein of the pathogen. Wherein the immunogenic parallel system can function as a pathogen-like particle. The pathogen-like particle may be a virus-like particle.

The non-antigenic portion may also function as an immunosuppressant. At this time, the immune assistant function may be to suppress the secretion of cytokines that promote the secretion of cytokines related to the immune response or inhibit the immune response in the living body. In addition, the immunocompetent function may be to degrade the membrane of the immune cell.

Parallel bodies may be the exogenous part of the pathogen.

The foreign part may be an immunogenic site on the antigen protein of another pathogen.

The foreign part may be a non-immunogenic part or a non-antigenic part on the antigen protein of another pathogen. Wherein the antigen homologous protein may function as a pathogen-like particle of another pathogen. The pathogen-like particle may be a virus-like particle.

The foreign part may function as an immune assistant. At this time, the immune assistant function may be to suppress the secretion of cytokines that promote the secretion of cytokines related to the immune response or inhibit the immune response in the living body. The immune-assisted function may also aid in the recognition of antigen-recognizing cells. Immunosuppressive function may also be the degradation of the membrane of immune cells.

And at least one of the n parallel substances should be the immunogenic substance. For example, it may be achieved with only an immunogenic substance that causes an immune response, or it may include other auxiliary factors that enhance the immune response in addition to the immunogenic substance.

[Immunogenic spore system]

8) Immunogenic spore system

One example of the present application is a vaccine comprising an immunogenic spore system.

&Quot; Spore system " means in one embodiment of the system that the system structure is spore or spore-like particles.

&Quot; Spore system structure " means a spore or spore-like particle as a system structure of a spore system.

An " immunogenic spore system " means an embodiment of an immunogenic system wherein the system structure is spores.

The immunogenic spore system consists of an immunogenic substance and a spore system structure that transmits the immunogenic substance in vivo. The structure and characteristics of the immunogenic material are as described above. At this time, the immunogenic material and the spore system structure are transferred as a system while being located within a certain distance in the living body. Spore system structure has higher physico-chemical stability than other cell, virus type system structure, has weak virulence and is easy to concentrate.

 In addition to the immunogenic material, the spore system structure of the immunogenic spore system may include an element that contributes to the function of the vaccine, such as an immunosuppressant.

Spore system structure

The spore system structure constituting the spore system may be spore or spore-like particles.

The spore system structure functions to transfer the immunogenic material into a living body within a certain distance. The spore system structure preferably has a size that can be administered to an animal body, and may be about the size of a general microbe, for example, about 0.02 to 5 mu m in diameter.

In nature, spores are generally required to survive in harsh physical / chemical environments. For this reason, most spores are characterized by high temperature, changes in pH, changes in external osmotic pressure, and external shocks. The properties of these spores give immunogen spore systems the advantage of being able to cause immunity under extreme conditions than other cell, virus type system structures. In addition, like other system structures, it has an advantage of exerting immunity due to microorganism like appearance, and in addition, when spore is a pathogen, it can act as a multivalent vaccine together with an immunogenic substance.

The spore system is not limited to the form described below.

- spores

&Quot; Spore " includes spores and modifications thereof that can be found in nature.

The spores may be plant spores.

The spores may be spores of yeast.

The spores may be spores of fungi.

The spore may be a spore of spore-forming bacteria. "Spore bacterium" refers to a bacterium that grows in the form of bacteria at normal times but temporarily becomes spore-forming and survivable when conditions are difficult to survive.

Wherein the spore bacterium may be Clostridium. For example, the Clostridium may be C. difficile.

At this time, the spore bacterium may be sporolactobacillus.

At this time, the spore bacterium may be Bacillus. The Bacillus may be, for example, B. subtilis, B. anthrasis, B. thuringiensis, or B. cereus.

The spore may be a part of which has been deformed or manipulated.

The spore may be the entire structure modified or manipulated.

In a preferred embodiment of the present application, the spore of the spore-forming bacteria is in particular a spore of B. subtilis.

- Spore-like particles

&Quot; Spore-like particles " are artificially created particles that are similar in structure to spores. For example, the spore-like particles may consist of a "spore-like particle nucleus" that forms the structure of the particle and a "free-desert" similar to the spore's outer membrane.

The spore-like particle nucleus may be a hollow spherical structure.

The spore-like particle nuclei may be a porous structure.

The spore-like particle nuclei may be a solid rigid structure.

The spore-like particle nuclei can be composed of organic materials.

The spore-like particle nuclei can be composed of inorganic materials. The inorganic material may be, for example, silica (Si).

The spore-like particle nuclei may be composed of a mixture of an organic material and an inorganic material.

Spore-like particle nuclei may resemble spores of microorganisms whose diameter is in nature. For example, the diameter may be between 1 and 50 mu m.

The for-free desert may be a phospholipid film.

The spore-like particles may be composed only of spore envelope proteins.

8-1) Immunogenic spore carrying system (immunogenic spore carrying system)

One example of the present application is a vaccine comprising an immunogenic spores internal support system.

&Quot; Spore carrying system " means one embodiment of the spore system, wherein the target substance is carried in the spore system structure.

&Quot; Carrying spore structure " means a spore system structure, which is a structure that supports and transports a spore-bearing immunogenic substance therein.

&Quot; Immunogenic spore internal support system " means that, as one embodiment of the immunogenic spore system, the immunogenic substance is carried in the spore system structure. In this case, the spore system structure can be expressed as "spore carrier", and the immunogenic substance can be expressed as "spore carrier immunogen".

- carrying spore structure

Spore bearing bodies encompass the spore system structure of the immunogenic spore system.

The spore carrier includes the carrier described above.

- spore carried immunogen

The spore-bearing immunogenic material encompasses the immunogenic material described above.

The spore-bearing immunogenic material may be less than a specific size. Preferably an amount capable of containing an effective amount of an immunogenic substance capable of causing an immune response.

The spore-bearing immunogenic material may be charged. At this time, the charge of the spore-bearing immunogenic material may be opposite to the charge inside the spore carrier. For example, the charge of the spore-bearing immunogenic material can be negative.

The spore-bearing immunogenic material may comprise a portion that deactivates spores.

The spore-bearing immunogenic material may be homologous to a protein present in the spores. Where the homologous portion may be the signal sequence portion of the protein. In addition, the spore internal protein may be a protein that is produced in the Spo I stage in the spore differentiation process. Preferably, the spore-bearing immunogenic material may be carried into the spores by the signal sequence of the protein and carried.

8-2) Immunogenic spore fused display system

One example of the present application is a vaccine comprising an immunogenic spore fusion display system.

&Quot; Spore display system " refers to initiating a target substance outside of the spore system structure as an embodiment of the spore system.

An " immunogenic spore display system " refers to initiating an immunogenic substance outside of a spore system structure as one embodiment of an immunogenic spore system.

&Quot; Spore fused display system " refers to a fusion of a target substance with a spore surface construct that initiates a target substance outside a spore system structure as one embodiment of the system.

&Quot; Spore fusion displaying structure " means a spore system structure, which is a structure that externally fuses a spore fusion immunogenic substance.

&Quot; Spore surface displaying substructure " refers to a substructure of a fused display system that fuses with a target material and starts outside the display body.

&Quot; Spore fused body " means a fusion of a spore surface body and an immunogenic substance.

&Quot; Spore fusing part " means a site where a spore surface body and an immunogenic substance are fused in a spore fusion body.

&Quot; Immunogenic fused display system " means an embodiment of an immunogenic spore system, which is a fusion of an immunogenic substance with a spore surface organ initiated outside the spore system structure by fusion with a target substance. The term "fusion" here refers to the direct connection of two substances as a bond of matter. In this case, spore system structure is defined as "spore fusion display body". In this case, the immunogenic substance is defined as a " spore fused immunogen ".

- spore fusion display body

The spore fusion display body encompasses the spore system structure of the immunogenic spore system.

The spore fusion display body may have an external charge. At this time, charges outside the spore fusion display body can cause charge and attraction of the spore surface body. In addition, charges outside the spore fusion display body can cause charge and attraction of the spore fusion body.

Charges outside the spore fusion display body can produce stronger negative charges than spores in the wild state.

The spore fusion display body may not be charged outside.

The outer membrane of the spore fusion display body may be porous. At this time, the hole of the outer membrane may be similar in size to the spore surface body.

- spore surface dog body

&Quot; Spore outer domain " refers to the space between the double lipid membrane of the spore and the outermost perimeter of the spore.

&Quot; Spore outer protein " refers to a spore protein present in the outer region of the spore in its natural state. For example, the outer spore protein may be a protein expressed in the spore membrane.

The spore surface is preferably a sub-structure of the spore fusion display system and the size thereof is smaller than that of the spore fusion display body. Preferably, the size is the same as the size of the spore external protein corresponding to the size of the spore fusion display body.

In this case, the spore surface body may be a wild-state protein of spores when the spore fusion display body is a spore.

The spore surface construct may comprise the site of action of a particular restriction enzyme. The specific restriction enzyme may be, for example, a signal peptidase.

Spore surface bodies may be charged. At this time, the electric charge of the spore surface openings may cause charge and attractive force outside the spore fusion display body.

The spore surface construct may include a structure in which the same sequence is repeated. Wherein the repeated structure may be homologous to the structure of the wild-type protein. Also, the repeated structure may be charged. At this time, the charge of the repeated structure may cause charge and attraction outside the spore fusion display body.

- spore outer protein

The spore surface can be an outer spore protein. Generally, spores of the same microorganism can be used as spores between the spores.

In one embodiment, when the spore fusion display is a spore of Bacillus sp., The spore external protein may be any one of spore exosporium protein, spore coat protein, transmembrane protein, spore appendage protein, and spore associated enzyme.

The spore exosporium protein may be, for example, BclA, InhA, and the like.

The spore coat protein may be, for example, CotC, CotD, CotB, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK, have.

For example, CotB, CotC, CotE and CotG can be proteins having a high expression ratio and a high ratio in spontaneous extracellular proteins.

The transmembrane protein may be, for example, prkC, OppA, or the like.

The spore appendage protein may be, for example, P29a, P29b, P85, and the like.

The spore-associated enzyme may be, for example, CotA (laccase), oxdD (oxalate decarboxylase), CotQ (reticuline oxidase-like protein), tgI (transglutaminase)

The spore surface construct may be a modified or engineered spore protein in the wild state.

- spore external homologous protein

&Quot; Spore outer homologous protein " means a protein that is homologous to the structure of a particular spore-forming protein. It can have 85% to 100% homology with wild-type protein. Preferably, the homology is 90 to 100%, more preferably 95 to 100%.

&Quot; Signal sequence " refers to a protein sequence that functions to direct a protein to a specific location in a cell during the synthesis of the protein.

&Quot; Spore outer signal sequence " refers to a protein sequence that functions as a signal sequence in the spore protein and serves to direct the protein to the spore outer region.

The term " outer localization motif " refers to a motif that positions the outer spore protein in the outer region of the spore.

The spore surface opener may be a spore external homologous protein.

The spore outer protein may comprise a spore external signal sequence consisting of about 20 or more amino acid sequences. The spore external signal sequence contained in the spore outer homologous protein may be one in which the signal sequence restriction enzyme action site has been removed.

In particular, in the case of spore-forming proteins, it may include a spore external locating motif that allows the spore to be located in the spore outer region. Wherein the spore external locating motif may be located at the N terminus of the outer spore protein, but is not limited thereto. Proteins that are homologous in these regions can be expressed in the outer region of the spore.

 The number of amino acid sequences of the spore external homologous protein is not particularly limited as long as it is sufficient to express a protein capable of functioning as an immunogenic substance in the spore outer region. For example, 50aa, 100aa, 150aa.

Spore external homologous proteins may comprise spore external locating motifs.

Spore external homologous proteins can include both spore external signal sequences and spore external locating motifs. In this case, the spore external signal sequence may be the signal sequence restriction enzyme removed region.

Also, the spore outer homologous protein may include a structure in which the same sequence is repeated, wherein the repeated structure may be a full-length sequence of the spore outer protein. The repeated structure may also be a spore external locating motif.

The repetitive structure of the protein outside the spore can also be positively charged.

For example, if the outer spore protein is CotB, the repeating structure may be positively charged.

For example, if the outer spore protein is CotC, the repeating structure may be positively charged.

For example, if the outer spore protein is CotG, the repeating structure may be positively charged.

- spore outer homologous protein-contained additive body

The term " pore outer homologous protein-contained additive " or " spore outer homologous protein " refers to a protein having some homology to the structure of the outer spore protein and having homology to the structure of the outer spore protein Or a portion of the protein that contains the missing portion. That is, the spore-exogenous homologous inclusion-containing protein refers to a form containing a region which is in addition to the spore exogenous homologous protein and which is not homologous with the spore external protein.

&Quot; Spore foreign body " refers to a protein or base sequence that does not exist in wild-type spores.

&Quot; Spore of another species " refers to a heterologous microbial spore of the same genus. &Quot; Spore outer protein of another species " refers to a protein outside the spore of heterozygous spores.

The spore surface construct may be a spore external homologous inclusion protein.

In one embodiment, the spore external homology inclusion attachment protein may be one that is homologous to another spore external protein of the same spore other than the specific spore external protein.

The spore outer homologue protein may contain a spore extraneous signal sequence of the outer protein of the sponge. In this case, the spore external signal sequence may be the signal sequence restriction enzyme removed region. In addition, the homology region with the external protein of the other reporters may have an amino acid sequence number of, for example, 50aa, 100aa, 150aa.

Spore Outer Homologous Protein The protein may contain spore external locating motifs of the outer sponge protein.

Spore Outer Homologous Protein The protein may contain both spore external signal sequence and spore external locating motifs of the external protein of the external sponge. In this case, the spore external signal sequence may be the signal sequence restriction enzyme removed region.

The protein may be homologous to two or more proteins outside the sponge in the same form.

In other embodiments, the spore outer homologous portion protein may comprise a spore outgrowth and a site that is homologous to the spore outer protein.

The foreign part may be homologous to the heterologous spore external protein.

The spore outer homologous protein may contain a spore-external signal sequence of the heterospolar outer protein. In this case, the spore external signal sequence may be the signal sequence restriction enzyme removed region. Also, homology sites with heterologous spore proteins can have amino acid sequences of 50aa, 100aa, 150aa.

The spore outer homologous protein may contain spore external locating motifs of heterologous spore external protein. In this case, the homologous site with the heterologous spore protein may have the amino acid sequence numbers of 50aa, 100aa, 150aa.

The spore outer homologous protein may contain both the spore external signal sequence of the heterologous spore outer protein and the spore external locating motif. In this case, the spore external signal sequence may be the signal sequence restriction enzyme removed region. Also, homology sites with heterologous spore proteins can have amino acid sequences of 50aa, 100aa, 150aa.

The spore outer homologue protein may be homologous to two or more heterospathic proteins in the same form.

In yet another embodiment, the foreign part may be charged with a specific sign. In general, the area outside the spore is negatively charged. Therefore, when the spore surface body is positively charged, the electrostatic attraction with the outer region of the spore will be added, so that it can be positioned more stably. Therefore, it is preferable that the charge of protein of the spore external homologous portion is positive.

At this time, the charge of the specific code may be opposite to the charge outside the spore fusion display body.

The charge of the foreign part may be positive. At this time, the foreign part can be positively charged by (the number of positive amino acids (arginine / histidine / lysine)): (the total number of amino acids).

In addition, due to the charge of the exogenous part, the protein can exert a stronger positive charge than the exogenous protein in the wild state. In this case, the number of amino acids in the protein (the number of positive amino acids): (the number of total amino acids) of the spore external homologous portion may be 0.1 to 0.8: 1. The ratio may be 0.5: 1, 0.6: 1, 0.7: 1.

- spore fusing part

The spore fusion site refers to a site where a spore surface integrator and a spore fusion immunogenic substance are fused. The spore fusion site may be a separate protein / base sequence but may be only a site forming a single chemical bond.

The spore fusion site may not have a particular function, but may have separate structural features or specific functions in the immune formation process.

The spore fusion unit encompasses the fusion unit described above.

- spore fused immunogen (spore fused immunogen)

The spore fusion immunogenic substance encompasses the above-mentioned fusion immunogenic substance.

The spore fusion immunogenic material may have a specific size ratio with the spore outer protein. Wherein the size ratio of the spore outer protein to the spore fusion immunogen may be from 2: 1 to 1: 2.

- spore fused body

The spore fusion may be one with a specific charge. In general, the area outside the spore is negatively charged. Therefore, the spore fusions will be more stable when positively charged, due to the addition of electrostatic attraction to the area outside the spore. Therefore, the charge of the spore fusion body is preferably positive.

The specific charge can cause charge and attraction outside the spore fusion display body.

The spore fusion can be positively charged by (number of positively charged amino acids (arginine / histidine / lysine)): (total number of amino acids). (Number of positive amino acids): (number of total amino acids) may be 0.1 to 0.8: 1. The ratio may be 0.5: 1, 0.6: 1, 0.7: 1.

8-3) Immunogenic Spore Coupling Display System (immunogenic spore coupling display system)

One example of the present application is a vaccine comprising an immunogenic spore-coupling display system.

"Spore-coupling display system" refers to a system having a spore system structure having a first coupler on the outside and a form having a target material having a second coupler in a coupling combination as an embodiment of the spore system.

&Quot; Spore coupling displaying structure " means a spore system structure and a structure that couples and is coupled to a spore-coupling immunogenic material.

By " spore coupling bond " is meant a chemical bond formed by the interaction of a spore display body coupler and a spore immunogenic coupler.

&Quot; Coupling group " means a moiety that forms a coupling bond by the interaction of two or more homologous or heterogeneous coupling groups.

&Quot; Spore coupling group on displaying structure " means a coupler located on a coupling display body.

&Quot; Spore coupling part on immunogen " means that it is located in the coupling immunogen as a coupling group.

&Quot; Spore coupling part " means a coupled site formed by interaction of a display body coupling unit and an immunogenic material coupling unit.

An " immunogenic spore-coupling display system " refers to an immunogenic system having a spore system structure having a first coupling agent externally and an immunogenic material having a second coupling agent to form a coupling bond. In this case, the system structure is defined as a "spore-coupling display body". The immunogenic material is defined as a " spore coupled immunogen ". At this time, the first coupler is defined as a " spore display body coupler ". Here, the second coupler is defined as a " spore immunogenic substance coupling group ".

- spore coupling display element

The spore-coupling display body encompasses the spore system structure of the immunogenic spore system.

- spore coupling coupled

The spore coupling bonds include the above-mentioned coupling bonds.

- Spore display body coupler

The spore display body coupler includes the above-mentioned display body coupler.

- Spore immunogenic material coupler

The spore immunogenic substance coupling group encompasses the above-mentioned immunogenic substance coupling group.

- spore-coupled immunogenic material

Spore-coupling immunogenic substances encompass the immunogenic substances mentioned above.

The spore-coupled immunogenic material may be homologous to the outer spore protein. In this case, the homologous region may be a spore external signal sequence of the spore outer protein. Preferably, the spore-coupled immunogenic material is delivered to the outside of the spore by a spore external signal sequence, resulting in higher efficiency of spore-coupling binding.

- spore coupling part

The coupling moiety refers to a site including a display body coupling unit and an immunogenic coupling unit as a coupling-coupled site of the coupling display body and the coupling immunogenic substance. Such a coupling portion may be a separate protein / base sequence, but may be only a functional group generated by one coupling bond. In addition, the coupling part may not have a particular function, but may have a separate structural feature or a specific function in the immune formation process.

The spore coupling portion includes the above-mentioned coupling portion.

8-4) Immunogenic spore attached display system

One example of the present application is a vaccine comprising an immunogenic spore-attached display system.

&Quot; Spore-attached display system " means that a target substance is attached to the outside of the spore system structure as one example of the spore system.

&Quot; Spore attached displaying structure " means a spore system structure, which refers to a structure that externally attaches and transmits spore attachment immunogenic material.

&Quot; Immunogenic spore-attached display system " means that an immunogenic substance is attached to the outside of the spore system structure as one embodiment of the spore immunogenicity system. In this case, "attachment" means the bonding of two substances indirectly connected with each other. In this case, spore system structure is defined as "spore attached display body". In this case, the immunogenic substance is defined as a " spore attached immunogen ".

The attachment may be by electrostatic attraction.

The attachment may be by hydrogen bonding.

The attachment may be by hydrophobic interaction.

- spore attached displaying structure

The spore-attached display body encompasses the spore system structure of the immunogenic spore system.

The spore-attached display body includes the attached display body.

- Spore attached immunogens (spore attached immunogens)

Spore attachment immunogenic material encompasses the immunogenic substance.

Spore attachment immunogenic material encompasses the attachment immunogenic substance.

The spore attachment immunogenic material may be homologous to the outer spore protein. In this case, the homologous region may be a spore external signal sequence of the spore outer protein. Preferably, the spore-attach immunogenic material is delivered to the outside of the spore by the spore external signal sequence and can be attached to the spore-attached display body with higher efficiency.

8-5) Other spore systems

In addition to the spore systems, other types of spore systems that deliver the target material may be used. As another example of the present application, it is possible to have aspects of a serial connection system, parallel system not mentioned above.

[Genetic Production of Protein]

Methods for Genetic Production of Proteins

One example of the present application is immunogenic materials and their various uses made by genetic recombination methods for constructing the immunogenic system.

&Quot; Target nucleotide sequence " means a nucleotide sequence to be included in a recombinant base sequence.

&Quot; Recombinant protein " refers to a protein that is ultimately desired to be produced in a genetic engineering method.

&Quot; Recombinant nucleotide sequence " means a nucleotide sequence encoding a recombinant protein.

A " recombinant vector " is a carrier that functions to transfer a recombinant base sequence into living bodies, including, for example, plasmids, episomal vectors, viral vectors and the like.

As used herein, the term " recombinant expression vector " means a vector which expresses the function of recombinant base sequence linked to a vector to express the target substance in vivo. These recombinant expression vectors can be used to confirm expression and production of recombinant proteins. Such an expression vector may, for example, be in the form of a plasmid, but is not limited thereto.

&Quot; incubating host cell " means a cell that is transformed and transformed with a recombinant expression vector for the production of recombinant protein.

Methods for the production of recombinant proteins include obtaining proteins via genetic recombination methods. The protein to be produced at this time is a desired recombinant protein, and the desired base sequence may be a sequence of such a recombinant protein.

A method for genetically preparing a protein comprises, as one embodiment, a first step of obtaining a target nucleotide sequence, a second step of producing a vector or polynucleotide having a recombinant nucleotide sequence containing the target nucleotide sequence, culturing the recombinant nucleotide sequence A third step of transforming host cells, a fourth step of culturing the transformed host cells, and a fifth step of obtaining recombinant proteins from the cultured host cells.

Each step will be described below.

The first step is to obtain the desired nucleotide sequence.

At this time, the nucleotide sequence of the protein in the wild state can be obtained by using a genbank of ncbi or by directly screening the protein.

The polynucleotide having the desired nucleotide sequence can be produced by conventional recombinant DNA technology.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer can be present at about the 20 base sequences present at the 5 ' end of the base sequence of the immunogenic material of interest in the present application, Lt; RTI ID = 0.0 > 20 < / RTI > nucleotides.

And the second step is a step of preparing a vector or polynucleotide having a recombinant base sequence containing the desired nucleotide sequence.

The vector or polynucleotide may be single stranded or double stranded DNA containing the desired base sequence or RNA form. Hereinafter, the thus-produced polynucleotide is used in combination with a recombinant vector or a recombinant polynucleotide.

The recombinant vector or recombinant polynucleotide preparation method may comprise ligating a polynucleotide having a desired base sequence through a ligase.

The recombinant vector or recombinant polynucleotide may contain a promoter necessary for the expression of the recombinant base sequence. The promoter may be derived from a host cell or artificially introduced separately.

In addition, the polynucleotide including the recombinant base sequence may be a recombinant expression vector into which the desired base sequence is inserted. As a method for inserting a desired nucleotide sequence into a recombinant expression vector, known gene recombinant techniques can be used.

The third step is a step of transforming the cultured host cell with the recombinant polynucleotide or recombinant expression vector prepared in the second step.

The transformation may be classified as " transient transformation " in which expression of the recombinant base sequence takes place in the short term, or " permanent transformation " in which it is inserted into the genome of the cultured host cell by a recombinant expression vector.

Transformation can also be classified into "transformation by reactants", "transformation by a tool", and "transformation by a virus" by a method of inserting a base sequence into a cell membrane or a nuclear membrane.

&Quot; Transformation by reactant " refers to a conversion method in which a positively charged transformant and a nucleotide sequence are mixed to pass through a negatively charged membrane. These transformants include calcium phosphate, DEAE-Dextran, cationic lipid, cationic polymer, activated dendrimer, and magnetic bead.

&Quot; Transformation by means of a tool " means a transformation method using an experimental apparatus developed for transformation. Such transformation methods include electroporation (EP), biolistic technology, microinjection, and laserfection / optoinjection.

&Quot; Viral transformation " means a transformation using the nature of a virus that infects a host and inserts a base sequence.

In a preferred embodiment of the present application, the transformation method utilizes heat shock transfection, which is a type of electroporation. Heat shock transfection refers to a method of transforming a competent cell prepared for easy transformation in advance by applying heat and electric shock. At this time, it is appropriate to convert cultured host cells into competent cells using conventional methods prior to transformation.

In this case, the cultured host cell may be an animal cell or a microbial cell. Vero cells and CHO cells, which are commonly used, can be used as animal cells. In case of using microbial cells, e. coli can be used.

The fourth and fifth steps are for culturing the transformed cultured host cells and isolating the recombinant proteins.

The culturing step may be carried out by using known culture conditions.

The step of separating the protein may be performed by a method such as cell lysis, centrifugation, gel electrophoresis or the like according to a conventional gene recombination method.

In the practice of the present application, conventional techniques of molecular biology, microbiology, recombinant DNA technology, protein chemistry, and immunology in the art can be used, unless otherwise indicated. These techniques are described in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning, Vols. I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Animal Cell Culture (R. K. Freshney ed., 1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Protein purification methods - a practical approach (E. L. V. Harris and S. Angal, eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell eds., 1986, Blackwell Scientific Publications)

Recombinant expression vector

One example of the present application includes a recombinant expression vector for expression of the desired base sequence.

&Quot; Expression control element " means a nucleotide sequence that regulates the expression of an expression target base sequence as a component of a recombinant expression vector.

&Quot; Expression objective base sequence " means a recombinant base sequence to be expressed as a component of a recombinant expression vector.

One embodiment of a genetic production method of a protein is to transform a cultured host cell after preparing a recombinant expression vector.

First, the expression vector may be a plasmid, an episome vector, or a viral vector. Typically, the form of the expression vector used is, but is not limited to, a plasmid. &Quot; Plasmid " means that a recombinant base sequence can be inserted as a closed circular double stranded DNA sequence.

The recombinant base sequence inserted into the recombinant expression vector may include an expression regulatory element and an expression target base sequence as a component. At this time, the expression regulatory element is preferably an optional constituent but it is included.

In this case, the expression control element refers to elements that regulate expression as well as initiation of transcription of the expression target base sequence. Expression control elements include promoters, enhancers, silencers, insulators, and the like. &Quot; Promoter " means a sequence in which transcription is initiated on a base sequence. &Quot; Enhancer " means a sequence that promotes the transcription of the base sequence when the activator is coupled as a remote control element. A " silencer " is a remote control element that refers to a sequence that inhibits the transcription of the base sequence when the repressor is joined. &Quot; Insulator " means a sequence that interrupts the interaction between the enhancer and the promoter.

The expression target nucleotide sequence means that the recombinant nucleotide sequence is inserted into the recombinant expression vector.

Preferably, the expression control element in the recombinant expression vector is optimized for the host cell codon.

The target nucleotide sequence to be expressed in the recombinant expression vector can be inserted into the step including the first step and the second step of the genetic production method of the protein.

The method using the recombinant expression vector is only one example of the genetic production method. Unless otherwise stated, therefore, it is evident that the method of genetic production includes a method using a recombinant expression vector.

Method for producing immunogenic material

One example of the present application is a method for producing an immunogenic substance.

The immunogenic material produced may itself be a composition of the vaccine or may be used to produce an immunogenic system. Methods for the preparation of immunogenic materials may also be utilized in the manufacture of immunogenic systems.

Methods for genetic production of immunogenic substances

&Quot; Immunogenic target nucleotide sequence " means a nucleotide sequence that is intended to be included in an immunogenic recombinant base sequence.

&Quot; Immunogenic recombinant protein " means an immunogenic protein that is ultimately desired to be produced in a genetic production method.

&Quot; Immunogenic recombinant nucleotide sequence " means a nucleotide sequence encoding an immunogenic recombinant protein.

An " immunogenic recombinant expression vector " means, as an example of a vector, that the immunogenic recombinant base sequence linked to a vector is expressed in vivo. That is, when an immunogenic recombinant expression vector is inserted, production of an immunogenic recombinant protein can be confirmed. Most of such expression vectors are in the form of plasmids, but are not limited thereto.

&Quot; Immunogen incubating host cell " means a cell transformed with an immunogenic recombinant expression vector for the production of an immunogenic recombinant protein.

In one embodiment of the method for producing an immunogenic material, the method of manufacture provides for producing an immunogenic material through a genetic engineering method. The protein to be produced at this time may be an immunogenic recombinant protein, and the immunogenic target base sequence may be an immunogenic part, a non-immunogenic part, a foreign part, or the like.

The method for genetically producing an immunogenic material comprises, in one embodiment, a first step of obtaining an immunogenic target nucleotide sequence, a second step of producing a vector or polynucleotide having an immunogenic recombinant nucleotide sequence containing the immunogenic target nucleotide sequence , A third step of transforming the immunogenic recombinant base sequence into an immunogenic culture host cell, a fourth step of culturing the transformed immunogenic culture host cell, a fifth step of culturing the immunogenic recombinant host cell, Step < / RTI >

The first step is to obtain the immunogenic target nucleotide sequence.

The nucleotide sequence of the wild-type immunogenic material can be obtained by using genbank of ncbi or directly screening pathogens.

Polynucleotides having an immunogenic target nucleotide sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer can be present at about the 20 base sequences present at the 5 ' end of the base sequence of the immunogenic material of interest in the present application, Lt; RTI ID = 0.0 > 20 < / RTI > nucleotides.

The second step is a step of preparing a vector or polynucleotide having an immunogenic recombinant base sequence containing the immunogenic target nucleotide sequence obtained in the first step.

The vector or polynucleotide may be a single-stranded or double-stranded DNA containing an immunogenic target sequence or may be in the form of RNA. The method for producing the polynucleotide may be such that the polynucleotide having the immunogenic target base sequence is ligated through the ligase.

Wherein the immunogenic recombinant base sequence may comprise a promoter necessary for expression. The promoter may be derived from a host cell or artificially introduced separately.

The polynucleotide including the immunogenic recombinant base sequence may also be an immunogenic recombinant expression vector inserted with an immunogenic target base sequence. As a method for inserting an immunogenic target nucleotide sequence into an immunogenic recombinant expression vector, conventional gene recombinant techniques can be used.

The third step is a step of transforming an immunogenic culturing host cell with the immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector prepared in the second step.

Transformation can be classified as "transient transfection" or "permanent transfection" by its effect. In one embodiment of the present application, transient transfection was used.

Transformation can also be categorized as "transgenic by reaction", "transgenic by tool" or "transgenic by virus" depending on the means. Heat shock transfection was used in one embodiment of the present application.

The immunogenic culture host cells include the cultured host cells.

The fourth and fifth steps are for culturing the transformed immunogenic cultured host cell and isolating the immunogenic recombinant protein.

The culturing step may be carried out by using known culture conditions.

The step of isolating the immunogenic recombinant protein can be carried out by conventional methods such as cell lysis, centrifugation, gel electrophoresis and the like.

The immunogenic recombinant expression vector

&Quot; Immunogenicity expression regulatory element " means a nucleotide sequence that regulates the expression of an immunogenic expression target sequence as a component of an immunogenic recombinant expression vector.

&Quot; Immunogenic expression target nucleotide sequence " means a recombinant nucleotide sequence to be expressed as a component of an immunogenic recombinant expression vector.

One embodiment of a method of genetically producing an immunogenic agent is to produce an immunogenic recombinant expression vector and then transform the immunogenic host cell.

The form of the immunogenic recombinant expression vector may be, but is not limited to, a plasmid.

The recombinant base sequence inserted into the immunogenic recombinant expression vector may comprise, as a component, an immunogenicity expression regulatory element and an immunogenic expression target sequence.

The immunogenicity expression control element encompasses the expression control element.

Preferably, the immunogenicity expression control element is optimized in the immunogenic cultured host cell codon.

The immunogenic expression target nucleotide sequence refers to that inserted into the immunogenic recombinant expression vector as the above immunogenic recombinant base sequence.

The immunogenicity expression base sequence is the base sequence of the above immunogenic substance. At this time, the nucleotide sequence for immunogenicity expression may be inserted into the step including the first step and the second step of the genetic preparation method of the immunogenic substance.

The method using recombinant expression vector of immunogenic material is only one example of genetic production method. Therefore, unless otherwise stated, it is clear that methods for genetic production of pathogen, antigen protein, antigen homologous protein, and antigen homologous additive protein include methods using immunogenic material recombinant expression vectors.

[Method of producing pathogens and antigens]

Pathogen preparation method

One example of the present application is a method for producing a pathogen as an immunogenic substance of a vaccine.

- wild-type pathogen

In one embodiment, there is provided a method of producing a pathogen in a wild state.

In one embodiment, the method of manufacture comprises harvesting and culturing. Generally, pathogens can be collected from the secretions, excretions, and dead bodies of diseased organisms. When these are cultured in culture medium or animal cells, they are differentiated into a plurality of pathogens. If the pathogen is sufficiently differentiated, it can be prepared as a vaccine composition. At this time, some pathogens can be stored and cultured to provide a large amount of vaccine.

In another embodiment, the method of manufacture may be a method for the genetic production of a wild-type pathogen. Wherein the genetic manufacturing method encompasses a genetic production method of the immunogenic substance. Wherein the immunogenic target sequence may be a full-length sequence of a wild-type pathogen or a subsequence thereof.

- pathogens that have lost / transformed a particular site

In another embodiment, there is provided a method for producing a pathogen in a state in which a specific site has been deleted, modified or manipulated.

In one embodiment, the method of production may be a method of physically deleting, altering, or manipulating the amino acid / peptide / base sequence that constitutes the pathogen. In this case, a known method can be used as a physical method.

In another embodiment, the method may be a method of chemically deleting, altering or manipulating the amino acid / peptide / base sequence constituting the pathogen. In this case, the deletion, modification, or manipulation method may include treating a pathogen with a specific chemical substance to delete, modify or manipulate a specific site.

In another embodiment, a chemical, e. G., A particular reagent or enzyme, that produces a response to a particular site after obtaining or producing a wild-type pathogen can be treated.

In this case, a known method can be used as a chemical method.

In yet another embodiment, the method of manufacture may be a genetic production method of a deleted, transformed or engineered pathogen.

The genetic manufacturing method encompasses a genetic production method of the immunogenic substance. Wherein the immunogenic target sequence may be a full-length sequence of a wild-type pathogen or a subsequence thereof. A mutation (Point mutation) is performed by PCR in the first step described above, or a specific deletion, modification or deletion is carried out using a mutation kit for an immunogenic recombinant base sequence or an immunogenic recombinant expression vector in a second step Can cause manipulation.

- The overall structure of the modified pathogen

In another embodiment, a method for producing a pathogen with a modified overall structure is provided.

One example is the modification of genetically engineered pathogens.

In one embodiment, the manufacturing method is a physical modification method. In this case, a known method can be used as a physical method.

In one embodiment, the manufacturing method is a chemical modification method. In this case, a known method can be used as a chemical method.

For example, if the virus is highly proliferating, the virus may be obtained and then treated with formalin, beta proprio lactone (BPL), binary ethyleneimine (BEI) or gamma radiation, or by other methods known to those skilled in the art Deactivated. The inactivated virus is then mixed with a pharmaceutically acceptable carrier (such as a saline solution) and optional adjuvants. As a specific example, it may be inactivated at a final concentration of 0.1% formalin.

Another example is the production of modified pathogens by genetic modification methods (genetic recombination methods).

The genetic modification method encompasses a genetic production method of the immunogenic substance.

At this time, the immunogenic target nucleotide sequence may be a full-length sequence of the wild-type pathogen or a partial sequence thereof. Mutation PCR may be performed in the first step described above, or, in the second step, deletion, modification, or manipulation may be performed entirely using the mutagenic kit for the immunogenic recombinant base sequence or the immunogenic recombinant expression vector.

Method for producing antigen protein

One example of the present application is a method for producing an antigen protein as an immunogenic substance of a vaccine. At this time, two or more antigenic proteins of one pathogen can be produced or mixed at the same time.

- wild-state antigen protein

In one embodiment, there is provided a method of producing an antigen protein in a wild state.

In one embodiment, the method of manufacture may be a method of separating the antigenic protein from a wild-type pathogen by a physical method.

The physical method at this time may be, but not limited to, centrifugation. The physical method may be a known method.

In another embodiment, the method of manufacture may be a method of isolating antigen protein from a wild-type pathogen by a chemical method. The chemical method may be a known method.

In another embodiment, the method of manufacture may be a method for the genetic production of a wild-type antigen protein. Vaccines typically produced in this manner are termed subunit vaccines. Wherein the genetic manufacturing method encompasses a genetic production method of the immunogenic substance. The desired nucleotide sequence may be a full-length sequence of the wild-type antigen protein or a partial sequence thereof.

- a site-modified antigen protein

In one embodiment, a method for producing an antigen protein in which a specific site has been modified or engineered is provided.

In one embodiment, the method of manufacture may be a method of modifying wild-type antigenic proteins in a physical manner. The physical method may be a known method.

In another embodiment, the production method may be a method of chemically modifying wild-type antigen protein. The chemical method may be a known method.

In another embodiment, the method of production may be a method for the genetic production of an antigen protein in which a specific site has been modified or engineered. Wherein the genetic manufacturing method encompasses a genetic production method of the immunogenic substance.

The desired nucleotide sequence may be a wild-state antigen protein. Mutagenic PCR is performed in the first step described above, or in the second step, an immunogenic recombinant base sequence or an immunogenically recombinant expression vector is subjected to a mutation kit to remove an antigen protein in which a specific site has been deleted, modified or engineered .

Method for producing antigen homologous protein

One example of the present application is a method for producing an antigen homologous protein as an immunogenic substance of a vaccine.

- an antigen homologous protein comprising one immunogenic site

In one embodiment, there is provided a method of preparing an antigen homologous protein comprising an immunogenic site.

In one embodiment, the moiety comprising the immunogenic site may be a method that is made by limiting the antigen protein produced. Methods for limiting antigenic proteins include physical methods such as centrifugation, and chemical methods using chemical reagents such as proteases.

In a preferred embodiment, the method for producing an antigen-homologous protein may be a genetic preparation method of a part including an immunogenic part. The genetic production method encompasses the genetic production method of the immunogenic substance described above. An immunogenic recombinant protein is an antigen homologous protein comprising at least one immunogenic site. The immunogenic target nucleotide sequence is a nucleotide sequence encoding the immunogenic region.

The first step encompasses obtaining the immunogenic site. The nucleotide sequence of the immunogenic region of the antigen protein can be found by using ncbi genbank or directly screening pathogens.

Polynucleotides containing the desired nucleotide sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, the primer is present at about the 20 base sequences present at the 5 ' end of the base sequence of the immunogenic site of interest in the present application, Lt; RTI ID = 0.0 > 20 < / RTI > nucleotides.

In addition, primers of the immunogenic target sequence can be designed through multiple alignments.

&Quot; Multiple alignment " means proceeding a sequence comparison between multiple protein sequences or base sequences.

&Quot; Common region " means a sequence portion common among a plurality of protein sequences or base sequences.

Multiple alignments between multiple strains of the same disease can identify common regions between antigenic proteins of the same disease strains. The reason why the mutant strains of the pathogen occur is because the antigenic protein of the existing vaccine is not homologous with the antigenic protein of the original vaccinia strain and mutant. Particularly, the immunogenic region of the antigen protein is particularly problematic because it is often a region where mutations actively occur.

Therefore, in order to solve such a problem, the present inventors searched for a common region present in the antigen proteins of the existing strains and mutants, and tried to prepare the antigen by including the immunogenic region between the two common regions.

At this time, two common regions are designed as primers. By performing PCR using the primer sequence at the 5 'end and the primer sequence at the 3' end of such a desired nucleotide sequence, an immunogenic target nucleotide sequence is obtained. Using this, it is possible to clone the target sequence including the immunogenic site without designing a new primer every time a mutant occurs. A primer that is designed through multiple alignments and configured as a common region is defined as a " common region primer ".

Common domain primers through multiple alignments can be a great advantage in the manufacture of the following master vaccine and complex disease master vaccine.

According to the existing vaccine technology, vaccine technology using a pathogen as an immunogenic substance has been problematic in securing the immunogenic substance promptly in the case of a mutant strain which does not have an immunity effect against the existing vaccine strain. When the pathogen is decrypted or attenuated by an immunogenic substance, it takes a long time to obtain a large amount of pathogen by subculturing the mutant strains. At this time, when the pathogen is a virus, it takes more time to cultivate. In addition, even when each mutant antigen protein is used as an immunogenic substance, it is possible to obtain mutant strains, screening mutants, designing and preparing primers at the antigenic protein ends, obtaining a recombinant antigen protein, A step is required.

However, the common region primer by multiple alignment can eliminate the step of screening the mutant and the step of designing and producing the primer in the above step, so that it is possible to cope with the mutant more rapidly. It is well suited for the purpose of master vaccine and multiple disease master vaccine for the purpose of creating strong immunity against allogeneic or heterologous pathogens and mutants thereof.

In one example, the strains that are subject to multiple alignments may be strains of one or more pathogens found in one country.

The strains to be subjected to multiple sorting may be strains of a pathogen occurring in one country and may be of different kinds or types. For example, if the target disease is PRRS, the multi-aligned strains may include North American and European strains.

In another example, the strains to be subjected to multiple sorting may include foreign strains imported from foreign countries in addition to the strains found in one country.

The foreign country may be an adjacent country.

The foreign country can be a country in a specific area. For example, East Asia, Southeast Asia, North America, and Eastern Europe.

The foreign country can be a country located within a certain distance from one country.

Also, the foreign country can be a country where exchange is active. Preferably, it may be an active country associated with livestock. Also, the foreign country can be a country where migratory birds pass through a country.

In another example, strains that are subject to multiple alignments may be selected based on overall homology to a particular strain.

The strains may be selected so that the overall homology to a specific strain is not less than a specific value.

The step of selecting strains to be subjected to multiple sorting includes steps of dividing the strains according to the entire homology to a specific vaccinia, sorting the strains according to the strains, and selecting strains belonging to the strains belonging to each strains to a specific ratio .

At this time, the group may be divided according to the range of homology to a specific strain.

Other methods for selecting strains include methods obvious to those skilled in the art.

The common region primer by multiple alignment of the present application makes it possible to efficiently produce an antigen homologous protein as an immunogenic substance of a vaccine against these various strains and their mutant strains.

The common region primer may correspond to a non-immunogenic region. The common region between the antigenic proteins of the mutant is mostly non-immunogenic. Antigen homologous proteins produced using these common region primers will inevitably contain non-immunogenic sites, including immunogenic sites. At this time, the non-immunogenic region exists at the N-terminus and C-terminus of the antigen-homologous protein and is the same as the sequence of the common region primer.

On the other hand, in the second step, an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector can be prepared by inserting the immunogenic target nucleotide sequence obtained in the first step. At this time, any number of immunogenic sites can be inserted as needed. In one embodiment, the engineered antigen homologous protein may have the form of a tandem linker.

- 1-immunogenic site-1 ... A method for producing an antigen-homologous protein comprising at least two selected from

In one embodiment, there is provided a method of preparing an antigen homologous protein comprising two or more selected from immunogenic site-1 to immunogenic site-n.

Antigen homologous proteins comprising two or more different immunogenic regions of an antigenic protein can be prepared by a genetic engineering method. Wherein the genetic manufacturing method encompasses a genetic production method of the immunogenic substance.

The immunogenic recombinant protein may be an antigen-homologous protein comprising two or more of immunogenic site-1 to immunogenic site-n. The immunogenic target nucleotide sequence may be a nucleotide sequence encoding each immunogenic site-x.

The first step encompasses obtaining each of the immunogenic sites. The nucleotide sequence of the immunogenic region of the antigen protein can be found by using ncbi genbank or directly screening pathogens.

Polynucleotides containing immunogenic target nucleotide sequences can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, those skilled in the art will be able to design suitable primers, for example, primers may contain about 20 nucleotide sequences present at the 5 ' end of the base sequence of each immunogenic site, 20 nucleotides at the 3 ≪ RTI ID = 0.0 > oligonucleotides < / RTI >

The primers of the immunogenic target sequence can also be designed using the above multiple alignments. The primers of the immunogenic subject sequence may be common region primers for each immunogenic site.

The common region primer may correspond to a non-immunogenic region. The common region between the antigenic proteins of the mutant is mostly non-immunogenic. Antigen homologous proteins produced using this common region primer will inevitably contain two or more selected from immunogenic site-1 to immunogenic site-n and non-immunogenic sites. At this time, non-immunogenic regions are present at the 5'-end and 3'-end of each immunogenic target nucleotide sequence and are the same as those of the common region primer.

The second step is a step of preparing an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector by inserting the immunogenic target base sequence obtained in the first step.

The sequence of the inserted immunogenic region may be different from that of the immunogenic region in the wild state. In addition, any number of immunogenic sites may be inserted as needed.

- One… An antigen-homologous protein comprising two or more selected from the immunogenic site

In one embodiment, there is provided a method for producing an antigen-homologous protein comprising two or more selected from a 1-immunogenic site to an m-immunogenic site.

Antigen homologous proteins comprising two or more immunogenic regions of different antigenic proteins can be produced by genetic engineering methods.

The genetic manufacturing method encompasses a genetic production method of the immunogenic substance. Wherein the immunogenic recombinant protein can be an antigen-homologous protein comprising two or more of the m-immunogenic sites from the 1-immunogenic site. The immunogenic target nucleotide sequence is a nucleotide sequence encoding each y-immunogenic region.

The first step encompasses obtaining each of the immunogenic sites. The nucleotide sequence of the immunogenic region of the antigen protein can be found by using ncbi genbank or directly screening pathogens.

Polynucleotides containing an immunogenic target sequence can also be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, those skilled in the art will be able to design suitable primers, for example, primers may contain about 20 nucleotide sequences present at the 5 ' end of the base sequence of each immunogenic site, 20 nucleotides at the 3 ≪ RTI ID = 0.0 > oligonucleotides < / RTI >

The primers of the immunogenic target sequence can also be designed using the above multiple alignments. The primers of the immunogenic subject sequence may be common region primers for each immunogenic site.

The common region primer may correspond to a non-immunogenic region. The common region between the antigenic proteins of the mutant is mostly non-immunogenic. Antigen homologous proteins produced using this common region primer will inevitably contain two or more selected from the 1-immunogenic site to the m-immunogenic site and two selected from the 1-non-immunogenic site to the non- Or more. At this time, non-immunogenic regions are present at the 5'-end and 3'-end of each target nucleotide sequence and are the same as those of the common region primer.

The second step is a step of preparing an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector by inserting the immunogenic target nucleotide sequence obtained in the first step.

The sequence of the inserted immunogenic region may be different from that of the immunogenic region in the wild state. In addition, any number of immunogenic sites may be inserted as needed.

It is apparent that antigen-homologous proteins comprising a plurality of immunogenic regions of a plurality of antigenic proteins can also be prepared by the above-described genetic production methods.

Antigen homologous protein recombinant expression vector

In one embodiment, there is provided an antigen-homologous protein recombinant expression vector for genetic production of an antigen homologous protein.

The antigen-homologous protein recombinant expression vector encompasses the immunogenic recombinant expression vector.

The antigen-homologous protein recombinant expression vector produced according to the above-mentioned 'method for producing an antigen-homologous protein' can be provided.

In one embodiment, the immunogenic expression target sequence may comprise the nucleotide sequence of the immunogenic site.

As a first aspect, the immunogenicity regulating element may be a promoter.

The promoter may be a promoter in a wild state.

Preferably, the promoter is optimized for immunogenic cultured host cells.

The promoter may be a wild-type promoter derived from an immunogenic culturing host cell, or may be a promoter introduced separately.

The promoter may be a wild-type promoter modified at some sites. At this time, the modified promoter may have an improved initiation efficiency.

As a second aspect, the immunogenic expression objective base sequence may comprise the base sequence of the immunogenic site.

The nucleotide sequence of the immunogenic site may comprise a non-immunogenic region corresponding to the common region primer sequence at the 5 ', 3' terminus.

The immunogenic expression objective base sequence may comprise multiple base sequences of one or more immunogenic regions.

The arrangement of the overall configuration is preferably a promoter-immunogenic site. 18 shows an example of an antigen-homologous protein recombinant expression vector comprising a promoter and a base sequence of 1-immunogenic site-1.

In another embodiment, the immunogenic expression objective base sequence may comprise two or more base sequences selected from immunogenic site-1 to immunogenic site-n.

As a first aspect, the immunogenicity regulating element may be a promoter.

The promoter includes the above-mentioned promoter. The term " promoter " includes all the promoters of the first embodiment.

As a second aspect, an immunogenic expression objective base sequence may comprise two or more base sequences selected from immunogenic site-1 to immunogenic site-n.

The nucleotide sequence of the immunogenic site may comprise a non-immunogenic region corresponding to the common region primer sequence at the 5 ', 3' terminus.

The immunogenic expression objective base sequence may comprise multiple base sequences of one or more immunogenic regions.

It is preferable that the arrangement of the whole constitution is a promoter- (immunogenic region-x) z. z means the number of immunogenic sites contained in the vector. 19 is an example of an antigen homologous protein recombinant expression vector comprising a promoter and a base sequence of 1-immunogenic site-1 and 1-immunogenic site-2.

At this time, the sequence of the immunogenic site may be different from the wild-type antigen protein.

In another embodiment, the immunogenic expression objective base sequence may comprise two or more base sequences selected from the 1-immunogenic site to the m-immunogenic site.

As a first aspect, the immunogenicity regulating element may be a promoter.

Here, the promoter includes the above promoter.

As a second aspect, the immunogenic expression objective base sequence may include two or more base sequences selected from the 1-immunogenic site to the m-immunogenic site.

The nucleotide sequence of the immunogenic site may comprise a non-immunogenic region corresponding to the common region primer sequence at the 5 ', 3' terminus.

The immunogenic expression objective base sequence may comprise multiple base sequences of one or more immunogenic regions.

Preferably, the overall configuration is an promoter- (y-immunogenic site) z. z means the number of immunogenic sites contained in the vector. 20 shows an example of an antigen-homologous protein recombinant expression vector comprising a promoter and a base sequence of 1-immunogenic site-1 and 2-immunogenic site-2.

The sequence of the immunogenic site may be different from the wild-type antigen protein.

From the above-mentioned constitution, it is apparent that an antigen-homologous protein recombinant expression vector in which an immunogenic expression objective base sequence comprises a plurality of immunogenic regions of a plurality of antigen proteins can also be produced.

Antigen homologous protein

One example of the present application is a method for producing an antigen homologous portion of a protein as an immunogenic substance of a vaccine.

The term " immunogenic site " used herein to describe a method for producing a genetic protein of an antigen includes not only the immunogenic site mentioned in the above " method for producing an antigen homologous protein " Concept. Hereinafter, " immunogenic site " means a y-antigen protein or a y-immunogenic site-x.

A method for producing an antigen homologous portion protein comprising an immunogenic portion and a nonantigen portion

In one embodiment, an antigen-homologous moiety comprising an immunogenic site and a non-antigenic moiety provides a method for producing a protein.

An antigen homologous portion protein comprising an immunogenic portion and a non-antigenic portion can be produced by a genetic engineering method. Wherein the genetic manufacturing method encompasses a genetic production method of the immunogenic substance. Immunogenic recombinant proteins are proteins that are antigen homologous, including immunogenic sites and non-antigenic sites. The immunogenic subject nucleotide sequence includes the nucleotide sequence of the immunogenic region and the nucleotide sequence of the non-immunogenic region.

The first step encompasses obtaining the immunogenic target nucleotide sequence.

The nucleotide sequence of the immunogenic site can be obtained by a method comprising a genetic preparation method of the antigen protein and a first step of a genetic preparation method of the antigen homologous protein.

The nucleotide sequence of the noncontiguous part of the pathogen can be determined by using ncbi genbank or directly screening the pathogen.

Polynucleotides containing an immunogenic target sequence can also be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer can be present at about the 20 base sequences present at the 5 ' end of the base sequence of the immunogenic material of interest in the present application, Lt; RTI ID = 0.0 > 20 < / RTI > nucleotides.

The primers of the immunogenic target sequence can also be designed using the above multiple alignments. The primers of the immunogenic subject sequence may be common region primers for each immunogenic target sequence. The immunogenic target nucleotide sequence may have a sequence of a common region primer at the 5 'end and the 3' end.

The second step is a step of preparing an immunogenic recombinant base sequence or an immunogenic recombinant expression vector by inserting the immunogenic subject base sequence obtained in the first step.

The sequence of the inserted immunogenic region may be different from that of the immunogenic region in the wild state. In addition, any number of immunogenic regions or non-antigenic regions can be inserted as needed.

In one embodiment, the non-antigenic portion may be part of the outer membrane protein of the pathogen.

In other embodiments, the non-antigenic portion may be part of a protein having immunosuppressive function.

- a method for producing an antigen homologous portion comprising an immunogenic region and a foreign part

In one embodiment, an antigen homologous portion comprising an immunogenic portion and an exogenous portion provides a method for producing a protein.

Antigen homologous portion proteins, including immunogenic regions and foreign regions, can be produced by genetic engineering methods. Wherein the genetic manufacturing method encompasses a genetic production method of the immunogenic substance. Immunogenic recombinant proteins are proteins that are antigen homologous, including immunogenic sites and foreign sites. The immunogenic target nucleotide sequence is the nucleotide sequence of the immunogenic region and the nucleotide sequence of the foreign gene. At this time, the foreign part can be broadly classified into those derived from proteins of other pathogens or those derived from totally different exogenous proteins. For the sake of convenience, the outpatient part derived from the protein of another pathogen is defined as "the outpatient part of the other pathogen", and the outpatient part derived from the different outpatient protein is defined as the "outpatient part of the consultation".

The first step encompasses obtaining the immunogenic target nucleotide sequence.

The method for obtaining the base sequence of the immunogenic region encompasses the first step of the genetic preparation method of the antigen protein and the genetic preparation method of the antigen homologous protein.

Outside sequences of other pathogens can be found using ncbi genbank or directly screening other pathogens. The nucleotide sequence of the foreign part of the consultation can be found by using ncbi genbank or by directly screening the protein after separation and purification.

Polynucleotides containing immunogenic target nucleotide sequences can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer can be present at about the 20 base sequences present at the 5 ' end of the base sequence of the immunogenic material of interest in the present application, Lt; RTI ID = 0.0 > 20 < / RTI > nucleotides.

The primers of the immunogenic target sequence can also be designed using the above multiple alignments. The primers of the immunogenic subject sequence may be common region primers for each immunogenic target sequence. In this case, the immunogenic target nucleotide sequence may have a sequence of a common region primer at the 5 'end and the 3' end.

The second step is a step of preparing an immunogenic recombinant polynucleotide or an immunogenic recombinant expression vector by inserting the immunogenic target nucleotide sequence obtained in the first step.

The sequence of the inserted immunogenic region may be different from that of the immunogenic region in the wild state. Also, any number of immunogenic sites or foreign parts can be inserted as needed.

In one embodiment, the foreign part can be a foreign part of another pathogen.

The foreign part of the other pathogen may be an immunogenic part on the antigen protein of another pathogen.

The foreign part of another pathogen may be a non-immunogenic part or non-antigenic part of another pathogen.

In other embodiments, the foreign part may be a foreign part of the consultation.

It is evident that the above-described genetic engineering methods can also produce proteins with one or more immunogenic regions, one or more non-antigens, and one or more foreign domains.

When the antigen homologous portion is a protein recombinant expression vector

In one embodiment, the antigen-homologous moiety for genetic production of a protein by an antigen-homologous moiety provides a protein recombinant expression vector.

The antigen-homologous protein recombinant expression vector encompasses the immunogenic recombinant expression vector.

The antigen-homologous portion made according to the 'method for producing an antigen-homologous portion of a protein' may provide a protein recombinant expression vector.

In one embodiment, the immunogenic expression base sequence of interest may comprise an immunogenic site, a non-antigenic base sequence.

As a first aspect, the immunogenicity regulating element may be a promoter.

In one embodiment, the promoter may be a promoter in a wild state.

Preferably, the promoter is optimized for immunogenic cultured host cells.

The promoter may be a wild-type promoter of an immunogenic culturing host cell, or may be an artificially introduced promoter.

The promoter may be a wild-type promoter modified at some sites. At this time, the modified promoter may have an improved initiation efficiency.

As a second aspect, the immunogenic expression target base sequence may include an immunogenic site, a non-antigenic base sequence.

The nucleotide sequence of the immunogenic region encompasses the genetic production method of the antigen protein, the nucleotide sequence obtained in the first step of the genetic production method of the antigen homologous protein.

In addition, the immunogenic expression objective base sequence may include a plurality of immunogenic regions and non-antigenic regions.

The arrangement of the overall constitution is preferably promoter- (immunogenic site-antagonistic) z. z means that the immunogenic part and non-antigenic part can be included in any order with any number.

In one embodiment, the recombinant expression vector is defined as a " pathogen-like particle recombinant expression vector " when the non-antigenic part is part of the outer membrane protein of the pathogen. Figure 21 is an illustration of a recombinant expression vector for a pathogen-like particle comprising a promoter, a 1-immunogenic site-1, and a base sequence of an outer membrane protein.

In another embodiment, the recombinant expression vector is defined as an " auxiliary immunoaddition recombinant expression vector " when the non-antigenic portion is part of a protein having immunocompetent function. Figure 22 is an illustration of a recombinant expression vector for an accessory immunostain comprising a promoter, a 1-immunogenic site-1, and a base sequence of a non-antigenic moiety having immuno-assisting function.

In another embodiment, the immunogenic expression base sequence of interest may comprise an immunogenic region, an exogenous base sequence.

As a first aspect, the immunogenicity regulating element may be a promoter.

Here, the promoter includes the above promoter. The term " promoter " includes all the promoters of the first embodiment.

As a second aspect, an immunogenic expression target base sequence may include an immunogenic region, an exogenous base sequence.

The nucleotide sequence of the immunogenic region encompasses the genetic production method of the antigen protein, the nucleotide sequence obtained in the first step of the genetic production method of the antigen homologous protein.

The immunogenic expression objective base sequence may comprise a plurality of immunogenic regions, exons.

The arrangement of the overall constitution is preferably a promoter- (immunogenic site-foreign part) z.

In one embodiment, the recombinant expression vector is defined as a " poly-immunogenic recombinant expression vector " when the foreign part is an immunogenic region on the antigen protein of another pathogen. Figure 23 is an illustration of a polyimmunized recombinant expression vector comprising the promoter, the 1-immunogenic site-1, and the nucleotide sequence of the immunogenic site of the other pathogen.

In one embodiment, the recombinant expression vector is defined as a " multivalent pathogen-like particle recombinant expression vector " when the foreign part is a non-immunogenic or non-antigenic part of another pathogen. 24 is an illustration of a multivalent pathogen-like particle recombinant expression vector comprising the promoter, 1-immunogenic site-1, and non-immunogenic and non-antigenic sites of other pathogens.

In another embodiment, the recombinant expression vector is defined as an " auxiliary immunoaddition recombinant expression vector " when the foreign antibody is part of a protein having immunocompetent function.

[Production method of immunogenic system]

Method of manufacturing an immunogenic system

One example of the present application is a method for preparing an immunogenic system.

An " immunogenic system component " is a component of an immunogenic system and includes system structures, immunogenic materials, surface constructs, fusions, polymers, and the like.

As a method for producing the above immunogenic system, for example, there are two methods as follows.

First, the immunogenic system components can each be prepared and assembled into an immunogenic system post-mortem. This involves making each immunogenic system component separately and then combining it into an immunogenic system.

Alternatively, an immunogenic system can be prepared as a whole. This method is a method in which the immunogenic system is produced in a single step without any distinction of steps, by means of a genetic manufacturing method, without manufacturing the individual components.

The produced immunogenic system may itself be a composition of the vaccine.

Method of manufacturing immunogenic system components

When a method of manufacturing an immunogenic system is used in which each of the immunogenic system components is separately prepared and the immunogenic system is subsequently assembled, each immunogenic system component is first prepared.

- Method of manufacturing a system structure

In one embodiment, a method of fabricating a system structure is provided.

If the system construct is a virus, bacteria, or spore, it can be produced by passaging. It may also be produced by a genetic manufacturing method.

When the system structure is an artificial structure, an artificial structure having a size similar to that of a microorganism can be produced by a conventional method. For example, a method for manufacturing an artificial structure may be a step of applying an artificial structure to a phospholipid solution and applying it with a phospholipid.

- genetic production of immunogenic system components

&Quot; Component target nucleotide sequence " means a nucleotide sequence that is intended to be included in a component recombinant base sequence.

&Quot; Recombinant system component " means an immunogenic system component produced by a genetic engineering method.

&Quot; Component recombinant nucleotide sequence " means a nucleotide sequence encoding a recombinant system component.

A " component recombinant expression vector " means, as an example of a component recombinant vector, that a component recombinant base sequence linked to a vector is expressed in vivo. Most of such expression vectors are in the form of plasmids, but are not limited thereto.

&Quot; Component incubating host cell " means a cell that is transformed and transfected with a component recombinant expression vector for the production of a recombinant system component.

In one embodiment, the immunogenic system provides a method of producing an immunogenic system component via a genetic manufacturing method. The protein to be produced at this time is a recombinant system component and the constituent target base sequence is a base sequence of a recombinant system component. The recombinant system components can be system structures, immunogenic materials, surface constructs, fusions, polymers, and the like.

In one embodiment, the genetic method of producing an immunogenic system component comprises, in one embodiment, a first step of obtaining a component objective base sequence, a second step of producing a polynucleotide having a constituent recombinant base sequence containing a constituent objective base sequence , A third step of transforming the component recombinant base sequence into a component culturing host cell, a fourth step of culturing the transformed component culture host cell, a fifth step of culturing the component recombinant host sequence, Step < / RTI >

The first step is the step of obtaining the component objective base sequence. The nucleotide sequence of the immunogenic system component in the wild state can be determined using ncbi genbank or directly screening immunogenic system components.

In addition, polynucleotides containing a constituent base sequence can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer comprising about 20 nucleotide sequences at the 5'end of the nucleotide sequence of the immunogenic system component, 20 nucleotides at the 3'end Lt; RTI ID = 0.0 > oligonucleotides < / RTI >

In addition, the primers of the constituent base sequences can be designed through multiple alignments.

The second step is a step of preparing a polynucleotide having a component recombinant base sequence comprising the constituent target nucleotide sequence obtained in the first step.

A polynucleotide comprising a constituent recombinant base sequence may be single-stranded or double-stranded DNA or RNA containing a constituent base sequence.

The method for producing a polynucleotide may be such that a polynucleotide having a component objective base sequence is ligated through a ligase.

The constituent recombinant base sequence may comprise a promoter of the component culturing host cell necessary for expression.

A polynucleotide comprising a constituent recombinant base sequence may be a constituent recombinant expression vector into which a constituent base sequence has been inserted. The method of inserting the component target sequence into the component recombinant expression vector can be carried out by conventional gene recombination techniques.

The third step is a step of transforming the component culture host cells with the component recombinant polynucleotide or the component recombinant expression vector prepared in the second step.

Transformation can be classified as "transient transfection" or "permanent transfection" by its effect. In one embodiment of the present application, transient transfection was used.

Transformation can also be categorized as "transgenic by reaction", "transgenic by tool" or "transgenic by virus" depending on the means. Heat shock transfection was used in one embodiment of the present application.

The component culturing host cells include the culturing host cells.

In the fourth and fifth steps, the transformed component culture host cells are cultured and the recombinant system components are separated.

The culturing step can be carried out under ordinary culture conditions.

The step of separating the components of the recombinant system can be performed by conventional gene recombination techniques.

- component recombinant expression vector

&Quot; Component expression regulatory element " means a nucleotide sequence that regulates the expression of a component expression target base sequence as a constituent of a component recombinant expression vector.

&Quot; Component expression target nucleotide sequence " means a component recombinant base sequence to be expressed as a constitution of a component recombinant expression vector.

One embodiment of a method of genetic production of an immunogenic system component is to produce a component recombinant expression vector and then transform the component culturing host cells.

The form of the component recombinant expression vector may be, but is not limited to, a plasmid.

The constituent recombinant base sequence inserted into the component recombinant expression vector may include a component expression regulatory element and a component expression base sequence.

The component expression regulatory element encompasses the expression regulatory element.

The element expression target nucleotide sequence refers to the inserted element recombinant expression vector as the constituent recombinant nucleotide sequence.

The component expression regulatory element is preferably codon optimized for the component cultured host cell.

The immunogenic expression objective nucleotide sequence is the nucleotide sequence of the immunogenic system component.

Wherein the expression objective nucleotide sequence can be inserted into a step including a first step and a second step of the genetic production method of the immunogenic system component.

The method using the component recombinant expression vector is only one example of the genetic production method. Thus, unless stated otherwise, it will be appreciated that the methods of genetic production of immunogenic system components described below include methods using component recombinant expression vectors.

Methods for Genetic Production of Immunogenic Systems

&Quot; System target nucleotide sequence " means a nucleotide sequence of an immunogenic system component that is intended to be included in a system recombinant base sequence.

&Quot; Immunogenic system component " means a system structure, an immunogenic material, a surface construct, a fused body, a polymer, etc., constituting an immunogenic system.

&Quot; Recombinant system " means any immunogenic system that is ultimately intended to be produced in a genetic production method.

&Quot; A system recombinant nucleotide sequence " means a nucleotide sequence encoding a recombination system.

A " system recombinant vector " means, in one embodiment of the recombinant vector, that the recombinant base sequence linked to the vector is a system recombinant base sequence.

A " system recombinant expression vector " refers to one embodiment of a system recombinant vector, wherein the system recombinant base sequence linked to the vector functions to express the entire system structure as a recombinant system. That is, when the system recombinant expression vector is inserted, it is possible to confirm the production of the recombination system. Most of such expression vectors are in the form of plasmids, but are not limited thereto.

&Quot; pre-system structure " system refers to a system construct that is transformed into a recombinant expression vector and expressed in a recombinant system.

In one embodiment, the immunogenic system provides a method of making through a genetic manufacturing method. In this case, the recombinant system to be produced is an immunogenic system, and the system target sequence is an immunogenic system component.

A method for genetic production of an immunogenic system comprises a first step of obtaining a systematic base sequence, a second step of producing a polynucleotide having a system recombinant base sequence including a systematic base sequence, a step of preparing a system recombinant base sequence A third step of transforming, a fourth step of culturing the transformed whole system structure, and a fifth step of extracting the recombination system successfully expressed from the unexpressed whole system structure.

The first step is to obtain a systematic base sequence.

The nucleotide sequence of the immunogenic system component in the wild state can be obtained by using ncbi genbank or screening direct immunogenic system components.

Polynucleotides containing the systematic base sequences can be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer having about 20 nucleotide sequences at the 5 'end of the nucleotide sequence of the immunogenic system component identified in the above process, May be oligonucleotides of about 20 nucleotides in length.

The second step is a step of producing a polynucleotide having a system recombinant base sequence including the systematic base sequence obtained in the first step.

The polynucleotide comprising the system recombinant base sequence may be single-stranded or double-stranded DNA or RNA, which simply contains the systematic base sequence.

The method for producing a polynucleotide may be such that a polynucleotide having a systematic base sequence is ligated through a ligase.

The system recombinant base sequence may comprise a promoter of the entire system structure required for expression.

The polynucleotide including the system recombinant base sequence may be a system recombinant expression vector into which the desired base sequence is inserted. Conventional gene recombination techniques can be used to insert the desired nucleotide sequence into the system recombinant expression vector.

The third step is a step of transforming the entire system structure with the system recombinant polynucleotide or the system recombinant expression vector prepared in the second step.

Transformation can be classified as "transient transfection" or "permanent transfection" by its effect. In one embodiment of the present application, transient transfection was used.

Transformation can also be categorized as "transgenic by reaction", "transgenic by tool" or "transgenic by virus" depending on the means. One embodiment of the present application utilized heat shock transfection.

The entire system structure encompasses the system structure.

In the fourth and fifth steps, the transformed whole system construct is cultured to express the recombinant system, and then the recombinant system that has been successfully expressed is isolated.

The culturing step can be carried out under ordinary culturing conditions.

The separation step of the recombinant system can be performed by a method such as classification using antibiotic resistance by a conventional gene recombination method.

- system recombinant expression vector

&Quot; System expression regulatory element " means a nucleotide sequence that regulates the expression of a nucleotide sequence of interest expressed as a component of a system recombinant expression vector.

&Quot; System expression target nucleotide sequence " means a system recombinant nucleotide sequence to be expressed as a component of a system recombinant expression vector.

One embodiment of a method of genetic production of an immunogenic system is to produce a system recombinant expression vector followed by transformation of the entire system construct.

The form of the system recombinant expression vector may be, but is not limited to, a plasmid.

The system recombinant base sequence inserted into the system recombinant expression vector may include a system expression regulatory element and a system expression target base sequence.

System expression regulatory elements encompass the expression regulatory elements.

The system expression target nucleotide sequence refers to the nucleotide sequence inserted into the system recombinant expression vector as the system recombinant nucleotide sequence.

The system expression regulatory elements are preferably codon-optimized for the entire system structure.

The system expression objective base sequence is the above immunogenic system.

The system expression objective nucleotide sequence may be inserted into a step including the first step and the second step of the genetic production method of the immunogenic system.

The method using a system recombinant expression vector is only one example of a genetic production method. Unless otherwise stated, therefore, it is clear that the method of genetic preparation of the immunogenic system includes a method using a system recombinant expression vector.

Method for manufacturing immunogenicity internal carrying system

One example of the present application is a method for producing an immunogenic inner support system as an immunogenicity system of a vaccine.

For example, there are two methods for producing an immunogenic inner support system.

As a method, there is a method of preparing a carrier and a carrier immunogen, respectively, and carrying the carrier immunogen on a carrier. This involves the steps of making each component separately and then combining it into the system.

Alternatively, it is a method of preparing an immunogenic inner support system as a whole. This method is a method in which the internal supporting system is manufactured in a single step without discrimination of steps, through a genetic manufacturing method, without manufacturing respective components.

- Preparation method of carrier

In one embodiment, there is provided a method for producing a carrier.

The method of preparing the carrier includes the method of manufacturing the system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a carrier having charge inside the carrier.

The charge inside the carrier may be caused by a substance which charges. The chargeable material may be a recombinant protein by a genetic method.

Further, the chargeable substance can be injected from the outside into the inside of the carrier. At this time, the injection method may be a conventional method in microbiology, and may be specifically, for example, microprojectile.

In another embodiment, the manufacturing method is a manufacturing method of a carrier having an external charge.

The charge on the outside of the support may be caused by a substance which charges. At this time, a substance having charge can be adsorbed on the carrier. The adsorption method can be carried out by mixing the carrier with a chargeable substance and keeping it at a constant temperature.

- Method for producing immobilized immunogenic material

In one embodiment, there is provided a method of preparing a supported immunogenic material.

The method of preparing a supported immunogenic material encompasses a method for producing said immunogenic material.

In one embodiment, the method of manufacture may be a method of preparing a charged immunogenic material.

The charge of the immunogenic material may be due to a substance that is charged. At this time, the charged substance can be adsorbed to the carrier immunogenic material. The adsorption method may be to mix the immobilized immunogenic material with a chargeable material and leave it at constant temperature.

- Supporting method of supported immunogenic material

In one embodiment, there is provided a method for supporting a carrier immunogenic substance on a carrier.

The supported immunogenic material may be injected from the outside into the carrier. In this case, the injection method may be a conventional method in microbiology, and a specific example may be micropecific.

- Genetic Production Method of Immunogenic Inorganic Carrier System

In one embodiment, a method of genetically producing an immunogenic internal support system is provided.

Immunogenicity A method for the genetic production of an internal carrier system encompasses a method for the genetic production of an immunogenic system.

The systematic base sequence includes the carrier immunogenic material. A systemic base sequence may comprise a chargeable material.

The sequence of the carrier immunogenic material may include the signal sequence of the internal protein of the carrier.

- Immunogenic internal carrying system Recombinant expression vector

In one embodiment, there is provided an immunogenic inner support system recombinant expression vector for genetic production of an immunogenic inner support system.

Immunogenic internal support system Recombinant expression vectors encompass system recombinant expression vectors.

The system expression objective base sequence includes the supported immunogenic material. At this time, the nucleotide sequence of the system expression target may include a substance having a charge.

Method for manufacturing an immunogenic fused display system

One example of the present application is a method for producing an immunogenic fused display system as an immunogenic system of a vaccine.

There are two methods for manufacturing an immunogenic fused display system, for example.

As one method, there is a method in which a fused display body and a fused body are produced, respectively, and the fused body is bonded to the outside of the fused display body. This involves the steps of making each component separately and then combining it into the system.

Alternatively, it is a method of manufacturing an immunogenic fused display system as a whole. This method is a method in which a fusion display system is manufactured in a single step without discrimination of steps through a genetic manufacturing method without manufacturing respective components.

- Manufacturing method of fused display body

In one embodiment, a method of making a fused display body is provided.

A method for producing a fused display body encompasses the method for manufacturing the system structure.

In one embodiment, the manufacturing method may be a manufacturing method of a fused display body having charges on the outside of the fused display body.

Electric charge outside the fused display body may be generated by a substance which charges the outside of the fused display body. At this time, a substance having a charge can be adsorbed on the fused display body. The adsorption method may be to put the fused display body in a solution of the chargeable substance and leave it at a constant temperature.

-Fabrication method of fusants

In one embodiment, there is provided a method of preparing a fusion.

Methods for producing fusions encompass methods of making such immunogenic system components.

In one embodiment, a method for producing a fusion substance comprises the steps of preparing a surface immunogenic substance and a surface integrant by the method of producing the immunogenic system component, coupling the surface immunizing substance with the surface immunizing substance .

The method of making the surface construct may be a genetic manufacturing method.

The method for producing the fusion immunogenic material may be a genetic manufacturing method.

Methods of making fusion immunogenic materials encompass a method for the genetic production of such immunogenic substances.

In another embodiment, the method of producing a fusion body may be a method of genetic production of an immunogenic system component.

In the genetic production method, the desired base sequence includes fused immunogenic substances and surface integrants. The desired base sequence may also include a fused immunogenic material, a surface construct, and a fusion moiety.

- Fusion Display Fusion Method of Fusion Body

In one embodiment, there is provided a method of attaching a fusion body to a fusion display body.

The binding method may be to leave the fusion body in the same solution as the fusion display body at a constant temperature. Preferably, the fusing body may be initiated outside the fused display body by the function of the surface opening of the fusing body.

- genetic method of producing an immunogenic fusion display systems

In one embodiment, a method of genetically producing an immunogenic fusion display system is provided.

Methods for the genetic production of immunogenic fused display systems encompass genetic production methods for such immunogenic systems. In this case, the system target base sequence includes a surface construct, a fusion immunogenic substance. Wherein the systematic base sequence may comprise a fusion site.

The promoter of the surface construct and the surface construct may be integrated into the target sequence of the system.

- Immunogenic fusion display system Recombinant expression vector

In one embodiment, an immunogenic fusion display system recombinant expression vector for genetic production of an immunogenic fusion display system is provided.

The immunogenic fused display system recombinant expression vector encompasses the system recombinant expression vector.

The system expression regulatory element may be a promoter that initiates transcription of a surface construct in the wild.

The system expression target base sequence includes a surface construct, a fusion immunogenic substance. At this time, the nucleotide sequence of the system expression target may include a fusion site.

The promoter of the surface construct and the surface construct may be integrated into the target sequence of the system.

Method of manufacturing an immunogenic coupling display system

One example of the present application is a method of producing an immunogenic coupled display system as an immunogenic system of a vaccine.

A method of making an immunogenic coupling display system comprises the steps of producing a coupling immunogenic material and a coupling display body, respectively, comprising a coupling unit, causing coupling coupling between the coupling display body and the coupling immunogenic material, .

- Manufacturing steps of coupling display body including display body coupler

In one embodiment, there is provided a method of manufacturing a coupling display body comprising a display body coupling device.

The manufacturing method of the coupling display body may include the steps of manufacturing the system structure and forming the display body coupling device in the system structure.

The system structure may be manufactured by the method of manufacturing the system structure.

The display body coupler can also be formed by conventional methods used to cause cross-linking between proteins. The display checker coupling device may also be included in a system structure in a wild state. The display body coupling unit may be a cysteine thiol group.

- Method for producing coupled immunogenic material including immunogenic material coupling group

In one embodiment, there is provided a method of preparing a coupling immunogenic material comprising an immunogenic material coupling group.

The method of making the coupling immunogenic material may comprise the steps of producing the immunogenic material and forming an immunogenic material coupling agent in the immunogenic material.

An immunogenic substance can be produced by the method for producing the immunogenic substance.

Immunogenic material coupling agents can also be formed by conventional methods used to cause cross-linking.

The immunogenic material coupling group may also be contained in an immunogenic material in a wild state. The immunogenic agent coupling group may be a thiol group of cysteine.

Coupling coupling step

In one embodiment, there is provided a step of causing a coupling bond between the coupling display body and the coupling immunogenic material.

At this time, the coupling coupling can be achieved by the normal coupling reaction conditions.

Method for manufacturing an immunogenic attachment display system

One example of the present application is a method for producing an immunogenic attachment display system as an immunogenic system of a vaccine.

Methods for manufacturing an immunogenic attachment display system include, for example, the following two methods.

As one method, there is a method of producing an attachment display body and an attachment immunogenic substance, respectively, and attaching the attachment immunogenic substance to the attachment display body. This involves the steps of making each component separately and then combining it into the system.

Alternatively, it is a method of manufacturing an immunogenic attachment display system as a whole. This method is a method in which an attached display system is manufactured in a single step without discrimination of steps through a genetic manufacturing method without manufacturing respective components.

- Manufacturing method of attached display body

In one embodiment, a method of making an attached display body is provided.

A method of manufacturing an attached display body encompasses a method of manufacturing the system structure.

In one embodiment, the manufacturing method may be a manufacturing method of an attached display body charged inside the attached display body.

The charge inside the attached display body may be caused by a substance which charges the inside of the attached display body. In this case, the charged substance may be a protein produced by genetic recombination. In addition, a chargeable material can be injected from the outside into the attached display body. In this case, the injection method may be a conventional method in microbiology, and may be micropecific as a specific example.

In another embodiment, the manufacturing method may be a manufacturing method of an attached display body having an electric charge outside the attached display body.

At this time, the charge outside the attached display body may be caused by a substance which charges the outside of the attached display body. The charged material can be adsorbed to the attached display body. The adsorption method may be that the attached display body is placed in a solution of a chargeable substance and allowed to stand at a constant temperature.

- Method for the manufacture of attachment immunogenic material

In one embodiment, there is provided a method of making an attachment immunogenic material.

A method for producing an attachment immunogenic material encompasses a method for producing the immunogenic substance.

In one embodiment, the method of manufacture may be a method for the preparation of a chargeable attachment immunogenic material.

The charge of the attachment immunogenic material may be due to a substance which charges. The chargeable material can be adsorbed to the attachment immunogenic material. The adsorption process may be by placing the adherent immunogenic material in a solution of the charged material and allowing it to stand at a constant temperature.

- Attachment of attachment immunogenic material

In one embodiment, there is provided a method of attaching an attachment immunogenic material to an attached display body.

The attachment method may be a method in which the adhered immunogenic substance is placed in the same solution as the adhered display body and allowed to stand at a constant temperature. At this time, the adhesive immunogenic material and the attached display body interact to attach the adhesive immunogenic substance to the attached display body.

- Genetic method for immunogenic attachment display system

In one embodiment, a method for genetically producing an immunogenic attachment display system is provided.

Methods for the genetic production of immunogenic attachment display systems encompass genetic production methods for immunogenic systems. Wherein the systematic base sequence comprises an attachment immunogenic material. The systematic base sequence may comprise a chargeable material.

- immunogenic attachment display system recombinant expression vector

In one embodiment, an immunogenic attachment display system recombinant expression vector for genetic production of an immunogenic attachment display system is provided.

Immunogenic Attachment Display System Recombinant expression vectors encompass system recombinant expression vectors. At this time, the nucleotide sequence of interest of the system expression includes the attachment immunogenic substance. The nucleotide sequence of interest for system expression may include a chargeable substance.

Method for manufacturing an immunogenic cross-coupled display system

One example of the present application is a method for producing an immunogenic cross-linked display system as an immunogenic system of a vaccine.

A method of making an immunogenic cross-linked display system comprises: fabricating a display system in which the cross-linked immunogenic material is disclosed; And adding a polymer to the display system to form a cross-linked network structure.

- Manufacturing method of display system

In one embodiment, a cross-linked immunogenic material is first provided as a method of making the disclosed display system.

A manufacturing method of a display system may be a manufacturing method of an immunogenic fusion display system.

A manufacturing method of a display system may be a manufacturing method of an immunogenic coupling display system.

A manufacturing method of a display system may be a manufacturing method of an immunogenic attachment display system.

The immunogenic material of the display system preferably has a cross-linker. The cross-linker may be comprised in an immunogenic material in a wild state. For example, the cross-linker is a hydroxy group. Further, the cross coupler may be a coupling group. The coupling unit may be formed by a known method used to induce cross-linking between proteins.

- Method of forming cross-linked net structure

In one embodiment, a method of forming a cross-linked net structure is provided.

The cross-linking net structure is formed by adding a polymer to the resulting display system to cause cross-linking.

The cross-linking can occur by conventional coupling reaction conditions.

The polymer may also be a conventional reagent used to cause cross-linking between proteins. For example, the polymer may be glutaraldehyde and the cross-linking reaction may be an aldol condensation reaction.

Method of manufacturing immunogenicity serial connection system

One example of the present application is a method for producing an immunogenic serial connection system as an immunogenic system of a vaccine.

For example, there are two methods for manufacturing an immunogenicity serial connection system.

One method is to prepare an immunogenic serial link and couple it with a serial link system structure. This involves the steps of making each component separately and then combining it into the system. Since the series connection system is characterized by the structure of the immunogenic material, there is no limitation on the type of the series connection system structure, and the manufacturing method of the series connection system structure may vary depending on the mode of the system.

Alternatively, it is a method of manufacturing an immunogenic serial connection system as a whole. This method is a method in which a serial connection system is manufactured in a single step without discrimination of steps through a genetic manufacturing method without manufacturing respective components.

- Method for producing protein x

In one embodiment, a method of producing an immunogenic series linker comprises providing a first linkage after each of the first protein is prepared, and then combining.

As a first step, a method for producing the x protein.

When the x-th protein is an immunogenic substance, the method for producing the x-protein includes the method for producing the immunogenic substance.

The xylan protein is preferably produced by a genetic production method.

When the x-th protein is an immunogenic substance, the method for producing the x-protein encompasses the method for producing the immunogenic substance.

If the x-protein is not an immunogenic substance, the method for producing the x-protein encompasses the genetic production method of the protein or the genetic production method of the immunogenic system component.

- Method of forming the y connection

(Y + 1) protein by forming a y-connection as a second step.

The method of binding the protein may be by a conventional coupling reaction.

A method of binding a protein may be to form a polymeric moiety using a suitable cross-linker and a polymer.

The method for forming the y-th connecting portion may be one formed sequentially from the first connecting portion to the (n-1) connecting portion.

- genetic production method of immunogenicity serial linkage

In one embodiment, a method is provided for genetically producing an immunogenic series linker.

Methods for the genetic production of immunogenic tandem linkages encompass genetic production methods for the immunogenic system components.

The genetic production method of the immunogenicity serial linkage is a genetic production method in which the immunogenicity serial linker is a constituent recombinant base sequence and the xy proteins are a component target base sequence. Wherein the constituent base sequence may optionally include the y junctions.

When the x protein is an immunogenic substance, the step of obtaining the base sequence of the x protein includes the first step of the genetic preparation method of the immunogenic substance.

Otherwise, when the x protein is not an immunogenic substance, the step of obtaining the base sequence of the x protein includes the first step of the genetic production method of the protein or the genetic production method of the immunogenic system component.

In the second step of producing the polynucleotide, the constituent recombinant base sequence of the polynucleotide is defined as a first protein-first linkage-second protein-second linkage- (n-1) And the constituent nucleotide sequences of the linkage-n protein are arranged in ascending order.

- immunogenicity serial link format combination expression vector

In one embodiment, an immunogenic serial link format expression vector is provided for genetic production of an immunogenic tandem linker.

Immunogenic Fusion Display Format Combination expression vectors encompass component recombinant expression vectors.

For convenience, the recombinant expression vector has been described as comprising the nucleotide sequence of the y-th junction, but the y-th junction referred to herein may be merely a peptide bond, in which case the corresponding specific nucleotide sequence may not be present.

As a second aspect, the constituent expression target base sequence may include the base sequence of the x-th protein and the y-th junction.

The nucleotide sequence of the component expression target sequence is a sequence in the ascending order of the first protein-first linkage-second protein-second linkage- (n-1) linkage-n protein .

(N-1) -linking-n-th protein. Figure 25 is a graph showing the relationship between the promoter and the first protein To 5 < th > proteins and proteins of the first to fourth proteins and the protein of the present invention is an example of an immunogenic serial linkage format expression vector comprising the nucleotide sequences of the first to fourth linkages.

- Coupling method of immunogenicity series connection system and serial connection system structure

In one embodiment, there is provided a method of coupling an immunogenic serial link made by the above method to a serial link system structure.

Since the series connection system is characterized by the structure of the immunogenic material, there is no limitation in the type of the system, and the coupling method to the serial connection system can be changed according to the system aspect.

- genetic manufacturing method of immunogenic serial connection system

In one embodiment, a method for genetically producing an immunogenic serial-linking system is provided.

Methods for the genetic production of immunogenic serial-linking systems encompass genetic production methods for such immunogenic systems.

A method for genetic production of an immunogenicity serial link system is a genetic production method in which an aspect of an optional system is referred to as a system recombinant base sequence and an immunogenicity serial link system is defined as a systematic base sequence.

The systematic base sequence may comprise an essential configuration depending on the mode of the optional system. For example, when an immunogenic fused display system is selected as an embodiment of the system, the systematic base sequence may essentially comprise the nucleotide sequence of the surface integrator.

Also, the systematic base sequence may comprise an optional configuration depending on the mode of the optional system. For example, when an immunogenic fused display system is selected as an embodiment of the system, the systematic base sequence may optionally include the base sequence of the fusion site.

The method for obtaining the nucleotide sequence of the immunogenic tandem linker in the first step of the genetic production method of the immunogenic system may be by the genetic preparation method of the immunogenic tandem linker.

- Immunogenicity Serial-link system Recombinant expression vector

In one embodiment, an immunogenic series-linked system recombinant expression vector is provided for genetic production of an immunogenic serial-linking system.

The immunogenicity serial-link system recombinant expression vector encompasses the system recombinant expression vector.

The system expression objective base sequence may comprise the nucleotide sequence of an immunogenic series linker.

The systematic base sequence may comprise an essential configuration depending on the mode of the optional system. For example, when an immunogenic fused display system is selected as an embodiment of the system, the systematic base sequence may essentially comprise the nucleotide sequence of the surface integrator. At this time, an arrangement relationship of a desirable configuration may be required depending on the mode of the system.

For the sake of understanding, it is assumed that the immunogenicity system as shown in FIG. 27 is manufactured. Fig. 27 is an illustration of an immunogenic serial connection system in which an immunogenic serial fused with a base sequence of first to fourth connecting portions connecting the first to fifth proteins and proteins is in conformity with an embodiment of a fusion display system.

In the above example, it is preferable that the nucleotide sequence of the surface construct be preceded by the nucleotide sequence of the immunogenic serial link.

Also, the systematic base sequence may comprise an optional configuration depending on the mode of the optional system. For example, when an immunogenic fused display system is selected as an embodiment of the system, the systematic base sequence may optionally include the base sequence of the fusion site.

As a second aspect, a system expression target base sequence may include a nucleotide sequence of a tandem linker.

In this case, the nucleotide sequence of the tandem linker encompasses the nucleotide sequence of the component expression of the " immunogenicity serial linkage format expression vector ".

It is preferable that the arrangement of the whole constitution is a promoter- [(essential constitution) - (immunogenic series connecting body) - (optional constitution)]. Fig. 26 shows an immunogenic serial connection format for producing the immunogenic system of Fig. 27 comprising the nucleotide sequence of the promoter, the surface protein, and the first to fourth proteins and the first to fourth protein- An example of a combination expression vector.

Method for manufacturing immunogenic parallel system

One example of the present application is a method for producing an immunogenic parallel system as an immunogenic system of a vaccine.

For example, there are two methods for manufacturing an immunogenic parallel system.

As one method, there is a method of manufacturing a parallel body first and associating it with a parallel system structure. This involves the steps of making each component separately and then combining it into the system. In this case, since the transmission of each parallel body is independent of the parallel system, the manufacturing method of the parallel system structure varies depending on the mode of the system.

Alternatively, it is a method of manufacturing an immunogenic parallel system as a whole. This method is a method in which the immunogenic parallel system is manufactured in a single step without discrimination of steps, through a genetic manufacturing method, without manufacturing the individual components.

- Manufacturing method of parallel body

First, a method of manufacturing an immunogenic parallel system provides a method of manufacturing a parallel body and then connecting the parallel body to the parallel system structure.

As a first step, a method for manufacturing a parallel body is provided.

When an arbitrary parallel body is an immunogenic substance, the method for producing a parallel body encompasses a method for producing the immunogenic substance. At this time, the parallel body is preferably manufactured by a genetic manufacturing method.

When an arbitrary parallel substance is not an immunogenic substance, for example, a substance that assists an immune response, etc. can be prepared by a known method.

- Coupling method of parallel body

As a second step, a method of associating a parallel object with a parallel system structure is provided.

Since the parallel system is independent of the transfer of each parallel object, the interfacing method may vary depending on the mode of the system selected for each parallel object. The bonding method encompasses the bonding method described in the above internal supporting system to the bonding system.

- Genetic Production Method of Immunogenic Parallel System

In one embodiment, a method for genetically producing an immunogenic parallel system is provided.

Methods for the genetic production of immunogenic parallel systems encompass genetic production methods for such immunogenic systems.

Methods for genetic production of immunogenic parallel systems can be cited, for example, in two ways.

As a method, there is a method of performing a genetic manufacturing method of a system in which each system of a parallel body is a system recombinant base sequence once.

For ease of understanding, it is assumed that the immunogenic parallel system as shown in FIG. 29 is manufactured. Figure 29 is an illustration of an immunogenic parallel system in which three parallel bodies are each comprised of an internal bearing system, a fusion display system, and a fusion display system.

The immunogenicity system of FIG. 29 can be produced by a genetic method of producing a first in-parallel retention system, a method of producing a second parallel fused fusion display system, and a method of producing a third parallel fused fusion display system have.

At this time, the manufacturing method of the one or more systems may be a method of connecting the components. For example, in the above example, the manufacturing method of the internal supporting system may be microfection.

The method of manufacturing a plurality of systems may be a one-time genetic manufacturing method in which each system is a system object base sequence. For example, in the above example, a method for producing a fusion-spliced display system of a second parallel-type body and a fusion-spliced display system of a third parallel-type body includes a step of inserting a recombinant expression vector for parallel fusion display system comprising two base sequences .

Alternatively, the second is a method of performing a genetic manufacturing method using a plurality of systems as a systematic base sequence.

A method for genetic production of an immunogenic parallel system is a genetic production method using an immunogenic parallel system as a system recombinant base sequence and an immunogenicity system of each parallel antibody as a systematic base sequence. For example, in the above example, the first parallel system, the second parallel system, and the third parallel system are part of an immunogenic parallel system that corresponds to the system target sequence and is a system recombinant base sequence.

At this time, the first step is to obtain each systematic base sequence.

A method for obtaining a systematic base sequence encompasses a method for obtaining a system recombinant base sequence in a genetic production method of the above internal support system or attachment system. For example, in the above example, a method for obtaining a systematic base sequence corresponding to the system of the second parallel-form body is one obtained by the first step and the second step of the genetic production method of the immunogenic fusion display system .

At this time, the second step is to obtain a polynucleotide having a system recombinant base sequence.

A system recombinant base sequence comprising the systematic base sequences obtained in the first step can be obtained in a conventional manner.

- Immunogenic parallel systems Recombinant expression vectors (restriction sites)

In one embodiment, an immunogenic parallel system recombinant expression vector for genetic production of an immunogenic parallel system is provided.

The immunogenic parallel system recombinant expression vector encompasses the system recombinant expression vector.

The system expression target base sequence may include a base sequence of an immunogenic parallel substrate.

In one embodiment, the immunogenic parallel system recombinant expression vector may be a plurality of system recombinant expression vectors each having a system expression target base sequence of each parallel system. For example, the immunogenic parallel system recombinant expression vector for producing the immunogenic system of FIG. 29 comprises a recombinant expression vector for an immunogenic inner support system of a first parallel body, a recombinant expression vector for an immunogenic fusion display system of a second parallel body, Or a recombinant expression vector of the immunogenic fusion display system of the third parallel body.

In another embodiment, the immunogenic parallel system recombinant expression vector may be a single system recombinant expression vector having a systemically expressed base sequence of a system of plural parallel sequences.

The systematic nucleotide sequence of each of the parallel sequences encompasses the nucleotide sequence of interest expressed in the system recombinant expression vector of the internal carrier system or the attachment system. It is preferable that the systematic sequences of the respective parallel bodies are inserted into the restriction enzyme sites at the respective insulated positions.

It is preferable that the base sequence of each parallelism body is preceded by a base sequence of the promoter.

(The first promoter - the first parallel body system) - (the insulated region) - (the second promoter - the system of the second parallel body) - (the region to be insulated) - (the third promoter - 3rd parallel system) - (area to be insulated) ... N-th < / RTI > promoter-to-nchannel system).

FIG. 28 shows the immunogenic parallel system of FIG. 29. FIG. 28 shows an immunogenic parallel system of FIG. 28 (an internal carrying system consisting of a first promoter and a first parallel member), (a second promoter, a first surface constructor and a first fusion unit, (A fusion display system comprising a first promoter, a second promoter, a second surface construct and a second fusion site, and a third parallel entity), (including an optional construct comprising an optional promoter and optional elements) , An example of an immunogenic parallel system recombinant expression vector for producing the immunogenic system of FIG. 29.

Method for producing immunogenic spore system

One example of the present application is a method for producing an immunogenic spore system as an immunogenic system of a vaccine.

- Method for manufacturing immunogenic spore system components

&Quot; Immunogenic spore system component " means a component of an immunogenic spore system, such as a spore system structure, an immunogenic substance, a spore surface construct, a spore fusion, and the like.

In the case of a method for producing an immunogenic spore system, in the case of preparing each of the immunogenic spore system components first and then combining them with the immunogenic spore system, preparation of the immunogenic spore system component is essential.

- Method of manufacturing spore system structure

In one embodiment, there is provided a method of making a spore system structure.

When the spore system structure is spore, it can be produced through subculture.

When the spore system structure is spore, it can be produced by a genetic manufacturing method. Methods for the genetic production of spore system constructs are described in the genetic method of preparing the following immunogenic spore system components.

If the spore is a spore bacterium spore, the method for producing the spore may include inducing formation of spores. Spores of spore-forming bacteria may be formed only under conditions in which bacteria are difficult to survive, and therefore, separate spore formation induction steps may be necessary.

At this time, the spore formation induction step may include, for example, culturing with Schaeffer's sporulation media. The composition of the shaker culture may include, for example, 2 to 20 g / L of Difco nutrient broth. In this case, the composition (concentration) of Difco nutrient broth preferred in the present application may be 7 g / L. The concentration of Difco nutrient broth is usually higher in a typical culture medium.

In one embodiment, the composition of the shaker culture was 7 g / L Difco nutrient broth, 0.25 g / L MgSO ₄ 7H ₂ O, 1 g / L KCl. The step of inducing spore formation may include adding 1 ml of a solution of FeSO ₄ 7H ₂ O 10 ^-3 M, MnCl ₂ 4H ₂ O 10 ^-2 M, CaCl ₂ 2H ₂ O 1M after the incubation.

The method of producing spores may include a spore inactivation step.

Spores of spore-forming bacteria become a barrier to the formation of a stable spore system because they can bacteriologize once the conditions of survival are gone. The spore inactivation step can be a way to overcome this obstacle and maintain the morphology of spores.

The spore inactivation step may be a physical method.

The physical method at this time may be, for example, by applying heat to deactivate. For example, the temperature for deactivation may be 40 to 300 占 폚. In one embodiment, the preferred deactivation temperature is 120 < 0 > C.

At this time, the inactivation time may be, for example, 5 to 60 minutes. In one embodiment, the preferred deactivation time is 15 minutes.

The spore inactivation step may be a chemical method.

In this case, a known method can be used as a chemical method. For example, a chemical method may be a method of changing pH conditions. The chemical method may also be a method using a specific chemical.

The spore inactivation step may be a genetic method.

At this time, a known method can be used as a genetic method.

If a spore system structure is to be constructed, the step of deactivating the spores may be unnecessary.

When the spore system structure is spore-like particles, the manufacturing method may include the step of producing spore-like particle nuclei and the step of applying the foam-free particle to the spore-like particle nuclei. At this time, spore-like particle nuclei can be prepared by conventional physical / chemical methods. In addition, the bubble free desert can be applied by placing the spore-like particle nuclei in a phospholipid solution and keeping it at a constant temperature.

The method of producing spore-like particles may include a genetic manufacturing method. Here, the method for producing spore-like particles may be a method for genetically producing an immunogenic system component in which the constituent objective base sequence is spore outer membrane protein.

- genetic production method of immunogenic spore system components

In one embodiment, the immunogenic spore system provides a method of producing the immunogenic spore system component via a genetic manufacturing method.

The genetic manufacturing method encompasses a genetic production method of the immunogenic system component.

The constituent recombinant base sequence is an immunogenic spore system component.

When the recombinant system component is spores, the genetic production method of spores may include the step of inducing spore formation or the step of spore inactivation in addition to the step of obtaining spores through the above-described genetic production method.

- Recombinant expression vector of immunogenic spore system components

One embodiment of a method for genetic production of an immunogenic spore system component is to produce a component recombinant expression vector and then transform the component culture host cells.

The recombinant expression vector of the immunogenic spore system component encompasses a component recombinant expression vector. The component expression base sequence is an immunogenic spore system component.

- Genetic production method of immunogenic sporulation system

&Quot; Spore system target nucleotide sequence " means a base sequence of an immunogenic system component that is intended to be included in the spore system recombinant base sequence.

&Quot; Spore recombinant system " means any immunogenic spore system that is ultimately desired to be produced in a genetic production method.

&Quot; Spore system recombinant nucleotide sequence " means a nucleotide sequence encoding a spore recombination system.

&Quot; Spore system recombinant vector " means, in one embodiment of the recombinant vector, that the recombinant base sequence linked to the vector is a spore-system recombinant base sequence.

A " spore system recombinant expression vector " means, as an example of a spore system recombination vector, that the spore-system recombinant base sequence linked to the vector functions to express the protoplasmic system structure into a spore-forming recombination system do. That is, when the recombinant expression vector of the spore system is inserted, generation of the spore recombination system can be confirmed. Most of such expression vectors are in the form of plasmids, but are not limited thereto.

&Quot; pre-spore system structure " refers to a spore system structure that is transformed with a spore system recombinant expression vector and expressed in a spore recombination system. At this time, the spore system structure is spores.

In one embodiment, the immunogenic spore system is a method of producing through a genetic manufacturing method. The recombinant system to be produced is an immunogenic spore system, and the spore system target base sequence is an immunogenic spore system component.

A method for genetic production of an immunogenic spore system includes, for example, a first step of obtaining a spore system target base sequence, a second step of producing a polynucleotide having a spore system recombinant base sequence including a spore system target base sequence, A third step of transforming the system recombinant base sequence into a protoplast system structure, a fourth step of culturing the transformed protoplast system structure, a step of extracting a spore recombination system successfully expressed from the unexpressed protoplast system structure It may include five steps.

The first step is to obtain the spore system target nucleotide sequence. The nucleotide sequence of the wild-type immunogenic spore system component can be obtained using ncbi's genbank or directly screening the immunogenic spore system components.

Polynucleotides containing the spore system target sequence can also be prepared by conventional recombinant DNA techniques.

For example, the polynucleotides can be prepared by PCR cloning.

For PCR cloning, one skilled in the art can design a suitable primer, for example, a primer comprising about 20 nucleotide sequences present at the 5 ' end of the nucleotide sequence of the immunogenic spore system component, 20 Lt; RTI ID = 0.0 > oligonucleotides < / RTI >

The second step is a step of producing a polynucleotide having a spore-system recombinant base sequence including the spore system target base sequence obtained in the first step.

The polynucleotide comprising the spore-system recombinant base sequence may be single-stranded or double-stranded DNA or RNA, including simply the spore-system target sequence.

The method for producing the polynucleotide may be such that the polynucleotide having the spore system target base sequence is ligated through the ligase.

The spore-system recombinant base sequence may include the promoter of the spore system structure, i.e., spores, necessary for expression.

The polynucleotide including the spore-system recombinant base sequence may be a spore-system recombinant expression vector inserted with the spore-system target base sequence. The method of inserting the spore system target nucleotide sequence into the recombinant expression vector of spore system can be carried out by conventional gene recombination techniques.

The third step is a step of transforming the protoplasmic system construct with the spore-system recombinant polynucleotide or spore-system recombinant expression vector prepared in the second step.

Transformation can be classified as "transient transfection" or "permanent transfection" by its effect. In one embodiment of the present application, transient transfection was used

Transformation can also be categorized as "transgenic by reaction", "transgenic by tool" or "transgenic by virus" depending on the means. One embodiment of the present application utilized heat shock transfection.

The protoplast system structure refers to spores in the spore system structure.

The fourth and fifth steps are for culturing the transformed protoplasmic system construct and isolating the successfully expressed recombinant system.

The culturing step can be carried out under ordinary culture conditions.

The fifth step may include the spore formation inducing step or spore inactivation step prior to the separation step of the recombination system.

The step of separating the recombinant system may be by a conventional recombinant method.

- spore system recombinant expression vector

&Quot; Spore System Expression Regulatory Element " means a nucleotide sequence that regulates the expression of a spore system expression target base sequence as a constitution of a spore system recombinant expression vector.

&Quot; Spore System Expression Target Sequence " means a spore-system recombinant base sequence to be expressed as a constitution of a spore-system recombinant expression vector.

One embodiment of a method for genetic production of an immunogenic spore system is to produce a spore system recombinant expression vector and then transform the protoplasmic system construct.

The form of the spore-system recombinant expression vector may be, but is not limited to, a plasmid.

The spore-system recombinant base sequence inserted into the spore-system recombinant expression vector may include a spore-system expression regulatory element and a spore-system expression base sequence.

The spore system expression control element encompasses the expression control element.

The promoter may be a spore promoter.

The promoter may be a promoter of spore microorganisms. For example, it may be a promoter of Bacillus.

The spore system expression target nucleotide sequence refers to the spore system recombinant base sequence inserted into the spore system recombinant expression vector.

Spore System Expression Regulatory Element and Spore System Expression The base sequence of interest is preferably sposodecon-optimized.

The spore system expression target sequence is the above immunogenic spore system.

Spore System Expression Objective base sequences include immunogenic spore system components.

The spore system expression target sequence can be inserted into the step including the first step and the second step of the genetic preparation method of the immunogenic spore system.

The method using recombinant expression vector of spore system is only one example of the genetic production method. Unless otherwise stated, therefore, it is apparent that the method of genetic preparation of the immunogenic spore system includes a method using a spore-system recombinant expression vector.

Method for manufacturing an immunogenic spore internal carrying system

One example of the present application is a method for producing an immunogenic spore internal support system as an immunogenicity system of a vaccine.

There are two methods for producing an immunogenic spore internal support system, for example.

As one method, there is a method in which a spore carrier and a carrier immunogenic substance are first prepared, respectively, and a carrier immunoreactive substance is carried on a carrier. This involves the steps of making each component separately and then combining it into the system.

Alternatively, there is a method for preparing an immunogenic spores internal support system as a whole. This method is a method in which the spore internal supporting system is manufactured in a single step without discrimination of steps, through a genetic manufacturing method, without manufacturing respective components.

- Preparation method of spore carrier

As one embodiment, there is provided a method for producing a spore carrier.

The method for producing the spore carrier includes the method for producing the spore system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a spore carrier having an internal charge. The charge inside the spore carrier may be caused by a substance which charges. At this time, the charged substance can be injected from the outside into the carrier. The injection method may be a conventional method in microbiology, and specific examples may be micropecific.

Or a charged substance may be a recombinant protein by a genetic method.

Genetic manufacturing methods encompass genetic production methods of immunogenic spore system components.

In the genetic production method, the spore target base sequence contains a substance which is charged. The chargeable material may comprise a spore-internal signal sequence. The term " spore internal signal sequence " refers to a protein sequence that functions as a signal sequence in a spore internal protein and serves to direct the protein into the spore. Methods of incorporating the spore internal signal sequence into a chargeable material include, for example, obtaining a region containing the signal sequence located in the spore internal protein, and inserting it with the base sequence of the spore-bearing immunogenic material .

The third step is a step of transforming the spore carrier with a component recombinant polynucleotide or a component recombinant expression vector.

In another embodiment, the production method may be a method for producing an external spore carrier.

The charge outside the spore carrier may be caused by a substance which charges. At this time, a substance having charge can be adsorbed on the spore carrier. The adsorption method may be that the spore carrier is mixed with a chargeable substance and allowed to stand at a constant temperature.

- Preparation method of spore-bearing immunogenic material

In one embodiment, there is provided a method of preparing a spore-bearing immunogenic material.

The spore-bearing immunogenic material may comprise a spore-internal signal sequence.

A method for producing a spore-bearing immunogenic material encompasses a method for producing the immunogenic material.

The method of producing the spore-bearing immunogenic material may be a method for genetic production of the immunogenic material.

In a genetic production method, the immunogenic target nucleotide sequence may comprise a spore internal signal sequence.

The method may also be a method for preparing a spore-bearing immunogenic material having a charge.

The charge of the spore-bearing immunogenic material may be due to a substance which charges. The charged material can be adsorbed onto the spore-bearing immunogenic material. The adsorption method may be to mix the spore-bearing immunogenic material with a chargeable material and leave it at constant temperature.

- Method of supporting spore-bearing immunogenic material

As one embodiment, there is provided a method for supporting a spore-bearing immunogenic substance on a spore carrier.

The spore-bearing immunogenic material may be injected from the outside into the spore carrier. In this case, the injection method may be a conventional method in microbiology, and a specific example may be micropecific.

If the spore-bearing immunogenic material comprises a spore-internal signal sequence, the spore-bearing immunogenic material may be carried on the spore carrier by a spore-internal signal sequence.

- Genetic Production Method of Immunogenic Spore Internal Support System

In one embodiment, there is provided a method for the genetic production of an immunogenic spores internal support system.

A method for the genetic production of an immunogenic spore internal support system encompasses a method for the genetic production of the immunogenic spore system. The spore system target sequence includes spore-bearing immunogenic substances.

In one embodiment, the spore-system target sequence may comprise only spore-bearing immunogenic material.

At this time, the first step is to obtain the nucleotide sequence of the spore-bearing immunogenic substance. In the second step, the nucleotide sequence of the spore-bearing immunogenic material is inserted to prepare a polynucleotide having a spore-system recombinant base sequence. In this case, the base sequence of the spore-bearing immunogenic substance can be inserted together with the spore internal signal sequence.

In another embodiment, the spore system target sequence may comprise a chargeable material.

The first step is to obtain the base sequence of the spore-bearing immunogenic substance, the chargeable substance. The second step is to prepare a polynucleotide having a spore-system recombinant base sequence by inserting a base sequence of a spore-bearing immunogenic substance and a base sequence of a substance having a charge. It is preferable that each substance is inserted into a separate restriction enzyme site so as not to interfere with the expression. The nucleotide sequence of the spore-bearing immunogenic material may be inserted with the spore-internal signal sequence. Also, the base sequence of the charged substance can be inserted with the spore internal signal sequence.

- Immunogenic spore internal support system Recombinant expression vector

In one embodiment, an immunogenic spore internal carrier system recombinant expression vector for genetic production of an immunogenic spore internal support system is provided.

Immunogenic spore internal retention system Recombinant expression vectors encompass spore-system recombinant expression vectors. And a spore-system recombinant expression vector made according to the above-mentioned 'genetic method for producing an immunogenic spore internal support system'.

In one embodiment, the spore system expression target sequence may comprise the base sequence of the spore-bearing immunogenic material.

As a first aspect, the spore system expression regulatory element may be a promoter of spore internal protein.

The promoter may be a promoter in a wild state.

The promoter may be a wild-type promoter modified at some sites. At this time, the modified promoter may have an improved initiation efficiency.

The promoter may be a promoter of the spore internal protein used to obtain the spore internal signal sequence.

In another embodiment, the spore system expression regulatory element may be a promoter of another protein.

The promoter may have an over-expressing effect of the base sequence of the spore expression system.

For example, the promoter may be a PCry. The promoter may be PSpac.

As a second aspect, the spore-expressing base sequence of interest may include the base sequence of the spore-bearing immunogenic substance.

The base sequence of the spore-bearing immunogenic material may comprise a spore-internal signal sequence. In this case, the spore internal signal sequence is preferably located at the 5 'end.

It is preferable that the arrangement of the entire constitution is a promoter-spore-bearing immunogenic substance. 30 shows an example of a recombinant expression vector for an immunogenic spore internal carrier system containing a base sequence of a promoter and a spore-bearing immunogenic substance.

In another embodiment, the spore-expressing base sequence of interest may comprise a base sequence of a substance that is charged with a spore-bearing immunogenic substance.

As a first aspect, the spore system expression regulatory element may be a promoter of spore internal protein. The promoter of the spore internal protein includes the above-described promoter.

As a second aspect, the base sequence of the spore system expression target may include the base sequence of the spore-bearing immunogenic substance and the base sequence of the substance having the charge.

The base sequence of the spore-bearing immunogenic material may comprise a spore-internal signal sequence. Preferably, the spore internal signal sequence is located at the 5 ' end of the nucleotide sequence of the spore-bearing immunogenic material.

The base sequence of the chargeable material may comprise a spore-internal signal sequence. Preferably, the spore internal signal sequence is located at the 5 'end of the base sequence of the charged substance.

In the arrangement of the whole structure, it is preferable that a substance having a promoter-spore-carrying immunogenic substance and a promoter-electric charge is located at a mutually insulated position. 31 shows an example of a recombinant expression vector for an immunogenic spore internal support system comprising a base sequence of a first promoter, a spore-bearing immunogenic substance, and a substance which charges a second promoter.

Method for manufacturing immunogenic spore fusion display system

One example of the present application is a method for producing an immunogenic spore fusion display system as an immunogenic system of a vaccine.

Methods for producing immunogenic spore fusion display systems can be cited, for example, in two ways.

As a method, there is a method in which a spore fusion display body and a spore fusion body are first prepared, respectively, and a spore fusion body is attached to a spore fusion display body.

Alternatively, there is a method of manufacturing an immunogenic spore fusion display system as a whole. This method is a method in which a spore fusion display system is manufactured in a single step without discrimination of steps through a genetic manufacturing method without manufacturing respective components.

- Manufacturing method of spore fusion display body

In one embodiment, a method for producing a spore fusion display body is provided.

A method of producing a spore fusion display body encompasses the method of manufacturing the spore system structure.

In one embodiment, the manufacturing method may be a method of manufacturing a spore fusion display body having charges on the outside of the spore fusion display body. The charge outside the spore fusion display body may be generated by a substance having a charge outside the spore fusion display body. At this time, a substance having a charge can be adsorbed on the fused display body. The adsorption method may be to put the fused display body in a solution of the chargeable substance and leave it at a constant temperature.

- Preparation method of spore fusion bodies

In one embodiment, a method for producing a spore fusion is provided.

Spore fusion is a fusion of spore fusion immunogen and spore surface integrator. The spore surface caner may comprise a spore external signal sequence.

The method of producing spore fusion includes the method of producing said immunogenic spore system component.

In one embodiment, a method for producing a spore fusion product includes, for example, preparing a spore surface integrator and a spore fusion immunogenic substance by the method for producing the immunogenic spore system component; And coupling the spore surface construct with the spore fusion immunogenic material. The coupling step can be performed by a method commonly used for cross-linking proteins.

The method of producing the spore surface can be a genetic manufacturing method.

The method of producing spore fusion immunogenic material may be a genetic manufacturing method.

Methods of producing spore fusion immunogenic materials encompass a method for the genetic production of such immunogenic substances.

In another embodiment, the method of producing spore fusion bodies may be a genetic manufacturing method.

The genetic manufacturing method encompasses a method for genetic production of immunogenic spore system components. In the genetic production method, the spore target base sequence includes spore fusion immunogenic material and spore surface integrator. Wherein the spore surface construct may comprise a spore external signal sequence.

The spore target nucleotide sequence may also include a spore fusion immunogenic substance, a spore surface construct, and a spore fusion region.

- Spore fusion of spore fusion

In one embodiment, a method of attaching a spore fusion body to a spore fusion display body is provided.

Such a binding method may be that the spore fusion body is allowed to stand at a constant temperature in the same solution as the spore fusion display body.

Attachment may be due to adsorption, electrostatic attraction, hydrophobic interaction.

For example, if the spore surface integrator of the spore fusion comprises a spore external signal sequence, the spore fusion entity may be attached to the spore fusion display body by a spore external signal sequence.

- Genetic production method of immunogenic spore fusion display system

In one embodiment, a method of genetically producing an immunogenic spore fusion display system is provided.

A method for the genetic production of an immunogenic spore fusion display system encompasses a method for the genetic production of said immunogenic spore system. The spore system target sequence includes spore surface integrants, spore fusion immunogen. In addition, the spore system target base sequence may include a spore fusion site. At this time, it is obvious that spore surface openings can be replaced with heterogeneous spore surface openings.

In one embodiment, the spore surface can be a protein external to the spore.

In this case, the first step is to obtain the base sequence of the spore outer protein, spore fusion immunogen. The obtained spore outer protein may be any one or more of CotB, CotC, CotE, CotG and CotG, for example, and known nucleotide sequences may be used.

For example, the sequence of CotG was the sequence of SEQ ID NO: 15.

For example, the sequence of CotB was the sequence of SEQ ID NO: 49.

For example, the sequence of SEQ ID NO: 50 was used as the sequence of CotC.

For example, the obtained spore outer protein may further utilize a promoter. The promoter may use the same or different promoter as the spore outer protein.

The second step is to prepare a polynucleotide having a system recombinant base sequence by inserting a base sequence of a spore outer protein and a base sequence of a spore fusion immunogen.

In another embodiment, the spore surface integrator may be a spore external homologous protein.

In one embodiment, the spore-external homologous protein may comprise a spore-external signal sequence.

In this case, the first step is to obtain a base sequence of a spore fusion immunogenic substance, including a spore external signal sequence of the spore outer protein. The base sequence of a portion including the spore external signal sequence of the obtained spore outer protein may be 150 to 450 bp in size. At this time, the action site of the signal sequence restriction enzyme can be removed by a conventional gene recombination method.

The second step is a step of preparing a polynucleotide having a system recombinant base sequence by inserting a base sequence of a part including a spore external signal sequence of a spore external protein and a base sequence of a spore fusion immunogen.

In other embodiments, the spore external homologous protein may comprise a spore external locating motif.

Wherein the first step is to obtain a nucleotide sequence of a part of the spore fusion immunogenic substance, including the spore external locating motif.

The second step is to prepare a polynucleotide having a system recombinant base sequence by inserting a partial nucleotide sequence including a spore external locating motif and a nucleotide sequence of a spore fusion immunogen.

In other embodiments, the spore exotypic protein may be a structure in which the same base sequence is repeated.

The same base sequence may be a base sequence of a spore external protein.

In this case, the first step is to obtain the base sequence of the spore outer protein, spore fusion immunogen.

The second step is a step of repeatedly inserting the base sequence of the spore external protein and then inserting the base sequence of the spore fusion immunogen into the polynucleotide having the system recombinant base sequence.

The same base sequence may be a partial base sequence including a spore external locating motif.

Wherein the first step is to obtain a nucleotide sequence of a part of the spore fusion immunogenic substance, including the spore external locating motif.

The second step is a step of repeatedly inserting a base sequence including a spore external locating motif and then inserting a base sequence of a spore fusion immunogen to prepare a polynucleotide having a system recombinant base sequence.

In another embodiment, the spore surface construct may be a protein wherein the spore external homology is a protein.

In one embodiment, the spore outer homologue protein may be homologous to other spore outer proteins of the same spore other than the specific spore outer protein.

The spore external homologous portion protein may comprise a spore external signal sequence of the other protein.

In this case, the first step is to obtain the base sequence of a part including the spore external signal sequence of the other protein, the spore external homology region, and the spore fusion immunogen.

In the second step, a certain number of base sequences including the spore external signal sequence of the other protein and the base sequence of the spore external homology region are inserted in any order, and the nucleotide sequence of the spore fusion immunogen is inserted, Is a step of producing a polynucleotide having a nucleotide sequence.

The spore outer homologous portion protein may comprise a spore outer locating motif of the outer sponge protein.

In this case, the first step is to obtain a base sequence of a part including the spore external locating motif of the other protein, the spore external homology region, and the spore fusion immunogen.

In the second step, a certain number of base sequences including the spore external locating motif of the other protein and the base sequence of the spore external homology region are inserted in any order, and the nucleotide sequence of the spore fusion immunogen is inserted Is a step of preparing a polynucleotide having a system recombinant base sequence.

In another embodiment, the spore outer homologous portion protein may comprise a spore outgrowth region and a region that is homologous to the spore outer protein.

In an exemplary embodiment, the spore outgrowth may comprise a spore-external signal sequence of a heterologous spore external protein.

In this case, the first step is to obtain a nucleotide sequence of a part including a spore external signal sequence of a heterologous spore outer protein, a spore external homology region, and a spore fusion immunogenic substance.

The second step is to insert a base sequence of a part including a spore external signal sequence of a heterologous spore outer protein and a base sequence of a spore external homology region in any order and insert a base sequence of a spore fusion immunogen Thereby preparing a polynucleotide having a system recombinant base sequence.

In another exemplary embodiment, the spore outgrowth may comprise a spore external locating motif of the heterologous spore outer protein.

Wherein the first step is to obtain a nucleotide sequence of a part including a spore external locating motif of a heterosporum protein, a spore external homology region, and a spore fusion immunogen.

The second step is to insert a certain number of base sequences including the spore outer locating motif of the heterologous spore outer protein and the base sequence of the spore outer homology region in any order and to insert the base sequence of the spore fusion immunogen To prepare a polynucleotide having a system recombinant base sequence.

In another exemplary embodiment, the spore externals can draw the charge of a particular sign.

The first step is to obtain the nucleotide sequence of the spore external homologous region and the spore fusion immunogenic material and to secure the nucleotide sequence of the spore outpatient having the charge of the specific sign. The nucleotide sequence of the exogenous part of the spore bearing the charge of a specific code can be obtained by obtaining a protein in a wild state, but it is also possible to design and obtain a positively charged protein. For example, CotG of B. subtilis has a high proportion of positively charged amino acids (arginine / histidine / lysine), can easily obtain sequence information, and can be easily obtained.

In the second step, any number of nucleotides in the outermost part of the spore having the charge of a specific code and the nucleotide sequence of the exogenous homologous part of the spore are inserted in any order, and the nucleotide sequence of the spore fusion immunogen is inserted, Is a step of producing a polynucleotide having a nucleotide sequence. At this time, it is preferable that the order of insertion of the nucleotide sequence of the spore outermost part be between the spore external homologous site and the spore fusion immunogenic substance so that the spore fusion body does not interfere with the attachment to the outside of the spores.

- Immunogenic spore fusion display system Recombinant expression vector

In one embodiment, an immunogenic spore fusion display system recombinant expression vector for genetic production of an immunogenic fusion display system is provided.

Wherein the immunogenic fused display system recombinant expression vector encompasses a spore-system recombinant expression vector.

For convenience, a spore-system recombinant expression vector prepared in accordance with the flow of the above-mentioned 'genetic production method of immunogen spore fusion display system' is provided.

Although omitted for convenience, spore fusion domains may be included between the spore surface integrator and the spore fusion immunogenic material of all the spore fusion display recombinant expression vectors mentioned herein.

At this time, it is obvious that spore surface open bodies can be replaced with heterogeneous spore surface openings.

In one embodiment, the spore-system expression base sequence of interest may comprise a base sequence of a spore outer protein and a spore fusion immunogen.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

The promoter may be a promoter in a wild state.

In addition, the promoter may be a wild-type promoter modified at some sites. At this time, the modified promoter may have an improved initiation efficiency.

Or spore system expression regulatory elements may be promoters of other proteins.

For example, the promoter may be PCotG even when the spore outer protein is not CotG.

For example, the promoter may be PCotB even when the spore outer protein is not CotB.

For example, the promoter may be PCotC even when the spore external protein is not CotC.

As a second aspect, the spore system expression target base sequence may include a base sequence of a spore outer protein and a spore fusion immunogenic substance.

Preferably, the overall configuration is a promoter-spore outer protein-spore fusion immunogenic material.

In another embodiment, the spore-expressing base sequence of interest may comprise a base sequence of a spore-exogenous homologous protein and a spore-fusion immunogenic substance.

In one embodiment, the spore exotypic protein may be part of a protein sequence of a spore outer protein, including a spore-external signal sequence.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect. Hereinafter, " the above-mentioned promoter " means that all the promoters are included.

Preferably, the overall configuration is a base sequence-spore fusion immunogen comprising a portion of the promoter-spore outer protein spore external signal sequence.

In other embodiments, the spore external homologous protein may be a portion that includes a spore external locating motif.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

As a second aspect, the spore system expression target base sequence may include a base sequence including a spore outermost locus motif and a base sequence of a spore fusion immunogen.

It is preferred that the overall configuration is a fractional nucleotide sequence-spore fusion immunogenic material including a promoter-spore outgassing motif.

32 is an illustration of a spore fusion display recombinant expression vector comprising a promoter and a spore surface construct, and a base sequence of a spore fusion immunogen.

In other embodiments, the spore exotypic protein may be a structure in which the same base sequence is repeated.

In an exemplary embodiment, the same base sequence may be a base sequence of a spore external protein.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

As a second aspect, the spore system expression target base sequence may include a plurality of spore outer protein base sequences and a spore fusion immunogenic substance base sequence.

It is preferred that the arrangement of the overall configuration is an n-spore fusion immunogenic substance of a promoter- (base sequence of spore external protein).

In another exemplary embodiment, the same base sequence may be a base sequence comprising a spore external locating motif.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

In a second aspect, the spore system expression target base sequence may include a base sequence including a plurality of spore outgassing motifs and a base sequence of a spore fusion immunogen.

It is preferred that the arrangement of the overall configuration is an n-spore fusion immunogenic material of a promoter- (a base sequence comprising a spore external locating motif).

33 shows an example of a spore fusion display recombinant expression vector comprising a promoter, a nucleotide sequence of the same spore external homology region repeated three times, and a nucleotide sequence of a spore fusion immunogenic substance.

In another embodiment, the spore-expressing base sequence of interest may comprise a base sequence of a protein, spore fusion immunogenic material, wherein the spore exotoxin is a spore.

In one embodiment, the spore outer homologue protein may be homologous to other spore outer proteins of the same spore other than the specific spore outer protein.

In an exemplary embodiment, the spore external homologous portion of the protein may comprise a spore-external signal sequence of the other protein.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

In a second aspect, the target sequence for expression of the spore system may include a portion including a spore external signal sequence of the other protein, a spore external homology region, and a base sequence of a spore fusion immunogen.

The arrangement of the entire structure is preferably a promoter- (a part including a spore-external signal sequence of the tachypoprotein, a spore-external homologous site) m, an n-spore fusion immunogenic substance. m, n is the number of spores containing the spore external signal sequence of the other protein, including the spore external homology region.

Figure 34 is an illustration of a spore fusion display recombinant expression vector comprising a promoter, a protein spore external signal sequence, a spore external homologous portion comprising a spore external homology region, and a base sequence of a spore fusion immunogen.

In another exemplary embodiment, the spore outer homologous portion of the protein may comprise a spore outer locating motif of the outer sponge protein.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

As a second aspect, the target sequence for expression of the spore system may include a part including a spore external locating motif of the other protein, a spore external homologous site, and a base sequence of a spore fusion immunogenic substance.

The overall arrangement is preferably a promoter- (a portion including a spore-external locating motif of the tat protein, a spore external homology region) m, an n-spore fusion immunogenic substance. m, n is the number of spores containing the spore external signal sequence of the other protein, including the spore external homology region.

Figure 35 is an illustration of a spore fusion display recombinant expression vector comprising a promoter, a protein spore external locating motif, a spore external homologous portion comprising a spore external homology region, a protein, and a base sequence of a spore fusion immunogen .

In other embodiments, the spore outer homologous portion protein may comprise a spore outgrowth and a site that is homologous to the spore outer protein.

In an exemplary embodiment, the spore outgrowth may comprise a spore-external signal sequence of a heterologous spore external protein.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

As a second aspect, the spore system expression target base sequence may include a part including a spore outer signal sequence of a heterosporum protein, a spore outer homology region, and a base sequence of a spore fusion immunogen.

Preferably, the arrangement of the entire structure is a promoter- (a part including a spore external signal sequence of a heterologous spore external protein, a spore external homology region) m, an n-spore fusion immunogenic substance.

In another exemplary embodiment, the spore outgrowth may comprise a spore external locating motif of the heterologous spore outer protein.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

As a second aspect, the spore system expression target base sequence may include a part including a spore outer locating motif of a heterosporum protein, a spore outer homology region, and a base sequence of a spore fusion immunogen.

The overall arrangement is preferably a promoter- (a portion including a spore external locating motif of a heterologous spore outer protein, a spore outer homology region) m, an n-spore fusion immunogenic substance.

Figure 36 shows that the spore outer homologous portion, including the promoter and the outer protein motif outside the spore, the spore outer homology region, the heterozygous outer spontaneous motif is a protein, and a spore comprising the base sequence of the spore fusion immunogenic material Fusion display is an example of a recombinant expression vector.

In another exemplary embodiment, the spore externals can draw the charge of a particular sign.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

Wherein the promoter of the spore external protein comprises the promoter of the above aspect.

As a second aspect, the target sequence for expression of the spore system may include a spore outline having a specific sign, a spore outer homology region, and a base sequence of a spore fusion immunogen.

The arrangement of the overall configuration is preferably a promoter- (spore external homology moiety) m- (spore external moiety with a specific sign) -spore fusion immunogen.

Figure 37 shows that the spore extracellular domain, including the promoter, the spore outer homology region, the sequence of the heterologous spore surface construct, the sequence of the spore surface construct, and the externally charged portion of the specified sign, is a protein and a spore fusion immunogen Lt; RTI ID = 0.0 > spore fusion display recombinant expression vector. ≪ / RTI >

Method for manufacturing an immunogenic spore-coupling display system

One example of the present application is a method of preparing an immunogenic spore-coupled display system as an immunogenic system of a vaccine.

Methods of producing an immunogenic spore-coupled display system include, for example, preparing a spore-coupled immunogenic material and a spore-coupling display body, each comprising a coupling agent; And causing spore coupling between the spore-coupling display body and the spore-coupling immunogenic material.

- Manufacturing method of spore-coupling display body

In one embodiment, there is provided a method of making a spore-coupled display body comprising a spore-display body coupling unit. The manufacturing method of the coupling display body includes the manufacturing method of the coupling display body.

- Preparation of spore-coupled immunogenic material

In one embodiment, there is provided a method of preparing a spore-coupled immunogenic material comprising a spore immunogenic material coupling group.

A method for producing a spore-coupled immunogenic material encompasses a method for producing the coupled immunogenic material.

An immunogenic substance can be produced by the method for producing the immunogenic substance. The immunogenic material may comprise a spore external signal sequence. If the spore-coupled immunogenic material comprises a spore-external signal sequence, the spore-coupled immunogenic material may be directed outside the spore by a spore external signal sequence to facilitate coupling binding.

Coupling coupling step

In one embodiment, providing a spore-coupling bond between the spore-coupling display body and the spore-coupling immunogenic material. The spore-coupling bond may occur under conventional coupling reaction conditions.

Method for manufacturing immunogenic spore-attached display system

One example of the present application is a method for producing an immunogenic spore-attached display system as an immunogenic system of a vaccine.

Methods for producing an immunogenic spore-attached display system can be roughly classified into two types, for example.

As one method, there is a method in which a spore-attached display body and an attachment immunogenic substance are respectively prepared, and an attachment immunogenic substance is attached to a spore-attached display body. This involves the steps of making each component separately and then combining it into the system.

Alternatively, there is a method of manufacturing an immunogenic spore-attached display system as a whole. This method is a method in which a spore-attached display system is manufactured in a single step without discrimination of steps through a genetic manufacturing method without manufacturing respective components.

- Manufacturing method of spore-attached display body

In one embodiment, a method of manufacturing a spore-attached display body is provided.

A method for producing a spore-attached display body encompasses a method for manufacturing the spore system structure.

A method for producing a spore-attached display body includes the above-described method for producing a spore carrier. The spore-attached display body shares the same properties as spore carrier in that it can charge. The reason for sharing this characteristic is that the purpose of attaching the immunogenic material to the system by electrostatic attraction is the same.

- Method for producing spore-attached immunogenic material

In one embodiment, there is provided a method of producing a spore-attach immunogenic material.

The spore attachment immunogenic material may comprise a spore external signal sequence.

The method for producing spore-attached immunogenic material encompasses the method for producing said immunogenic material.

The method of producing the spore-attaching immunogenic material may be a method of genetic production of the immunogenic material. In the genetic production method, the immunogenic target base sequence may include a spore external signal sequence.

The production method may be a method for producing a spore-attached immunogenic substance with a charge. The charge of the spore-attached immunogenic material may be due to a substance which charges. The charged material can be adsorbed to the spore-attach immunogenic material. The adsorption method may be to mix the spore-attached immunogenic material with a chargeable material and leave it at constant temperature.

- Method of attaching spore attachment immunogenic material

In one embodiment, there is provided a method of attaching a spore-attached immunogenic substance to a spore-bearing display body.

The attachment method may be to mix the spore-mounted immunogenic material with the spore-attached display body and to stand at a constant temperature.

Also, if the spore-attaching immunogenic material comprises a spore-internal signal sequence, the spore-bearing immunogenic material may be carried on the spore carrier by the spore internal signal sequence.

- Genetic production method of immunogenic spore-attached display system

In one embodiment, a method of genetically producing an immunogenic spore-attached display system is provided.

A method for the genetic production of an immunogenic spore-attached display system encompasses a method for the genetic production of the immunogenic spore system. The spore system target sequence includes spore-attaching immunogenic substances.

In one embodiment, the spore-system target sequence may comprise only spore-bearing immunogenic material.

At this time, the first step is to obtain the spore-attaching immunogenic substance.

The second step is to prepare a polynucleotide having a spore-system recombinant base sequence by inserting a base sequence of a spore-attaching immunogenic substance. The base sequence of the spore-attaching immunogenic material may be inserted with the spore-external signal sequence.

In another embodiment, the spore system target sequence may comprise a chargeable material.

At this time, the first step is to obtain the base sequence of the spore-attaching immunogenic substance, the chargeable substance.

The second step is to prepare a polynucleotide having a spore-system recombinant base sequence by inserting a base sequence of a spore-attaching immunogenic substance and a base sequence of a substance having a charge. At this time, it is preferable that each substance is inserted into a separate restriction enzyme site so as not to interfere with the expression. The base sequence of the spore-attaching immunogenic material may be inserted with the spore-external signal sequence. Also, the base sequence of the charged substance may be inserted together with the spore internal signal sequence.

- Immunogenic spore-attached display system Recombinant expression vector

In one embodiment, an immunogenic spore-attached display system recombinant expression vector for genetic production of an immunogenic spore-attached display system is provided.

Immunogenic spore-attached display system Recombinant expression vectors encompass spore-system recombinant expression vectors. And a spore-system recombinant expression vector made according to the above-mentioned 'genetic method for producing an immunogenic spore-attached display system'.

In one embodiment, the spore-system expression base sequence of interest may comprise the base sequence of a spore-bearing immunogenic material.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein.

In one embodiment, the promoter may be a promoter in a wild state.

The promoter may be one in which a wild-type promoter is modified or manipulated at a part thereof. At this time, the modified promoter may have an improved initiation efficiency. Also, the promoter may be a promoter of the spore external protein used to obtain the spore external signal sequence.

In another embodiment, the spore system expression regulatory element may be a promoter of another protein.

The promoter may have an over-expressing effect of the base sequence of the spore expression system. For example, the promoter may be a PCry. The promoter may also be a PSpac.

As a second aspect, a spore system expression target base sequence may include a base sequence of a spore-attaching immunogenic substance.

The base sequence of the spore-attached immunogenic material may comprise a spore-external signal sequence. At this time, the spore external signal sequence is preferably located at the 5 'end.

The arrangement of the whole structure is preferably a promoter-spore attachment immunogenic substance. Figure 38 is an example of a recombinant expression vector of spore-attached display system containing a promoter and a base sequence of spore-attaching immunogenic substance.

In another embodiment, the spore-system expression base sequence may comprise a base sequence of a substance which is charged with a spore-bearing immunogenic substance.

In a first aspect, the spore system expression regulatory element may be a promoter of an extracellular protein. The promoter of the outer spore protein includes the promoter of the above embodiment.

As a second aspect, the spore system expression target base sequence may include the base sequence of the spore-attaching immunogenic substance and the base sequence of the substance having charge.

The base sequence of the spore-attached immunogenic material may comprise a spore-external signal sequence. In this case, the spore external signal sequence is preferably located at the 5 'end of the base sequence of the spore-attaching immunogenic substance.

The base sequence of the chargeable material may comprise a spore-internal signal sequence. Preferably, the spore internal signal sequence is located at the 5 'end of the base sequence of the charged substance.

In the arrangement of the whole structure, it is preferable that a substance having a promoter-spore attachment immunogenic substance and a promoter-charge substance is located at a mutually insulated position. 39 is an illustration of a spore-attached display system recombinant expression vector comprising a base sequence of (a first promoter and a spore-attaching immunogenic substance), (substance which charges a second promoter).

[Vaccine composition]

One example of the present application is a vaccine composition comprising the immunogenic system described above and its various uses.

The vaccine is essentially composed of an immunogenic component.

The immunogenic component may be an immunogenic substance or an immunogenic system.

Depending on the composition of the immunogenic component, the mode of vaccine may be different. Major vaccine patterns can be divided into vaccine, multivalent vaccine, master vaccine, and complex disease master vaccine. However, this classification is not essential and the present application is not limited thereto.

Generally, a vaccination dose of about 2 to 5 ml is appropriate. In the current vaccine market, most vaccines use the pathogen itself as an immunogenic agent.

The vaccine composition may be administered by any of several routes, including subcutaneous, intravenous, intradermal, intradermal, intramuscular, needle-free, electroporation, oral delivery, intranasal delivery, oronasal delivery, ≪ / RTI > The composition to be administered may additionally comprise a therapeutically acceptable carrier. Such therapeutically acceptable carriers may be selected from the group consisting of proteins, buffers, surfactants, and polyethylene glycol polymers, or any combination thereof.

It will be apparent to those skilled in the art that immunogenic adjuvants that aid the function of the vaccine may be included in the composition.

A common vaccine

&Quot; Conventional vaccine " refers to an embodiment of a vaccine that is intended to produce acquired immunity to a single vaccine strain of a single pathogen.

One embodiment of the present application is the above-mentioned commercial vaccine.

In general, vaccine is a mode of vaccine that is mainly used in the past, and it is a mode of vaccine that determines the target disease and determines the most popular one among the vaccine strains of the target disease pathogens. In general, the vaccine should contain only a single immunogenic substance or an immunogenic system, which is advantageous in that the cost is low and the concentration of the immunogenic substance is high so that the immune response is improved. However, there is a disadvantage in that the scope of immunization is limited because it is possible to prevent only outdoor lobes having high homology with a single vaccine strain. Normally, the vaccine is suitable as a mode of vaccine against a disease that does not cause a lot of outdoor stocks.

The conventional vaccine may contain a single immunogenic substance.

The normal vaccine may comprise a single immunogenic system.

Multivalent vaccine

A " multivalent vaccine " refers to an embodiment intended to form acquired immunity to a single vaccine strain of a plurality of pathogens as an embodiment of the vaccine.

One embodiment of the present application is the multivalent vaccine.

Multivalent vaccines are a form of vaccine that can be selected when trying to co-immunize multiple diseases in vivo. In this case, the pathogens to be subjected to the multivalent vaccine may be pathogens causing multiple diseases in the living body. In this case, the multivalent vaccine has an advantage of preventing multiple diseases. In addition, pathogens that are the target of a multivalent vaccine can cause major diseases that are the most damaging to the living body. In this case, the multivalent vaccine has the advantage of being able to immunize against the most dangerous diseases. However, if one of the immunogenic substances of the multivalent vaccine is high in pathogenicity or toxicity, there is a risk that the risk of the vaccine increases. However, since the immunogenic system of the present application is low in pathogenicity or toxicity, have.

Multiple pathogens subject to a multivalent vaccine may be pathogens causing multiple diseases.

The plurality of pathogens may be a pathogen of a major disease occurring in a living body.

At this time, the living body may be a pig.

The main pathogen of this disease may be, for example, porcine epidemic diarrhea virus (PEDV), porcine reproductive, respiratory syndrome virus (PRRSV), porcine circovirus (PCV).

The multivalent vaccine may be a mixture of immunogenic materials that target multiple pathogens. The multivalent vaccine may also be a mixture of immunogenic systems directed against multiple pathogens.

Multivalent vaccines may be a mixture of immunogenic systems and immunogenic systems that target multiple pathogens.

A multivalent vaccine may be an immunogenic serial link system in which the linkage comprises immunogenic materials directed against a plurality of pathogens.

Multivalent vaccines are immunogenic parallel systems, in which the parasite may be an immunogenic agent that targets multiple pathogens.

Master vaccine

&Quot; Master vaccine " refers to an embodiment intended to form acquired immunity against multiple vaccinees of a single pathogen as an embodiment of the vaccine.

One embodiment of the present application is a master vaccine.

A master vaccine is an embodiment of a vaccine that can be selected when a strong and broad immunity to a single disease is to be established. The master vaccine has the advantage of easy cross protection sprotection for mutant or open field since it can form acquired immunity against several vaccines with different homology. The master vaccine is suitable as a vaccine form for a disease with a high incidence of mutant or open-stock.

Since the amount of immunogenic substances that can be contained in a single dose of the vaccine is limited, the type of vaccine subject to the master vaccine is also limited. It is desirable to form the widest cross-protection range to produce the most preferred master vaccine. However, current vaccine technology is not enough to select the most suitable vaccine.

In the present application, multiple phylogenetic trees can be utilized to select vaccine strains that are the subject of a master vaccine. The multiple alignment process is a process of examining homology between strains based on one strain, and the genealogy can be constructed according to the degree of homology obtained as a result. Mixing vaccine strains with various homologies has the advantage of extending the range of cross protection.

In one embodiment of the present application, a method for selecting vaccine strains to be the subject of a master vaccine comprises a first step of constructing a phylogenetic tree by multiple alignments, a second step of dividing a homologous reference taxon in the phylogenetic tree, And a third step of selecting a vaccine strain of each one. 40 is a system diagram illustrating an exemplary method for selecting a vaccine to aid understanding.

The first step is the step of producing the tree water. The phylogenetic tree can be made by multiple alignments. The lines on the left side of FIG. 40 are phantom numbers generated by multiple alignments, and the lines in the middle represent sorted strains.

The second step is the step of dividing the homologous reference taxon. "Homology based clust" is defined as the grouping of strains in phylogenetic trees according to homology. At this time, a homologous range that can cross-protect is determined and the homologous reference taxon is divided. In general, the homology between strains is more than 85%, even though the mutations are highly variable.

The homologous reference taxon may be classified by a specific homology interval. For example, homologous reference taxa can be divided into the first group with homology of 100-95%, the second group with 95-90%, the third group with 90-85%, and the fourth group with less than homology.

The right side of FIG. 40 shows that the strains were divided into homologous reference taxa from Clust 1 to Clust 4. Clust 1, Clust 2, Clust 3, and Clust 4 have a homology of 99 to 100%, 95 to 99%, 86.5 to 95%, 50 to 86.5% Respectively.

The third step is to select one or more strains from each homology taxonomic group. Subsequently, the immunogenic material or immunogenic system of the selected vaccine strains is mixed and made into a master vaccine.

The master vaccine may be a mixture of immunogenic materials directed against one or more strains according to each homology standard taxon. For example, in the case of FIG. 40, a master vaccine can be prepared by mixing one or more strains selected from Clust 1 to Clust 4.

The master vaccine may also be a mixture of immunogenic systems directed to one or more strains according to each homologous reference taxon. Wherein the immunogenic system is a preferred example, and may be an immunogenic spore system.

The master vaccine may also be a mixture of an immunogenic agent and an immunogenic system directed to one or more strains according to each homologous reference taxon.

In addition, the step of selecting a vaccine strain includes the criteria for selecting a strain to be subjected to multiple sorting in the " antigen-homologous protein containing one immunogenic site ".

Combined Disease Master Vaccine

&Quot; Combination disease master vaccine " refers to an embodiment intended to form acquired immunity against a plurality of vaccinees of a plurality of pathogens as an embodiment of the vaccine.

A complex disease master vaccine is an embodiment of a vaccine that functions as a master vaccine against multiple diseases. When a master vaccine for a complex disease is manufactured using existing vaccine technology, there is a problem in that the vaccination amount is too high, the inoculation method is too complicated, and it takes a long time. The existing vaccine technology was limited in the concentration of the immunogenic substance, so the amount of the immunogenic substance would have to be increased as the kind of the immunogenic substance increased.

However, this problem can be solved by the immunogenic spore system which is one embodiment of the present application.

Where the immunogenic material is a viral pathogen, the concentration of virus in the conventional decrypting or attenuated vaccine is limited. Because viruses form a single layer of plaques when cultured, they are more difficult to cultivate than bacteria that form multilayered colonies. The maximum concentration of virus that can be achieved by subculture is known to be about 10 ⁷ cells / ml. Concentrating the virus solution above that level increases the virulence of the virus and increases the concentration of toxic substances to inactivate the virus, so it is common to see about 10 ⁷ / ml as the maximum concentration.

However, taking advantage of the one specific example Spore immunogenic systems of the present application for about 10 to ¹⁰ without risk of the above mentioned 10 < ¹² > cells / ml. It is possible to have a concentration concentration of 10 ³ to 10 ⁵ times at the same dose, so that even when a plurality of pathogens or a plurality of vaccine strains is administered to a subject, it is possible to maintain a dose of about 2 to 3 ml, preferably 2 ml. Thus, the immunogenic spore system of the present application may have a significant effect enabling a commercially available complex disease master vaccine, which was not possible before.

As a preferred example, the complex disease master vaccine may be a mixture of immunogenic spore systems directed to each disease and each vaccine strain.

At this time, multiple pathogens that are the subject of the complex disease master vaccine may be pathogens causing multiple diseases.

The plurality of pathogens subject to the complex disease master vaccine may also be a pathogenic agent of a major disease occurring in the living body.

In addition, multiple vaccine recipients who are subject to the Combined Disease Master Vaccine cover the criteria for selecting a vaccine strain in the "Master Vaccine."

[Example]

Hereinafter, the present application will be described in more detail through examples.

One embodiment of the present application relates to the production of antigens, antibodies and vaccines against PEDV.

Another embodiment of the present application relates to the production of antigens, antibodies and vaccines against PCV.

It will be apparent to those skilled in the art that these embodiments are for illustrative purposes only and that the scope of the present application is not construed as being limited by these examples.

[PEDV vaccine production]

Example 1: Preparation of common region primer

Materials required for the experiment were as follows:

Samples (Animal Tissue): Revival Farm

0.2 micron syringe filter: Millpore

nPFU-forte (enzynomics)

nTaq polymerase (enzynomics)

Restriction enzymes SacI, PstI, and BamHI (enzynomics)

pGEM T easy vector system: (Promega)

PCR machine: (BioRad)

We obtained tissue from swine which showed diarrhea symptoms in Korea revival farm. Homogenates were generated from the tissue and the filtrate was obtained through 0.2 micron syringe filter filtration.

Nucleotide sequences (SEQ ID NO: 19 to SEQ ID NO: 36) encoding the spike proteins of PEDV obtained through GenBank of about 18 kinds of NCBI were multiplexed and compared and analyzed to find common regions in which the following mutations did not occur (Strain, GenBank accession no. SEQ ID NO: 19: 83P-5 p34th, AB548619, SEQ ID NO: 20: 83P-5 p61st, AB548620, SEQ ID NO: 21: 83P-5 p100th, AB548621, SEQ ID NO: , AB548618, SEQ ID NO: 23 Br1 / 87, Z25483, SEQ ID NO: 24: Chinju99, AY167585, SEQ ID NO: 25 DR13 attenuated, DQ462404, SEQ ID NO: 26 DR13 parent, DQ862099, SEQ ID NO: 27, JS-2004-2, AY653204 KNU-0902, KNU-0902, GU180143, SEQ ID NO: 30: KNU-0901, GU180144, SEQ ID NO: 31: KNU-0902, GU180145, SEQ ID NO: 32, KNU-0903, GU180146 , SEQ ID NO: 33: KNU-0904, GU180147, SEQ ID NO: 34: KNU-0905, GU180148, SEQ ID NO: 35: LJB_03, DQ985739, SEQ ID NO: 36: Spk1, AF500215).

Spike 1 over forward: CCATTCAGCGTATTCTTTATTGTGATGA (SEQ ID NO: 1)

Spike 1 over reverse: CCTATGTTACTATACACCAACACAGGCTCTG (SEQ ID NO: 2)

Spike 2 over forward: CTGTTAATGATTACCTGTCTTTAGCAAATTTTGTG (SEQ ID NO: 3)

Spike 2 over reverse: CAATCAACACTAACAGGCGTGTTGTAAAGC (SEQ ID NO: 4)

Among these, PEDV cDNA was prepared using Accuscript Hi-Fi Reverse transcriptase (Ailgent) using primer SEQ ID NO: 4 closest to the 3 'end.

The prepared cDNA was used to clone the immunocomplexes according to the following PCR conditions using primer sequences 1 and 2 and primer sequences 3 and 4.

Step 1: 90 ° C for 10 min,

Step 2: 90 < 0 > C for 30 sec,

Step 3: 62 ° C for 30 sec,

Step 4: 72 ° C for 2 min,

Step 5: go to Step 2 (x39),

Step 6: 72 < 0 > C for 10 min,

Step 7: Hold at 12 ° C.

In order to insert the cloned immunocomplex into the gene recombination vector, a restriction enzyme site at the 5 'end and a BamHI restriction enzyme site at the 3' end were attached using the following primers, followed by ligation lt; / RTI >

Spike 1 forward PstI: CTGCAGATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 5)

Spike 1 reverse BamHI: GCGCGGATCCTTATATGTTACTATACACC (SEQ ID NO: 6)

Spike 2 forward PstI: GGCTGCAGGTTAATGATTACCTGTCTTT (SEQ ID NO: 7)

Spike 2 reverse BamHI: GGATCCTTAATCAACACTAACAGGCGT (SEQ ID NO: 8)

The PCR conditions for this were the same as those described above.

Example 2: Vector production

Bacillus subtilis 168 strain (KCTC 1327) was used. The vector for expressing the immunocomplexes on the surface of the spores of B. subtilis was prepared by digesting the pHT-01 vector (BioSharp, Inc.) with SacI and BamHI and ligating this site to the SacI restriction site at the 5 'end and the SacI restriction site at the 3' BamHI restriction sites, PCotB-CotB-linker-MCS and PCotC-CotC-linker-MCS, respectively.

The following primers (SEQ ID NOS: 9, 10, 37, 38, 39 and 40) were amplified from the genomic DNA of B. subtilis of PCotG-CotG, PCotB-CotB and PCotC- And a BamHI restriction enzyme site and a linker as a fusion site were attached to the 3 'end. In this case, the linker sequence was commonly used in SEQ ID NO: 16.

Linker sequence GGAGGTGGGGGTTCACTCCAG (SEQ ID NO: 16) CotG forward GAGCTCAGTGTCCCTAGCTCCGAG (SEQ ID NO: 9) Liker reverse CTGCAGTGAACCCCCACCTCCTTTGTATTTCTTTTTGACTA
(SEQ ID NO: 10) CotB forward ATAGAGCTCCTTCCAATCTCTT (SEQ ID NO: 37) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAAAATTTACGTTTC (SEQ ID NO: 38) CotC forward ATAGAGCTCTGTAGGATAAATCGT (SEQ ID NO: 39) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAGTAGTGTT (SEQ ID NO: 40)

The PstI restriction site was attached to the 3 'terminus of the linker and was replaced with the immunocomplex site in the future.

In order to transfer the cloned immunocomplex to the gene recombination vector, a PstI restriction site was attached to the 5 'end and a BamHI restriction site was attached to the 3' end using the primers of SEQ ID NOS: 5, 6, 7 and 8. The PCR conditions for this were the same as those described above.

Example 3: Transformation of Bacillus

Bacillus transformation was carried out by a conventional method using electroporation (EP) (BIO-RAD Gene Pulser II) among the above-mentioned methods.

Specifically, B. subtilis DB104 strain grown in growth medium (LB medium plus 0.5M sorbitol (Sigma-Aldrich Inc)) was added to electroporation medium (LB medium plus 0.5M sorbitol, 0.5M mannitol (Sigma-Aldrich Inc) (Sigma-Aldrich). The dilution was diluted to a constant time of 5 msec when given to 200 μl of 2 Ω kV, 0.25 μF of Gene Pulser II (BIO-RAD) by dividing 60 μl into a 0.1 cm electrode of E. Coli Pulser Cuvett (BIO-RAD). The diluted competent cells were stored at -80 ° C.

Transformation was carried out by adding 10 ng of DNA plasmid to competent cells.

Immediately after the electric shock, 1 ml of outgrowth medium (LB medium plus 0.5 M sorbitol and 0.38 M mannitol) was added and incubated for 3 hours in a shaker incubator at 37 ° C. Subsequently, transformed Bacillus colony was obtained from chloramphenicol (Sigma-Aldrich Inc) LB plate.

Example 4: Fabrication of a Bacillus spore display system

In order to confirm the self-made gene recombination vector, the GFP base sequence having the PstI restriction site at the 5 'end and the BamHI restriction site at the 3' end was transferred to the recombinant vector with the primer sets of SEQ ID NOS: 11 and 12 .

eGFP forward PstI: CTGCAGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 11)

eGFP reverse BamHI: CCATGGGGATCCTTACTTGTACAGCTCGTCCATGCCG (SEQ ID NO: 12)

Transgenic bacilli were obtained by the above-mentioned transformation method using the prepared recombinant vector.

Transfected Bacillus expresses GFP signal during spore formation. In order to confirm this, GFP signal was confirmed by fluorescence microscope and flow cytometry at 24, 48, and 72 hours while growing transformed Bacillus in Schaeffer's sporulation medium. Spore expression was also confirmed by Malachite green staining.

When using CotG, a fluorescence microscope, flow cytometry and Malachite green staining are shown in FIGS. 41, 42 and 43, respectively.

When using CotB, a fluorescence microscope, flow cytometry and Malachite green staining are shown in FIGS. 47, 48 and 49, respectively.

When using CotC, a fluorescence microscope, flow cytometry and Malachite green staining are shown in FIGS. 52, 53 and 54, respectively.

In addition, when the surface protein was removed by treatment with Pronase (Sigma-Aldrich, Inc.) to detect the spore surface expression of the antigen, the GFP protein was expressed on the spore surface through the decrease of the GFP signal Respectively.

Fig. 44 shows the results of the Pronase treatment experiment to confirm that GFP was expressed on the spore surface when CotG was used.

Through this, it was found that the antigen linked to CotG was displayed on the surface of the spores through the linker.

Example 5: Method for producing vaccine

Transformed B. subtilis was cultured in 2 ml of LB medium for 3 hours and 500 μl per 1 L of Schaeffer's sporulation medium was added to induce spore formation for 48 hours.

If more than 90% of spores are formed through malachite green staining mentioned above, the process goes to the spore inactivation step. If the spore formation is not enough, the spore is inactivated after additional culturing for 6 hours to 12 hours.

Spore inactivation was carried out by sterilization at 120 ° C for 15 min. To inactivate spores, a portion of the obtained samples was placed in LB plate or LB medium, and cultured at 37 ° C in a shaker incubator at 37 ° C for overnight culture.

Spores not inactivated as a control were cultured together. At this time, serial dilution was performed to confirm the number of spores. When spore inactivation was confirmed, washing and centrifugation were performed 5 times with sterilized cold destilled water (DW) to avoid suspension. The spores Washing process is finished is dispensed and stored at -80 ℃ refrigerator until ready for use by the PBS 10 with the mouse ⁸ / 200ul, pigs 10 to ¹² / ml concentration.

Example 6: Master vaccine

Currently, PEDV that has spread to domestic are divided into domestic, domestic, European and European types. Cross protection between these three PEDV vaccines is known to be poor. The reason for this is that mutation occurs in the immunocomplex and the immune decision region is different for each kind of PEDV virus. Therefore, when the immunocomplexes of three kinds of PEDV viruses were cloned into the above-mentioned recombinant vector, a vaccine producing defense against PEDV propagated in Korea could be produced.

Example 7: Identification of the immune response

The immunoreactivity of the constructed recombinant vaccine was confirmed as follows. A 10 ⁸ / 200ul recombinant vaccine was injected intraperitoneally into c57BL / 6 strain at two week intervals. Changes in body weight and blood IgG levels were measured before or at 40 days after the first injection.

The results of the immunoreaction confirmation experiment using CotG, CotB and CotC are shown in FIGS. 45, 50 and 55, respectively.

The mice inoculated with the recombinant vaccine should have an increased concentration of IgG in the blood without a change in body weight as compared to the non-vaccinated mouse. In order to confirm the generation of an antigen-specific antibody, the Spike2 antigen was cloned into the pET28a vector with the primer set of SEQ ID NOS: 13 and 14 shown below and purified using AKTA pure L1. On the 40th day after the vaccination with the recombinant recombinant protein Immunoblotting assay was performed using the blood obtained from the mouse.

forward: GCTAGCATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 13)

reverse: GGATCCTTATATGTTACTATACACCAACACAGG (SEQ ID NO: 14)

His-tagging was performed at the N-terminus of the antigen to purify and verify the antigen. Identification of the antigen-specific antibody can be confirmed by detecting the band at the same position as the anti-His antibody when the immunoblotting assay is performed.

The results of the immunoreaction confirmation experiment using CotG, CotB and CotC are shown in FIGS. 46, 51 and 56, respectively.

Materials

pET28a vector: Addgene

AKTA pure L1: GE Healthcare

Anti-His antibody: Santa-Cruz

Example 8: Preparation of neutralizing antibody

The method of verifying the effect of the recombinant vaccine was carried out by confirming the change in the IgG concentration in the blood obtained in the above-described immunoreaction confirmation method. The concentration of IgG in blood was determined by a conventional ELISA assay. At this time, an ELISA kit (Goma Biotech) was used

It can be confirmed that a higher level of IgG is produced in the blood of the mice inoculated with the recombinant vaccine than in the blood of the non-inoculated mice.

A total of 8 pigs (4 to 5 weeks old on D-1) were randomly divided into two groups to determine whether the present recombinant vaccine vaccinated pigs were protected from PEDV. The placebo or recombinant vaccine was designated D0 , 14, and 28 were inoculated intramuscularly.

Clinical signs up to D40 were monitored daily. Injection site and weight change were measured. Changes in IgG levels were measured by ELISA using pre - collected serum samples.

[Production of PCV vaccine]

The following is another example of the preparation of antigens, antibodies and vaccines against PCV.

Example 9: Preparation of common region primer

Materials required for the experiment were as follows:

Samples (Animal Tissue): Revival Farm

0.2 micron syringe filter: Millpore

nPFU-forte (enzynomics)

nTaq polymerase (enzynomics)

Restriction enzymes SacI, PstI, and BamHI (enzynomics)

pGEM T easy vector system: (Promega)

PCR machine: (BioRad)

We obtained tissue from swine which showed diarrhea symptoms in Korea revival farm. Homogenates were generated from the tissue and the filtrate was obtained through 0.2 micron syringe filter filtration.

PCV-2A, PCV-2B, PCV-m2B) obtained by NCBI's GenBank were compared and compared. Three types of capsid primers of SEQ ID NOS: 41 to 46 below were obtained, from which the useful antigens could be obtained.

PCV-2A
Capsid forward CTGCAGACGTATCCAAGGAG (SEQ ID NO: 41) reverse CCATGGGGATCCTTAGGGTTTAAGT (SEQ ID NO: 42) PCV-2B
Capsid forward CTGCAGACGTATCCAAGGAG (SEQ ID NO: 43) Liker reverse CCATGGGGATCCTTAAGGGTTAA (SEQ ID NO: 44) PCV-m2B
Capsid forward CTGCAGACGTATCCAAGGAG (SEQ ID NO: 45) Liker reverse CCATGGGGATCCTCACTTAGGGT (SEQ ID NO: 46)

The ORF2 antigen, which is the antigenic protein of PCV, was generated from any one of the three capsid primers.

Therefore, cDNAs of PCVs using Accuscript Hi-Fi Reverse Transcriptase (Ailgent) using 5 'CCCCCCCATGCCCTGAATTTCCATA 3' (SEQ ID NO: 48) at the termination codon end of the gene encoding the capsid protein, .

The prepared cDNA was used to clone an immunocomplex region using the following PCR conditions using SEQ ID NO: 41 to SEQ ID NO: 46.

Step 1: 90 ° C for 10 min,

Step 2: 90 < 0 > C for 30 sec,

Step 3: 62 ° C for 30 sec,

Step 4: 72 ° C for 2 min,

Step 5: go to Step 2 (x39),

Step 6: 72 < 0 > C for 10 min,

Step 7: Hold at 12 ° C.

In order to insert the cloned immunocomplex into the gene recombination vector, a restriction enzyme site at the 5 'end and a BamHI restriction enzyme site at the 3' end were attached using the following primers, followed by ligation lt; / RTI >

forward PstI: CTGCAGATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 5)

reverse BamHI: GCGCGGATCCTTATATGTTACTATACACC (SEQ ID NO: 6)

The PCR conditions for this were the same as those described above.

Example 10: Vector production

Bacillus subtilis 168 strain (KCTC 1327) was used. The vector for expressing the immunocomplexes on the surface of the spores of B. subtilis was prepared by digesting the pHT-01 vector (BioSharp, Inc.) with SacI and BamHI and ligating this site to the SacI restriction site at the 5 'end and the SacI restriction site at the 3' BamHI restriction sites were replaced with PCotG-CotG-linker-MCS, PCotB-CotC-linker-MCS and PCotC-CotC-linker-MCS, respectively.

The following primers (SEQ ID NOS: 9, 10, 37, 38, 39, and 40) were amplified from the genomic DNA of B. subtilis of PCotG-CotG, PCotB-CotB and PCotC- And a BamHI restriction enzyme site and a linker as a fusion site were attached to the 3 'end. In this case, the linker sequence was commonly used in SEQ ID NO: 16.

Linker sequence GGAGGTGGGGGTTCACTCCAG (SEQ ID NO: 16) CotG forward GAGCTCAGTGTCCCTAGCTCCGAG (SEQ ID NO: 9) Liker reverse CTGCAGTGAACCCCCACCTCCTTTGTATTTCTTTTTGACTA
(SEQ ID NO: 10) CotB forward ATAGAGCTCCTTCCAATCTCTT (SEQ ID NO: 37) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAAAATTTACGTTTC (SEQ ID NO: 38) CotC forward ATAGAGCTCTGTAGGATAAATCGT (SEQ ID NO: 39) Liker reverse TATCTGCAGTGAACCCCCACCTCCTTAGTAGTGTT (SEQ ID NO: 40)

The PstI restriction site was attached to the 3 'terminus of the linker and was replaced with the immunocomplex site in the future.

In order to transfer the cloned immunocomplex to the gene recombination vector, the PstI restriction site was attached to the 5 'end and the BamHI restriction site was attached to the 3' end using the primers of SEQ ID NOS: 5 and 6. The PCR conditions for this were the same as those described above.

Example 11: Transformation of Bacillus

Bacillus transformation was carried out by a conventional method using electroporation (EP) (BIO-RAD Gene Pulser II) among the above-mentioned methods.

Specifically, B. subtilis DB104 strain grown in growth medium (LB medium plus 0.5M sorbitol (Sigma-Aldrich Inc)) was added to electroporation medium (LB medium plus 0.5M sorbitol, 0.5M mannitol (Sigma-Aldrich Inc) (Sigma-Aldrich). The dilution was diluted to a constant time of 5 msec when given to 200 μl of 2 Ω kV, 0.25 μF of Gene Pulser II (BIO-RAD) by dividing 60 μl into a 0.1 cm electrode of E. Coli Pulser Cuvett (BIO-RAD). The diluted competent cells were stored at -80 ° C.

Transformation was carried out by adding 10 ng of DNA plasmid to competent cells.

Immediately after the electric shock, 1 ml of outgrowth medium (LB medium plus 0.5 M sorbitol and 0.38 M mannitol) was added and incubated for 3 hours in a shaker incubator at 37 ° C. Subsequently, transformed Bacillus colony was obtained from chloramphenicol (Sigma-Aldrich Inc) LB plate.

Example 12: Fabrication of Bacillus spore display system

In order to confirm the self-made gene recombination vector, the GFP base sequence having the PstI restriction site at the 5 'end and the BamHI restriction site at the 3' end was transferred to the recombinant vector with the primer sets of SEQ ID NOS: 11 and 12 .

eGFP forward PstI: CTGCAGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 11)

eGFP reverse BamHI: CCATGGGGATCCTTACTTGTACAGCTCGTCCATGCCG (SEQ ID NO: 12)

Transgenic bacilli were obtained by the above-mentioned transformation method using the prepared recombinant vector.

Transfected Bacillus expresses GFP signal during spore formation. In order to confirm this, GFP signal was confirmed by fluorescence microscope and flow cytometry at 24, 48, and 72 hours while growing transformed Bacillus in Schaeffer's sporulation medium. Spore expression was also confirmed by Malachite green staining.

The results of Malachite green staining experiment using CotG, CotB and CotC are shown in FIGS. 57, 58 and 59, respectively.

Example 13: Preparation of vaccine

Transformed B. subtilis was cultured in 2 ml of LB medium for 3 hours and 500 μl per 1 L of Schaeffer's sporulation medium was added to induce spore formation for 48 hours.

If more than 90% of spores are formed through malachite green staining mentioned above, the process goes to the spore inactivation step. If the spore formation is not enough, the spore is inactivated after additional culturing for 6 hours to 12 hours.

Spore inactivation was carried out by sterilization at 120 ° C for 15 min. To inactivate spores, a portion of the obtained samples was placed in LB plate or LB medium, and cultured at 37 ° C in a shaker incubator at 37 ° C for overnight culture.

Spores not inactivated as a control were cultured together. At this time, serial dilution was performed to confirm the number of spores. When spore inactivation was confirmed, washing and centrifugation were performed 5 times with sterilized cold destilled water (DW) to avoid suspension. The spores Washing process is finished is dispensed and stored at -80 ℃ refrigerator until ready for use by the PBS 10 with the mouse ⁸ / 200ul, pigs 10 to ¹² / ml concentration.

Example 14: Identification of the immune response

The immunoreactivity of the constructed recombinant vaccine was confirmed as follows. A 10 ⁸ / 200ul recombinant vaccine was injected intraperitoneally into c57BL / 6 strain at two week intervals. Changes in body weight and blood IgG levels were measured before or at 40 days after the first injection.

The results of the immunoreaction confirmation experiment using CotG, CotB and CotC are shown in Figs. 60, 61 and 62, respectively.

The mice inoculated with the recombinant vaccine should have an increased concentration of IgG in the blood without a change in body weight as compared to the non-vaccinated mouse. PCV-2B and PCV-m2B antigens were cloned into the pET28a vector with the primer sets of SEQ ID NOS: 13 and 14 shown below, and purified using AKTA pure L1 to confirm the generation of the antigen-specific antibody Immunoblotting assay was performed using the blood obtained from the mouse 40 days after the recombinant vaccination.

forward: GCTAGCATTCAGCGTATTCTTTATTGTGA (SEQ ID NO: 13)

reverse: GGATCCTTATATGTTACTATACACCAACACAGG (SEQ ID NO: 14)

His-tagging was performed at the N-terminus of the antigen to purify and verify the antigen. Identification of the antigen-specific antibody can be confirmed by detecting the band at the same position as the anti-His antibody when the immunoblotting assay is performed.

The results of the immunoreaction confirmation experiment using CotG, CotB and CotC are shown in Figs. 63, 64 and 65, respectively.

Materials

pET28a vector: Addgene

AKTA pure L1: GE Healthcare

Anti-His antibody: Santa-Cruz

Example 15: Preparation of neutralizing antibody

The method of verifying the effect of the recombinant vaccine was carried out by confirming the change in the IgG concentration in the blood obtained in the above-described immunoreaction confirmation method. The concentration of IgG in blood was determined by a conventional ELISA assay. At this time, an ELISA kit (Goma Biotech) was used

It can be confirmed that a higher level of IgG is produced in the blood of the mice inoculated with the recombinant vaccine than in the blood of the non-inoculated mice.

A total of 8 pigs (4 to 5 weeks old on D-1) were randomly divided into two groups to determine whether the present recombinant vaccine vaccinated pigs were protected from PEDV. The placebo or recombinant vaccine was designated D0 , 14, and 28 were inoculated intramuscularly.

Clinical signs up to D40 were monitored daily. Injection site and weight change were measured. Changes in IgG levels were measured by ELISA using pre - collected serum samples.

The present application provides a variety of applications and uses of immunogenic materials, immunogenic systems, and animal vaccine compositions comprising them, directed against pathogenic agents of particular disease in animals.

As a preferable example, it can be usefully used for vaccines, medicines and feeds for prevention, improvement and treatment of swine infectious diseases.

<110> JBbiotech <120> Immunogen, immunogenic system and vaccine composition thereof <130> CP17-151 <160> 50 <170> KoPatentin 3.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> spike1 forward primer <400> 1 ccattcagcg tattctttat tgtgatga 28 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> spike1 reverse primer <400> 2 cctatgttac tatacaccaa cacaggctct g 31 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> spike2 forward primer <400> 3 ctgttaatga ttacctgtct ttagcaaatt ttgtg 35 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> spike2 reverse primer <400> 4 caatcaacac taacaggcgt gttgtaaagc 30 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Spike1 forward PstI primer <400> 5 ctgcagattc agcgtattct ttattgtga 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Spike 1 reverse BamHI primer <400> 6 gcgcggatcc ttatatgtta ctatacacc 29 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Spike 2 forward PstI primer <400> 7 ggctgcaggt taatgattac ctgtcttt 28 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Spike 2 reverse BamHI primer <400> 8 ggatccttaa tcaacactaa caggcgt 27 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CotG forward primer <400> 9 gagctcagtg tccctagctc cgag 24 <210> 10 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> CotG Liner reverse primer <400> 10 ctgcagtgaa cccccacctc ctttgtattt ctttttgact a 41 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> eGFP forward PstI primer <400> 11 ctgcaggtga gcaagggcga ggagctg 27 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> eGFP reverse BamHI primer <400> 12 ccatggggat ccttacttgt acagctcgtc catgccg 37 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Spike2 purification forward primer <400> 13 gctagcattc agcgtattct ttattgtga 29 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Spike2 purification reverse primer <400> 14 ggatccttat atgttactat acaccaacac agg 33 <210> 15 <211> 585 <212> DNA <213> Bacillus subtilis <400> 15 ttgggccact attcccattc tgacatcgaa gaagcggtga aatccgcaaa aaaagaaggt 60 ttaaaggatt atttatacca agagcctcat ggaaaaaaac gcagtcataa aaagtcgcac 120 cgcactcaca aaaaatctcg cagccataaa aaatcatact gctctcacaa aaaatctcgc 180 agtcacaaaa aatcattctg ttctcacaaa aaatctcgca gccacaaaaa atcatactgc 240 tctcacaaga aatctcgcag ccacaaaaaa tcgtaccgtt ctcacaaaaa atctcgcagc 300 tataaaaaat cttaccgttc ttacaaaaaa tctcgtagct ataaaaaatc ttgccgttct 360 tacaaaaaat ctcgcagcta caaaaagtct tactgttctc acaagaaaaa atctcgcagc 420 tataagaagt catgccgcac acacaaaaaa tcttatcgtt cccataagaa atactacaaa 480 aaaccgcacc accactgcga cgactacaaa agacacgatg attatgacag caaaaaagaa 540 tactggaaag acggcaattg ctgggtagtc aaaaagaaat acaaa 585 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Linker sequence <400> 16 ggaggtgggg gttcactcca g 21 <210> 17 <211> 891 <212> DNA <213> porcine epidemic diarrhea virus <400> 17 attcagcgta ttctttattg tgatgatcct gttagccaac tcaagtgttc tcaggttgct 60 tttgaccttg acgatggttt ttaccctatt tcttctagaa accttctgag tcatgaacag 120 ccaatttctt ttgttactct gccatcattt aatgatcatt cttttgttaa cattactgta 180 tctgcttcct ttggtggtca tagtggtgcc aaccttattg catctgacac tactatcaat 240 gggtttagtt ctttctgtgt tgacactaga caatttacca tttcactgtt ttacaacgtt 300 acaaacagtt atggttatgt gtctaaatca caggacagta attgcccctt caccttgcaa 360 tctgttaatg attacttgtc ttttagcaaa ttttgtgttt ccaccagcct tttggctagt 420 gcctgtacca tagatctttt tggttaccct gagtttggta gtggtgttaa gtttacgtcc 480 ctttactttc aattcacaaa gggtgagttg attactggca cgcctaaacc acttgaaggt 540 gtcacggacg tttcttatat gactctggat gtgtgtacca agtatactat ctatggcttt 600 aaaggtgagg gtgtcattac ccttacaaat tctagctttt tggcaggtgt ttattacaca 660 tctgattctg gacagttgtt agcctttaag aatgttacta gtggtgctgt ttattctgtt 720 acgccatgtt ctttttcaga gcaggctgca tatgttgatg atgatatagt gggtgttatt 780 tctagtttgt ctagctccac ttttaacagt actagggagt tgcctggttt cttctaccat 840 tctaatgatg gctctaattg tacagagcct gtgttggtgt atagtaacat a 891 <210> 18 <211> 687 <212> DNA <213> porcine epidemic diarrhea virus <400> 18 gttaatgatt acctgtcttt tagcaaattt tgtgtttcca ccagcctttt ggctagtgcc 60 tgtaccatag atctttttgg ttaccctgag tttggtagtg gtgttaagtt tacgtccctt 120 tactttcaat tcacaaaggg tgagttgatt actggcacgc ctaaaccact tgaaggtgtc 180 acggacgttt cttatatgac tctggatgtg tgtaccaagt atactatcta tggctttaaa 240 ggtgagggtg tcattaccct tacaaattct agctttttgg caggtgttta ttacacatct 300 gattctggac agttgttagc ctttaagaat gttactagtg gtgctgttta ttctgttacg 360 ccatgttctt tttcagagca ggctgcatat gttgatgatg atatagtggg tgttatttct 420 agtttgtcta gctccacttt taacagtact agggagttgc ctggtttctt ctaccattct 480 aatgatggct ctaattgtac agagcctgtg ttggtgtaca gtaacatagg tgtttgtaaa 540 tctggcagta ttggctacgt cccttctcag tctggccaag tcaagattgc acccatggtt 600 actgggaata ttagtattcc caccaacttt agtatgagta ttaggacaga atatttacag 660 ctttacaaca cgcctgttag tgttgat 687 <210> 19 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 19 acgtaaacaa atgaggtctt taatttactt ctggttgctc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ctaggtgcca gtctactact aactttaggc ggttcttttc 120 ggttacctac ctcttctagc tggtactgtg gcacaggcat tgaaactgct agtggcgttc atggtatttt 240 tctcagctac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacataa ggccactaat ggtaacacta atgctattgc 360 acgactgcgc atttgccagt ttcccgataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gcttatatgc gtgatggaaa 480 agatattgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaatcgcag 600 aagttgtgct atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc 660 aggtgaggat ggcatttatt atgaaccctg tacagctaat tgcactggtt acgctgccaa 720 tgtatttgcc actgattcca atggccatat accagaaggt tttagtttta ataattggtt 780 tcttttatcc aatgactcca ctttgttgca tggtaaagtg gtttccaacc aacccttgtt 840 ggtcaattgt cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa 900 tcacacgatg gatggcgttt gtaatggagc tgctgtggat cgtgccccag aggctctgag 960 gtttaatatt aatgacacct ccgtcattct tgctgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcatt tagccatctt 1080 tgccatacct ctgggtgcta ctgaagtacc ctactattgc tttcttaaag tggatactta 1140 caactccact gtttataaat tcttggctgt tttacctcct actgtcaggg aaattgtcat 1200 caccaagtat ggtgatgttt atgtcaatgg gtttggctat ttgcatctcg gtttgttgga 1260 tgctgtcaca attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac 1320 catagcatcg actaattttg ttgatgcact catcgaggtt caaggaactt ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct 1440 tgacgatggt ttttacccca tctcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tctctgcggc 1560 ttttggtggt cttagtagtg ccaatctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatttac cattacactg ttttataatg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag taattgtcct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgcgttcgg tagtggtgtt aagttgacgt ccctttattt 1860 tcaattcaca aaaggtgagt tgattactgg cacgcctaaa ccacttgaag gtatcacaga 1920 cgtttctttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccac ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactc acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttacc atttctgaag aggctttaca 2580 gttagctacc atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgc 2640 ttccgtgtac gatcctgcaa gtggcagggt ggtacaaaaa aggtctgtta ttgaagactt 2700 gctttttaat aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgatctagt ctgtgcgcag tattactctg gtgtcatggt 2820 actacctggc gttgttgacg ctgagaagct tcacatgtac agtgcgtctc tcataggtgg 2880 tatggcgcta ggaggtataa ctgctgcagc ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttctacag cggaaccagc aattgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc 3060 tattagtcaa acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga 3120 ggttgttaat tcgcagggtt cagctttgaa ccaacttacc gtacagctgc aacacaactt 3180 ccaagccatt tctagttcta ttgatgacat ttattcccga ctggacattc tttcagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgccca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta cggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctg gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc 3480 gggtgatttt gtaaatgttc ttgccatcgc tggcttatgc gttaatggtg aaattgcctt 3540 gactctacgt gagcctggct tagtcttgtt tacgcatgaa cttcaaaatt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt gagagttgtg tggtcaccta tgtcaatctg actagcgacc agctaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaaat ggtccaagtc ttcccctaga tgtttttaat gccacttatc ttaatcttac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctc attaacaaca tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacatac atcaagtggc cgtggtgggt ttggttgatc atttttattg ttctcatctt 4020 tgttgtgtca ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 20 <211> 4152 <212> DNA <213> porcine epidemic diarrhea virus <400> 20 atgaagcctt taatttactt ctggttgttc ttaccagtac ttctaacact tagcctacca 60 caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc aaaatttaat 120 gttcaggcac ctgccgtcgt cgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt tctcagttac 240 atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga tcctagtggt 300 taccagcttt atttacacaa ggccactaat ggtaacacta gtgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacaa agccattcca gcttatatgc aggatggaaa aaatattgtt 480 gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat ctatcatttt 540 tatattaaaa atgattggtc ccgtgttgcg acaagatgtt acaataaaag aagttgtgcc 600 atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc aggtgaggat 660 ggcatttact atgaaccttg tacagctaat tgcagtggtt acgctgccaa tgtatttgcc 720 actgattcca atggccatat accagaaggt tttagtttta ataattggtt tcttttgtcc 780 aatgactcca ctttgttgca tggtaaagtg gtttcaaacc aacctttgtt ggtcaactgc 840 ctttgggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa tcaaacgatg 900 gatggcgttt gtaacggagc cgctgcgcag cgtgccccag aggctctgag gtttaatatt 960 aatgacactt ttgtcattct tgctgaaggc tcaattgtac ttcatactgc tttaggaaca 1020 aatctttctt ttgtttgcag taattcctca gatcctcaca aagccatctt taccatacct 1080 ttgggtgtta ctgaagtacc ctactattgc tttcttaaag tggatactta caaatccact 1140 gtttataaat tcttggctgt tttacctcct actgtcaagg aaattgtcat caccaagtac 1200 ggtgatgttt atgtcaacgg gtttggctat ttgcatctcg gtttgttgga tgctgtcaca 1260 attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac cgtagcatcg 1320 actaattttg ttgatgcact catcgaggtt caaggaactg ccattcagcg tattctttat 1380 tgtgatgacc ctgttagcca acttaagtgt tctcaggttt cttttgacct tgatgatggt 1440 ttttacccta tttcttctag aaaccttctg agtcatgaac agccaatttc ttttgttact 1500 ttgccatcat tcaatgatca ttcttttgtt aatattactg tctctgcggc ttttggtggt 1560 catagtggtg ccaacctcat tgcatctgac actactatca atgggtttag ttctttctgt 1620 gttgacacta gacaatttac cattacactg ttttataacg ttacaaacag ttatggttat 1680 gtgtctaagt cacaggatag taattgccct ttcaccttgc aatctgttaa tgattacctg 1740 ttttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac catagatctt 1800 tttggttacc ctgagttcgg tagtggtgtt aagtttacgt ccctttattt tcaattcaca 1860 aagggtgagt tgattactgg cacgcctaaa ccacttcaag gtgtcacgga cgtttctttt 1920 atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga gggtattatt 1980 acccttacaa attctagctt tttggcaggt gtttattata catctgattc tggacagttg 2040 ttagccttta agaatgtcac tagtggtgct gtttattctg ttacgccatg ttctttttca 2100 gagcaggctg catatgttga tgatgatata gtgggtgtta tttctagttt gtctaactcc 2160 acttttaaca ataccaggga gttgcctggt ttcttctacc attctaatga tggctccaat 2220 tgtacagagc ctgtgttggt gtatagtaac ataggtgtct gtaaatctgg cagtattggc 2280 tatgtcccac ttcaggatgg ccaagtcaag attgcaccca cggttactgg gaatattagt 2340 attcccacca actttagtat gagtattaga acagaatatt tacagcttta caacacgcct 2400 gttagtgttg attgcgttac atatgtttgt aatggtaact ctcgttgtaa acaattactc 2460 acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag cgctaggctt 2520 gagtctgttg aagttaactc tatgcttact atttctgaag aggctctaca gttagctacc 2580 atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgt ttccgtgtac 2640 gatcctgcaa gtggcagggt ggtacaaaaa aggtctttta ttgaagacct gctttttaat 2700 aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg ttctaatggt 2760 cgctctgtgg cagatctagt ctgtgcgcag tattactctg gtgtcatggt actacctggc 2820 gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg tatggcgcta 2880 ggaggtttta ctactgcagc ggcattgcct tttagccatg ctgttcaagc gaggctcaat 2940 tatcttgctt tacagacgga tgttctacag cgcaaccagc aattgcttgc tgagtctttt 3000 aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc tattagtcaa 3060 acttccaatg gtttgaacac tgtggctcat gcgcttacta aggttcaaga ggttgttaat 3120 tcgcagggtt cagctttgac ccaacttacc atacagctgc aacacaactt ccaagccatt 3180 tctagttcta ttgatgacat ttactcccga ctggacattc tttcagccga tgttcaggtt 3240 gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca aaccctcact 3300 aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa tgagtgcgtc 3360 aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat cttctctctg 3420 gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc gggtgatttt 3480 gtaaatgtta ttgccatcga tggcttatgc gttaatggtg atattgcctt gactctacgt 3540 gagcctggct tagtcttgtt tacgcatgaa cttcaaactt atactgcgac ggaatatttt 3600 gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt tgttcaaatt 3660 gagagttgtg tggtcaccta tgtcaatctg actagcgacc aactaccaga tgtaatccca 3720 gattacatcg atgttaacaa aacacttgat gagattctag cttctctgcc caatagaatt 3780 ggtcctagtc ttcccctaga tgtttttaat gccacttatc ttaatctcac tggtgaaatt 3840 gcagatttag agcagcgttc agagtctctc cgtaatacta cagaagagct ccgaagtctc 3900 atatataata tcaacaacac acttgttgac cttgagtggc tcaaccgagt tgagacatat 3960 atcaagtggc cgtggtgggt ttggttgatt atttttattg ttctcatctt tgttgtgtca 4020 ttattagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg ttgcggtgct 4080 tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt tgaaaaggtc 4140 cacgtgcagt ga 4152 <210> 21 <211> 4149 <212> DNA <213> porcine epidemic diarrhea virus <400> 21 atgacgcctt taatttactt ctggttgttc ttaccagtac ttctaacact tagcctacca 60 caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc aaaatttaat 120 gttcaggcac ctgccgtcgt tgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt tctcagttac 240 atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga tcctagtggt 300 taccagcttt atttacacaa ggccactaat ggtaacacta gtgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacaa agccattcca gctttgcagg atggaaaaaa tattgttgtc 480 ggcataacat gggataatga tcgtgtcact gtttttgctg acaagatcta tcatttttat 540 attaaaaatg attggtcccg tgttgcgaca agatgttaca ataaaagaag ttgtgccatg 600 caatatgttt atacacctac ctactacatg cttaatgtta ctagtgcagg tgaggatggc 660 atttactatg aaccttgtac agctaattgc agtggttacg ctgccaatgt atttgccact 720 gattccaatg gccatatacc agaaggtttt agttttaata attggtttct tttgtccaat 780 gactccactt tgttgcatgg taaagtggtt tcaaaccaac ctttgttggt caactgcctt 840 tgggccattc ctaagattta tggactaggc caatttttct cattcaatca aacgatggat 900 ggcgtttgta acggagccgc tgcgcagcgt gccccagagg ctctgaggtt taatatta 960 gacacttttg tcattcttgc tgaaggctca attgtacttc atactgcttt aggaacaaat 1020 ctttcttttg tttgcagtaa ttcctcagat cctcacaaag ccatctttac catacctttg 1080 ggtgttactg aagtacccta ctattgcttt cttaaagtgg atacttacaa atccactgtt 1140 tataaattct tggctgtttt acctcctact gtcaaggaaa ttgtcatcac caagtacggt 1200 gatgtttatg tcaacgggtt tggctatttg catctcggtt tgttggatgc tgtcacaatt 1260 aatttcactg gtcatggcac tgacgatgac gtttcaggtt tctggaccgt agcatcgact 1320 aattttgttg atgcactcat cgaggttcaa ggaactgcca ttcagcgtat tctttattgt 1380 gatgaccctg ttagccaact taagtgttct caggtttctt ttgaccttga tgatggtttt 1440 taccctattt cttctagaaa ccttctgagt catgaacagc caatttcttt tgttactttg 1500 ccatcattca atgatcattc ttttgttaat attactgtct ctgcggcttt tggtggtcat 1560 agtggtgcca acctcattgc atctgacact actatcaatg ggtttagttc tttctgtgtt 1620 gacactagac aatttaccat tacactgttt tataacgtta caaacagtta tggttatgtg 1680 tctaagtcac aggatagtaa ttgccctttc accttgcaat ctgttaatga ttacctgtct 1740 tttagcaaat tttgtgtttc aaccagcctt ttggctggtg cttgtaccat agatcttttt 1800 ggttaccctg agttcggtag tggtgttaag tttacgtccc tttattttca attcacaaag 1860 ggtgagttga ttactggcac gcctaaacca cttcaaggtg tcacggacgt ttcttttatg 1920 actctggatg tgtgtaccaa gtatactatc tatggcttta aaggtgaggg tattattacc 1980 cttacaaatt ctagcttttt ggcaggtgtt tattatacat ctgattctgg acagttgtta 2040 gcctttaaga atgtcactag tggtgctgtt tattctgtta cgccatgttc tttttcagag 2100 caggctgcat atgttgatga tgatatagtg ggtgttattt ctagtttgtc taactccact 2160 tttaacaata ccagggagtt gcctggtttc ttctaccatt ctaatgatgg ctccaattgt 2220 acagagcctg tgttggtgta tagtaacata ggtgtctgta aatctggcag tattggctat 2280 gtcccacttc aggatggcca agtcaagatt gcacccatgg ttactgggaa tattagtatt 2340 cccaccaact ttagtatgag tattagaaca gaatatttac agctttacaa cacgcctgtt 2400 agtgttgatt gcgttacata tgtttgtaat ggtaactctc gttgtaaaca attactcacc 2460 cagtacactg cagcatgtaa gaccatagag tcagcattac aactcagcgc taggcttgag 2520 tctgttgaag ttaactctat gcttactatt tctgaagagg ctctacagtt agctaccatc 2580 agttcgttta atggtgatgg atataacttt actaatgtgc tgggtgtttc cgtgtacgac 2640 cctgcaagtg gcagggtggt acaaaaaagg tcttttattg aagacctgct ttttaataaa 2700 gtggttacta atggccttgg tactgttgat gaagactata agcgctgttc taatggtcgc 2760 tctgtggcag atctagtctg tgcgcagtat tactctggtg tcatggtact acctggcgtt 2820 gttgacgctg agaagcttca catgtatagt gcgtctctca tcggtggtat ggcgctagga 2880 ggtcttacta ctgcagcggc attgcctttt agccatgctg ttcaagcgag gctcaattat 2940 cctgctttac agacggatgt tctacagcgc aaccagcaat tgcttgctga gtcttttaac 3000 tctgctattg gtaatataac ttcagccttt gagagtgtta aagaggctat tagtcaaact 3060 tccaatggtt tgaacactgt ggctcatgcg cttactaagg ttcaagaggt tgttaattcg 3120 cagggttcag ctttgaccca acttaccata cagctgcaac acaacttcca agccatttct 3180 agttctattg atgacattta ctcccgactg gacattcttt cagccgatgt tcaggttgat 3240 cgtctcatca ccggcagatt atcagcactt aatgcttttg ttgctcaaac cctcactaag 3300 tatactgagg ttcaggctag caggaagcta gcacagcaaa aggttaatga gtgcgtcaaa 3360 tcgcaatctc agcgttatgg tttttgtggt ggtgatggcg agcacatctt ctctctggta 3420 caggccgcac ctcagggcct gctgttctta catacagtac ttgtaccggg tgattttgta 3480 aatgttattg ccatcgatgg cttatgcgtt aatggtgata ttgccttgac tctacgtgag 3540 cctggcttag tcttgtttac gcatgaactt caaacttata ctgcgacgga atattttgtt 3600 tcatcgcgac gtatgtttga acctagaaaa cctaccgtta gtgattttgt tcaaattgag 3660 agttgtgtgg tcacctatgt caatctgact agcgaccaac taccagatgt aatcccagat 3720 tacatcgatg ttaacaaaac acttgatgag attctagctt ctctgcccaa tagaattggt 3780 cctagtcttc ccctagatgt ttttaatgcc acttatctta atctcactgg tgaaattgca 3840 gatttagagc agcgttcaga gtctctccgt aatactacag aagagctccg aagtctcata 3900 tataatatca acaacacact tgttgacctt gagtggctca accgagttga gacatatatc 3960 aagtggccgt ggtgggtttg gttgattatt tttattgttc tcatctttgt tgtgtcatta 4020 ttagtgttct gctgcatttc cacgggttgt tgtggatgct gcggttgttg cggtgcttgt 4080 ttttcaggtt gttgtagggg tcctagactt caaccttacg aagcttttga aaaggtccac 4140 gtgcagtga 4149 <210> 22 <211> 4152 <212> DNA <213> porcine epidemic diarrhea virus <400> 22 atgaagcctt taatttactt ctggttgttc ttaccagtac ttctaacact tagcctacca 60 caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc aaaatttaat 120 gttcaggcac ctgccgtcgt cgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt tctcagttac 240 atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga tcctagtggt 300 taccagcttt atttacacaa ggccactaat ggtaccacta atgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacaa agccattcca gcttatatgc aggatggaaa aaatattgtt 480 gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat ctatcatttt 540 tatattaaaa atgattggtc ccgtgttgcg acaagatgtt acaataaaag aagttgtgcc 600 atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc aggtgaggat 660 ggcatttact atgaaccttg tacagctaat tgcagtggtt acgctgccaa tgtatttgcc 720 actgattcca atggccatat accagaaggt tttagtttta ataattggtt tcttttgtcc 780 aatgactcca ctttgttgca tggtaaagtg gtttcaaacc aacctttgtt ggtcaactgc 840 ctttgggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa tcaaacgatg 900 gatggcgttt gtaacggagc cgctgcgcag cgtgccccag aggctctgag gtttaatatt 960 aatgacactt ttgtcattct tgctgaaggc tcaattgtac ttcatactgc tttaggaaca 1020 aatctttctt ttgtttgcag taattcctca gatcctcaca aagccatctt taccatacct 1080 ttgggtgtta ctgaagtacc ctactattgc tttcttaaag tggatactta caaccccact 1140 gtttataaat tcttggctgt tttacctcct actgtcaagg aaattgtcat caccaagtac 1200 ggtgatgttt atgtcaacgg gtttggctat ttgcatctcg gtttgttgga tgctgtcaca 1260 attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac cgtagcatcg 1320 actaattttg ttgatgcact catcgaggtt caaggaactg ccattcagcg tattctttat 1380 tgtgatgacc ctgttagcca acttaagtgt tctcaggttt cttttgacct tgatgatggt 1440 ttttacccta tttcttctag aaaccttctg agtcatgaac agccaatttc ttttgttact 1500 ttgccatcat tcaatgatca ttcttttgtt aatattactg tctctgcggc ttttggtggt 1560 catagtggtg ccaacctcat tgcatctgac actactatca atgggtttag ttctttctgt 1620 gttgacacta gacaatttac cattacactg ttttataacg ttacaaacag ttatggttat 1680 gtgtctaagt cacaggatag taattgccct ttcaccttgc aatctgttaa tgattacctg 1740 ttttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac catagatctt 1800 tttggttacc ctgagttcgg tagtggtgtt aagtttacgt ccctttattt tcaattcaca 1860 aagggtgagt tgattactgg cacgcctaaa ccacttgaag gtgtcacgga cgtttctttt 1920 atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga gggtattatt 1980 acccttacaa attctagctt tttggcaggt gtttattata catctgattc tggacagttg 2040 ttagccttta agaatgtcac tagtggtgct gtttattctg ttacgccatg ttctttttca 2100 gagcaggctg catatgttga tgatgatata gtgggtgtta tttctagttt gtctaactcc 2160 acttttaaca ataccaggga gttgcctggt ttcttctacc attctaatga tggctccaat 2220 tgtacagagc ctgtgttggt gtatagtaac ataggtgtct gtaaatctgg cagtattggc 2280 tatgtcccac ttcaggatgg ccaagtcaag attgcaccca cggttactgg gaatattagt 2340 attcccacca actttagtat gagtattaga acagaatatt tacagcttta caacacgcct 2400 gttagtgttg attgcgttac atatgtttgt aatggtaact ctcgttgtaa acaattactc 2460 acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag cgctaggctt 2520 gagtctgttg aagttaactc tatgcttact atttctgaag aggctctaca gttagctacc 2580 atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgt ttccgtgtac 2640 gatcctgcaa gtggcagggt ggtacaaaaa aggtctttta ttgaagacct gctttttaat 2700 aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg ttctaatggt 2760 cgctctgtgg cagatctagt ctgtgcgcag tattactctg gtgtcatggt actacctggc 2820 gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg tatggcgcta 2880 ggaggtttta ctgctgcagc ggcattgcct tttagctatg ctgttcaagc gaggctcaat 2940 tatcttgctt tacagacgga tgttctacag cgcaaccagc aattgcttgc tgagtctttt 3000 aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc tattagtcaa 3060 acttccaatg gtttgaacac tgtggctcat gcgcttacta aggttcaaga ggttgttaat 3120 tcgcagggtt cagctttgac ccaacttacc atacagctgc aacacaactt ccaagccatt 3180 tctagttcta ttgatgacat ttactcccga ctggacattc tttcagccga tgttcaggtt 3240 gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca aaccctcact 3300 aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa tgagtgcgtc 3360 aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat cttctctctg 3420 gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc gggtgatttt 3480 gtaaatgtta ttgccatcgc tggcttatgc gttaatggtg atattgcctt gactctacgt 3540 gagcctggct tagtcttgtt tacgcatgaa cttcaaactt atactgcgac ggaatatttt 3600 gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt tgttcaaatt 3660 gagagttgtg tggtcaccta tgtcaatctg actagcgacc aactaccaga tgtaatccca 3720 gattacatcg atgttaacaa aacacttgat gagattctag cttctctgcc caatagaact 3780 ggtcctagtc ttcccctaga tgtttttaat gccacttatc ttaatctcac tggtgaaatt 3840 gcagatttag agcagcgttc agagtctctc cgtaatacta cagaagagct ccgaagtctc 3900 atatataata tcaacaacac acttgttgac cttgagtggc tcaaccgagt tgagacatat 3960 atcaagtggc cgtggtgggt ttggttgatt atttttattg ttctcatctt tgttgtgtca 4020 ttattagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg ctgcggtgct 4080 tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt tgaaaaggtc 4140 cacgtgcagt ga 4152 <210> 23 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 23 acgtaaacaa atgaggtctt taatttactt ctggttgctc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ctaggtgcca gtctactact aactttaggc ggttcttttc 120 ggttacctac ctcttctagc tggtactgtg gcacaggcat tgaaactgct agtggcgttc atggtatttt 240 tctcagctac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacataa ggccactaat ggtaacacta atgctactgc 360 acgactgcgc atttgccagt ttcccgataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gcttatatgc gtgatggaaa 480 agatattgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaatcgcag 600 aagttgtgct atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc 660 aggtgaggat ggcatttatt atgaaccctg tacagctaat tgcactggtt acgctgccaa 720 tgtatttgcc actgattcca atggccatat accagaaggt tttagtttta ataattggtt 780 tcttttatcc aatgactcca ctttgttgca tggtaaagtg gtttccaacc aacccttgtt 840 ggtcaattgt cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa 900 tcacacgatg gatggcgttt gtaatggagc tgctgtggat cgtgccccag aggctctgag 960 gtttaatatt aatgacacct ccgtcattct tgctgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcatt tagccatctt 1080 tgccatacct ctgggtgcta ctgaagtacc ctactattgc tttcttaaag tggatactta 1140 caactccact gtttataaat tcttggctgt tttaccttct actgtcaggg aaattgtcat 1200 caccaagtat ggtgatgttt atgtcaatgg gtttggctat ttgcatctcg gtttgttgga 1260 tgctgtcaca atttatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac 1320 catagcatcg actaattttg ttgatgcact catcgaggtt caaggaactt ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct 1440 tgacgatggt ttttacccca tctcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tctctgcggc 1560 ttttggtggt cttagtagtg ccaatctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatttac cattacactg ttttataatg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag taattgtcct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgcgttcgg tagtggtgtt aagttgacgt ccctttattt 1860 tcaattcaca aaaggtgagt tgattactgg cacgcctaaa ccacttgaag gtatcacaga 1920 cgtttctttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccat ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactc acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttacc atttctgaag aggctttaca 2580 gttagctacc atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgc 2640 ttccgtgtac gatcctgcaa gtggcagggt ggtacaaaaa aggtctgtta ttgaagactt 2700 gctttttaat aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgatctagt ctgtgcgcag tattactctg gtgtcatggt 2820 actacctggc gttgttgacg ctgagaagct tcacatgtac agtgcgtctc tcataggtgg 2880 tatggcgcta ggaggtataa ctgctgcagc ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttctacag cggaaccagc aattgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc 3060 tattagtcaa acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga 3120 ggttgttaat tcgcagggtt cagctttgaa ccaacttacc gtacagctgc aacacaactt 3180 ccaagccatt tctagttcta ttgatgacat ttattcccga ctggacattc ttttagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgccca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta cggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctg gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc 3480 gggtgatttt gtaaatgttc ttgccatcgc tggcttatgc gttaatggtg aaattgcctt 3540 gactctacgt gagcctggct tagtcttgtt tacgcatgaa cttcaaactt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt gagagttgtg tggtcaccta tgtcaatctg actagcgacc agctaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaact ggtccaagtc ttcccctaga tgtttttaat gccacttatc ttaatcttac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctc attaacaaca tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacatac atcaagtggc cgtggtgggt ttggttgatc attgttattg ttctcatctt 4020 tgttgtgtca ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 24 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 24 acgtaaacaa atgaggtctt taatttattt tttgttgttc gtaccagtac ttccaacact 60 cagcctacca caagatgtct ataggtgctc agctaacact aactttaggc ggttcttttc 120 ggttatctac acacgctggt tggtactgtg ctgccgacat ccaaactgct agtggcgttc atggtatctt 240 ccttagccat attagaggtg gtcatggctt tgagattggc atttcgcaag agccgtttga 300 ccctagtggt taccagcttt atttacataa ggccactaac ggtaacacta atgctactgc 360 gcgactgcgt atttgccagt ttcccagcag taaaacattg ggccccactg ctaatgatgt 420 tacaacaggt cgtaattgcc tatttaacaa agccattcca gctcatatga gtgatggaaa 480 acatagtgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaaactgtt acaacagtgg 600 aggttgtgct atgcaatatg tttacgaacc tatttactac atgcttaatg ttactagtgc 660 tggtgaggat ggtatttctt atcaaccctg tacagctaat tgcattggtt atgctgccaa 720 tgtatttgcc actgagtcca atggccacat accagaaggt tttagtttta ataattggtt 780 tcttttgtcc aatgattcca ctttgtttca tggtaaagtg gtttccaacc aacctttgtt 840 ggtcaactgt ctttgggcca ttcctaagat ttacggacta ggccactttt tctcatttaa 900 tcaaacgatg gatggcgttt gtaacggagc tactgcgtat cgtgccccac aggctctgag 960 gtttaatatt aatgacactt ctgtcattct tgccgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcaca aagccatctt 1080 ctccatacct ctgggtgcta cccaagtacc ctactattgc tttcttaaag ttgatactta 1140 caactccact gtctataaat ttcctgctgt tttaccttct actgtcaggg aaattgtcat 1200 cacaaagtac ggtgatgttt atgtcaacgg gtttggctac ttgcatctcg gtttgttgga 1260 tgctgtcaca attaatttca ctggccatgg cactaacgat gacgtctcag gtttctggac 1320 catagcatcg actaatttta ttgatgcact catcgaggtt caagcaactg ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttt cttttgacct 1440 tgatgatggt ttttacccta tttcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tatctgcggc 1560 ttttggtgat tctggtggtg ccaacctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatatac cattagactg ttttacaacg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag caattgccct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgctttcgg tagtggtgtt aattacaggt ccctctattt 1860 tcaattcaca aaaggtgagt ggattacttg ggcacctaaa cccttaaacg gccttttaaa 1920 ggggggtttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccat ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactt acccagtaca ctgcagcatg taagaccata gagtcagcat tagaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttact atttctgaag aggccttaca 2580 gttagctacc atcagttcgt ttaatggtga tgggtataac tttactaatg tgttgggtgt 2640 ttctgtgtac gattctcaaa gtggcagggt gatacacgaa aggtctttta ttgaagacct 2700 gctttttaat aaggtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgataaagt ctgtgcgcag tattactctg gtctcatggt 2820 actacctggg gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg 2880 tatggcgcta ggaggtttta ctgccgcagt ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttttacag cggaaccagc aactgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacctcagcc tttgcgagtg ttaaagaggc 3060 tatcagtcaa acttctaagg gtttgaatac tgtggctcat gcgcttacta aagttcaaga 3120 ggttgttaat tcgcagggtt cagctttgac tcaacttacc atacagctgc aacataactt 3180 ccaagccatt tctagttcta ctgatgacat ttactcccga ctggacattc tttcagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctt gtacaggccg caccccaggg cctgctgttc ttacacacag tacttgtacc 3480 gggtgatttt gtaaatgtta ttgccatcgc aggcttatgc gttaatggtg atattgcctt 3540 gactctacgt gagcctggct tagtcttggt tacgcatgaa cttcaaactt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt cagagttgtg tggtcaccta tgtcaatctg actagcgacc aactaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaact ggtccaaatc ttcccctaga tgtttttaat gccacttatc ttaatctcac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctt atatacaata tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacttat atcaagtggc cgtggtgggt ttggttgatt atttttattg gtctcatctt 4020 tgttgtgtca ttattagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttggag gggtcctaga cttcaacctt acgaaggttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 25 <211> 4159 <212> DNA <213> porcine epidemic diarrhea virus <400> 25 acgtaaacaa atgacgcctt taatttactt ctggttgttc ttaccagtac ttctaacact 60 tagcctacca caagatgtca ctaggtgcca gtctactatt aactttaggc ggttcttttc 120 ggttatctac ctcttctagc tggtactgtg gcacaggcat tgaaactgat agtggcgttc atggtatttt 240 tctcagttac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacacaa ggccactaat ggtaacacta gcgctattgc 360 acgactgcgc atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gctttgcagg atggaaaaaa 480 tactgttgtc ggcataacat gggataatga tcgtgtcact gtttttgctg acaagatcta 540 tcatttttat attaaaaatg attggtcccg tgttgcgaca agatgttaca ataaaagaag 600 ttgtgccatg caatatgttt atacacctac ctactacatg cttaatgtta ctagtgcagg 660 tgaggatggc atttactatg aaccttgtac agctaattgc agtggttacg ctgccaatgt 720 atttgccact gattccaatg gccatatacc agaaggtttt agttttaata attggtttct 780 tttgtccaat gactccactt tgttgcatgg taaagtggtt tcaaaccaac ctctgttggt 840 caactgcctt tgggccattc ctaagattta tggactagga caattttttct cattcaatca 900 aacgatggat ggcgtttgta acggagccgc tgcgcagcgt gccccagagg ctctgaggtt 960 taatattaat gacacttttg tcattcttgc tgaaggctca attatacttc atactgcttt 1020 aggaacaaat ctttcttttg tttgcagtaa ttcctcagat cctcacaaag ccatctttac 1080 catacctttg ggtgttactg aagtacccta ctattgcttt cttaaagtgg atacttacaa 1140 atccactgtt tataaattct tggctgtttt acctcctact gtcaaggaaa ttgtcatcac 1200 caagtacggt gatgtttatg tcaacgggtt tggctatttg catctcggtt tgttggatgc 1260 tgtcacaatt aatttcactg gtcatggcac tgacgatgac gtttcaggtt tctggaccgt 1320 agcatcgact aattttgttg atgcactcat cgaggttcaa ggaactgcca ttcagcgtat 1380 tctttattgt gatgaccctg ttagccaact taagtgttct caggttgctt ttgaccttga 1440 tgatggtttt taccctattt cttctagaaa ccttctgagt catgaacagc caatttcttt 1500 tgttactttg ccatcattca atgaccattc ttttgttaat attactgtct ctgcggcttt 1560 tggtggtcat agtggtgcca acctcattgc atctgacact actatcaatg ggtttagttc 1620 tttctgtgtt gacactagac aatttaccat tacactgttt tataacgtta caaacagtta 1680 tggttatgtg tctaagtcac aggatagtaa ttgccctttc accttgcaat ctgttaatga 1740 ttacctgtct tttagcaaat tttgtgtttc aaccagcctt ttggctggtg cttgtaccat 1800 agatcttttt ggttaccctg agttcggtag tggtgttaag tttacgtccc tttattttca 1860 attcacaaag ggtgagtcga ttactggcac gcctaaacca cttcaaggtg tcacggacgt 1920 ttcttttatg actctggatg tgtgtaccaa gtatactatc tatggcttta aaggtgaggg 1980 tattattacc cttacaaatt ctagcttttt ggcaggtgtt tattatacat ctgattctgg 2040 acagttgtta gcctttaaga atgtcactag tggtgctgtt tattctgtta cgccatgttc 2100 tttttcagag caggctgcat atgttgatga tgatatagtg ggtgttattt ctagtttgtc 2160 taactccact tttaacaata ccagggagtt gcctggtttc ttctaccatt ctaaggatgg 2220 ctccaattgt acagagcctg tgttggtgta tagtaacata ggtgtctgta aatctggcag 2280 tattggctat gtcccacttc aggatggcca agtcaagatt gcacccatgg ttactgggaa 2340 tattagtatt cccaccaact ttagtatgag tattagaaca gaatatttac agctttacaa 2400 cacgcctgtt agtgttgatt gcgttacata tgtttgtaat ggtaactctc gttgtaaaca 2460 attactcacc cagtacactg cagcatgtaa gaccatagag tcagcattac aactcagcgc 2520 taggcttgag tctgttgaag ttaactctat gcttactatt tctgaagagg ctctacagtt 2580 agctaccatc agttcgttta atggtgatgg atataacttt actaatgtgc tgggtgtttc 2640 cgtgtacgac cctgcaagtg gcagggtggt acaaaaaggg tcttttattg aagacctgct 2700 ttttaataaa gtggttacta atggccttgg tactgttgat gaagactata agcgctgttc 2760 taatggtcgc tctgtggcag atctagtctg tgcgcagtat tactctggtg tcatggtact 2820 acctggcgtt gttgacgctg agaagcttca catgtatagt gcgtctctca tcggtggtat 2880 ggcgctagga ggtcttacta gtgcagcggc attgtctttt agccatgctg ttcaagcgag 2940 gctcaattat cttgctttac agacggatgt tctacagcgc aaccagcaat tgcttgctga 3000 gtcttttaac tctgctattg gtaatataac ttcagccttt gagagtgtta aagaggctat 3060 tagtcaaact tccaatggtt tgaacactgt ggctcatgcg cttactaagg ttcaagaggt 3120 tgttaattcg cagggttcag ctttgaccca acttaccata cagctgcaac acaacttcca 3180 agccatttct agttctattg atgacattta ctcccgactg gacattcttt cagccgatgt 3240 tcaggttgat cgtctcatca ccggcagatt atcagcactt aatgctttcg ttgctcaaac 3300 cctcactaag tatactgagg ttcaggctag caggaagcta gcacagcaaa aggttaatga 3360 gtgcgtcaaa tcgcaatctc agcgttatgg tttttgtggt ggtgatggcg agcacatctt 3420 ctctctggta caggccgcac ctcagggcct gctgttttta catacagtac ttgtaccggg 3480 tgattttgta aatgttattg ccatcgatgg cctatgcgtt aatggtgata ttgccttgac 3540 tctacgtgag cctggcttag tcttgtttac gcatgaactt caaacttata ctgcgacgga 3600 atattttgtt tcatcgcgac gtatgtttga acctagaaaa cctaccgtta gtgattttgt 3660 tcaaattgag agttgtgtgg tcacctatgt caatctgact agcgaccaac taccagatgt 3720 aatcccagat tacatcgatg ttaacaaaac acttgatgag attctagctt ctctgcccaa 3780 tagaattggt cctagtcttc ccctagatgt ttttaatgcc acttatctta atctcactgg 3840 tgaaattgca gatttagagc agcgttcaga gtctctcagt aatactacag aagagctccg 3900 aagcctcata tataatatca acaacacact tgttgacctt gagtggctta accgagttga 3960 gacatatatc aagtggccgt ggtgggtttg gttgattatt tttattgttc tcatctttgt 4020 tgtgtcatta ttagtgttct gctgcatttc cacgggttgt tgtggatgct gcggttgttg 4080 cggtgcctgt ttttcaggtt gttgtagggg tcctagactt caaccttacg aagcttttga 4140 aaaggtccac gtgcagtga 4159 <210> 26 <211> 4162 <212> DNA <213> porcine epidemic diarrhea virus <400> 26 acgtaaacaa atgaggtctt taatttactt ctggttgctc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ctaggtgcca gtctactact aactttaggc ggttcttttc 120 ggttacctac ctcttctagc tggtactgtg gcacaggcat tgaaactgct agtggcgttc atggtatttt 240 tctcagctac atcgattctg gtcagggctt tgagattggc atttcgcaag agccgtttga 300 tcctagtggt taccagcttt atttacataa ggccactaat ggtaacacta atgctattgc 360 acgactgcgc atttgccagt ttcccgataa taaaacattg ggccctactg ttaatgatgt 420 tacaacaggt cgtaactgcc tattcaacaa agccattcca gcttatatgc gtgatggaaa 480 agatattgtt gtcggcataa catgggataa tgatcgtgtc actgtttttg ctgacaagat 540 ctatcatttt tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaatcgcag 600 aagttgtgct atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc 660 aggtgaggat ggcatttatt atgaaccctg tacagctaat tgcactggtt acgctgccaa 720 tgtatttgcc actgattcca atggccatat accagaaggt tttagtttta ataattggtt 780 tcttttatcc aatgactcca ctttgttgca tggtaaagtg gtttccaacc aacccttgtt 840 ggtcaattgt cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa 900 tcacacgatg gatggcgttt gtaatggagc tgctgtggat cgtgccccag aggctctgag 960 gtttaatatt aatgacacct ccgtcattct tgctgaaggc tcaattgtac ttcatactgc 1020 tttaggaaca aatctttctt ttgtttgcag taattcctca gatcctcatt tagccatctt 1080 tgccatacct ctgggtgcta ctgaagtacc ctactattgc tttcttaaag tggatactta 1140 caactccact gtttataaat tcttggctgt tttacctcct actgtcaggg aaattgtcat 1200 caccaagtat ggtgatgttt atgtcaatgg gtttggctat ttgcatctcg gtttgttgga 1260 tgctgtcaca attaatttca ctggtcatgg cactgacgat gacgtttcag gtttctggac 1320 catagcatcg actaattttg ttgatgcact catcgaggtt caaggaactt ccattcagcg 1380 tattctttat tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct 1440 tgacgatggt ttttacccca tctcttctag aaaccttctg agtcacgaac agccaatttc 1500 ttttgttact ttgccatcat ttaatgatca ttcttttgtt aatattactg tctctgcggc 1560 ttttggtggt cttagtagtg ccaatctcgt tgcatctgac actactatca atgggtttag 1620 ttctttctgt gttgacacta gacaatttac cattacactg ttttataatg ttacaaacag 1680 ttatggttat gtgtctaaat cacaggatag taattgtcct ttcaccttgc aatctgttaa 1740 tgattacctg tcttttagca aattttgtgt ttcaaccagc cttttggctg gtgcttgtac 1800 catagatctt tttggttacc ctgcgttcgg tagtggtgtt aagttgacgt ccctttattt 1860 tcaattcaca aaaggtgagt tgattactgg cacgcctaaa ccacttgaag gtatcacaga 1920 cgtttctttt atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga 1980 gggtattatt acccttacaa attctagcat tttggcaggt gtttattata catctgattc 2040 tggacagttg ttagccttta agaatgtcac tagtggtgct gtttattctg tcacgccatg 2100 ttctttttca gagcaggctg catatgttaa tgatgatata gtgggtgtta tttctagttt 2160 gtctaactcc acttttaaca atactaggga gttgcctggt ttcttctacc attctaatga 2220 cggctccaat tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg 2280 cagtattggc tatgttccac ctcagtatgg ccaagtcaag attgcaccca cggttactgg 2340 gaatattagt attcccacca actttagtat gagtattaga acagaatatt tacagcttta 2400 caacacgcct gttagtgttg attgtgctac atatgtttgt aatggtaact ctcgttgtaa 2460 acaattactc acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag 2520 cgctaggctt gagtctgttg aagttaactc tatgcttacc atttctgaag aggctttaca 2580 gttagctacc atcagttcgt ttaatggtga tggatataac tttactaatg tgctgggtgc 2640 ttccgtgtac gatcctgcaa gtggcagggt ggtacaaaaa aggtctgtta ttgaagactt 2700 gctttttaat aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg 2760 ttctaatggt cgctctgtgg ctgatctagt ctgtgcgcag tattactctg gtgtcatggt 2820 actacctggc gttgttgacg ctgagaagct tcacatgtac agtgcgtctc tcataggtgg 2880 tatggcgcta ggaggtataa ctgctgcagc ggcattgcct tttagctatg ctgttcaagc 2940 gagactcaat tatcttgctt tacagacgga tgttctacag cggaaccagc aattgcttgc 3000 tgagtctttt aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc 3060 tattagtcaa acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga 3120 ggttgttaat tcgcagggtt cagctttgaa ccaacttacc gtacagctgc aacacaactt 3180 ccaagccatt tctagttcta ttgatgacat ttattcccga ctggacattc tttcagccga 3240 tgttcaggtt gatcgtctca tcaccggcag attatcagca cttaatgctt ttgttgccca 3300 aaccctcact aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa 3360 tgagtgcgtc aaatcgcaat ctcagcgtta cggtttttgt ggtggtgatg gcgagcacat 3420 tttctctctg gtacaggccg cacctcaggg cctgctgttc ttacatacag tacttgtacc 3480 gggtgatttt gtaaatgttc ttgccatcgc tggcttatgc gttaatggtg aaattgcctt 3540 gactctacgt gagcctggct tagtcttgtt tacgcatgaa cttcaaaatt atactgcgac 3600 ggaatatttt gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt 3660 tgttcaaatt gagagttgtg tggtcaccta tgtcaatctg actagcgacc agctaccaga 3720 tgtaatccca gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc 3780 caatagaaat ggtccaagtc ttcccctaga tgtttttaat gccacttatc ttaatcttac 3840 tggtgaaatt gcagatctag agcagcgttc agagtctctc cgtaatacta cagaagagct 3900 ccgaagtctc attaacaaca tcaacaacac acttgttgac cttgagtggc tcaaccgagt 3960 tgagacatac atcaagtggc cgtggtgggt ttggttgatc atttttattg ttctcatctt 4020 tgttgtgtca ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg 4080 ctgcggtgct tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt 4140 tgaaaaggtc cacgtgcagt ga 4162 <210> 27 <211> 4152 <212> DNA <213> porcine epidemic diarrhea virus <400> 27 atgaagtctt taacttactt ctggttgtta ttaccagtac tttcaacact cagcctacca 60 caagatgtca ctaggtgcca gtccactatt aacttcaggc ggttcttttc aaaatttaat 120 gtgcaggcac ctgctgtcgt tgttttgggt ggttatctac ctagtatgaa ctcttctagc 180 tggtactgtg gcacaggtct tgaaactgct agtggcgtgc atggtatttt cctcagttac 240 atcgatgctg gtcagggctt tgagattggc atttcacagg agccgtttga tcctagtggt 300 taccagcttt atttacataa ggctactaat ggtaatacta atgctattgc acgactgcgc 360 atttgccagt ttccagataa taaaacattg ggccctactg ttaatgatgt tacaacaggt 420 cgtaactgcc tattcaacag agccattcca gcttatatgc aggatggaaa aaatattgtt 480 gtcggcataa catgggataa tgatcgcgtc actgtttttg ctgacaagat ctatcatttt 540 tatcttaaaa atgattggtc ccgcgttgcg acaagatgtt acaataaaag gagttgtgct 600 atgcaatatg tttatacacc tacctactac atgcttaatg ttactagtgc aggtgaggat 660 ggcatttatt atgaaccatg tacagctaat tgcagtggtt acgctgctaa tatatttgcc 720 actgattcta atggccatat accagaaggt tttagtttta ataattggtt tcttttgtcc 780 aatgattcca ctttgttgca tggtaaggtg gtttccaacc aacctttgtt ggtcaattgt 840 cttttggcca ttcctaagat ttatggacta ggccaatttt tctcattcaa tcaaacgatg 900 gatggcgttt gtaatggagc tgctgcgcag cgtgcaccag aggctctgag gtttaatatt 960 aatgacacct ctgtcattct tgctgaaggc tcaattgtac ttcatactgc tttaggaaca 1020 aatctttctt ttgtttgcag taattcctca gatcctcatt tagccacctt cgccatacct 1080 ctgggtgcta cccaagtacc ctattattgt tttcttaaag tggatactta caactccact 1140 gtttataaat tcttggctgt tttacctcct accgtcaggg aaattgtcat caccaagtat 1200 ggtgatgttt atgtcaatgg gtttggctac ttgcatctcg gtttgttgga tgctgtcaca 1260 attaatttca ctggtcatgg cactgacgat gacgtttctg gtttttggac catagcatcg 1320 actaattttg ttgatgcact catcgaagtt caaggaactg ccattcagcg tattctttat 1380 tgtgatgatc ctgttagcca actcaagtgt tctcaggttg cttttgacct tgacgatggt 1440 ttttacccta tttcttctag aaaccttctg agtcatgaac agccaatttc ttttgttact 1500 ttgccatcat ttaatgatca ttcttttgtt aacattactg tctctgcgtc ctttggtggt 1560 catagtggtg ccaacctcat tgcatctgac actactatca atgggtttag ttctttctgt 1620 gttgacacta gacaatttac catttcactg ttttataacg ttacaaacag ttatggttat 1680 gtgtctaaat cacaggacag taattgccct ttcaccttgc aatctgttaa tgattacctg 1740 ttttttagca aattttgtgt ttctaccagc cttttggcta gtgcctgtac catagatctt 1800 tttggttacc ctgagtttgg tagtggtgtt aagtttacgt ccctttactt tcaattcaca 1860 gagggtgagt tgattactgg cacgcctaaa ccacttgaag gtgtcacgga cgtttctttt 1920 atgactctgg atgtgtgtac caagtatact atctatggct ttaaaggtga gggtatcatt 1980 acccttacaa attctagctt tttggcaggt gtttattata catctgattc tggacagttg 2040 ttagccctta agaatgtcac tagtggtgct gtttattctg ttacgccatg ttctttttca 2100 gagcaggctg catatgttga tgatgatata gtgggtgtta tttctagttt gtctagctcc 2160 acttttaaca gtactaggga gttgcctggt ttcttctacc attctaatga tggctctaat 2220 tgtacagagc ctgtgttggt gtatagtaac ataggtgttt gtaaatctgg cagtattggc 2280 tatgtcccat ctcagtctgg ccaagtcaag attgcaccca cggttactgg gaatattagt 2340 attcccacca actttagtat gagtattagg acagaatatt tacagcttta caacacgcct 2400 gttagtgttg attgtgccac atatgtttgt aatggtaact ctcgttgcaa acaattactc 2460 acccagtaca ctgcagcatg taagaccata gagtcagcat tacaactcag cgctaggctt 2520 gagtctgttg aagttaactc tatgcttact atttctgaag aggctctaca gttagctacc 2580 atcagttcgt ttaatggtga tggatataat tttactaatg tgctgggtgt ttccgtgtat 2640 gatcctgcaa gtggcagggt ggtacacaaa aggtctttta ttgaagacct gctttttaat 2700 aaagtggtta ctaatggcct tggtactgtt gatgaagact ataagcgctg ttctaatggt 2760 cgctctgtgg cagatctagt ctgtgcacag tattactctg gtgtcatggt actacctggt 2820 gttgttgacg ctgagaagct tcacatgtat agtgcgtctc tcatcggtgg tatggcgcta 2880 ggaggtttta ctgttgcagc ggcattgcct tttagctatg ctgttcaagc tagactcaat 2940 tatcttgctc tacagacgga tgttctacag cggaaccagc aattgcttgc tgagtctttt 3000 aactctgcta ttggtaatat aacttcagcc tttgagagtg ttaaagaggc tattagtcaa 3060 acttccaagg gtttgaacac tgtggctcat gcgcttacta aggttcaaga ggttgttaat 3120 tcgcagggtg cagctttgac ccaacttacc gtacagctgc aacacaactt ccaagccatt 3180 tctagttcta ttgatgacat ttactcccga ctggacattc tttcagccga tgttcaggtt 3240 gaccgtctca tcaccggcag attatcagca cttaatgctt ttgttgctca aaccctcact 3300 aagtatactg aggttcaggc tagcaggaag ctagcacagc aaaaggttaa tgagtgcgtt 3360 aaatcgcaat ctcagcgtta tggtttttgt ggtggtgatg gcgagcacat tttctctctg 3420 gtacaggcag cacctcaggg cctgctgttt ttacatacag tacttgtacc gggtgatttt 3480 gtagatgtta ttgccatcgc tggcttatgc gttaacgatg aaattgcctt gactctacgt 3540 gagcctggct tagtcttgtt tacgcatgaa cttcaaaatc atactgcgac ggaatatttt 3600 gtttcatcgc gacgtatgtt tgaacctaga aaacctaccg ttagtgattt tgttcaaatt 3660 gagagttgtg tggtcaccta tgtcaatttg actagagacc aactaccaga tgtaatccca 3720 gattacatcg atgttaacaa aacacttgat gagattttag cttctctgcc ctatagaacg 3780 ggtccaagtc ttcctttaga tgtttttaat gccacttatc ttaatctcac tggtgaaatt 3840 gcagatttag agcagcgttc agagtctctc cgtaatacta cagaagagct ccaaagtctt 3900 atatataata tcaacaacac actagttgac cttgagtggc tcaaccgagt tgagacatat 3960 atcaagtggc cgtggtgggt ttggttgatt attttcattg ttctcatctt tgttgtgtca 4020 ttactagtgt tctgctgcat ttccacgggt tgttgtggat gctgcggttg ctgctgtgct 4080 tgtttttcag gttgttgtag gggtcctaga cttcaacctt acgaagcttt tgaaaaggtc 4140 cacgtgcagt ga 4152 <210> 28 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 28 acgtaaacaa atgaggtctt taatttattt tttgttgttc gtaccagtac ttccaacact 60 cagcctacca caagatgtct ataggtgctc agctaacact aactttaggc ggttcttttc 120 ggttatctac aacacaggct gggtcaagac cttggtactg tgctggccga catccaactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgccact gcgcgactgc gtatttgcca gtttcccagc agtaaaacat tgggccccac 420 tgctaatgat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgcgttgcga caaactgtta 600 caacagtgga ggttgtgcta tgcaatatgc ttacgaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta 720 tgccgccaat gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca 840 acctttgttg gtcaactgtc tttgggccat tcctaagatt tacggactag gccacttttt 900 ctcatttaat caaacgatgg atggcgtttg taacggagct actgcgtatc gtgccccaga 960 ggctctgagg tttaatatta atgacacttc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcacaa 1080 agccatcttc tccatacctc tgggtgctac ccaagtaccc tactattgct ttcttaaagt 1140 tgatacttac aactccactg tctataaatt tcttgctgtt ttacctccta ctgtcaggga 1200 aattgtcatc accaagtacg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaacttcac tggccatggc actaacgatg acgtctcagg 1320 tttctggacc atagcatcga ctaattttat tgatgcactc atcgaggttc aagcaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggtttc 1440 ttttgacctt gatgatggtt tttaccctat ttcttctaga aaccttctta gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt 1560 atctgcggct tttggtgatt ctggtggtgc caacctcgtt gcatctgaca ctactatcaa 1620 tgggttcagt tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt 1680 tacaaacagt tatggttatg tgtctaaatc acaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg 1800 tgcttgtacc atagatcttt ttggttaccc tgctttcggt agtggtgtta agtttacgtc 1860 cctctatttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttcaagg 1920 tgtcacggac gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtattatta cccttacaaa ttctagcttt ttggcaggtg tttattatac 2040 atctgattct ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacaa tactagggag ttgcccggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtctg 2280 taaatctggt agtattggct atgtcccact tcaggatggc caagtcaaaa ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagaa cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgctaca tatgtttgta atggtaactc 2460 tcgttgtaaa caattgctta cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 agaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggccttacag ttagctacca tcagttcgtt taatggtgat gggtataact ttactaatgt 2640 gttgggtgtt tctgtgtacg attctcaaag tggcagggtg atacacgaaa ggtcttttat 2700 tgaagacctg ctttttaata aggtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc tgatctagtc tgtgcgcagt attactctgg 2820 tatcatggta ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctag gaggttttac tgccgcagtg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttttacagc ggaaccagca 3000 actgcttgct gagtctttta actctgctat tggtaatata acctcagcct ttgcgagtgt 3060 taaagaggct atcagtcaaa cttctcaagg tttgaatact gtggctcatg cgcttactaa 3120 agttcaagag gttgttaatt cgcagggttc agctttgact caacttacca tacagctgca 3180 acataacttc caagccattt ctagttctat tgatgacatt tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctcttg tacaggccgc accccagggc ctgctgttct tacacacagt 3480 acttgtaccg ggtgattttg taaatgttat tgccatcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaactta 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattc agagttgtgt ggtcacctat gtcaatctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc 3780 ttctctgccc aatagaactg gtccaaatct tcctctagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac 3900 agaagagctc cgaagtctta tatacaatat caacaacaca cttgttgacc ttgagtggct 3960 caaccgagtt gagacttata tcaagtggcc gtggtgggtt tggttgatta tttttattgt 4020 tctcatcttt gttgtgtcat tattagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggttgt tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 29 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 29 acgtaaacaa atgaggtctt taatttattt tttgttgttc gtaccagtac ttccaacact 60 cagtctacca caagatgtcc ataggtgctc agctaacact aattttaggc ggttcttttc 120 ggttatctac aaaccagggt gtgaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgctact gcgcgactgc gcatttgcca gtttcccagc agtaaaacat tgggccccac 420 tgctaatgat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca tcccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgttttttc 540 tgacaagatc tatcattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacgaaccc acttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttcgta tcaaccctgt acagttaatt gcattggtta 720 tgctgccaat gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttggtgcat ggtaaggtgg tttccaacca 840 acctttgttg gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt 900 ctccttcaat caaacgatcg atggtgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct cagttgtact 1020 tcatactgct ttaggaacaa atttttcttt tgtttgcagt aattcctcaa atcctcattt 1080 agccaccttt gccatacttc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggatacttac aattccactg tttataaatt cttggctgtt ttacctccta ctgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcaatggg tttggttatt tgcatctcgg 1260 tttgttggac gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttcagg 1320 tttctggacc atagcatcga ctaattttgt tgatgctctc atcgaagttc aaggaaccgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat atcttctaga aacctcctga gtcatgaaca 1500 gccaacttct tttgttactt cgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtct tttggtggtc atagtggtgc caacctcgtt gcatctgaca ctactatcaa 1620 tggattcagt tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt 1680 tacaaacagt tatggttatg tgtctaattc acaggacagt aattgccctt ttaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tctaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgatttcggt agtggtgtta agtttacgtc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgtcacggac gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattatac 2040 atctgattct ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc atatgttgat gacgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacaa tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgtcccatc tcagtctggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc 2460 tcgttgcaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta cttctgaaga 2580 ggctctacag ttagctacca tcagttcgtt taatggtgat ggatataatt ttactaatgt 2640 gctgggtgtt tccgtgtatg attctgcaag tggcagggtg gtacacaaaa ggtctttcat 2700 tgaagacctg ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggcc gctctgtggc tgatctagtc tgtgcgcagt attactctgg 2820 tgtcatggta ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggtgctag gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct ttgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaacact gtggctcatg cgcttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgacc caacttaccg tacagctgca 3180 acacaacttt caagccattt ctagttctat tgatgacatt tattcccgac ttgacattct 3240 ttcagccgat gttcaggttg accgtctcat cactggcaga ttatcagcac ttaacgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcagtc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgaacacatt ttttccctgg tacaggccgc acctcagggc ctgctgttct tacacgcagt 3480 acttgtaccg ggtgattttg taaatgttat tgctatcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcctgttt acgcatgaac ttcaaactca 3600 tacggcgaca gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaatctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttggc 3780 ttctctgccc aatagaactg gtccaagtct tcccctagat gtttttaatg ctacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc aaaatatcac 3900 agaagagctc cgaagtctca tatataacat caacaacaca cttgttgacc ttgagtggct 3960 caaccgcgtt gagacatata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tttcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 30 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 30 acgtaaacaa atgaggtctt taacctattt ctggttgttc ttaccagtac ttccaatact 60 cagcctacca caagatgtct ataggtgctc agctaacact aactttaggc ggttcttttc 120 ggttatctac aacacaggcc gggtcaagac cttggtactg tgctggccga catccaactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgccact gcgcgactgc gtatttgcca gtttcccagc agtaaaacat tgggccccac 420 tgctaatgat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgcgttgcga caaactgtta 600 caacagtgga ggttgtgcta tgcaatatgc ttacgaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta 720 tgccgccaat gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca 840 acctttgttg gtcaactgtc tttgggccat tcctaagatt tacggactag gccacttttt 900 ctcatttaat caaacgatgg atggcgtttg taacggagct actgcgtatc gtgccccaga 960 ggctctgagg tttaatatta atgacacttc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcacaa 1080 agccatcttc tccatacctc tgggtgctac ccaagtaccc tactattgct ttcttaaagt 1140 tgatacttac aactccactg tctataaatt tcttgctgtt ttacctccta ctgtcaggga 1200 aattgtcatc accaagtacg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcgcaa ttaacttcac tggccatggc actaacgatg acgtctcagg 1320 tttctggacc atagcatcga ctaattttat tgatgcactc atcgaggttc aagcaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggtttc 1440 ttttgacctt gatgatggtt tttaccctat ttcttctaga aaccttctta gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt 1560 atctgcggct tttggtgatt ctggtggtgc caacctcgtt gcatctgaca ctactatcaa 1620 tgggttcagt tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt 1680 tacaaacagt tatggttatg tgtctaaatc acaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg 1800 tgcttgtacc atagatcttt ttggttaccc tgctttcggt agtggtgtta agtttacgtc 1860 cctctatttt caattcacaa agggtgagct gattactggc acgcctaaac cacttcaagg 1920 tgtcacggac gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtattatta cccttacaaa ttctagcttt ttggcaggtg tttattatac 2040 atctgattct ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacaa tactagggag ttgcccggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtctg 2280 taaatctggt agtattggct atgtcccact tcagtatggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagaa cagaatatct 2400 acagctttac aacacgcctg ttagtgttga ttgtgctaca tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagctacca tcagttcgtt taatggtggt ggatataatt ttactaatgt 2640 gctgggtgtt tccgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtctattat 2700 tgaagacctg ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggcc gctctgtggc agatctagtc tgtgcgcagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 cgtcggtggt atggtgctag gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaatcagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacta tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgacatt tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcaatc acagcgttat ggtttttgtg gtggtgatgg 3420 tgaacacatt ttttctctgg tacaggccgc acctcagggc ctgctgtttt tacacacagt 3480 acttgtaccg ggtgattttg taaatgttat tgctatcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaactca 3600 tactgcgatg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gttaatttga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttggc 3780 ttctctgccc aatagaactg gtccaagtct tccattagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgtgca gagtctctcc gtaataccac 3900 agaagagctc cgaagtctta tatataacat caacaacaca cgtgtagacc ttgagtggct 3960 caaccgtgtt gagacatata tcaagtggcc gtggtgggtt tggttggtta tttttattgt 4020 tctcatcttt gttgtgtcat tattagtgtt ctgctgcatt tccactggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 31 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 31 acgtaaacaa atgaggtctt taacctactt ctggttgttc ttaccagtac tttcaacact 60 cagcctacca caagatgtcg ccaggtgctc agctaacact aattttaggc ggttcttttc 120 ggttatctac aaaccacggt gtcaattcaa cttggcactg tgctggccaa catccaactg ctagtggcgt 240 tcatggtatt tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gaccctagcg gttaccagct ttatttacat aaggccacta acggtaacac 360 taatgctact gcgcgactgc gcatttgcca gtttcccagc attaaaacat tgggccccac 420 tgctaataat gatgttacaa caggtcgtaa ctgcctattt aacaaagcca tcccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc 540 tgacaagatc tattattttc attttaaaaa tgattggtcc cgtgttgcga caaagtgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacgaaccc acttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtattcctta ccaaccctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgttgcat ggtaagatgg tttccaacca 840 accattgttg gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt 900 ctcattcaat caaacgatgg atggcgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccatacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt cttggctgtt ttacctccta tcgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcgatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tatggttatg tgtctaactc gcaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgattttggt agtggtgtta agctcacatc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgttacggac gtttcttttt tgactctgga tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtatcatta cccttacaaa ttctagcttt ttggcaggtt tttattatac 2040 atctgattct ggacagttgt tagcttttaa gaatgtcact agtggtgctg tttattctgt 2100 tacgccatgt tctttttccg agcaggctgc atatgttgat gatgatatag tgggtgttat 2160 ttctagtttg tctaactcca cttttaacag tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgtcccatc tcagtctggc caagccaaga ctgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagccacca tcagttcgtt taatggtgat ggatataact ttactaatgt 2640 gctgggtatt tccgtgtacg agcctgcaag tggcagggtg gtacacaaaa ggtcttttat 2700 tgaagacctg ctttttaaca aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc agatctagtc tgtgcacagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctag gaggttttac cgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attactcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacca tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgatatc tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatactga ggttcaggct agcaggaggc tagcgcagca 3360 aaaggttaat gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctctgg tacaggccgc acctcagggc ctgctgtttt tacacacagt 3480 acttgtaccg ggtgattttg taaatgttac tgccatcgct ggcttatgcg ttaatgatga 3540 tattgccttg actctgcgtg agcctggctt agtcttgttt acacatgaac ttcaaactca 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaacctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acgcttgatg agattttagc 3780 ctctctgccc aatagaactg atccaagttt tccactaggt gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gcaataccac 3900 agaagagctc cgaagtctca tatataatat caacaacaca ctagttgacc ttgagtggct 3960 caaccgagtt gagacgtata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tttcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 32 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 32 acgtaaacaa atgaggtctt taacctattt ctggttgttc ttaccagtac ttccaacact 60 cagcctacca caagatgtca ataggtgctc agctgtgact aactttaggc agttcttttc 120 ggttatctac aaaacaggtt gatgcaccac gttggtactg tgctggccga tatgatactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacca acggtaacac 360 gt; tgctaatgat gatgtcacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgtgttgcgt caaaatgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacaaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaactctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgaacccaa tggccacata ccagaaagtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgctccat ggtaaagtgg tttccaacca 840 acctttgttg gtcaattgtc tttgggccat tcctaagatt tatggactag gccaattttt 900 ctcattcaat caaacgatgg atggcgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccatacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt cttggctgtt ttacctccta tcgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcgatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tatggttatg tgtctaactc gcaggatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgattttggt ggtgctgtta agttcacatc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgttacggac gtttctttta tgactctgta tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtgtcatta cccccacaaa ttctagcttt ttggcaggta tttattatac 2040 atctgattcc ggacagttgt tagcctttaa gaatgttact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttccagtttg tctaactcca cttttaacaa tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgttccatc tcagtctggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaaa tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagccacca tcagttcgtt taatggtgat ggctataact ttactaatgt 2640 gctgggtgtt tccgtgtacg agcctgcaag tggcagggtg gtacacaaaa ggtcttttat 2700 tgaagacctg ctttttaaca aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc agatctagtc tgtgcacagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctgg gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacca tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgatatc tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatacaga ggttcaggct agcaggaggc tagcgcagca 3360 aaaggttaat gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctctgg tacaggccgc acctcagggc ctgctgttct tacacacagt 3480 acttgtaccg ggtgattttg taaatgttac tgccatcgct ggcttatgcg ttaatgatga 3540 tattgccttg actctgcgtg agcctggctt agtcttgttt acacatgaac ttcaaactca 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaacctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc 3780 ctctctgccc aatagaactg atctaagttt tccactagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gcaataccac 3900 agaagagctc cgaagtctca tatataatat caacaacaca ctagttgacc ttgagtggct 3960 caaccgagtt gagacgtata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tctcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 33 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 33 acgtaaacaa atgaggtctt taacctattt ctggttgttc ttaccagtac ttccaatact 60 cagcctacca caagatgtca ataggtgctc agctgtgact aactttaggc agttcttttc 120 ggttatctac aaaacaggtt gatgcaccaa gttggtactg tgctggccga tatgatactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacca acggtaacac 360 gt; tgctaatgat gatgtcacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctta 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgtgttgcgt caaaatgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacaaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaactctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgagcccaa tggccacata ccagaaagtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca 840 acctttgttg gtcaattgtc tttgggccat tcctaagatt tacggactag gccacttttt 900 ctcttttaat caaacgatgg atggcgtttg taacggagct actgcttatc gtgccccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccttacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt tttggctgtt ttacctccta ccgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aacctcctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc ataatggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tacggttatg tgtctaactc gcaggatagc aattgccctt tcaccttgcg 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg 1800 tgcttgtacc atagatcttt ttggtcaccc tgcttttggt agtagtgtta agtttacgtc 1860 cctctatttt caattcacaa agggtgattt gattactggc acgcctaaat cacttgaagg 1920 tgtcacggac gtttctttta tgactatgga tgtgtgtact aagtatacta tctatggctt 1980 taaaggtgag ggtattatta cccttacaaa ttctagcttt ttggcaggta tttattatac 2040 atctgattcc ggacagttgt tagcctttaa gaatgttact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttccagtttg tctaactcca cttttaacaa tactagggag ttgcccggtt tcttctacca 2220 ttctaatgac ggctccaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggcc atgtcccttc tcagtctggc ccagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc 2460 tcgttgcaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagctacca tcagttcgtt taatggtgat ggatataatt ttactaatgt 2640 gctgggtgtt tccgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtctttcat 2700 tgaagacctg ctttttaata aagtggttac taatggtctt ggtactgttg atgaagacta 2760 caagcgctgt tctaatggcc gctctgtggc tgatctagtc tgtgcgcagt attactctgg 2820 tgtcatggta ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggtgctag gaggttttac tgctgcagcg gcactgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 actgcttgct gagcctttta actctgctat tggtaatata acttcagcct ttgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaacact gtggctcatg cgcttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgact caacttaccg tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgacatt tattcccgac ttgacattct 3240 ttcagccgat gttcaggttg accgtctcat cactggcaga ttatcagcac ttaacgcttt 3300 tgttgctcaa actctcacta agtatactga ggttcaggct agcaggaagc tagcacagca 3360 aaaggttaat gagtgcgtca aatcgcagtc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgaacacatt ttttccctgg tacaggccgc acctcagggc ctgctgttct tacacacagt 3480 acttgtaccg ggtgattttg taaatgttat tgctgtcgca ggcttatgcg ttaatggtga 3540 tattgccttg actctacgtg agcctggctt agtcctgttt acgcatgaac ttcaaactca 3600 tacggcggca gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaatctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttggc 3780 ctctctgccc aatagaactg gtccaagtct tccactagat gtttttaatg ctacttatct 3840 taatctcact ggtgaaattg cagatttaca gcagcgttca gagtctcttc aaaatatcat 3900 agaagagctc cgaagtttca tttatagcat caacaacaca cgtgttgacc ttgagtggct 3960 caaccgcgtt gagacatata tcaagtggcc gtggtgggtt tggttgattc tttttattgt 4020 tctcatcttt gttgtgtcat tactagtgtt ctgctgcatt tctacgggtt gctgtggatg 4080 ctgcggttgc tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 34 <211> 4171 <212> DNA <213> porcine epidemic diarrhea virus <400> 34 acgtaaacaa atgaggtctt taacttactt ctggttgtta ttaccagtac ttccaatact 60 cagcctacca caagatgtca ataggtgctc agctgtgact aactttaggc agttcttttc 120 ggttatctac aaaacaggtt gatgcaccac gttggtactg tgctggccga tatgatactg ctagtggcgt 240 tcatggtatc tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca 300 agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacca acggtaacac 360 gt; tgctaatgat gatgtcacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca 480 tatgagtgaa catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc 540 tgacaagatc tatcattttt atcttaaaaa tgattggtcc cgtgttgcgt caaaatgtta 600 caacagtgga ggttgtgcta tgcaatatgt ttacaaacct atttactaca tgcttaatgt 660 tactagtgct ggtgaggatg gtatttctta tcaactctgt acagctaatt gcattggtta 720 tgctgccaat gtatttgcta ctgagcccaa tggccacata ccagaaagtt ttagttttaa 780 taattggttt cttttgtcca atgattccac tttgctccat ggtaaagtgg tttccaacca 840 acctttgttg gtcaattgtc tttgggccat tcctaagatt tatggactag gccaattttt 900 ctcattcaat caaacgatgg atggcgtttg taatggagct gctgcgcagc gtgcaccaga 960 ggctctgagg tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact 1020 tcatactgct ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcattt 1080 agccaccttc gccatacctc tgggtgctac ccaagtaccc tattattgtt ttcttaaagt 1140 ggacacttac aactccactg tttataaatt cttggctgtt ttacctccta tcgtcaggga 1200 aattgtcatc accaagtatg gtgatgttta tgtcaatggg tttggctact tgcatctcgg 1260 tttgttggat gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg 1320 tttttggacc atagcatcga ctaattttgt tgaagcactc atcgaagttc aaggaactgc 1380 cattcagcgt attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc 1440 ttttgacctt gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca 1500 gccaatttct tttgttactt tgccatcatt taatgatcat tcttttgtta acattactgt 1560 ctctgcgtcc tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa 1620 tgggtttagt tctttctgtg ttgacactag acaatttacc attagactgt tttataacgt 1680 tacaagcagt tatggttata tgtctaactc gcaagatagc aattgccctt tcaccttgca 1740 atctgttaat gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctag 1800 tgcctgtacc atagatcttt ttggttaccc tgattttggt ggtgctgtta agttcacatc 1860 cctttacttt caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg 1920 tgttacggac gtttctttta tgactctgta tgtgtgtacc aagtatacta tctatggctt 1980 taaaggtgag ggtgtcatta cccccacaaa ttctagcttt ttggcaggta tttattatac 2040 atctgattcc ggacagttgt tagcctttaa gaatgttact agtggtgctg tttattctgt 2100 tacgccatgt tctttttcag agcaggctgc ttatgttgat gatgatatag tgggtgttat 2160 ttccagtttg tctaactcca cttttaacaa tactagggag ttgcctggtt tcttctacca 2220 ttctaatgac ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg 2280 taaatctggc agtattggct atgttccatc tcagtctggc caagtcaaga ttgcacccac 2340 ggttactggg aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt 2400 acagctttac aacacgcctg ttagtgttga ttgtgccaaa tatgtttgta atggtaactc 2460 tcgttgtaaa caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt 2520 acaactcagc gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga 2580 ggctctacag ttagccacca tcagttcgtt taatggtgat ggctataact ttactaatgt 2640 gctgggtgtt tccgtgtacg agcctgcaag tggcagggtg gtacacaaaa ggtcttttat 2700 tgaagacctg ctttttaaca aagtggttac taatggcctt ggtactgttg atgaagacta 2760 taagcgctgt tctaatggtc gctctgtggc agatctagtc tgtgcacagt attactctgg 2820 tgtcatggta ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct 2880 catcggtggt atggcgctgg gaggttttac tgctgcagcg gcattgcctt ttagctatgc 2940 tgttcaagcg agactcaatt atcttgcttt acagacggat gttctacagc gtaaccagca 3000 attgcttgct gagtctttta actctgctat tggtaatata acttcagcct tcgagagtgt 3060 taaagaggct attagtcaaa cttcccaggg tttgaatact gtggctcatg cacttactaa 3120 ggttcaagag gttgttaatt cgcagggtgc agctttgtct caactcacca tacagctgca 3180 acacaacttc caagccattt ctagttctat tgatgatatc tactcccgac tggacattct 3240 ttcagccgat gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt 3300 tgttgctcaa accctcacta agtatacaga ggttcaggct agcaggaggc tagcgcagca 3360 aaaggttaat gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg 3420 cgagcacatt ttctctctgg tacaggccgc acctcagggc ctgctgttct tacacacagt 3480 actcgtaccg ggtgattttg taaatgttac tgccatcgct ggcttatgcg ttaatgatga 3540 tattgccttg actctgcgtg agcctggctt agtcttgttt acacatgaac ttcaaactca 3600 tactgcgacg gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt 3660 tagtgatttt gttcaaattg agagttgtgt ggtcacctat gtcaacctga ctagcgacca 3720 actaccagat gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc 3780 ctctctgccc aatagaactg atctaagttt tccactagat gtttttaatg ccacttatct 3840 taatctcact ggtgaaattg cagatttaga gcagcgttca gagtctctcc gcaataccac 3900 agaagagctc cgaagtctca tatataatat caacaacaca ctagttgacc ttgagtggct 3960 caaccgagtt gagacgtata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt 4020 tctcatcttt gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg 4080 ctgcggctgc tgctgtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta 4140 cgaagctttt gaaaaggtcc acgtgcagtg a 4171 <210> 35 <211> 4207 <212> DNA <213> porcine epidemic diarrhea virus <400> 35 tttgtggctt ttctaatcat ttggtcaacg taaacaaatg aagtctttaa cttacttctg 60 gttgttctta ccagtatttt caacactcag cctaccacaa gatgtcacta ggtgccagtc 120 cactattaac ttcaggcggt tcttttcaaa atttaatgtg caagcacctg ctgtcgttgt 180 tttgggtggt tatctaccta gtatgaactc ttctagctgg tactgtggca caggccttga 240 aactgctagt ggcgttcatg gtatttttct tagttacatc gattctggtc agggctttga 300 gattggcatt tcgcaagagc cgtttgatcc tagtggttac cagctttatt tacataaggc 360 caccaatggt aacactaatg ctattgcacg actgcgtatt tgccagtttc caaataataa 420 aacattgggc cccgctgtta atgatgttac aacaggtcgt aactgcctat tcaacaaagc 480 tattccagct catatgcagg atgggaaaaa tattgttgtc ggcataacat gggacaatga 540 tcgtgtcact gtttttgctg acaagatcta tcatttttat cttaaaaatg attggtcccg 600 cgttgcgaca agatgttaca ataaaaggag ttgtgctatg caatatgttt atacacccac 660 ctactacatg cttaatgtta ctagtgcagg tgaggatggc atttattatg aaccctgtac 720 agctaattgc agtggttacg ctgccaatgt atttgccact gattctaatg gccatatacc 780 agaaggtctt agttttaata attggtttct tttgtccaat gattccactt tgttgcatgg 840 ctaggtttt tggactaggc caatttttct cattcaatca aacgatgtat ggcgtttgta atggagctgc 960 tgcgcagcgt gcaccagagg ctctgaggtt taatattaat gacacctctg tcattcttgc 1020 tgaaggctca attgtacttc atactgcttt aggaacaaat ctttcttttg tttgcagtaa 1080 ttcctcagat cctcatttag ccaccttcgc catacctctg ggtgctaccc aagtacccta 1140 ttattgtttt cttaaagtgg atacttacaa ctccactgtt tataaattct tggctgtttt 1200 acctcctacc gtcagggaaa ttgtcatcac caagtatggt gatgtttatg tcaatgggtt 1260 tggctacttg catctcggtt tgttggatgc tgtcacaatt aatttcactg gtcatggcac 1320 tgacgatgac gtttcaggtt tttggaccat agcatcgact aattttgttg atgcactcat 1380 cgaagttcaa ggaactgcca ttcagcgtat tctttattgt gatgatcctg ttagccaact 1440 caagtgttct caggttgctt ttgaccttga cgatggtttt taccctattt cttctagaaa 1500 ccttctgagt catgaacagc caatttcttt tgttactttg ccatcgttta atgatcattc 1560 ttttgttaac attactgtct ctgcgtcctt tggtggtcat agtggtgcca acctcattgc 1620 atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac aatttaccat 1680 ttcactgttt tataacgtta caaacagtta tggttatgtg tccaaatcac aggatagtaa 1740 ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat tttgtgtttc 1800 taccagcctt ttggctagtg cctgtaccat agatcttttt ggttaccctg agttcggtag 1860 tggtgttaag tttacgtccc tttactttca attcacaaag ggtgagttga ttactggcac 1920 gcctaaacca ctcgaaggtg tcacggacgt ttcttttatg actctggatg tgtgtaccaa 1980 gtatactatc tatggcttta aaggtgaggg tatcattacc cttacaaatt ctagcttttt 2040 ggcaggtgtt tattatacat ctgattctgg acagttgtta gcctttaaga atgtcactag 2100 tggtgctgtt tattctgtta cgccatgttc tttttcagag caggctgcat atgttgatga 2160 tgatatagtg ggtgttattt ctagtttgtc tagctccact tttaacagta ctagggagtt 2220 gcctggtttc ttctaccatt ctaatgatgg ctctaattgt acagagcctg tgttggtgta 2280 tagtaacata ggtgtttgta aatctggcag tattggctat gtcccatctc agtctggcca 2340 agtcaagatt gcacccacgg ttactgggaa tatcagtatt cccaccaact ttagtatgag 2400 tattaggaca gaatatttac agctttacaa cacgcctgtt agtgttgatt gtgccacata 2460 tgtttgtaat ggtaactctc gttgtaaaca actacttacc cagtacactg cagcatgtaa 2520 gaccatagag tcagcattac aactcagcgc taggcttgag tctgttgaag tcaactctat 2580 gcttactatt tctgaagagg ctctacagtt agctaccgtc agttcgttta atggtgatgg 2640 atataacttt actaatgtgc tgggcgtttc cgtgtacgat cctgcaagtg acagggtggt 2700 acaaaaaagg tcttttattg aagacctgct ttttaacaaa gtggttacta atggccttgg 2760 tactgttgat gaagactata agcgctgttc taatggtcgc cctgtggcag atctagtctg 2820 tgcgcagtat tactctggtg tcatggtact acctggtgtt gttgacgctg agaagcttca 2880 catgtatagt gcgtctctca tcggtggtat ggtgctagga ggttttactg ctgcagcggc 2940 attgcctttt agctatgctg ttcaagcgag actcaatgaa attgctctac agacggatgt 3000 tctacagcgg aaccagcaat tgcttgctga gtcttttaac tctgctattg gtaatataac 3060 ttcagccttt gagagtgtta aagaggctat tagtcatact tccaagggtt tgaacactgt 3120 ggcacatgcg cttactaagg ttcaagaggt tgttaattcg cagggtgcag ctttgaccca 3180 acttaccgta cagctgcaac acaacttcca agccatttct agttctattg atgacattta 3240 ctcccgactg gacagtcttt cagctgatgt tcaggttggc cgtctcatca ccggcagatt 3300 atcagtactt aatgcttttg ttgctcaaac ccttactaag tatactgagg ttcaggctag 3360 caggaaacta gcacagcaaa aggttaatga gcgtgttaaa tcgcaatctc agcgttatgg 3420 tttttgtggt ggtgatggcg agcacatttt ctctctggta caggcagcac ctcagggctt 3480 gctgttttta cacacagtac ttgtaccggg tgattttgta gatgttattg ccatcgctgg 3540 cttatgcgtt aacgatgaaa ttgccttgac tctacgtgag cctggcttag tcttgtttac 3600 gcatgaactt caaaattata ctgcgacgga atattttgtt tcatcgcgac gtatgtttga 3660 acctagaaaa cctaccgtta gtgattttgt tcaaattgag agttgtgtgg tcacctatgt 3720 caatttgact agagaccaac taccagatgt aatcccagat tacatcgatg ttaacaaaac 3780 acttgatgag atattagctt ctctgcccaa tagaactggt ccaagtcttc ctctagatgc 3840 ttttaatgcc acttatctta atctcactgg tgaaattgca gatttagagc agcgttcaga 3900 gtctctccgt aatactctag aagagctcca aagtcttata tataatatca acaacacact 3960 tgtcgacctt gagtggctca accgagttga gacatatatc aagtggccgt ggtgggtttg 4020 gttgattatt ttcattgttc tcatctctgt tgtgtcatta ctagtgttct gctgcatttc 4080 cacgggttgc tgtggatgct gcggttgctg cggtgcttgt ttttcaggtt gttgtagggg 4140 tcctagactt caaccttacg aagcttttga aaaggtccac gtgcagtgat gtttcttgga 4200 ctttttc 4207 <210> 36 <211> 4161 <212> DNA <213> porcine epidemic diarrhea virus <400> 36 atgaggtctt taatttactt ttggttgtcc ttaccagtac ttccaacact cagcctacca 60 caagatgtct ataggtgctc agctaggact aactttaggc ggttcttttc aaagtttaat 120 gttcaggcgc ctgcagtcgt tgtactgggc ggttatctac ctagtggtga aacacagggt 180 ggggcaccac gttggtactg tgctggccga catgaaactg ctagtggcgt tcatggtatc 240 tttcttagcc atattagagg tggtcacggc tttgagattg gcatttcgca agagccgtta 300 gaccctagtg gttaccagct ttatttacat aaggccacta acggtaacac taatgctact 360 gcgcgactgc gtatttgcca gtttcccagc aataaaacat tgggccccac tgctaatgat 420 gatgttacaa caggtcgtaa ctgcctattt aacaaagcca ttccagctca tatgagtgaa 480 catagtgttg tcggcataac atgggataat gatcgtgtca ctgtttttgc tgacaagatc 540 tatcattttt atcttaaaaa tgagtggtcc cgtgttgcga caaaatgtta caacagtgga 600 ggttgtgcta tgcaatatgt ttacgaacct atttactaca tgcttaatgt tactagtgct 660 ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720 gtatttgcca ctgagtccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780 cttttgtcca atgattccac tttgtttcat ggtaaagtgg tttccaacca acctttgttg 840 gtcaactgtc tttgggccat tcctaagatt tacggactag gccacttttt ctcattcaac 900 caaacgatgg atggcgtttg taacggagct actgcgtatc gtgccccaga ggctctgagg 960 tttaatatta atgacacttc tgtcattctt gccgaaggct caattgtact tcatactgct 1020 ttaggaacaa atctttcttt tgtttgcagt aattcctcag atcctcacaa agccatcttt 1080 tccatacctc tgggtgctac ccaagtaccc tactattgct ttcttaaagt tgatacttac 1140 aactccactg tctataaatt tcttgctgtt ttacctccta ctgtcaggga aattgtcatc 1200 accaagtacg gtgatgttta tgtcaatggg tttggctact tgcatctcgg tttgttggat 1260 gctgtcacaa ttaacttcac tggccatggc actaacgatg acgtctcagg tttctggacc 1320 atagcatcga ctaattttat tgatgcactc gtcgaggttc gagcaactgc cattcagcgt 1380 attctttatt gtgatgatcc tgtttgccaa ctcaagtgtt ctcaggtttc ttttgacctt 1440 gatgatggtt tttaccctat ttcttctaga aaccttctta gtcatgaaca gccaatttct 1500 tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt gtctgcggct 1560 tttggtgatt ctggtggtgc caacctcgtt gcatctgaca ctactatcaa tgggttcagt 1620 tctttctgtg ttgacactag acaatttacc attagactgt tttacaacgt tacaagcagt 1680 tatggttatg tgtctaaatc acaggatagc aattgccctt tcaccttgca atctgttaat 1740 gattacctgt cttttagcaa attttgtgtt tcaaccagcc ttttggctgg tgcttgtacc 1800 atagatcttt ttggttaccc tgctttcggt agtggtgtta agtttacgtc cctctatttt 1860 caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg tgtcacggac 1920 gtttctttta tgactctgga tgtgtgtacc aagtatacta tttatggctt taaaggtgag 1980 ggtattatta cccttacaaa ttctagcttt ttggcaggtg tttattatac atctgattct 2040 ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100 tctttttcag agcaggctgc ttatgtagat gatgatatag tgggtggtat ttctagtttg 2160 tctaactcca cttttaacaa tnntagggat tttcccggtt tcttctacca ttctaatgac 2220 ggctccaatt gcacagagcc tgtgttggtg tatagtaaca taggtgtctg taaatctggt 2280 agtattggct atgtcccact tcaggatggc caagtcaaga ttgcacccac ggttattggg 2340 cattatagta aacacgcctg ttagtgttga ttgtgctaca tatgtttgta atggtaactc tcgttgtaaa 2460 caattactta cccagtacac tgcagcatgt aagaccatag agtcagcatt agaactcagc 2520 gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga ggccttacag 2580 ttagctacca tcagttcgtt taatggtgat gggtataact ttactaatgt gttgggtgtt 2640 tctgtgtacg attctgaaag tggcagggtg gtacacgaaa ggtcttttat tgaagacctg 2700 ctttttaata aggnggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760 tctaatggtc gctctgtggc tgatctagtc tgtgcgcagt attactctgg tatcatggta 2820 ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct catcggtggt 2880 atggcgctag gaggttttac tgccgcagtg gcattgcctt ttagctatgc tgttcaagcg 2940 agactcaatt atcttgcttt acagacggat gttctacagc ggaaccagca actgcttgct 3000 gagtctttta actctgctat tggtagtata acctcagcct ttgagagtgt taatgaggct 3060 atcagtcaaa cttctaaggg tttgaatact gtggctcatg cgcttactaa agttcaagag 3120 gttgttaatt cgcagggttc agctttgact caacttacca tacagctgca acataacttc 3180 caagccattt ctagttctat tgatgacatt tactcccgac tggacattct ttcagccgat 3240 gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300 accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca aaaggttaat 3360 gagtgcgtca aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatt 3420 ttctctcttg tacaggccgc accccagggc ctgctgttct tacacacagt acttgtaccg 3480 ggtgattttg taaatgttat tgccatcgca ggcttgtgcg ttaatggtga tattgccttg 3540 actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaactca tactgcgacg 3600 gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt tagtgatttt 3660 gttcaaattc agagttgtgt ggtcacctat gtcaatctga ctagcgacca actaccagat 3720 gtaatcccag attacgtcga tgttaacaaa acacttgatg agattttagc ttctctgccc 3780 aatagaactg gtccaaatct tcctctagat gtttttaatg ccacttatct taatctcact 3840 ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac agaagagctc 3900 cgaagtctta tatataatat caacaacaca cttgttgacc ttgagtggct caaccgagtt 3960 gagacttata tcaagtggcc gtggtgggtt tggttgattg tttttattgt tctcatcttt 4020 gttgtgtcat tattagtgtt ctgctgcatt tccacgggtt gttgtggatg ctgcggttgc 4080 tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta cgaagctttt 4140 gaaaaggtcc acgtgcagtg a 4161 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 37 ccattcagcg tattctttat tgtgatga 28 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 38 tatctgcagt gaacccccac ctccttaaaa tttacgtttc 40 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 39 atagagctct gtaggataaa tcgt 24 <210> 40 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 40 tatctgcagt gaacccccac ctccttagta gtgtt 35 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 41 ctgcagacgt atccaaggag 20 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 42 ccatggggat ccttagggtt taagt 25 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 43 ctgcagacgt atccaaggag 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 44 ccatggggat ccttaagggt taa 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 45 ctgcagacgt atccaaggag 20 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 46 ccatggggat cctcacttag ggt 23 <210> 47 <211> 702 <212> DNA <213> Porcine circovirus <400> 47 atgacgtatc caaggaggcg ttaccgaagg agaagacacc gcccccgcag ccatcttggc 60 cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120 aaaaatggca tcttcaacgc ccgcctctcc cgcaccttcg gatatactgt caaggctacc 180 acagtcagca cgccctcctg ggcggtggac atgctgagat ttaatcttga cgactttgtt 240 cccccgggag gggggaccaa caaaatctct ataccctttg aatactacag aataagaaag 300 gttaaggttg aattctggcc ctgctccccg atcacccagg gtgacagggg agttggatcc 360 agtgctatta ttctagatga caactttgta ataaaggcca cagcccaaac ctatgacccc 420 tatgtaaact actcctcccg ccatacaatc ccccaaccct tctcctacca ctcccgttac 480 ttcacaccca aacctgttct tgattccact attgattact tccaaccaaa taacaaaagg 540 aatcagctgt ggatgagact acaaaccagt agaaatgtgg accacgtagg cctcggcact 600 gcgttcgaaa acagtaaata cgaccaggac tacaatatcc gtgtaaccat gtatgtacaa 660 ttcagagaat ttaatcttaa agacccccca cttaaaccct aa 702 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 48 cccccccatg ccctgaattt ccata 25 <210> 49 <211> 1143 <212> DNA <213> Bacillus subtilis <400> 49 atgagcaaga ggagaatgaa atatcattca aataatgaaa tatcgtatta taactttttg 60 cactcaatga aagataaaat tgttactgta tatcgtggag gtccggaatc taaaaaagga 120 aaattaacag ctgtaaaatc agattatata gctttacaag ctgaaaaaaa aataatttat 180 tatcagttgg agcatgtgaa aagtattact gaggatacca ataatagcac cacaacaatt 240 gagactgagg aaatgctcga tgctgatgat tttcatagct taatcggaca tttaataaac 300 caatcagttc aatttaacca agggggtccg gaatctaaaa aaggaagatt ggtctggctg 360 ggagatgatt acgctgcgtt aaacacaaat gaggatgggg tagtgtattt taatatccat 420 cacatcaaaa gtataagtaa acacgagcct gatttgaaaa tagaagagca gacgccagtt 480 ggagttttgg aagctgatga tttaagcgag gtttttaaga gtctgactca taaatgggtt 540 tcaattaatc gtggaggtcc ggaagccatt gagggtatcc ttgtagataa tgccgacggc 600 cattatacta tagtgaaaaa tcaagaggtg cttcgcatct atccttttca cataaaaagc 660 atcagcttag gtccaaaagg gtcgtacaaa aaagaggatc aaaaaaatga acaaaaccag 720 gaagacaata atgataagga cagcaattcg ttcatttctt caaaatcata tagctcatca 780 aaatcatcta aacgatcact aaaatcttca gatgatcaat catccaaatc tggtcgttcg 840 tcacgttcaa aaagttcttc aaaatcatct aaacgatcac taaaatcttc ggattatcaa 900 tcatccaaat ctggccgttc gtcacgttca aaaagttctt caaaatcatc taaacgatca 960 ttaaaatctt cagattatca atcatcaaaa tcatctaaac gatcaccaag atcttcagat 1020 tatcaatcat caagatcacc aggctattca agttcaataa aaagttcagg aaaacaaaag 1080 gaagattata gctatgaaac gattgtcaga acgatagact atcactggaa acgtaaattt 1140 taa 1143 <210> 50 <211> 201 <212> DNA <213> Bacillus subtilis <400> 50 atgggttatt acaaaaaata caaagaagag tattatacgg tcaaaaaaac gtattataag 60 aagtattacg aatatgataa aaaagattat gactgtgatt acgacaaaaa atatgatgac 120 tatgataaaa aatattatga tcacgataaa aaagactatg attatgttgt agagtataaa 180 aagcataaaa aacactacta a 201

Claims (33)

i) spores of spore-forming bacteria,
ii) a spore coat protein present in the outer region of the spore of the spore,
ii) a porcine disease virus immune region fused to the spore coat protein
Including the
Wherein the porcine disease virus is at least one of porcine epidemic diarrhea virus (PEDV) and porcine circovirus (PCV).
The method according to claim 1,
Wherein the spore-forming bacteria are bacteria belonging to Clostridium, Sporolactobacillus, and Bacillus genus.
3. The method of claim 2,
Wherein the spore bacterium is Bacillus subtilis.
The method according to claim 1,
Wherein the immunogenic region of the Porcine Epidemic Diarrhea Virus (PEDV) comprises a common sequence of more than 15 outdoor strains.
5. The method of claim 4,
Wherein the common sequence of the Porcine Epidemic Diarrhea Virus (PEDV) comprises any one of SEQ ID NOS: 1 to 4.
The method according to claim 1,
Wherein the immunogenic region of the Porcine Circovirus (PCV) comprises a consensus sequence of three or more outdoor strains.
The method according to claim 6,
Wherein the common sequence of the Porcine Circovirus (PCV) comprises any one of SEQ ID NOs: 41 to 46.
The method according to claim 1,
iv) a fusion moiety fusing between the spore coat protein and the immunogenic site
Further comprising a spore fusion display system.
9. The method of claim 8,
Wherein the fusion site is a peptide encoding SEQ ID NO: 16.
The method according to claim 1,
The spore-coat protein is any one selected from CotC, CotD, CotB, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK, Characterized in that the immunogenic spore fusion display system comprises:
11. The method of claim 10,
Wherein the spore coat protein is any one or more of CotB, CotC and CotG.
The method according to claim 1,
Wherein the immunogenic region of the Porcine Epidemic Diarrhea Virus (PEDV) is part or all of the spike protein.
13. The method of claim 12,
Wherein the spike protein of the porcine epidemic diarrhea virus (PEDV) is any one of spike proteins encoding SEQ ID NO: 19 to SEQ ID NO: 36.
The method according to claim 1,
Wherein the immunogenic region of Porcine Circovirus (PCV) is part or all of the capsid protein.
15. The method of claim 14,
Wherein the capsid protein of Porcine Circovirus (PCV) is a capsid protein encoding SEQ ID NO: 47.
i) a spore fusion display system of claim 1,
ii) a carrier for delivering said immunogenic spore fusion display system
Wherein the concentration of the immunogenic spore fusion display system is 10 &lt; ¹² &gt; to 10 &lt; ¹⁴ &gt; cells / ml.
17. The method of claim 16,
Wherein the carrier comprises a PBS buffer.
Porcine Epidemic Diarrhea Virus (PEDV) To obtain immunogenic regions of outdoor strains,
SEQ ID NOS: 1 and 2;
SEQ ID NOS: 3 and 4;
&Lt; / RTI &gt;
Porcine Circovirus (PCV) To obtain immunogenic regions of outdoor strains,
SEQ ID NOS: 41 and 42;
SEQ ID NOS: 43 and 44;
SEQ ID NOs: 45 and 46;
&Lt; / RTI &gt;
i) a spore coat protein present in the outer region of the spore of the spore, and
ii) an immunogenic portion (s) of any one or more of porcine epidemic diarrhea virus (PEDV) or porcine circovirus (PCV) fused to the spore coat protein
Encoding a spore-forming recombinant expression vector.
21. The method of claim 20,
Wherein the base sequence encoding the immunogenic region of the Porcine Epidemic Diarrhea Virus (PEDV) comprises a common sequence of at least 15 outdoor strains.
22. The method of claim 21,
Wherein the common sequence of the Porcine Epidemic Diarrhea Virus (PEDV) is any one of SEQ ID NOS: 1 to 4.
21. The method of claim 20,
Wherein the base sequence encoding the immunogenic region of the Porcine Circovirus (PCV) comprises a consensus sequence of three or more outdoor strains.
24. The method of claim 23,
Wherein the common sequence of the Porcine Circovirus (PCV) is any one of SEQ ID NOs: 41 to 46.
21. The method of claim 20,
The spore system expression target sequence is
iv) a fusion moiety fusing between the spore coat protein and the immunogenic site
Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; spore system recombinant expression vector.
26. The method of claim 25,
Wherein the nucleotide sequence encoding the fusion site is the nucleotide sequence of SEQ ID NO: 16.
21. The method of claim 20,
The nucleotide sequence encoding the sporescoat protein is selected from CotC, CotD, CotB, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK, A recombinant expression vector of spores which is a nucleotide sequence encoding any selected one.
28. The method of claim 27,
Wherein the base sequence encoding the sporescoat protein is a base sequence encoding any one or more of CotB, CotC and CotG.
21. The method of claim 20,
The nucleotide sequence encoding the immunogenic region of the porcine epidemic diarrhea virus (PEDV) is a nucleotide sequence encoding part or all of the spike protein,
Wherein the nucleotide sequence encoding the immunogenic region of the porcine circovirus (PCV) is a nucleotide sequence encoding a part or all of the capsid protein.
30. The method of claim 29,
Wherein the spike protein of the Porcine Epidemic Diarrhea Virus (PEDV) is any one of spike proteins encoding SEQ ID NO: 19 to SEQ ID NO: 36.
30. The method of claim 29,
Wherein the capsid protein of Porcine Circovirus (PCV) is any of the capsid proteins encoding SEQ ID NO: 47.
An immunogenic spore fusion display system characterized in that an immunogenic site derived from porcine epidemic diarrhea virus (PEDV) or Porcine Circovirus (PCV) is fused to a spore coat protein, comprising 10 ¹² to 10 ¹⁴ / ml &lt; / RTI &gt; of the vaccine composition.
33. The method of treating a PEDV-infected animal according to claim 32, wherein the animal infected with PEDV or PCV is a pig.

Images