KR20200022992A - Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara - Google Patents

Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara Download PDF

Info

Publication number
KR20200022992A
KR20200022992A KR1020180099305A KR20180099305A KR20200022992A KR 20200022992 A KR20200022992 A KR 20200022992A KR 1020180099305 A KR1020180099305 A KR 1020180099305A KR 20180099305 A KR20180099305 A KR 20180099305A KR 20200022992 A KR20200022992 A KR 20200022992A
Authority
KR
South Korea
Prior art keywords
straight
formula
branched
psoriasis
alkoxy
Prior art date
Application number
KR1020180099305A
Other languages
Korean (ko)
Other versions
KR102179531B1 (en
Inventor
김영식
이주희
송광호
백우현
장혜리
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to KR1020180099305A priority Critical patent/KR102179531B1/en
Publication of KR20200022992A publication Critical patent/KR20200022992A/en
Application granted granted Critical
Publication of KR102179531B1 publication Critical patent/KR102179531B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/28Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105Plant extracts, their artificial duplicates or their derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/37Esters of carboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat

Abstract

The present invention relates to a composition for preventing or treating psoriasis containing sesquiterpenoid compounds (TG, ECN, TH7, TGN, and AECN) or sesquiterpenoid enriched fraction (STE) derived from Tussilago farfara as an active ingredient. The TG, ECN, TH7, TGN, AECN and STE of the present invention inhibit the mRNA expression of inflammation-related factors increased by TNF-α in HaCaT cells, a human-derived keratinocyte line, and inhibit cell hyperproliferation induced by IL-6. In particular, TGN, AECN, and STE exhibit clinical and histological anti-psoriasis effects in an imiquimod-induced psoriasis mouse model, thereby being usefully used as a composition for preventing, treating, or alleviating psoriasis.

Description

관동화 유래 세스퀴테르펜 화합물 또는 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 치료용 조성물{Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara}Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara}

본 발명은 관동화 유래 세스퀴테르펜 화합물 또는 세스퀴테르펜 강화 분획(sesquiterpenoids enriched fraction)을 유효성분으로 함유하는 건선의 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for the prevention or treatment of psoriasis containing a sesquiterpene compound or sesquiterpenes enriched fraction derived from kantoin as an active ingredient.

건선(psoriasis)은 악화와 호전이 반복되는 만성 염증성 피부질환으로, 정확한 발병 원인이 밝혀지지 않았지만, 통상적으로 면역학적 이상에 의해 발생되는 것으로 보고되고 있다. 건선은 피부에 작은 좁쌀같은 발진이 생기면서, 그 위에 새하얀 비듬과 같은 각질이 겹겹이 쌓여 나타나게 되며, 발진이 점점 퍼져 심해지면 전신의 거의 모든 피부가 발진으로 덮이기도 한다. 건선은 전세계적으로 약 3%의 유병률을 보이고, 우리나라에도 약 150만 명 내외의 환자가 있는 것으로 추정되며, 환자 수가 점점 증가하는 추세에 있다. Psoriasis is a chronic inflammatory skin disease with repeated deterioration and improvement. Although the exact cause of the disease is not known, it is commonly reported to be caused by an immunological abnormality. Psoriasis develops a small, milly-like rash on the skin, with layers of dead skin, such as white dandruff, on top of it, and as the rash grows and spreads, almost all of the skin is covered with a rash. Psoriasis has a prevalence of about 3% worldwide, and it is estimated that there are about 1.5 million patients in Korea, and the number of patients is increasing.

일반적인 건선의 치료방법은 국소치료, 전신치료 또는 광치료 등이 있으며, 최근에는 건선의 병인에 근거한 다양한 면역 생물학적 제제들이 개발되고 있다. 또한, 건선의 치료 효과는 증가시키면서 부작용은 감소시키기 위해 상기 치료 방법들을 적절히 혼합하는 복합 요법도 많이 사용된다. 상기 건선의 치료 방법 중 가장 많이 쓰이는 방법은 국소치료법이며, 특히 건선 환자가 소화장애, 간 또는 신장 장애와 같은 전신 질환이 있는 경우에는 전신치료보다 국소치료가 보다 안전하다. 현재 국소치료제로 비타민 D 연고제, 비타민 D 겔 제제, 스테로이드 연고제, 비타민 A 연고제, 타르제제 등이 시판되고 있다.The general treatment of psoriasis is topical treatment, systemic treatment or phototherapy. Recently, various immunobiological agents based on the pathogenesis of psoriasis have been developed. In addition, many combination therapies are used that combine the appropriate treatment methods to increase the therapeutic effect of psoriasis while reducing side effects. The most widely used method of treatment of psoriasis is topical therapy, especially when psoriasis patients have systemic diseases such as digestive disorders, liver or kidney disorders, local therapy is safer than systemic therapy. Currently, topical treatments include vitamin D ointment, vitamin D gel preparation, steroid ointment, vitamin A ointment and tar agent.

그러나, 지금까지 개발된 건선 치료제들은 단순히 면역을 억제함으로써, 암, 결핵 등 여러 감염증을 유발하거나, 약물을 중단하는 경우 건선이 급격히 악화되는 반동현상(rebound phenomenon)이 일어날 수 있고, 치료 효율이 낮은 문제점이 있다. 따라서, 오랜 기간 사용되어 비교적 안전한 천연물 유래 소재를 이용한 부작용은 적고 건선의 치료 효율은 높은 새로운 치료제 개발이 필요하다. However, the psoriasis treatments developed so far simply suppress the immunity, causing various infections such as cancer and tuberculosis, or when the drug is discontinued, a rebound phenomenon may occur. There is a problem. Therefore, there is a need for the development of a new therapeutic agent that has been used for a long time and uses relatively safe natural material-derived materials and has high treatment efficiency of psoriasis.

대한민국 등록특허 제10-1881722호Republic of Korea Patent No. 10-1881722

본 발명의 목적은 관동화 유래 세스퀴테르펜 화합물 또는 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방, 치료 또는 개선용 조성물을 제공하는 것이다.It is an object of the present invention to provide a composition for the prevention, treatment or improvement of psoriasis containing the sesquiterpene compound or sesquiterpene-enhanced fraction derived from a kantoin as an active ingredient.

상기 목적을 달성하기 위하여, 본 발명은 관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 치료용 약학 조성물을 제공한다.In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of psoriasis containing the sesquiterpene-enhanced fraction derived from the Kantoin extract as an active ingredient.

또한, 본 발명은 하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 치료용 약학 조성물을 제공한다:The present invention also provides a pharmaceutical composition for the prevention or treatment of psoriasis containing the compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:

[화학식 I][Formula I]

Figure pat00001
Figure pat00001

(상기 화학식 I에서,(In Formula I,

R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And

R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,

Figure pat00002
, 또는
Figure pat00003
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00002
, or
Figure pat00003
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).

또한, 본 발명은 관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 개선용 건강기능식품을 제공한다.The present invention also provides a health functional food for the prevention or improvement of psoriasis containing the sesquiterpene-enriched fraction derived from Kantoin extract as an active ingredient.

또한, 본 발명은 하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 개선용 건강기능식품을 제공한다:The present invention also provides a health functional food for the prevention or improvement of psoriasis containing a compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:

[화학식 I][Formula I]

Figure pat00004
Figure pat00004

(상기 화학식 I에서,(In Formula I,

R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And

R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,

Figure pat00005
, 또는
Figure pat00006
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00005
, or
Figure pat00006
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).

또한, 본 발명은 관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 개선용 화장료 조성물을 제공한다.In another aspect, the present invention provides a cosmetic composition for the prevention or improvement of psoriasis containing the sesquiterpene-enhanced fraction derived from Kantoin extract as an active ingredient.

또한, 본 발명은 하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 개선용 화장료 조성물을 제공한다:The present invention also provides a cosmetic composition for the prevention or improvement of psoriasis containing a compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:

[화학식 I][Formula I]

Figure pat00007
Figure pat00007

(상기 화학식 I에서,(In Formula I,

R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And

R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,

Figure pat00008
, 또는
Figure pat00009
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00008
, or
Figure pat00009
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).

본 발명의 관동화 유래 세스퀴테르펜 화합물(TG, ECN, TH7, TGN 및 AECN) 및 세스퀴테르펜 강화 분획(sesquiterpenoids enriched fraction, STE)은 인간 유래 각질 세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자들의 mRNA 발현을 억제하고, IL-6에 의해 유도된 세포 과증식(hyperproliferation)을 억제하며, 특히 TGN, AECN 및 STE는 이미퀴모드 유도 건선 마우스 모델에서 임상적 및 조직학적 항건선 효과를 나타냄으로써, 건선의 예방, 치료 또는 개선용 조성물로 유용하게 사용될 수 있다.The Kantoin-derived sesquiterpene compounds (TG, ECN, TH7, TGN and AECN) and the sesquiterpenoids enriched fraction (STE) of the present invention are increased inflammation by TNF-α in HaCaT cells, which are human-derived keratinocyte lines. Inhibits mRNA expression of related factors and inhibits cell hyperproliferation induced by IL-6, in particular TGN, AECN and STE exhibit clinical and histological anti-psoriasis effects in imiquimod induced psoriasis mouse models By this, it can be usefully used as a composition for preventing, treating or improving psoriasis.

도 1은 관동화 추출액으로부터 CCC-DCI를 통해 세스퀴테르펜 강화 분획(STE)을 얻는 과정을 모식화한 도면이다.
도 2는 관동화 추출액(A)을 이용하여 CCC-DCI를 수행한 크로마토그램이다(B: 세스퀴테르펜 강화 분획, STE).
도 3은 세스퀴테르펜 강화 분획(STE) 내 TG, AECN 및 ECN이 존재함을 검증한 HPLC 크로마토그램이다.
도 4는 HaCaT 세포에서 IL-17(A), IL-17A(B), IL-23(C) 및 TNF-α(D)의 상대적 mRNA 발현량을 측정한 결과 그래프이다.
도 5는 HaCaT 세포에서 IL-17(A), IL-17A(B), TNF-α(C) 및 IL-23(D)의 상대적 mRNA 발현량을 측정한 결과 그래프이다.
도 6은 HaCaT 세포에서 STE 또는 TG(A), ECN 또는 TH7(B), 및 TGN 또는 AECN(C)의 IL-6 유도 세포 과증식 억제 효과를 측정한 결과 그래프이다.
도 7은 이미퀴모드(imiquimod, IMQ) 크림 유도 건선 마우스 모델에서의 실험 일정을 도식화한 도면이다.
도 8은 이미퀴모드 크림 유도 건선 마우스 모델 등 피부의 두께(A), 홍반(B), 인설(C) 및 총점(D)을 측정한 결과 그래프이다.
도 9는 이미퀴모드 크림 유도 건선 마우스 모델 귀의 두께(A) 및 홍반(B)을 측정한 결과 그래프이다.
도 10은 이미퀴모드 크림 유도 건선 마우스 모델 등 피부 조직의 헤마톡실린 및 에오신 염색 사진이다.
FIG. 1 is a diagram schematically illustrating a process of obtaining a sesquiterpene-enriched fraction (STE) through CCC-DCI from a kantoin extract.
FIG. 2 is a chromatogram of CCC-DCI performed using the tuberization extract (A) (B: sesquiterpene enriched fraction, STE). FIG.
Figure 3 is an HPLC chromatogram verifying the presence of TG, AECN and ECN in sesquiterpene enriched fraction (STE).
Figure 4 is a graph of the results of measuring the relative mRNA expression of IL-17 (A), IL-17A (B), IL-23 (C) and TNF-α (D) in HaCaT cells.
Figure 5 is a graph of the results of measuring the relative mRNA expression of IL-17 (A), IL-17A (B), TNF-α (C) and IL-23 (D) in HaCaT cells.
Figure 6 is a graph of the results of measuring the inhibitory effect of IL-6 induced cell hyperproliferation of STE or TG (A), ECN or TH7 (B), and TGN or AECN (C) in HaCaT cells.
FIG. 7 is a diagram illustrating the schedule of experiments in an imiquimod (IMQ) cream induced psoriasis mouse model.
Figure 8 is a graph of the results of measuring the skin thickness (A), erythema (B), tear (C) and total score (D) of the imiquimod cream-induced psoriasis mouse model.
Figure 9 is a graph of the results of measuring the thickness (A) and erythema (B) of the imiquimod cream-induced psoriasis mouse model ears.
Figure 10 is a hematoxylin and eosin staining pictures of skin tissue, such as imiquimod cream induced psoriasis mouse model.

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 치료용 약학 조성물을 제공한다.The present invention provides a pharmaceutical composition for the prevention or treatment of psoriasis containing sesquiterpene-enhanced fraction derived from Kantoin extract as an active ingredient.

상기 관동화 추출물은 하기의 단계들을 포함하는 제조방법에 의해 제조될 수 있다:The Kanto extract may be prepared by a manufacturing method comprising the following steps:

1) 관동화(Tussilago farfara)의 꽃봉오리에 추출 용매를 가하여 추출하는 단계; 및1) extracting by adding an extraction solvent to the buds of Tussilago farfara ; And

2) 단계 1)의 추출물을 여과하는 단계.2) filtering the extract of step 1).

상기 단계 1)의 관동화는 재배한 것 또는 시판된 것 등 제한 없이 사용될 수 있다.Kanto of step 1) may be used without limitation, such as grown or commercially available.

상기 단계 1)의 관동화의 꽃봉오리는 건조된 것일 수 있으나, 이에 제한되지 않는다.The bud of Kwanhwa of step 1) may be dried, but is not limited thereto.

상기 추출용매는 물, 알코올, 아세토니트릴(acetonitrile), 물과 알코올의 혼합물, 또는 물과 아세토니트릴의 혼합물일 수 있다. 상기 알코올은 C1 내지 C4의 저급 알코올일 수 있고, 구체적으로, 상기 저급 알코올은 에탄올 또는 메탄올일 수 있다. 상기 추출용매는 추출에 사용되는 관동화의 중량 1 g당 1 내지 50 mL의 양으로 첨가될 수 있다.The extractant may be water, alcohol, acetonitrile, a mixture of water and alcohol, or a mixture of water and acetonitrile. The alcohol may be C 1 to C 4 lower alcohol, specifically, the lower alcohol may be ethanol or methanol. The extractant may be added in an amount of 1 to 50 mL per 1 g of weight of the tuberization used for extraction.

상기 추출방법은 진탕추출, Soxhlet 추출, 환류추출 또는 초음파 추출일 수 있다. 이때, 추출 시간은 1 내지 50시간, 10 내지 40시간 또는 15 내지 30시간일 수 있다. 상기 추출은 3 내지 5회 반복 추출할 수 있다.The extraction method may be shaking extraction, Soxhlet extraction, reflux extraction or ultrasonic extraction. At this time, the extraction time may be 1 to 50 hours, 10 to 40 hours or 15 to 30 hours. The extraction may be repeated 3 to 5 times.

상기 세스퀴테르펜 강화 분획은 상기 단계 2)의 여과한 관동화 추출물을 그대로 분획하거나, 상기 여과한 관동화 추출물을 감압 농축한 후 건조하여 제조한 관동화 추출물을 다시 유기 용매로 용해한 후 분획하여 제조할 수 있다.The sesquiterpene-enriched fraction may be prepared by fractionating the filtered Kwan Tong extract of Step 2) as it is, or by concentrating the filtered Kwan Tong extract extract under reduced pressure and then drying and dissolving the Kwan Tong extract extract in an organic solvent. .

상기 세스퀴테르펜 강화 분획은 관동화 추출물로부터 n-헥산, 물 및 아세토니트릴을 용매로 사용하여 CCC-DCI(counter-current chromatography-direct and continuous injection) 방법으로 수득할 수 있으나, 이에 제한되지 않는다.The sesquiterpene-enriched fraction may be obtained by counter-current chromatography-direct and continuous injection (CCC-DCI) method using n-hexane, water, and acetonitrile as solvents from the tuberization extract, but is not limited thereto.

상기 세스퀴테르펜 강화 분획은 하기 단계를 포함하는 CCC-DCI 방법으로 제조될 수 있으나, 이에 제한되지 않는다:The sesquiterpene enriched fraction may be prepared by the CCC-DCI method, including but not limited to:

1) 컬럼에 고정상으로 n-헥산을 충진하고, 관동화 추출액을 주입하는 단계;1) filling the column with n-hexane into the stationary phase, and injecting the tube mixture extract;

2) 물 및 아세토니트릴의 혼합 용매를 컬럼에 주입하는 단계; 및2) injecting a mixed solvent of water and acetonitrile to the column; And

3) 100% 아세토니트릴을 컬럼에 주입한 후 용출되는 분획을 수득하는 단계.3) Injecting 100% acetonitrile into the column to obtain the fraction eluted.

상기 단계 2)의 물 및 아세토니트릴의 혼합 용매는 30 내지 80, 35 내지 70, 또는 40 내지 60%(v/v)의 아세토니트릴 용액일 수 있다.The mixed solvent of water and acetonitrile of step 2) may be 30 to 80, 35 to 70, or 40 to 60% (v / v) of acetonitrile solution.

상기 단계 3)은 단계 2) 이후 UV 신호가 감소하기 시작할 때 수행되는 것일 수 있다.Step 3) may be performed when the UV signal starts to decrease after step 2).

상기 단계 3)의 용출되는 분획을 수득하는 단계는 100% 아세토니트릴을 컬럼에 주입한 후 UV 신호가 다시 증가하였다가 감소하는 구간에서 용출되는 분획을 수득하는 것일 수 있고, 구체적으로 430-490분 구간에서 용출되는 분획을 수득하는 것일 수 있다.The step of obtaining the eluted fraction of step 3) may be to obtain a fraction eluted in a section in which 100% acetonitrile is injected into the column and the UV signal is increased again and then decreases, specifically, 430-490 minutes It may be to obtain the fraction eluted in the interval.

상기 CCC-DCI 방법을 수행함에 있어 용출 속도는 당업계에서 일반적으로 사용하는 속도로 적용할 수 있으며, 구체적으로 10 내지 50 ㎖/분의 속도로 적용할 수 있으나, 이에 제한되지 않는다.In performing the CCC-DCI method, the dissolution rate may be applied at a rate generally used in the art, and specifically, may be applied at a rate of 10 to 50 ml / min, but is not limited thereto.

상기 세스퀴테르펜 강화 분획은 상기 단계 1) 내지 3)을 포함하는 CCC-DCI 방법을 1 내지 3회 반복하여 수득할 수 있으나, 이에 제한되지 않는다.The sesquiterpene enriched fraction may be obtained by repeating the CCC-DCI method including the steps 1) to 3) 1 to 3 times, but is not limited thereto.

상기 세스퀴테르펜 강화 분획은 하기 화학식 1, 2 또는 3으로 표시되는 화합물을 포함할 수 있다:The sesquiterpene enriched fraction may comprise a compound represented by Formula 1, 2 or 3:

[화학식 1][Formula 1]

Figure pat00010
Figure pat00010

[화학식 2][Formula 2]

Figure pat00011
Figure pat00011

[화학식 3][Formula 3]

Figure pat00012
.
Figure pat00012
.

상기 화학식 1, 2 또는 3으로 표시되는 화합물은 각각 TG(tussilagone), AECN(14-acetoxy-7β-(3'-ethyl cis-crotonoyloxy)-1α-(2'-methylbutyryloxy)-notonipetranone) 또는 ECN(7β-(3-ethyl cis-crotonoyloxy)-1α-(2-methylbutyryloxy)-3,14-dehydro-Z-notonipetranone)일 수 있다.Compounds represented by Formula 1, 2 or 3 are TG (tussilagone), AECN (14-acetoxy-7β- (3'-ethyl cis-crotonoyloxy) -1α- (2'-methylbutyryloxy) -notonipetranone) or ECN (respectively) 7β- (3-ethyl cis-crotonoyloxy) -1α- (2-methylbutyryloxy) -3,14-dehydro-Z-notonipetranone).

상기 세스퀴테르펜 강화 분획은 각질 세포의 염증 반응 또는 과증식을 억제할 수 있다.The sesquiterpene enriched fraction can inhibit the inflammatory response or hyperproliferation of keratinocytes.

본 발명의 구체적인 실시예에서, 본 발명자들은 관동화 추출물 유래 세스퀴테르펜 강화 분획(STE)을 제조하고, STE 내 세스퀴테르펜 화합물인 TG, AECN 및 ECN이 함유되어 있음을 확인하였고(도 1 내지 3 참조), STE가 인간 유래 각질세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자의 mRNA 발현을 억제하고, IL-6로 유도된 세포 과증식을 억제하며, 이미퀴모드 유도 건선 마우스 모델에서 임상적 및 조직학적 항건선 효과를 나타냄을 확인하였다(도 4, 및 6 내지 10 참조). 따라서, 본 발명의 세스퀴테르펜 강화 분획은 건선의 예방 또는 치료에 유용하게 사용될 수 있다. In a specific embodiment of the present invention, the present inventors have prepared a sesquiterpene-enriched fraction (STE) derived from a kantoin extract, and confirmed that the sesquiterpene compounds TG, AECN and ECN are contained in STE (FIGS. 1 to 3). STE inhibits mRNA expression of inflammation-related factors increased by TNF-α in HaCaT cells, a human-derived keratinocyte line, inhibits IL-6-induced cell hyperproliferation, and in an imiquimod induced psoriasis mouse model. It was confirmed to exhibit clinical and histological anti-psoriasis effects (see Figures 4, and 6-10). Therefore, the sesquiterpene enriched fraction of the present invention can be usefully used for the prevention or treatment of psoriasis.

또한, 본 발명은 하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 치료용 약학 조성물을 제공한다:The present invention also provides a pharmaceutical composition for the prevention or treatment of psoriasis containing the compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:

[화학식 I][Formula I]

Figure pat00013
Figure pat00013

(상기 화학식 I에서,(In Formula I,

R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And

R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,

Figure pat00014
, 또는
Figure pat00015
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00014
, or
Figure pat00015
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).

또한, 상기 화학식 I에서,Further, in the formula (I),

상기 R1은 -H, -OH, C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시, 또는 C1-5의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy, or C 1-5 straight or branched alkylcarbonyloxy; And

R2는 C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시,

Figure pat00016
, 또는
Figure pat00017
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-3의 직쇄 또는 분지쇄 알킬일 수 있다.R 2 is C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy,
Figure pat00016
, or
Figure pat00017
Wherein A 1 and A 2 may be independently —H, or C 1-3 linear or branched alkyl.

또한, 상기 화학식 I에서,Further, in the formula (I),

상기 R1은 -H, -OH, 또는

Figure pat00018
이고; 및R 1 is —H, —OH, or
Figure pat00018
ego; And

R2

Figure pat00019
, 또는
Figure pat00020
일 수 있다.R 2 is
Figure pat00019
, or
Figure pat00020
Can be.

또한, 상기 화학식 I로 표시되는 화합물은 하기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물로 이루어진 군으로부터 선택되는 어느 하나의 화합물일 수 있다.In addition, the compound represented by Chemical Formula I may be any one compound selected from the group consisting of compounds represented by the following Chemical Formulas 1, 2, 3, 4 and 5.

[화학식 1][Formula 1]

Figure pat00021
Figure pat00021

[화학식 2][Formula 2]

Figure pat00022
Figure pat00022

[화학식 3][Formula 3]

Figure pat00023
Figure pat00023

[화학식 4][Formula 4]

Figure pat00024
Figure pat00024

[화학식 5][Formula 5]

Figure pat00025
.
Figure pat00025
.

상기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물은 TG, AECN, ECN, TGN(tussilagonone) 또는 TH7(7β-(3'-ethyl cis-crotonoyloxy)-1α-hydroxy-3,14-dehydro-Z-notonipetranone)일 수 있다.Compounds represented by Formulas 1, 2, 3, 4 and 5, respectively, are TG, AECN, ECN, TGN (tussilagonone) or TH7 (7β- (3'-ethyl cis-crotonoyloxy) -1α-hydroxy-3,14- dehydro-Z-notonipetranone).

상기 세스퀴테르펜 강화 분획은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 세스퀴테르펜 강화 분획은 관동화 추출물로부터 제조될 수 있고, 상기 화학식 1, 2 또는 3으로 표시되는 화합물을 포함할 수 있다.The sesquiterpene enriched fraction may have the characteristics as described above. For example, the sesquiterpene-enriched fraction may be prepared from a Kantoin extract, and may include a compound represented by Chemical Formula 1, 2 or 3.

상기 화합물은 각질 세포의 염증 반응 또는 과증식을 억제할 수 있다.The compound can inhibit the inflammatory response or hyperproliferation of keratinocytes.

본 발명의 구체적인 실시예에서, 본 발명자들은 관동화 추출물 유래 세스퀴테르펜 강화 분획(STE)으로부터 세스퀴테르펜 화합물인 TG, AECN 및 ECN을 분리 및 정제하고, TG 및 ECN을 가수분해함으로써 TGN 및 TH7을 제조하였다(도 3 참조).In a specific embodiment of the present invention, the present inventors isolate and purify sesquiterpene compounds TG, AECN and ECN from the sesquiterpene enriched fraction (STE) derived from the Kantoin extract, and TGN and TH7 by hydrolyzing TG and ECN. Prepared (see Figure 3).

또한, TG, AECN, ECN, TGN 및 TH7이 인간 유래 각질세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자의 mRNA 발현을 억제하고, IL-6로 유도된 세포 과증식을 억제함을 확인하였다(도 4 내지 6 참조).It was also confirmed that TG, AECN, ECN, TGN and TH7 inhibit mRNA expression of inflammation-related factors increased by TNF-α and inhibit IL-6-induced cell hyperproliferation in HaCaT cells, human-derived keratinocyte lines. (See FIGS. 4-6).

또한, 본 발명자들은 이미퀴모드 유도 건선 마우스 모델에서 TGN 및 AECN이 임상적 및 조직학적 항건선 효과를 나타냄을 확인하였다(도 7 내지 10 참조).In addition, the inventors have confirmed that TGN and AECN exhibit clinical and histological anti-psoriasis effects in the imiquimod induced psoriasis mouse model (see FIGS. 7-10).

따라서, 본 발명의 세스퀴테르펜 화합물들(TG, AECN, ECN, TGN 및 TH7)은 건선의 예방 또는 치료에 유용하게 사용될 수 있다. Therefore, the sesquiterpene compounds of the present invention (TG, AECN, ECN, TGN and TH7) can be usefully used for the prevention or treatment of psoriasis.

본 발명에 따른 약학 조성물은 조성물 전체 중량에 대하여 유효성분인 세스퀴테르펜 강화 분획 또는 상기 화학식 1, 2, 3, 4 또는 5로 표시되는 화합물을 10 내지 95 중량%로 포함할 수 있다. 또한, 본 발명의 약학 조성물은 상기 유효성분 이외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 포함할 수 있다.The pharmaceutical composition according to the present invention may include 10 to 95% by weight of the sesquiterpene-enriched fraction, which is an active ingredient or the compound represented by Formula 1, 2, 3, 4 or 5, based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention may further include one or more active ingredients exhibiting the same or similar functions in addition to the active ingredient.

본 발명의 약학 조성물은 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 이의 혼합물을 포함할 수 있다. 약학적으로 허용가능한 담체는 조성물을 생체 내에 전달하는데 적합한 것이면 모두 사용할 수 있다. 구체적으로, 상기 담체는 Merck Index, 13th ed., Merck & Co. Inc.에 기재된 화합물, 식염수, 멸균수, 링거액, 덱스트로스 용액, 말토덱스트린 용액, 글리세롤, 에탄올 또는 이의 혼합물일 수 있다. 또한, 필요에 따라 항산화제, 완충액, 정균제 등과 같은 통상의 첨가제를 첨가할 수 있다.The pharmaceutical compositions of the present invention may comprise carriers, diluents, excipients or mixtures thereof conventionally used in biological preparations. Pharmaceutically acceptable carriers can be used as long as they are suitable for delivery of the composition in vivo. Specifically, the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol or mixtures thereof. In addition, conventional additives such as antioxidants, buffers, bacteriostatics, etc. may be added as necessary.

상기 조성물을 제제화하는 경우, 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 첨가할 수 있다.When formulating the composition, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used may be added.

본 발명의 조성물은 경구용 제제 또는 비경구용 제제로 제형화될 수 있다. 경구용 제제로는 고형 제제 및 액상 제제가 포함될 수 있다. 상기 고형 제제는 정제, 환제, 산제, 과립제, 캡슐제 또는 트로키제일 수 있고, 이러한 고형 제제는 상기 조성물에 적어도 하나 이상의 부형제를 첨가하여 조제할 수 있다. 상기 부형제는 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 또는 이의 혼합물일 수 있다. 또한, 상기 고형 제제는 윤활제를 포함할 수 있고, 그 예로는 마그네슘 스티레이트, 탈크등이 있다. 한편, 상기 액상 제제는 현탁제, 내용액제, 유제 또는 시럽제일 수 있다. 이때, 상기 액상 제제에는 습윤제, 감미제, 방향제, 보존제 등과 같은 부형제가 포함될 수 있다.The composition of the present invention may be formulated as an oral or parenteral preparation. Oral formulations may include solid and liquid formulations. The solid preparation may be a tablet, pill, powder, granule, capsule or troche, and such solid preparation may be prepared by adding at least one excipient to the composition. The excipient may be starch, calcium carbonate, sucrose, lactose, gelatin or mixtures thereof. In addition, the solid preparation may include a lubricant, for example magnesium styrate, talc and the like. On the other hand, the liquid formulation may be a suspension, a liquid solution, an emulsion or a syrup. At this time, the liquid formulation may include excipients such as wetting agents, sweeteners, fragrances, preservatives and the like.

상기 비경구용 제제는 주사제, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 파우더 및 크림 등을 포함할 수 있다. 상기 주사제는 멸균된 수용액, 비수성용제, 현탁용제, 유제 등을 포함할 수 있다. 이때, 비수성용제 또는 현탁용제로서는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름이나, 에틸올레이트와 같이 주사가능한 에스테르 등이 사용될 수 있다.The parenteral preparations may include injections, suppositories, respiratory inhalation powders, spray aerosols, powders and creams, and the like. The injection may include a sterile aqueous solution, a non-aqueous solvent, a suspension solvent, an emulsion, and the like. In this case, as the non-aqueous solvent or the suspension solvent, vegetable oil such as propylene glycol, polyethylene glycol, olive oil, or injectable ester such as ethyl oleate may be used.

본 발명의 조성물은 목적하는 방법에 따라 경구 또는 비경구로 투여될 수 있다. 비경구 투여는 복강내, 직장내, 피하, 정맥, 근육내 또는 흉부내 주사 방식을 포함할 수 있다.The composition of the present invention can be administered orally or parenterally according to the desired method. Parenteral administration can include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection modes.

상기 조성물은 약학적으로 유효한 양으로 투여될 수 있다. 이는 질환의 종류, 중증도, 약물의 활성, 약물에 대한 환자의 민감도, 투여 시간, 투여 경로, 치료기간, 동시에 사용되는 약물 등에 따라 달라질 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 약학 조성물에 포함되는 유효성분의 양은 0.0001 내지 100 ㎎/㎏, 구체적으로 0.001 내지 10 ㎎/㎏일 수 있다. 상기 투여는 하루에 1회 내지 수회일 수 있다.The composition may be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, the severity, the activity of the drug, the patient's sensitivity to the drug, the time of administration, the route of administration, the duration of treatment, the drug being used simultaneously, and the like. However, for the desired effect, the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 100 mg / kg, specifically 0.001 to 10 mg / kg. The administration can be from one to several times a day.

본 발명의 조성물은 단독 또는 다른 치료제와 병용하여 투여될 수 있다. 병용 투여 시, 투여는 순차적 또는 동시일 수 있다. The composition of the present invention may be administered alone or in combination with other therapeutic agents. In combination administration, the administration can be sequential or simultaneous.

또한, 본 발명은 관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 개선용 건강기능식품을 제공한다.The present invention also provides a health functional food for the prevention or improvement of psoriasis containing the sesquiterpene-enriched fraction derived from Kantoin extract as an active ingredient.

상기 관동화 추출물은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 관동화 추출물은 하기의 단계들을 포함하는 제조방법에 의해 제조될 수 있다:The Kanto extract may have the characteristics as described above. In one example, the Kanto extract may be prepared by a manufacturing method comprising the following steps:

1) 관동화(Tussilago farfara)의 꽃봉오리에 추출 용매를 가하여 추출하는 단계; 및1) extracting by adding an extraction solvent to the buds of Tussilago farfara ; And

2) 단계 1)의 추출물을 여과하는 단계.2) filtering the extract of step 1).

상기 세스퀴테르펜 강화 분획은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 세스퀴테르펜 강화 분획은 관동화 추출물로부터 제조될 수 있고, 상기 화학식 1, 2 또는 3으로 표시되는 화합물을 포함할 수 있다.The sesquiterpene enriched fraction may have the characteristics as described above. For example, the sesquiterpene-enriched fraction may be prepared from a Kantoin extract, and may include a compound represented by Chemical Formula 1, 2 or 3.

또한, 상기 화학식 1, 2 또는 3으로 표시되는 화합물은 TG, AECN 또는 ECN일 수 있다.In addition, the compound represented by Formula 1, 2 or 3 may be TG, AECN or ECN.

본 발명의 구체적인 실시예에서, 본 발명자들은 관동화 추출물 유래 세스퀴테르펜 강화 분획(STE)을 제조하고, STE 내 세스퀴테르펜 화합물인 TG, AECN 및 ECN이 함유되어 있음을 확인하였고(도 1 내지 3 참조), STE가 인간 유래 각질세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자의 mRNA 발현을 억제하고, IL-6로 유도된 세포 과증식을 억제하며, 이미퀴모드 유도 건선 마우스 모델에서 임상적 및 조직학적 항건선 효과를 나타냄을 확인하였다(도 4, 및 6 내지 10 참조). 따라서, 본 발명의 세스퀴테르펜 강화 분획은 건선의 예방 또는 개선에 유용하게 사용될 수 있다.In a specific embodiment of the present invention, the present inventors have prepared a sesquiterpene-enriched fraction (STE) derived from a kantoin extract, and confirmed that the sesquiterpene compounds TG, AECN and ECN are contained in STE (FIGS. 1 to 3). STE inhibits mRNA expression of inflammation-related factors increased by TNF-α in HaCaT cells, a human-derived keratinocyte line, inhibits IL-6-induced cell hyperproliferation, and in an imiquimod induced psoriasis mouse model. It was confirmed to exhibit clinical and histological anti-psoriasis effects (see Figures 4, and 6-10). Therefore, the sesquiterpene enriched fraction of the present invention can be usefully used for the prevention or improvement of psoriasis.

또한, 본 발명은 하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 개선용 건강기능식품을 제공한다:The present invention also provides a health functional food for the prevention or improvement of psoriasis containing a compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:

[화학식 I][Formula I]

Figure pat00026
Figure pat00026

(상기 화학식 I에서,(In Formula I,

R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And

R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,

Figure pat00027
, 또는
Figure pat00028
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00027
, or
Figure pat00028
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).

또한, 상기 화학식 I에서,Further, in the formula (I),

상기 R1은 -H, -OH, C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시, 또는 C1-5의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy, or C 1-5 straight or branched alkylcarbonyloxy; And

R2는 C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시,

Figure pat00029
, 또는
Figure pat00030
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-3의 직쇄 또는 분지쇄 알킬일 수 있다.R 2 is C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy,
Figure pat00029
, or
Figure pat00030
Wherein A 1 and A 2 may be independently —H, or C 1-3 linear or branched alkyl.

또한, 상기 화학식 I에서,Further, in the formula (I),

상기 R1은 -H, -OH, 또는

Figure pat00031
이고; 및R 1 is —H, —OH, or
Figure pat00031
ego; And

R2

Figure pat00032
, 또는
Figure pat00033
일 수 있다.R 2 is
Figure pat00032
, or
Figure pat00033
Can be.

또한, 상기 화학식 I로 표시되는 화합물은 하기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물로 이루어진 군으로부터 선택되는 어느 하나의 화합물일 수 있다.In addition, the compound represented by Chemical Formula I may be any one compound selected from the group consisting of compounds represented by the following Chemical Formulas 1, 2, 3, 4 and 5.

[화학식 1][Formula 1]

Figure pat00034
Figure pat00034

[화학식 2][Formula 2]

Figure pat00035
Figure pat00035

[화학식 3][Formula 3]

Figure pat00036
Figure pat00036

[화학식 4][Formula 4]

Figure pat00037
Figure pat00037

[화학식 5][Formula 5]

Figure pat00038
.
Figure pat00038
.

상기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물은 TG, AECN, ECN, TGN 또는 TH7일 수 있다.The compounds represented by Formulas 1, 2, 3, 4, and 5, respectively, may be TG, AECN, ECN, TGN, or TH7.

본 발명의 구체적인 실시예에서, 본 발명자들은 관동화 추출물 유래 세스퀴테르펜 강화 분획(STE)으로부터 세스퀴테르펜 화합물인 TG, AECN 및 ECN을 분리 및 정제하고, TG 및 ECN을 가수분해함으로써 TGN 및 TH7을 제조하였다(도 3 참조).In a specific embodiment of the present invention, the present inventors isolate and purify sesquiterpene compounds TG, AECN and ECN from the sesquiterpene enriched fraction (STE) derived from the Kantoin extract, and TGN and TH7 by hydrolyzing TG and ECN. Prepared (see Figure 3).

또한, TG, AECN, ECN, TGN 및 TH7이 인간 유래 각질세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자의 mRNA 발현을 억제하고, IL-6로 유도된 세포 과증식을 억제함을 확인하였다(도 4 내지 6 참조).It was also confirmed that TG, AECN, ECN, TGN and TH7 inhibit mRNA expression of inflammation-related factors increased by TNF-α and inhibit IL-6-induced cell hyperproliferation in HaCaT cells, human-derived keratinocyte lines. (See FIGS. 4-6).

또한, 본 발명자들은 이미퀴모드 유도 건선 마우스 모델에서 TGN 및 AECN이 임상적 및 조직학적 항건선 효과를 나타냄을 확인하였다(도 7 내지 10 참조).In addition, the inventors have confirmed that TGN and AECN exhibit clinical and histological anti-psoriasis effects in the imiquimod induced psoriasis mouse model (see FIGS. 7-10).

따라서, 본 발명의 세스퀴테르펜 화합물들(TG, AECN, ECN, TGN 및 TH7)은 건선의 예방 또는 개선에 유용하게 사용될 수 있다. Therefore, the sesquiterpene compounds of the present invention (TG, AECN, ECN, TGN and TH7) can be usefully used for the prevention or improvement of psoriasis.

본 명세서의 "건강기능식품"이란 일상 식사에서 결핍되기 쉬운 영양소나 인체에 유용한 기능을 가진 원료나 성분을 사용하여 제조한 식품으로, 인체의 건강을 유지하는데 도움을 주는 식품을 의미하나 이에 한정되지 않으며 통상적인 의미의 건강식품을 모두 포함하는 의미로 사용한다.The "health functional food" of the present specification is a food prepared by using ingredients or ingredients having nutrients or functions useful to the human body that are easily deficient in a daily meal, and means foods that help maintain the health of the human body, but are not limited thereto. It is used in the sense that includes all the health food in the normal sense.

건강기능식품의 형태 및 종류는 특별히 제한되지 않는다. 구체적으로, 상기 건강기능식품은 정제, 캅셀, 분말, 과립, 액상 및 환의 형태일 수 있다. 상기 건강기능식품은 추가성분으로서 여러 가지 향미제, 감미제 또는 천연 탄수화물을 포함할 수 있다. 상기 감미제는 천연 또는 합성 감미제일 수 있고, 천연 감미제의 예로는 타우마틴, 스테비아 추출물 등이 있다. 한편, 합성 감미제의 예로는 사카린, 아스파르탐 등이 있다. 또한, 상기 천연 탄수화물은 모노사카라이드, 디사카라이드, 폴리사카라이드, 올리고당 및 당알코올 등일 수 있다.The form and type of dietary supplement are not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids and pills. The dietary supplement may include various flavors, sweeteners or natural carbohydrates as additional ingredients. The sweetener may be a natural or synthetic sweetener, and examples of the natural sweetener include taumartin, stevia extract, and the like. On the other hand, examples of the synthetic sweeteners include saccharin, aspartame and the like. In addition, the natural carbohydrate may be monosaccharides, disaccharides, polysaccharides, oligosaccharides and sugar alcohols.

본 발명의 건강기능식품은 상기 서술한 추가성분 외에, 영양제, 비타민, 전해질, 풍미제, 착색제, 펙스탄 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올 등을 더 포함할 수 있다. 이러한 성분은 독립적으로 또는 조합으로 사용될 수 있다. 상기 첨가제의 비율은 본 발명의 조성물의 100 중량부당 0.01 내지 0.1 중량부의 범위에서 선택될 수 있다.In addition to the above-mentioned additional ingredients, the health functional food of the present invention is a nutrient, vitamin, electrolyte, flavoring agent, coloring agent, pectane and salts thereof, alginic acid and salts thereof, organic acid, protective colloid thickener, pH adjusting agent, stabilizer, and preservative. , Glycerin, alcohol, and the like may be further included. These components can be used independently or in combination. The proportion of the additive may be selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

본 발명의 세스퀴테르펜 강화 분획 또는 세스퀴테르펜 화합물(TG, AECN, ECN, TGN 및 TH7)은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있다. 이때, 첨가되는 유효성분의 함량은 목적에 따라 결정될 수 있다. 일반적으로, 건강기능식품 중의 함량은 전체 식품 중량의 0.01 내지 90 중량부일 수 있다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없다면 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.The sesquiterpene fortified fractions or sesquiterpene compounds (TG, AECN, ECN, TGN and TH7) of the present invention may be added to foods as is or used in combination with other foods or food ingredients. At this time, the amount of the active ingredient added may be determined according to the purpose. In general, the content in the dietary supplement may be from 0.01 to 90 parts by weight of the total food weight. However, in the case of long-term intake for health and hygiene or health control, the amount may be below the above range, and if there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

또한, 본 발명은 관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 개선용 화장료 조성물을 제공한다.In another aspect, the present invention provides a cosmetic composition for the prevention or improvement of psoriasis containing the sesquiterpene-enhanced fraction derived from Kantoin extract as an active ingredient.

상기 관동화 추출물은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 관동화 추출물은 하기의 단계들을 포함하는 제조방법에 의해 제조될 수 있다:The Kanto extract may have the characteristics as described above. In one example, the Kanto extract may be prepared by a manufacturing method comprising the following steps:

1) 관동화(Tussilago farfara)의 꽃봉오리에 추출 용매를 가하여 추출하는 단계; 및1) extracting by adding an extraction solvent to the buds of Tussilago farfara ; And

2) 단계 1)의 추출물을 여과하는 단계.2) filtering the extract of step 1).

상기 세스퀴테르펜 강화 분획은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 세스퀴테르펜 강화 분획은 관동화 추출물로부터 제조될 수 있고, 상기 화학식 1, 2 또는 3으로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 포함할 수 있다.The sesquiterpene enriched fraction may have the characteristics as described above. In one example, the sesquiterpene fortified fraction may be prepared from a percolating extract, and may include a compound represented by Formula 1, 2 or 3 or a pharmaceutically acceptable salt thereof.

또한, 상기 화학식 1, 2 또는 3으로 표시되는 화합물은 TG, AECN 또는 ECN일 수 있다.In addition, the compound represented by Formula 1, 2 or 3 may be TG, AECN or ECN.

본 발명의 구체적인 실시예에서, 본 발명자들은 관동화 추출물 유래 세스퀴테르펜 강화 분획(STE)을 제조하고, STE 내 세스퀴테르펜 화합물인 TG, AECN 및 ECN이 함유되어 있음을 확인하였고(도 1 내지 3 참조), STE가 인간 유래 각질세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자의 mRNA 발현을 억제하고, IL-6로 유도된 세포 과증식을 억제하며, 이미퀴모드 유도 건선 마우스 모델에서 임상적 및 조직학적 항건선 효과를 나타냄을 확인하였다(도 4, 및 6 내지 10 참조). 따라서, 본 발명의 세스퀴테르펜 강화 분획은 건선의 예방 또는 개선에 유용하게 사용될 수 있다. In a specific embodiment of the present invention, the present inventors have prepared a sesquiterpene-enriched fraction (STE) derived from a kantoin extract, and confirmed that the sesquiterpene compounds TG, AECN and ECN are contained in STE (FIGS. 1 to 3). STE inhibits mRNA expression of inflammation-related factors increased by TNF-α in HaCaT cells, a human-derived keratinocyte line, inhibits IL-6-induced cell hyperproliferation, and in an imiquimod induced psoriasis mouse model. It was confirmed to exhibit clinical and histological anti-psoriasis effects (see Figures 4, and 6-10). Therefore, the sesquiterpene enriched fraction of the present invention can be usefully used for the prevention or improvement of psoriasis.

또한, 본 발명은 하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 개선용 화장료 조성물을 제공한다:The present invention also provides a cosmetic composition for the prevention or improvement of psoriasis containing a compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:

[화학식 I][Formula I]

Figure pat00039
Figure pat00039

(상기 화학식 I에서,(In Formula I,

R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And

R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,

Figure pat00040
, 또는
Figure pat00041
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00040
, or
Figure pat00041
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).

또한, 상기 화학식 I에서,Further, in the formula (I),

상기 R1은 -H, -OH, C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시, 또는 C1-5의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및R 1 is —H, —OH, C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy, or C 1-5 straight or branched alkylcarbonyloxy; And

R2는 C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시,

Figure pat00042
, 또는
Figure pat00043
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-3의 직쇄 또는 분지쇄 알킬일 수 있다.R 2 is C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy,
Figure pat00042
, or
Figure pat00043
Wherein A 1 and A 2 may be independently —H, or C 1-3 linear or branched alkyl.

또한, 상기 화학식 I에서,Further, in the formula (I),

상기 R1은 -H, -OH, 또는

Figure pat00044
이고; 및R 1 is —H, —OH, or
Figure pat00044
ego; And

R2

Figure pat00045
, 또는
Figure pat00046
일 수 있다.R 2 is
Figure pat00045
, or
Figure pat00046
Can be.

또한, 상기 화학식 I로 표시되는 화합물은 하기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물로 이루어진 군으로부터 선택되는 어느 하나의 화합물일 수 있다.In addition, the compound represented by Chemical Formula I may be any one compound selected from the group consisting of compounds represented by the following Chemical Formulas 1, 2, 3, 4 and 5.

[화학식 1][Formula 1]

Figure pat00047
Figure pat00047

[화학식 2][Formula 2]

Figure pat00048
Figure pat00048

[화학식 3][Formula 3]

Figure pat00049
Figure pat00049

[화학식 4][Formula 4]

Figure pat00050
Figure pat00050

[화학식 5][Formula 5]

Figure pat00051
.
Figure pat00051
.

상기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물은 TG, AECN, ECN, TGN 또는 TH7일 수 있다.The compounds represented by Formulas 1, 2, 3, 4, and 5, respectively, may be TG, AECN, ECN, TGN, or TH7.

본 발명의 구체적인 실시예에서, 본 발명자들은 관동화 추출물 유래 세스퀴테르펜 강화 분획(STE)으로부터 세스퀴테르펜 화합물인 TG, AECN 및 ECN을 분리 및 정제하고, TG 및 ECN을 가수분해함으로써 TGN 및 TH7을 제조하였다(도 3 참조).In a specific embodiment of the present invention, the present inventors isolate and purify sesquiterpene compounds TG, AECN and ECN from the sesquiterpene enriched fraction (STE) derived from the Kantoin extract, and TGN and TH7 by hydrolyzing TG and ECN. Prepared (see Figure 3).

또한, TG, AECN, ECN, TGN 및 TH7이 인간 유래 각질세포주인 HaCaT 세포에서 TNF-α에 의해 증가된 염증 관련 인자의 mRNA 발현을 억제하고, IL-6로 유도된 세포 과증식을 억제함을 확인하였다(도 4 내지 6 참조).It was also confirmed that TG, AECN, ECN, TGN and TH7 inhibit mRNA expression of inflammation-related factors increased by TNF-α and inhibit IL-6-induced cell hyperproliferation in HaCaT cells, human-derived keratinocyte lines. (See FIGS. 4-6).

또한, 본 발명자들은 이미퀴모드 유도 건선 마우스 모델에서 TGN 및 AECN이 임상적 및 조직학적 항건선 효과를 나타냄을 확인하였다(도 7 내지 10 참조).In addition, the inventors have confirmed that TGN and AECN exhibit clinical and histological anti-psoriasis effects in the imiquimod induced psoriasis mouse model (see FIGS. 7-10).

따라서, 본 발명의 세스퀴테르펜 화합물들(TG, AECN, ECN, TGN 및 TH7)은 건선의 예방 또는 개선에 유용하게 사용될 수 있다. Therefore, the sesquiterpene compounds of the present invention (TG, AECN, ECN, TGN and TH7) can be usefully used for the prevention or improvement of psoriasis.

본 발명의 화장료 조성물은 상기 화합물 이외에 화장료 조성물에 통상적으로 이용되는 성분들이 포함되며, 예컨대 황산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다.The cosmetic composition of the present invention includes components commonly used in cosmetic compositions in addition to the above compounds, and includes conventional auxiliaries such as sulfates, stabilizers, solubilizers, vitamins, pigments and flavors, and carriers.

본 발명의 화장료 조성물에 있어서, 통상적으로 함유되는 화장료 조성물에 본 발명의 화합물은 0.1 내지 50중량%, 바람직하게는 1 내지 10 중량%의 양으로 첨가되는 것이 일반적이나 상기 비율은 본 발명의 화장품의 제조되는 형태에 따라 또 그것의 구체적인 적용 부위(얼굴이나 손)나 그것의 적용용량에 따라 달라지는 것이므로, 이에 한정되지 않는다.In the cosmetic composition of the present invention, the compound of the present invention is generally added to the cosmetic composition contained in an amount of 0.1 to 50% by weight, preferably 1 to 10% by weight, but the ratio of the cosmetic composition of the present invention Depending on the form to be manufactured and its specific application site (face or hand) or its application dose, it is not limited thereto.

본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액(무수 및 수계), 무수 생성물(오일 및 글리콜계), 유탁액, 페이스트, 젤, 마스크, 팩, 분말, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수(스킨), 영양 화장수(밀크로션), 영양 크림, 맛사지 크림, 에센스, 아이크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.Cosmetic compositions of the present invention may be prepared in any formulation conventionally prepared in the art, for example solutions, suspensions (anhydrous and aqueous), anhydrous products (oil and glycols), emulsions, pastes, gels , Masks, packs, powders, creams, lotions, powders, soaps, surfactant-containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, sprays, and the like, but are not limited thereto. More specifically, it may be prepared in the form of a flexible lotion (skin), nutrition lotion (milk lotion), nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder .

본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성 유, 식물성 유, 왁스, 파라핀, 전분, 트라가칸타, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanta, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide are used as carrier components. Can be.

본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellant such as butane or dimethyl ether.

본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.

본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라가칸타 등이 이용될 수 있다.When the formulation of the present invention is a suspension, liquid carrier diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, and microcrystals are used as carrier components. Soluble cellulose, aluminum metahydroxy, bentonite, agar or tragacanta and the like can be used.

본 발명의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is a surfactant-containing cleansing, the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, an isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide. Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

본 발명의 비누 조성물은 첨가제로서 피부 보습제, 유화제, 경수연화제 등을 포함하여 제조될 수 있으며, 상기 비누의 기재로서는 야자유, 팜유, 대두유, 올리브유, 팜핵유, 호오바유 등의 식물유지나 우지, 돈지, 양지, 어유 등의 동물 유지가 사용될 수 있고, 보습제로서는 글리세린, 데티프리톨, 프로필렌글리콜, 부틸렌글리콜, 헥실 글리콜, 이소프로필미리스테이트, 알로에베라, 솔비톨 등이 사용될 수 있으며, 유화제로서 천연오일, 왁스, 탄화수소류 등이 사용 가능하며, 경수 연화제로서는 테트라소듐 이디티에이 등이 사용될 수 있으나 이에 한정되지 않는다.The soap composition of the present invention may be prepared by including a skin moisturizer, an emulsifier, a water softener and the like as an additive, and as the base material of the soap, vegetable oils such as palm oil, palm oil, soybean oil, olive oil, palm kernel oil, hoova oil, pork fat Animal fats, oil, fish oil, etc. may be used, and as a moisturizing agent, glycerin, defototol, propylene glycol, butylene glycol, hexyl glycol, isopropyl myristate, aloe vera, sorbitol, and the like may be used. , Waxes, hydrocarbons, and the like may be used, and tetrasodium ethane may be used as the hard water softener, but is not limited thereto.

본 발명의 비누 조성물은 첨가제로서 항균제, 거품억제제, 용매, 부식방지제, 향료, 색소, 금속이온 봉쇄제, 방부제 등을 추가적으로 포함할 수 있다. The soap composition of the present invention may further include an antimicrobial agent, antifoaming agent, solvent, corrosion inhibitor, fragrance, pigment, metal ion sequestrant, preservative and the like.

이하 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해서 한정되는 것은 아니다.However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

관동화 추출액의 제조Preparation of Kanto Extract

관동화(Tussilago farfara)의 건조된 꽃봉오리(옴니허브, 대한민국) 1 kg을 분쇄하고, 45% 아세토니트릴 3 L에 넣어 1시간 동안 초음파 처리하여 추출하였다. 이후, 2 L의 45% 아세토니트릴에서 상기 추출과정을 동일하게 2번 더 반복하였다. 추출액을 여과지(Advantec, 일본)로 여과하여 여액을 모두 모은 후, 세스퀴테르펜 강화 분획 제조에 사용하였다.1 kg of dried buds of the Kanto ( Tussilago farfara ) (Omni Herb, South Korea) was ground, and extracted by sonication for 1 hour in 3 L of 45% acetonitrile. Thereafter, the extraction process was repeated two more times in 2 L of 45% acetonitrile. The extract was filtered through filter paper (Advantec, Japan), and the filtrates were collected and used to prepare sesquiterpene enriched fractions.

관동화 추출액으로부터 세스퀴테르펜 강화 분획의 제조Preparation of Sesquiterpene-Enriched Fractions from Kantoin Extracts

상기 실시예 1에서 제조한 관동화 추출액을 이용하여 CCC-DCI(counter-current chromatography-direct and continuous injection) 분획을 수행하였다(도 1).The counter-current chromatography-direct and continuous injection (CCC-DCI) fractions were performed using the Kantoin extract prepared in Example 1 (FIG. 1).

구체적으로, CCC-DCI 분획은 예비 CCC 기기(TBE-1000A, Tauto Biotech, 중국)를 이용하여 4 단계로 수행하였으며, 용매는 n-헥산-아세토니트릴-물을 사용하였다. 먼저, 다층 코일 컬럼(multi-layered coiled column)을 고정상을 형성하기 위한 n-헥산으로 충진하고, 기기를 450 rpm에서 회전시켜 관동화 추출액(5.4 L)을 컬럼 끝 방향으로 펌핑하여(유속: 15 ㎖/분), 극성 물질들이 씻겨져 나가도록 하였다(단계 1; 직접적 주입(direct injection)). 이후, 상기 추출액을 컬럼에 지속적으로 주입하였고, 코일 컬럼의 꼬리 유출부(tail outlet)와 UV 검출기를 연결함으로써, 용출액을 지속적으로 모니터링하였다. UV 검출은 235 nm 및 최대 2.5 흡광 단위(absorbance units)에서 수행하였다. 본 단계에서 표적 물질 및 비교적 덜 극성인 물질들이 고정상에 농축되었고, 극성 불순물은 컬럼을 통해 빠져나가도록 하였다(단계 2; 지속적 주입(continuous injection)). 상기 단계 1 및 2에서 모든 추출액이 주입되기 위해 약 360분이 소요되었다. 다음 단계로, 모든 추출액이 CCC 기기에 주입된 후, 순수 45% 아세토니트릴을 컬럼의 머리 부분으로 주입하여 남은 극성 불순물을 완전히 제거하였다(단계 3; 극성 물질의 세척(washing polar components)). 마지막으로, UV 신호가 감소하기 시작함에 따라, 100% 아세토니트릴을 CCC 기기로 주입하였다. 430-490분 구간에서 용출되는 분획을 수득하여 세스퀴테르펜 강화 분획(sesquiterpenoids enriched fraction, STE)으로 명명하였다(단계 4; 표적 화합물의 용출(eluting target components)). 상기 분획 과정은 약 500분이 소요되었고, 최종적으로 관동화 추출액 5.4 L(관동화 추출물 함량: 315.9 g)로부터 STE 6.8 g을 수득하였다(도 2).Specifically, the CCC-DCI fraction was performed in four steps using a preliminary CCC instrument (TBE-1000A, Tauto Biotech, China), and the solvent was n-hexane-acetonitrile-water. First, a multi-layered coiled column was filled with n-hexane to form a stationary phase, and the instrument was rotated at 450 rpm to pump the tubular extract (5.4 L) towards the column end (flow rate: 15 ml). Per minute), allowing the polar material to be washed away (step 1; direct injection). Thereafter, the extract was continuously injected into the column, and the eluate was continuously monitored by connecting a tail outlet of the coil column and a UV detector. UV detection was performed at 235 nm and up to 2.5 absorbance units. In this step the target material and relatively less polar materials were concentrated in the stationary phase and the polar impurities were allowed to exit through the column (step 2; continuous injection). It took about 360 minutes for all the extracts to be injected in steps 1 and 2 above. In the next step, after all the extracts were injected into the CCC instrument, pure 45% acetonitrile was injected into the head of the column to completely remove the remaining polar impurities (step 3; washing polar components). Finally, as the UV signal began to decrease, 100% acetonitrile was injected into the CCC instrument. The fraction eluting in the 430-490 minute interval was obtained and named sesquiterpenoids enriched fraction (STE) (step 4; eluting target components). The fractionation process took about 500 minutes, and finally, 6.8 g of STE was obtained from 5.4 L (Kantok extract content: 315.9 g) of the Kanto Extract (FIG. 2).

STE로부터 세스퀴테르펜 화합물 TG, ECN 및 AECN의 분리Isolation of Sesquiterpene Compounds TG, ECN and AECN from STE

CCC를 수행하여 상기 실시예 2에서 제조한 STE로부터 세스퀴테르펜 화합물 TG(tussilagone), ECN(7β-(3-ethyl cis-crotonoyloxy)-1α-(2-methylbutyryloxy)-3,14-dehydro-Z-notonipetranone) 및 AECN(14-acetoxy-7β-(3'-ethyl cis-crotonoyloxy)-1α-(2'-methylbutyryloxy)-notonipetranone)을 분리하였다.CCS was carried out from the STE prepared in Example 2 sesquiterpene compounds TG (tussilagone), ECN (7β- (3-ethyl cis-crotonoyloxy) -1α- (2-methylbutyryloxy) -3,14-dehydro-Z -notonipetranone) and AECN (14-acetoxy-7β- (3'-ethyl cis-crotonoyloxy) -1α- (2'-methylbutyryloxy) -notonipetranone) were isolated.

구체적으로, 60 ㎖ 샘플 루프(sample loop)가 구비된 HSCCC(high speed CCC, TBE-100A, Tauto Biotech) 기기를 사용하였다. 먼저, n-헥산을 고정상으로 HSCCC에 충진한 후, 기기를 450 rpm에서 회전시키고, STE 3 g을 65% 아세토니트릴 60 ㎖에 용해하여 샘플 루프에 주입하였다. 샘플 용액은 6개의 주입 밸브(six-port injection valve)로 주입되었고, 이동상(65% 아세토니트릴)은 5 ㎖/분의 유속으로 컬럼의 머리 부분으로 직접 주입되었다. 이동상은 물을 A, 아세토니트릴을 B로 하여, 0-300분 동안에는 65-100% B, 300-400분 동안에는 100% B로 흘려주었다. 고정상 머무름(stationary phase retention)은 컬럼의 내용물(contents)을 가압된 질소 가스와 함께 컬럼을 통과하게 하여 수득함으로써 측정되었다. 수득한 3종 세스퀴테르펜 화합물들은 1H NMR 및 13C NMR 분석을 통하여 TG, ECN 및 AECN으로 확인되었다. TG는 110-130분 구간에서 320 ㎎을, ECN은 150-175분 구간에서 1,350 ㎎, AECN은 330-350분 구간에서 290 ㎎을 수득하였고, 예비 고성능 액체 크로마토그래피(high performance liquid chromatography, HPLC)로 더 정제하였다. Specifically, a HSCCC (high speed CCC, TBE-100A, Tauto Biotech) instrument equipped with a 60 ml sample loop was used. First, n-hexane was charged into HSCCC as a stationary phase, then the instrument was rotated at 450 rpm, and 3 g of STE was dissolved in 60 ml of 65% acetonitrile and injected into the sample loop. Sample solution was injected with six six-port injection valves and mobile phase (65% acetonitrile) was injected directly into the head of the column at a flow rate of 5 ml / min. The mobile phase flowed water to A, acetonitrile to B, 65-100% B for 0-300 minutes and 100% B for 300-400 minutes. Stationary phase retention was measured by obtaining the contents of the column through the column with pressurized nitrogen gas. The three sesquiterpene compounds obtained were identified as TG, ECN and AECN by 1 H NMR and 13 C NMR analysis. TG obtained 320 mg in 110-130 minutes, ECN in 1150 mg in 150-175 minutes, AECN in 330 mg in 330-350 minutes, and preparative high performance liquid chromatography (HPLC). Further purified.

TG 및 ECN의 가수분해를 통한 TGN 및 TH7의 제조Preparation of TGN and TH7 by Hydrolysis of TG and ECN

상기 실시예 3에서 분리 및 정제한 TG 및 ECN을 각각 가수분해하여 TGN(tussilagonone) 및 TH7(7β-(3'-ethyl cis-crotonoyloxy)-1α-hydroxy-3,14-dehydro-Z-notonipetranone)을 제조하였다.Hydrolyzed TG and ECN isolated and purified in Example 3, respectively, TGN (tussilagonone) and TH7 (7β- (3'-ethyl cis-crotonoyloxy) -1α-hydroxy-3,14-dehydro-Z-notonipetranone) Was prepared.

구체적으로, TG 및 ECN 각 500 mg을 100 ㎖의 80% 아세토니트릴 수용액에 용해시키고 수산화나트륨 400 mg을 첨가하여 수산화나트륨의 최종 농도가 0.1 M이 되도록 혼합하였고, TG가 용해된 용액은 20℃에서, ECN이 용해된 용액은 40℃에서 각각 교반하였다. 각 용액에 20 ㎖의 메틸렌 클로라이드(CH2Cl2) 및 10 ㎖의 물을 첨가하여 혼합하고, 원심분리하여 층을 분리시킨 후, 상부의 수층을 제거하였다. 상기 각 용액에 10 ㎖의 물을 다시 첨가하여 마찬가지로 수층을 제거하는 과정을 2번 반복하였다. 잔여 유기용매층을 건조하여 얻어진 시료를 이용하여 상기 실시예 3에 기재된 것과 동일한 CCC를 수행하여 2종 세스퀴테르펜 화합물을 분리하였다. 수득한 2종 세스퀴테르펜 화합물들은 1H NMR 및 13C NMR 분석을 통하여 TGN 및 TH7로 확인되었고, TGN는 140-160분 구간에서 190 ㎎을, TH7은 125-145분 구간에서 150 ㎎을 수득하였다.Specifically, 500 mg of each TG and ECN were dissolved in 100 ml of 80% acetonitrile aqueous solution, and 400 mg of sodium hydroxide was added so that the final concentration of sodium hydroxide was 0.1 M, and the solution containing TG was dissolved at 20 ° C. And the solution in which ECN was dissolved were stirred at 40 ° C. 20 ml of methylene chloride (CH 2 Cl 2 ) and 10 ml of water were added to each solution, mixed, centrifuged to separate the layers, and the upper aqueous layer was removed. 10 ml of water was added to each of the solutions, and the process of removing the aqueous layer was repeated twice. Two kinds of sesquiterpene compounds were separated by performing the same CCC as described in Example 3 using a sample obtained by drying the residual organic solvent layer. The two sesquiterpene compounds obtained were identified as TGN and TH7 by 1 H NMR and 13 C NMR analysis, TGN obtained 190 mg in 140-160 minutes and TH7 obtained 150 mg in 125-145 minutes. It was.

HPLC 분석을 이용한 STE 내 세스퀴테르펜 화합물들의 존재 검증Validation of Sesquiterpene Compounds in STE Using HPLC Analysis

상기 실시예 2에서 수득한 STE 내 TG, ECN 및 AECN의 존재를 HPLC 분석으로 검증하였다.The presence of TG, ECN and AECN in STE obtained in Example 2 was verified by HPLC analysis.

구체적으로, HPLC 펌프(Hitachi L-6200 HPLC pump, Hitachi Chemical, 일본), UV 검출기(Spectra-100 UV detector, Spectra-Physics, 미국), 인젝터(SIL-9A auto injector, Shimadzu, 일본), 및 C18 컬럼(Phenomenex Luna C18 column, 150 mm ×4.6 mm, 입자 크기 5 ㎛, Phenomenex, 미국)을 사용하여 HPLC 분석을 수행하였다. 이동상은 물을 A, 아세토니트릴을 B로 하여, 0-3분 동안에는 60-75% B, 3-28분 동안에는 75-100% B, 28-33분 동안에는 100% B로 흘려준 후, 0.9 ㎖/분의 유속으로 10분 동안 60% B를 흘려주어 평형화하였다. 컬럼은 상온으로 유지하고, UV 검출은 235 nm에서 수행하였다. STE 3 ㎎을 메탄올 1 ㎖에서 10분 동안 초음파 처리하여 용해하였고, 0.45 ㎛ 막으로 여과시켜 준비하였고, 실시예 3에서 분리 및 정제한 TG, ECN 및 AECN을 메탄올에 용해하여 62.5, 125, 250, 500 및 1000 ㎍/㎖ 농도로 준비하여 표준용액으로 사용하였다. 각 시료를 5 ㎕씩 주입하여 시료 당 3회 씩 반복하여 HPLC 분석을 수행하였다.Specifically, HPLC pumps (Hitachi L-6200 HPLC pump, Hitachi Chemical, Japan), UV detectors (Spectra-100 UV detector, Spectra-Physics, USA), injectors (SIL-9A auto injector, Shimadzu, Japan), and C HPLC analysis was performed using a 18 column (Phenomenex Luna C 18 column, 150 mm × 4.6 mm, particle size 5 μm, Phenomenex, USA). Mobile phase is water with A, acetonitrile B, 60-75% B for 0-3 minutes, 75-100% B for 3-28 minutes, 100% B for 28-33 minutes, 0.9 mL Equilibration was performed by flowing 60% B for 10 minutes at a flow rate of / min. The column was kept at room temperature and UV detection was performed at 235 nm. 3 mg of STE was dissolved by sonication in 1 ml of methanol for 10 minutes, prepared by filtration with a 0.45 μm membrane, and TG, ECN and AECN isolated and purified in Example 3 were dissolved in methanol to give 62.5, 125, 250, 500 and 1000 μg / ml were prepared and used as standard solutions. 5 μl of each sample was injected and repeated 3 times per sample to perform HPLC analysis.

그 결과, STE의 HPLC 크로마토그램에서 TG, ECN 및 AECN의 피크가 뚜렷하게 검출됨을 확인하였다(도 3).As a result, it was confirmed that peaks of TG, ECN and AECN were clearly detected in HPLC chromatogram of STE (FIG. 3).

실험예 1. STE 또는 세스퀴테르펜 화합물 처리에 따른 HaCaT 세포에서 염증 관련 인자의 mRNA 발현 억제 효과 확인Experimental Example 1. Confirmation of the inhibitory effect of inflammation-related factors mRNA expression in HaCaT cells by treatment with STE or sesquiterpene compounds

인간 유래 각질 세포주인 HaCaT 세포에서 TNF-α(tumor necrosis factor-α) 처리에 의해 증가한 염증 관련 인자들의 mRNA 발현을 STE 또는 세스퀴테르펜 화합물들(TGN, AECN, TG, ECN 및 TH7)이 억제할 수 있는지 여부를 정량적 실시간 역전사 중합효소 연쇄 반응(quantitative real-time reverse transcriptase polymerase chain reaction, qRT-PCR)으로 확인하였다.STE or sesquiterpene compounds (TGN, AECN, TG, ECN and TH7) may inhibit mRNA expression of increased inflammation-related factors by TNF-α treatment in HaCaT cells, a human-derived keratinocyte line. Whether or not it can be confirmed by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR).

구체적으로, HaCaT 세포주는 독일 암 연구소의 Norbert E. Fusenig 박사로부터 입수하였고, 배양 배지로 15% 말 혈청(horse serum), 10% 소태아혈청(fetal bovine serum, FBS) 및 항생제(100 unit/㎖의 페니실린(penicillin) 및 100 ㎍/㎖의 스트렙토마이신(streptomycin))가 포함된 DMEM(Dulbecco’Eagle’배지를 사용하였다. 시료는 실시예 2에서 제조한 STE, 실시예 3에서 분리 및 정제한 TG, ECN 및 AECN, 및 실시예 4에서 분리한 TGN 및 TH7을 사용하였다. HaCaT 세포를 6-웰 플레이트에 1 ×106 개/웰로 배양하고, STE 0.5 ㎍/㎖, TG 10 μM, ECN 2.5 μM, TH7 2.5 μM, TGN 2.5, 5, 10 μM, AECN 0.625, 1.25, 또는 2.5 μM을 세포에 처리한 후, 1시간 뒤에 TNF-α 25 ng/㎖을 처리하여 6시간 동안 더 배양하였다. 이후, 세포를 회수하여 TRIzol 시약(Invitrogen, 미국)을 이용하여 제조사의 설명서에 따라 총 RNA를 추출하였다. 분리된 RNA를 정량한 뒤, 상보적 DNA(complementary DNA, cDNA) 합성 키트(iScriptTM cDNA synthesis kit, Bio-rad, 미국)를 사용하여 25℃에서 5분, 42℃에서 30분, 85℃에서 5분 동안 반응시켜 cDNA를 합성하였다. 합성된 cDNA, 하기 표 1의 프라이머쌍들(Bioneer, 대한민국), 및 SYBR 그린 용액(iTaqTM Universal SYBR Green Supermix, Bio-rad)을 이용하여 40 사이클 수준으로 qRT-PCR을 수행하였다(Applied Biosystems Prism 7300 Real-Time PCR, Applied Biosystems, 미국).Specifically, HaCaT cell line was obtained from Dr. Norbert E. Fusenig of the German Cancer Institute, and cultured medium with 15% horse serum, 10% fetal bovine serum (FBS) and antibiotics (100 unit / ml). DMEM (Dulbecco'Eagle 'medium) containing penicillin and 100 μg / ml of streptomycin was used. , ECN and AECN, and TGN and TH7 isolated in Example 4. HaCaT cells were incubated at 1 × 10 6 / well in 6 -well plates, STE 0.5 μg / ml, TG 10 μM, ECN 2.5 μM , TH7 2.5 μM, TGN 2.5, 5, 10 μM, AECN 0.625, 1.25, or 2.5 μM were treated with the cells, followed by further incubation for 6 hours by treatment with TNF-α 25 ng / ml after 1 hour. Cells were harvested and total RNA was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. , 5 min at 25 ℃ using a complementary DNA (complementary DNA, cDNA) synthesis kit (iScript TM cDNA synthesis kit, Bio-rad, USA), for 30 minutes at 42 ℃, is reacted at 85 ℃ for 5 minutes, cDNA QRT-PCR was performed at the level of 40 cycles using the synthesized cDNA, primer pairs of Table 1 (Bioneer, South Korea), and SYBR Green solution (iTaq Universal SYBR Green Supermix, Bio-rad) ( Applied Biosystems Prism 7300 Real-Time PCR, Applied Biosystems, USA).

프라이머명Primer Name 서열(5'→3')Sequence (5 '→ 3') 서열번호SEQ ID NO: IL-17 ForwardIL-17 Forward GCA ATG AGG ACC CTG AGA GAGCA ATG AGG ACC CTG AGA GA 1One IL-17 ReverseIL-17 Reverse TGG ATG GGG ACA GAG TTC ATTGG ATG GGG ACA GAG TTC AT 22 IL-17A ForwardIL-17A Forward ACT ACA ACC GAT CCA CCT CAACT ACA ACC GAT CCA CCT CA 33 IL-17A ReverseIL-17A Reverse ACT TTG CCT CCC AGA TCA CAACT TTG CCT CCC AGA TCA CA 44 IL-23 ForwardIL-23 Forward CAG CAA CCC TGA GTC CCT AACAG CAA CCC TGA GTC CCT AA 55 IL-23 ReverseIL-23 Reverse TCA ACA TAT GCA GGT CCC ACTCA ACA TAT GCA GGT CCC AC 66 TNF-α ForwardTNF-α Forward TTC TGT CTA CTG AAC TTC GGG GTG ATC GGT CCTTC TGT CTA CTG AAC TTC GGG GTG ATC GGT CC 77 TNF-α ReverseTNF-α Reverse GTA TGA GAT AGC AAA TCG GCT GAC GGT GTG GGGTA TGA GAT AGC AAA TCG GCT GAC GGT GTG GG 88 β-actin Forwardβ-actin Forward CCACGAAACTACCTTCAACTCCCCACGAAACTACCTTCAACTCC 99 β-actin Reverseβ-actin Reverse GTGATCTCCTTCTGCATCCTGTGTGATCTCCTTCTGCATCCTGT 1010

측정된 Ct 값을 베타-액틴(β-actin)에 대한 상대적인 값으로 표준화하여, mRNA 유전자 발현 수준을 분석하였다. 통계학적 분석은 one-way ANOVA를 사용하여 수행하였고, p 값이 0.05 이하인 경우 통계적으로 유의성이 있는 것으로 판단하였다(*p < 0.05, **p < 0.01, ***p < 0.001, ###p < 0.001).MRNA gene expression levels were analyzed by normalizing the measured Ct values relative to beta-actin. Statistical analysis was performed using one-way ANOVA, and it was judged to be statistically significant when the p value was less than 0.05 ( * p <0.05, ** p <0.01, *** p <0.001, ### p <0.001).

그 결과, HaCaT 세포에 TNF-α 처리 시, 염증 관련 인자인 IL-17(interleukin-17), IL-17A, IL-23 및 TNF-α의 mRNA 발현이 유의하게 증가한 반면, STE, TG, ECN, TH7, TGN 또는 AECN을 전처리한 경우, 각 mRNA 발현이 유의하게 감소하였다(도 4 및 5). 이는 STE 또는 세스퀴테르펜 화합물들이 건선의 병변 중 하나인 각질 세포의 염증 반응을 억제할 수 있음을 제시한다.As a result, mRNA expression of IL-17 (interleukin-17), IL-17A, IL-23, and TNF-α, which are inflammation-related factors, was significantly increased in TNF-α treatment in HaCaT cells, whereas STE, TG, ECN Pretreatment with, TH7, TGN or AECN significantly reduced each mRNA expression (FIGS. 4 and 5). This suggests that STE or sesquiterpene compounds can inhibit the inflammatory response of keratinocytes, one of the lesions of psoriasis.

실험예 2. STE 또는 세스퀴테르펜 화합물 처리에 따른 HaCaT 세포의 과증식 억제 효과 확인Experimental Example 2. Confirmation of the hyperproliferation inhibitory effect of HaCaT cells by treatment with STE or sesquiterpene compounds

HaCaT 세포에서 IL-6에 의해 유도된 세포의 과증식을 STE 또는 세스퀴테르펜 화합물들(TGN, AECN, TG, ECN 및 TH7)이 억제할 수 있는지 여부를 MTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) 분석법으로 확인하였다.Whether or not STE or sesquiterpene compounds (TGN, AECN, TG, ECN and TH7) can inhibit IL-6-induced cell proliferation in HaCaT cells, MTT (3- (4,5-dimethylthiazol- 2-yl) -2,5-diphenyltetrazolium bromide) assay.

구체적으로, HaCaT 세포를 24-웰 플레이트에 1.5 ×105 개/웰로 접종하고, 37℃ 및 5% 이산화탄소 조건 하에서 24시간 동안 배양하였다. 이후, 배지를 무혈청 배지로 교체한 후, 12 내지 24시간을 더 배양하여 G0/G1 상의 세포주기로 평형화시켰다. 세포에 STE 0.125, 0.25 또는 0.5 ㎍/㎖, TG 2.5, 5 또는 10 μM, ECN 0.625, 1.25 또는 2.5 μM, TH7 0.625, 1.25 또는 2.5 μM, TGN 2.5, 5 또는 10 μM, 또는 AECN 0.625, 1.25 또는 2.5 μM을 처리한 후, IL-6 25 ng/㎖을 처리하여 24시간 동안 더 배양하였다. 반응이 종료된 후 각 웰에 0.5 ㎎/㎖의 MTT 용액을 첨가하여 2시간 동안 배양한 후, 배지를 제거하고, 형성된 포르마잔(formazan)을 용해하기 위하여, DMSO를 웰 당 500 ㎕씩 첨가하여 쉐이커 위에서 5분간 흔들어 주었다. 이후, ELISA 리더를 이용하여 595 nm에서 흡광도를 측정하여, 약물이 처리되지 않은 대조군의 흡광도를 기준으로 한 세포 증식율(%)을 계산하였다. 통계학적 분석은 상기 실험예 1에 기재된 것과 동일한 방법으로 수행하였다.Specifically, HaCaT cells were seeded at 1.5 × 10 5 cells / well in 24-well plates and incubated for 24 hours under 37 ° C. and 5% carbon dioxide conditions. Thereafter, the medium was replaced with serum-free medium, followed by further incubation for 12 to 24 hours to equilibrate to the cell cycle on G 0 / G 1 . 0.15, 0.25 or 0.5 μg / ml, TG 2.5, 5 or 10 μM, ECN 0.625, 1.25 or 2.5 μM, TH7 0.625, 1.25 or 2.5 μM, TGN 2.5, 5 or 10 μM, or AECN 0.625, 1.25 or After 2.5 μM treatment, 25 ng / ml of IL-6 was further incubated for 24 hours. After completion of the reaction, 0.5 mg / ml MTT solution was added to each well, followed by incubation for 2 hours, and then, medium was removed, and 500 μl of DMSO was added per well in order to dissolve formazan. Shake for 5 minutes on a shaker. Then, the absorbance was measured at 595 nm using an ELISA reader to calculate the cell proliferation rate (%) based on the absorbance of the drug-free control group. Statistical analysis was performed in the same manner as described in Experimental Example 1.

그 결과, HaCaT 세포에 IL-6 처리 시, 세포의 과증식이 유발되었으나, STE, TG, ECN, TH7, TGN 또는 AECN을 전처리한 경우, 세포 증식율이 감소하였다(도 6). 이는 STE 또는 세스퀴테르펜 화합물들이 건선의 병변 중 하나인 각질 세포의 과증식을 억제할 수 있음을 제시한다.As a result, HaCaT cells induced cell proliferation upon IL-6 treatment, but when STE, TG, ECN, TH7, TGN or AECN was pretreated, cell proliferation was reduced (FIG. 6). This suggests that STE or sesquiterpene compounds can inhibit hyperproliferation of keratinocytes, one of the lesions of psoriasis.

실험예 3. STE 또는 세스퀴테르펜 화합물 투여에 의한 건선 유발 동물 모델에서의 임상적 및 조직학적 항건선 효과 확인Experimental Example 3. Confirmation of clinical and histological anti-psoriasis effect in psoriasis-induced animal model by administration of STE or sesquiterpene compound

상기 실험예 1 및 2에서 확인한 STE 또는 세스퀴테르펜 화합물의 세포 내 항건선 효과를 동물 모델에서 검증하고자, 이미퀴모드(imiquimod)로 유도된 건선 마우스 모델을 이용하여 하기 실험을 수행하였다.In order to verify the intracellular psoriasis effect of the STE or sesquiterpene compounds identified in Experimental Examples 1 and 2 in an animal model, the following experiment was performed using a imiquimod induced psoriasis mouse model.

3-1. 이미퀴모드 유도 건선 마우스 모델 제작 및 실험 일정3-1. Imiquimod induced psoriasis mouse model production and experiment

암컷 BALB/c 마우스(8-10주령)의 등 털을 제모크림(Veet®, Oxy Reckitt Benckiser, 프랑스)을 이용하여 제모하고, 2일 후, 등 피부 1 cm2 면적 부위 및 오른쪽 귀의 양면에 TGN, AECN, STE 또는 칼시포트리올(calcipotriol, CAL, Cayman, 미국)을 국소로 도포하였다. STE는 0.1 ㎎을 에탄올 100 ㎕에 용해하고, TGN, AECN 또는 CAL은 100 nmol을 에탄올 100 ㎕에 용해하여 투여하였다. 1시간 후 5% 이미퀴모드 크림(AldaraTM, 3M Pharmaceuticals, 미국)을 6일 동안 매일 등 피부에 62.5 ㎎씩 도포하였고, 대조군 마우스에는 이미퀴모드 크림 대신 바세린 크림을 동일하게 도포하였으며, 이미퀴모드 크림을 마지막으로 도포한 다음 날에 마우스를 희생시켰다(도 7).The back hairs of female BALB / c mice (8-10 weeks old) are depilated using hair removal cream (Veet ® , Oxy Reckitt Benckiser, France), and after 2 days, TGN on the back 1 cm 2 area of the back skin and on both sides of the right ear , AECN, STE or calcipotriol (Calcipotriol, CAL, Cayman, USA) were applied topically. 0.1 mg of STE was dissolved in 100 μl of ethanol, and TGN, AECN or CAL was administered by dissolving 100 nmol in 100 μl of ethanol. After 1 hour, 5% imiquimod cream (Aldara , 3M Pharmaceuticals, USA) was applied 62.5 mg daily to the back skin for 6 days, and control mice received the same application of petrolatum cream instead of imiquimod cream. Mice were sacrificed the day after the last application of mod cream (FIG. 7).

3-2. STE 또는 세스퀴테르펜 화합물의 임상적 항건선 효과 확인3-2. Confirmation of Clinical Anti-Psoriasis Effects of STE or Sesquiterpene Compounds

TGN, AECN 또는 STE의 임상적 항건선 효과를 확인하고자, 상기 실험예 3-1의 마우스 모델의 등 피부의 두께, 홍반(erythema) 및 인설(scales)을 측정하여 0 내지 4점 척도를 기준으로 평가하였고(0: 없음, 1: 약함, 2: 보통, 3: 두드러짐, 및 4: 매우 두드러짐), 귀의 홍반을 상기와 같은 기준으로 평가하였으며, 귀의 두께를 측정하여 mm 단위로 나타내었다. 통계학적 분석은 상기 실험예 1에 기재된 것과 동일한 방법으로 수행하였다.To determine the clinical anti-psoriasis effect of TGN, AECN or STE, the thickness of the back skin, erythema and scales of the mouse model of Experimental Example 3-1 were measured and based on a 0-4 point scale. (0: none, 1: weak, 2: moderate, 3: outstanding, and 4: very pronounced), erythema of the ear was evaluated according to the above criteria, and the thickness of the ear was measured and expressed in mm. Statistical analysis was performed in the same manner as described in Experimental Example 1.

그 결과, 이미퀴모드 크림 도포 군은 대조군에 비하여 등 피부 두께, 홍반 및 인설, 귀 두께 및 홍반이 모두 증가하였으며, TGN, AECN 또는 STE를 전처리한 군은 모두 이미퀴모드 크림 도포 군에 비하여 상기 측정 항목이 모두 감소하였고, 합성 비타민 D 유도체로 건선 치료에 사용되는 양성 대조군인 칼시포트리올 도포 군과 유사하거나 보다 더 우수한 효과를 보였다(도 8 및 9).As a result, the imiquimod cream application group increased the skin thickness, erythema and tear, ear thickness and erythema as compared to the control group, and all the groups pretreated with TGN, AECN or STE were compared with the imiquimod cream application group. All of the measured items were reduced, and the synthetic vitamin D derivatives showed a similar or better effect than the calcipotriol applied group, a positive control group used for treating psoriasis (FIGS. 8 and 9).

3-3. STE 또는 세스퀴테르펜 화합물의 조직학적 항건선 효과 확인3-3. Confirmation of Histological Anti-Psoriasis Effects of STE or Sesquiterpene Compounds

TGN, AECN 또는 STE의 조직학적 항건선 효과를 확인하고자, 상기 실험예 3-1에서 희생시킨 마우스의 약물을 도포한 등 피부 1 cm2 면적 부위 조직을 적출하여 포르말린(formalin)에 고정시켰다. 이후, 고정된 조직을 파라핀(paraffin)에 24 내지 36시간 동안 넣어 파라핀 블록을 제작하고, 이를 4 ㎛의 두께로 박리하여 헤마톡실린(hematoxylin) 및 에오신(eosin)으로 조직 염색을 수행하였다. 염색한 조직은 광학 현미경(Olympus CKX41, 일본)으로 사진을 찍어 관찰하였다.In order to confirm the histological anti-psoriasis effect of TGN, AECN or STE, 1 cm 2 area of skin, such as a drug applied to the mice sacrificed in Experimental Example 3-1, was extracted and fixed in formalin. Thereafter, the immobilized tissue was placed in paraffin for 24 to 36 hours to prepare a paraffin block, which was peeled to a thickness of 4 μm, and tissue staining was performed with hematoxylin and eosin. The stained tissue was observed by photographing with an optical microscope (Olympus CKX41, Japan).

그 결과, 이미퀴모드 크림 도포 군은 대조군에 비하여 표피 두께가 증가된 반면, TGN, AECN 또는 STE를 전처리한 군에서는 모두 이미퀴모드 크림 도포 군에 비하여 표피 두께가 감소하였고, 양성대조군인 칼시포드리올 도포 군과 유사한 정도의 효과를 보였다(도 10).As a result, the imiquimod cream application group had an increased epidermal thickness compared to the control group, whereas the TGN, AECN or STE pretreatment group showed a decrease in epidermal thickness compared to the imiquimod cream application group, and a positive control calcipo. The effect was similar to that of the Driol application group (FIG. 10).

<110> Seoul National University R&DB Foundation <120> Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara <130> 2018P-08-008 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17 Forward <400> 1 gcaatgagga ccctgagaga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17 Reverse <400> 2 tggatgggga cagagttcat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17A Forward <400> 3 actacaaccg atccacctca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17A Reverse <400> 4 actttgcctc ccagatcaca 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-23 Forward <400> 5 cagcaaccct gagtccctaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-23 Reverse <400> 6 tcaacatatg caggtcccac 20 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha Forward <400> 7 ttctgtctac tgaacttcgg ggtgatcggt cc 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha Reverse <400> 8 gtatgagata gcaaatcggc tgacggtgtg gg 32 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Forward <400> 9 ccacgaaact accttcaact cc 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Reverse <400> 10 gtgatctcct tctgcatcct gt 22 <110> Seoul National University R & DB Foundation <120> Composition for preventing or treating psoriasis configuring          sesquiterpenoid compounds or sesquiterpenoids enriched fraction          derived from Tussilago farfara <130> 2018P-08-008 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17 Forward <400> 1 gcaatgagga ccctgagaga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17 Reverse <400> 2 tggatgggga cagagttcat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17A Forward <400> 3 actacaaccg atccacctca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-17A Reverse <400> 4 actttgcctc ccagatcaca 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-23 Forward <400> 5 cagcaaccct gagtccctaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-23 Reverse <400> 6 tcaacatatg caggtcccac 20 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha Forward <400> 7 ttctgtctac tgaacttcgg ggtgatcggt cc 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha Reverse <400> 8 gtatgagata gcaaatcggc tgacggtgtg gg 32 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Forward <400> 9 ccacgaaact accttcaact cc 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Reverse <400> 10 gtgatctcct tctgcatcct gt 22

Claims (19)

관동화 추출물 유래 세스퀴테르펜 강화 분획(sesquiterpenoids enriched fraction)을 유효성분으로 함유하는 건선의 예방 또는 치료용 약학 조성물.
A pharmaceutical composition for the prevention or treatment of psoriasis containing sesquiterpenoids enriched fraction derived from Kantoin extract as an active ingredient.
제1항에 있어서, 상기 세스퀴테르펜 강화 분획은 하기 화학식 1, 2 또는 3으로 표시되는 화합물을 포함하는, 약학 조성물:
[화학식 1]
Figure pat00052

[화학식 2]
Figure pat00053

[화학식 3]
Figure pat00054
.
The pharmaceutical composition of claim 1, wherein the sesquiterpene enriched fraction comprises a compound represented by Formula 1, 2 or 3
[Formula 1]
Figure pat00052

[Formula 2]
Figure pat00053

[Formula 3]
Figure pat00054
.
제1항에 있어서, 상기 세스퀴테르펜 강화 분획은 각질 세포의 염증 반응 또는 과증식(hyperproliferation)을 억제하는, 약학 조성물.
The pharmaceutical composition of claim 1, wherein the sesquiterpene enriched fraction inhibits inflammatory response or hyperproliferation of keratinocytes.
하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 치료용 약학 조성물:
[화학식 I]
Figure pat00055

(상기 화학식 I에서,
R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및
R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,
Figure pat00056
, 또는
Figure pat00057
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).
A pharmaceutical composition for preventing or treating psoriasis containing a compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula I]
Figure pat00055

(In Formula I,
R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And
R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00056
, or
Figure pat00057
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).
제4항에 있어서,
R1은 -H, -OH, C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시, 또는 C1-5의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및
R2는 C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시,
Figure pat00058
, 또는
Figure pat00059
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-3의 직쇄 또는 분지쇄 알킬인, 약학 조성물.
The method of claim 4, wherein
R 1 is —H, —OH, C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy, or C 1-5 straight or branched alkylcarbonyloxy; And
R 2 is C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy,
Figure pat00058
, or
Figure pat00059
Wherein A 1 and A 2 are independently —H, or C 1-3 straight or branched alkyl.
제4항에 있어서,
R1은 -H, -OH, 또는
Figure pat00060
이고; 및
R2
Figure pat00061
, 또는
Figure pat00062
인, 약학 조성물.
The method of claim 4, wherein
R 1 is —H, —OH, or
Figure pat00060
ego; And
R 2 is
Figure pat00061
, or
Figure pat00062
Phosphorus, pharmaceutical composition.
제4항에 있어서,
상기 화학식 I로 표시되는 화합물은 하기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물로 이루어진 군으로부터 선택되는 어느 하나의 화합물인, 약학 조성물:
[화학식 1]
Figure pat00063

[화학식 2]
Figure pat00064

[화학식 3]
Figure pat00065

[화학식 4]
Figure pat00066

[화학식 5]
Figure pat00067
.
The method of claim 4, wherein
The compound represented by the formula (I) is any one compound selected from the group consisting of compounds represented by the following formula (1), (2), (3), (4) and (5),
[Formula 1]
Figure pat00063

[Formula 2]
Figure pat00064

[Formula 3]
Figure pat00065

[Formula 4]
Figure pat00066

[Formula 5]
Figure pat00067
.
제4항에 있어서, 상기 화합물은 각질 세포의 염증 반응 또는 과증식을 억제하는, 약학 조성물.
The pharmaceutical composition of claim 4, wherein the compound inhibits inflammatory response or hyperproliferation of keratinocytes.
관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 개선용 건강기능식품.
Health functional food for the prevention or improvement of psoriasis containing sesquiterpene-enhanced fraction derived from Kwandonghwa extract as an active ingredient.
하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 개선용 건강기능식품:
[화학식 I]
Figure pat00068

(상기 화학식 I에서,
R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및
R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,
Figure pat00069
, 또는
Figure pat00070
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).
Health functional food for the prevention or improvement of psoriasis containing a compound represented by the formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula I]
Figure pat00068

(In Formula I,
R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And
R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00069
, or
Figure pat00070
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).
제10항에 있어서,
R1은 -H, -OH, C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시, 또는 C1-5의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및
R2는 C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시,
Figure pat00071
, 또는
Figure pat00072
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-3의 직쇄 또는 분지쇄 알킬인, 건강기능식품.
The method of claim 10,
R 1 is —H, —OH, C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy, or C 1-5 straight or branched alkylcarbonyloxy; And
R 2 is C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy,
Figure pat00071
, or
Figure pat00072
Wherein A 1 and A 2 are independently —H, or C 1-3 straight or branched chain alkyl.
제10항에 있어서,
R1은 -H, -OH, 또는
Figure pat00073
이고; 및
R2
Figure pat00074
, 또는
Figure pat00075
인, 건강기능식품.
The method of claim 10,
R 1 is —H, —OH, or
Figure pat00073
ego; And
R 2 is
Figure pat00074
, or
Figure pat00075
Phosphorus, dietary supplement.
제10항에 있어서,
상기 화학식 I로 표시되는 화합물은 하기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물로 이루어진 군으로부터 선택되는 어느 하나의 화합물인, 건강기능식품:
[화학식 1]
Figure pat00076

[화학식 2]
Figure pat00077

[화학식 3]
Figure pat00078

[화학식 4]
Figure pat00079

[화학식 5]
Figure pat00080
.
The method of claim 10,
The compound represented by Formula I is any one compound selected from the group consisting of compounds represented by the following Formulas 1, 2, 3, 4 and 5, health functional foods:
[Formula 1]
Figure pat00076

[Formula 2]
Figure pat00077

[Formula 3]
Figure pat00078

[Formula 4]
Figure pat00079

[Formula 5]
Figure pat00080
.
관동화 추출물 유래 세스퀴테르펜 강화 분획을 유효성분으로 함유하는 건선의 예방 또는 개선용 화장료 조성물.
Cosmetic composition for the prevention or improvement of psoriasis containing sesquiterpene-enhanced fraction derived from Kantoin extract as an active ingredient.
하기 화학식 I로 표시되는 화합물, 이의 광학 이성질체, 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 건선의 예방 또는 개선용 화장료 조성물:
[화학식 I]
Figure pat00081

(상기 화학식 I에서,
R1은 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시, 또는 C1-10의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및
R2는 -H, -OH, 할로겐, C1-10의 직쇄 또는 분지쇄 알킬, C1-10의 직쇄 또는 분지쇄 알콕시,
Figure pat00082
, 또는
Figure pat00083
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-5의 직쇄 또는 분지쇄 알킬이다).
A cosmetic composition for preventing or improving psoriasis containing a compound represented by the following formula (I), an optical isomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula I]
Figure pat00081

(In Formula I,
R 1 is —H, —OH, halogen, C 1-10 straight or branched chain alkyl, C 1-10 straight or branched chain alkoxy, or C 1-10 straight or branched chain alkylcarbonyloxy; And
R 2 is —H, —OH, halogen, C 1-10 straight or branched alkyl, C 1-10 straight or branched alkoxy,
Figure pat00082
, or
Figure pat00083
Wherein A 1 and A 2 are independently —H, or C 1-5 straight or branched alkyl).
제15항에 있어서,
R1은 -H, -OH, C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시, 또는 C1-5의 직쇄 또는 분지쇄 알킬카보닐옥시이고; 및
R2는 C1-5의 직쇄 또는 분지쇄 알킬, C1-5의 직쇄 또는 분지쇄 알콕시,
Figure pat00084
, 또는
Figure pat00085
이고, 여기서 상기 A1 및 A2는 독립적으로 -H, 또는 C1-3의 직쇄 또는 분지쇄 알킬인, 화장료 조성물.
The method of claim 15,
R 1 is —H, —OH, C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy, or C 1-5 straight or branched alkylcarbonyloxy; And
R 2 is C 1-5 straight or branched alkyl, C 1-5 straight or branched alkoxy,
Figure pat00084
, or
Figure pat00085
Wherein A 1 and A 2 are independently —H, or C 1-3 straight or branched alkyl.
제15항에 있어서,
R1은 -H, -OH, 또는
Figure pat00086
이고; 및
R2
Figure pat00087
, 또는
Figure pat00088
인, 화장료 조성물.
The method of claim 15,
R 1 is —H, —OH, or
Figure pat00086
ego; And
R 2 is
Figure pat00087
, or
Figure pat00088
Phosphorus, cosmetic composition.
제15항에 있어서,
상기 화학식 I로 표시되는 화합물은 하기 화학식 1, 2, 3, 4 및 5로 각각 표시되는 화합물로 이루어진 군으로부터 선택되는 어느 하나의 화합물인, 화장료 조성물:
[화학식 1]
Figure pat00089

[화학식 2]
Figure pat00090

[화학식 3]
Figure pat00091

[화학식 4]
Figure pat00092

[화학식 5]
Figure pat00093
.
The method of claim 15,
The compound represented by the formula (I) is any one compound selected from the group consisting of compounds represented by the following formula 1, 2, 3, 4 and 5, cosmetic composition:
[Formula 1]
Figure pat00089

[Formula 2]
Figure pat00090

[Formula 3]
Figure pat00091

[Formula 4]
Figure pat00092

[Formula 5]
Figure pat00093
.
제14항 내지 제18항에 있어서, 상기 화장료 조성물은 연고, 로션, 젤, 크림, 에센스, 화장수, 비누 및 팩으로 이루어진 군으로부터 선택되는 어느 하나의 제형으로 제조되는 것인, 화장료 조성물.The cosmetic composition of claim 14, wherein the cosmetic composition is prepared in any one formulation selected from the group consisting of ointments, lotions, gels, creams, essences, lotions, soaps and packs.
KR1020180099305A 2018-08-24 2018-08-24 Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara KR102179531B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180099305A KR102179531B1 (en) 2018-08-24 2018-08-24 Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180099305A KR102179531B1 (en) 2018-08-24 2018-08-24 Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara

Related Child Applications (1)

Application Number Title Priority Date Filing Date
KR1020200010063A Division KR102218299B1 (en) 2020-01-28 2020-01-28 Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara

Publications (2)

Publication Number Publication Date
KR20200022992A true KR20200022992A (en) 2020-03-04
KR102179531B1 KR102179531B1 (en) 2020-11-18

Family

ID=69783648

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180099305A KR102179531B1 (en) 2018-08-24 2018-08-24 Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara

Country Status (1)

Country Link
KR (1) KR102179531B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100067700A (en) * 2008-12-12 2010-06-22 (주)아모레퍼시픽 Cosmetic compositions for skin care containing extract of tussilago farfara linne flower
KR20150033978A (en) * 2013-09-25 2015-04-02 충북대학교 산학협력단 Composition for Suppression of Dendritic Cell Maturation Comprising Tussilagone As Active Ingredient
KR101881722B1 (en) 2018-04-23 2018-07-24 가천대학교 산학협력단 Pharmaceutical composition for preventing or treating of psoriasis comprising expressing or activity inhibitors of inflammatory mediator of eosinophil

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100067700A (en) * 2008-12-12 2010-06-22 (주)아모레퍼시픽 Cosmetic compositions for skin care containing extract of tussilago farfara linne flower
KR20150033978A (en) * 2013-09-25 2015-04-02 충북대학교 산학협력단 Composition for Suppression of Dendritic Cell Maturation Comprising Tussilagone As Active Ingredient
KR101881722B1 (en) 2018-04-23 2018-07-24 가천대학교 산학협력단 Pharmaceutical composition for preventing or treating of psoriasis comprising expressing or activity inhibitors of inflammatory mediator of eosinophil

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
New sesquiterpenoids from the dried flower buds of Tussilago farfara and their inhibition on NO production in LPS-induced RAW264.7 cells, Fitoterapia, 83(2), pp.318-322(2011.11.20.) 1부.* *
Sesquiterpenoids from Tussilago farfara inhibit LPS-induced nitric oxide production in macrophage RAW 264.7 cells, Arch Pharm Res, 9(1),pp.127-132(2015.10.17.) 1부.* *

Also Published As

Publication number Publication date
KR102179531B1 (en) 2020-11-18

Similar Documents

Publication Publication Date Title
JP7076534B2 (en) Cosmetic composition containing dendrobium candidum flower extract
KR101800498B1 (en) Composition for improving skin wrinkle comprising extract or compounds derived from unripe apple
KR20160056268A (en) Composition for the inhibition of UV-induced melanogenesis or anti inflammatory comprising extracts or fractions of Psidium guajava L.
KR102055322B1 (en) Composition for whitening comprising fraction of Inula helenium as an active ingredient
KR101419588B1 (en) Composition for Moisturizing Skin Comprising Ginseng Oil as Active Ingredient
JP2020502172A (en) Cosmetic composition containing Chinese herbal extract as active ingredient
TW200401780A (en) Novel derivative of flavone C-glycoside and composition containing the same
KR102218299B1 (en) Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara
KR20180040756A (en) Skin whitening composition comprising an extract of coixlachryma-jobi var. mayuen
KR102179531B1 (en) Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara
EP3042651A1 (en) Composition containing monoacetyldiacylglycerol compound as active ingredient for preventing or treating atopic dermatitis
JP2002080360A (en) Antiallergic agent including caffeic acid derivative as active ingredients
KR101780939B1 (en) Method for Seperation of Compound Derived from Ginseng and Composition for anti-inflammatory Using the same
KR101721666B1 (en) Skin-whitening compound from Inula britannica, and skin-whitening composition containing the same
KR20200025244A (en) Composition for preventing, alleviating or treating pruritus, containing punicalagin
JPH11269192A (en) Flavone glycoside
KR102014685B1 (en) Compound from Caragana sinica and composition for skin whitening comprising the same
KR102475143B1 (en) Composition for Skin Regeneration Comprising Extract of Vanilla Bean
KR102014646B1 (en) Compound from Caragana sinica and composition for skin whitening comprising the same
KR102411893B1 (en) Composition for inhibiting sebum secretion comprising Chestnut bur extract as an active ingredient
KR102607716B1 (en) A composition for preventing or improving circadian rhythm disorders comprising Artemisia annua plant extracts or artemisinin
JP5405782B2 (en) Ceramide production promoter and moisturizer
KR101719708B1 (en) Composition for reducing skin wrinkle and for promoting recovery of iskin injury comprising extracts of Orostachys japonicus and Saururus chinensis
KR102306041B1 (en) Composition for improving skin comprising stevioside as active ingredient
KR20220165545A (en) Composition for improving skin containing 3,3&#39;,4-tri-O-methylellagic acid as an active ingredient

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
A107 Divisional application of patent
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant