KR20190143663A - One-step isothermal detection method of gene mutation using hairpins formed on a gold nanoshell - Google Patents

Abstract

The present invention provides a kit for detecting a target nucleic acid, including primers designed to be used for hybridization of another primer set, when two primer sets hybridize with a target sequence, a hairpin structure is formed by ligation, causing target nucleic acid molecules to separate; and a detection method using the kit. KRAS mutations can be detected with sensitivity of 20 attomoles (10-18 mole) within 1 hour by the method of the present invention. The kit for detecting a target nucleic acid and the detection method using the same of the present invention may be usefully used as a technique for detecting a target nucleic acid directly, quickly, and specifically with high sensitivity, without using a thermocycling device such as PCR in the field of SNP detection.

Description

One-step isothermal detection method of gene mutation using hairpins formed on a gold nanoshell}

The present invention relates to a method for detecting a target nucleic acid to be detected without using a thermocycling apparatus such as PCR, and more particularly, when two primer sets hybridize with a target sequence, the target nucleic acid molecules are separated by ligation to form a hairpin structure. The present invention relates to a kit for detecting a target nucleic acid including a primer designed to be used for hybridization of another primer set, and a detection method using the same.

Single nucleotide polymorphism (SNP) is a single nucleotide variation of DNA found in more than 1% of the population. Some SNPs are known to be closely associated with progression of disease or drug sensitivity because SNPs in the coding region occur less frequently than SNPs in the non-coding region. Therefore, SNPs have been used as biomarkers for predicting disease risk, and in particular for assessing drug efficacy for personalized medicines.

Until recently, several analytical methods using SNPs as biomarkers have been commercially available. Most of the methods available are principles that can be detected by amplifying the target gene using PCR. Basically, these methods generate all of a specific product during or after PCR, and then quantify it by one of several methods including MALDI-TOF MS, gel electrophoresis, fluorescence detection and sequencing (base analysis). Allele discrimination strategies of the method are classified into four groups including primer extension, hybridization, ligation and enzymatic cleavage. In the primer extension method, an extension product corresponding to one of the alleles of each SNP is generated using SNP-specific primers. Hybridization-based assays take advantage of the difference in binding affinity between the matched or discordant target and the probe. The ligation approach uses DNA ligase to generate SNP-specific ligation products. They enable effective cancer treatment, but require relatively high costs and long analysis times because they rely on expensive equipment and thermocyclers. Therefore, the challenge remains to develop a cost-effective and rapid SNP typing (detection) method.

Isothermal nucleic acid amplification (IAA) without PCR has been considered as an alternative to PCR based methods. However, isothermal methods for SNP detection are not yet commercially available, probably due to the low specificity of IAA due to the relatively low operating temperatures. Due to the dual specificity of ligation due to enzymes and probes, the specificity in ligation methods is greater than in other methods. Ligase chain reaction (LCR), ligase detection reaction (LDR) and branch amplification (RAM) are representative ligation-based methods for SNP typing. In LCR and LDR, two primers are linked which perfectly match the target gene. The complex of the ligated primer (LP) and the target gene is heat denatured and the target gene is reused as a template for new ligation, thus inducing exponential production of LP. In contrast, in RAM, two ends of a linear probe are ligated (ligated) to create a circularized probe that hybridizes perfectly to the target gene and hybridizes and performs isothermal rolling circle amplification (RCA). do. In the case of LCR, there are still costly limitations due to the use of PCR. While RAM isothermally produces amplification products, RCA's protocol involves many complex steps, such as capture of target genes, washing of unbound probes, ligase reactions, RAM reactions, and amplified product detection. In an effort to develop an isothermal method for SNP detection, nuclease reactions after cyclic ligation reactions have been reported. In this method, primer-target DNA complexes ligated by strand-displacing hairpins were isolated without thermal denaturation, allowing a new set of two primers to be cyclically ligated. The ligation product was also circulated to cleave the fluorescently labeled substrate by RNase H on gold nanoparticles to induce target specific fluorescence amplification. As a result, 10 attomoles ( ^10-18 mole) of target DNA including point mutations of the KRAS gene were detected. Although the combination of ligation and degradation by ligase and nucleases respectively induced high specificity and sensitivity, the two-step process is an obstacle to direct and simple detection of point mutations.

Korean Patent Publication No. 10-2015-0143347 (2015.12.23.) Korean Patent Publication No. 10-2013-0082495 (2013.07.19) Korean Patent Publication No. 2003-0055343 (2013.07.19)

The inventors of the present invention are studying a technique for detecting SNPs by isothermal nucleic acid amplification without expensive thermocycling devices such as PCR, and when two primer sets hybridize with a target sequence, they are ligated to form a hairpin structure to separate target nucleic acid molecules. Using primer design techniques used for hybridization of different primer sets, it is possible to proceed a single step isothermal ligase reaction in which multiple ligase reactions are carried out per single target nucleic acid, and the use of thermocycling devices such as PCR in the prior art. Compared with the long time analysis time by, single detection isothermal ligase reaction can achieve 5 times lower detection limit with detection reaction within 1 hour, and SNP detection can be performed with excellent detection efficiency of 1% sensitivity. I found it.

Accordingly, the present invention provides a kit for detecting a target nucleic acid comprising a primer designed to be used for hybridization of another primer set by separating a target nucleic acid molecule by ligating two primer sets to hybridize with a target sequence to form a hairpin structure, and detecting using the same. It is an object to provide a method.

According to one aspect of the present invention, a primary primer is immobilized comprising a secondary primer having an Au nanoshell and a SERS active dye, wherein the sequence of the ligation primer ligated primary and secondary primers and the sequence of the target nucleic acid Complementary, having a sequence that forms a hairpin structure after the primary and secondary primers are ligated, the ligation temperature of the primary and secondary primers is higher than the Tm between the primary and secondary primers, and the formed hairpin structure Provided is a kit for detecting a target nucleic acid, wherein the kit has a Tm value higher than that of the ligation primer and the target nucleic acid.

In one embodiment, the Au nanoshells may be 10-1000 nm in diameter.

In one embodiment, the target nucleic acid may be a variant gene of the KRAS gene, preferably a 35G> A mutation or a 35G> T variant gene at codon 12 of the KRAS gene.

In one embodiment, the ligation temperature may be 35-55 ℃.

In one embodiment, the primary primer may have a nucleotide sequence of SEQ ID NO: 1, the secondary primer may have a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

In one embodiment, the SERS active dye may be TAMRA or CY3.

According to another aspect of the invention, (i) attaching seed gold (Au) to the silica core to obtain Au nanoshells; And (ii) fixing the thiolated primary primer to the Au nanoshell surface obtained in step (iii).

According to another aspect of the present invention, (a) hybridizing the primary primer with the target nucleic acid by mixing the Au nanoshell to which the primary primer is fixed to the sample to be detected; (b) mixing a secondary primer having a SERS active dye and a ligase with the mixture obtained in step (a) and incubating to form an isothermal ligation reaction and a hairpin structure; And (c) detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS.

In one embodiment, the incubation of step (b) may be performed for 30 minutes to 1 hour 30 minutes.

According to the present invention, using a primer design technique in which two primer sets hybridize with a target sequence to be ligated to form a hairpin structure, the target nucleic acid molecules are separated and used for hybridization of another primer set, thereby allowing multiple ligase per single target nucleic acid. Single stage isothermal ligase reaction in which the reaction is carried out can be carried out, and compared to the long time analysis time by the use of a thermocycler such as PCR in the prior art, detection within 1 hour by the single stage isothermal ligase reaction It has been found that the reaction can achieve a 5x lower detection limit and that SNP detection can be performed with good detection efficacy of 1% sensitivity.

Therefore, a kit for detecting a target nucleic acid including a primer designed specifically for the present invention, and a detection method using the same, can be used to directly and quickly detect a target nucleic acid to be detected in a SNP detection field without using a thermocycling device such as PCR. It can be usefully used as a detectable technique.

1 is a schematic showing single-step isothermal detection of multiple KRAS mutants using hairpin forming probes specific for AuNS and SNPs.
FIG. 2 is an electrophoretic image on TBE gels (4-20%) of oligonucleotides (Table 1) used and ligation products [lane 1: FP1, lane 2: FP2A, lane 3: FP2AC, lane 4: 35G > A, lane 5: LPA, lane 6: mixture of FP1 and FP2A, lane 7: mixture of FP1 and FP2A treated with DNA ligase for 1 hour in the presence of 35G> A, lane 8: in the presence of 35G> A Mixture of FP1 and FPAC treated with DNA ligase for 1 hour, lane 9: mixture of FP1 FP2A treated with DNA ligase for 1 hour without 35G> A].
3 is a TEM image of schematic (a), amino-modified silica sphere (b), and AuNS (c) of AuNS synthesis.
4 is a SERS spectrum obtained after performing an isothermal ligase reaction of FP1 immobilized on AuNS with FP2A (a) or FP2T (b) according to the target sequence.
FIG. 5 is a SERS spectrum after one hour of isothermal ligase reaction by changing the concentration of target SNP, (a) SERS spectrum of different concentrations of 35G> A KRAS gene point mutations, and (b) 35G> A concentration Plot of 1385 cm ⁻¹ band intensities, inset shows linear relationship between band intensity and log value of target nucleic acid concentration of 1.0 × 10 ⁻¹¹ to 1.0 × 10 ⁻⁸ M.
Figure 6 shows the SERS spectrum after changing the concentration of target SNP for 1 hour of isothermal ligase reaction, (a) SERS spectrum of different concentrations of 35G> T KRAS gene point mutations, (b) 35 G> T concentration Plot of contrast 1588 cm ⁻¹ band intensities, inset shows linear relationship between band intensity and log value of target nucleic acid concentration of 1.0 × 10 ⁻¹¹ to 1.0 × 10 ⁻⁸ M.
Figure 7 shows the diagnostic sensitivity of the assay using the present invention, which is the S / N ratio of SERS intensity at the characteristic frequency of TAMRA and CY3 for 35G> A and 35G> T in the presence of wild type KRAS gene.
8 is SERS intensity obtained according to the concentration of KRAS mutations (35G> A) shown in the graph of FIG.
9 is SERS intensity obtained according to the concentration of KRAS mutations (35G> T) shown in the graph of FIG.

The present invention includes a secondary primer having an Au nanoshell and a SERS active dye to which the primary primer is immobilized, the sequence of the ligation primer ligated with the primary primer and the secondary primer is complementary to the sequence of the target nucleic acid, and the primary Having a sequence of forming a hairpin structure after the primer and the secondary primer are ligated, and the ligation temperature of the primary primer and the secondary primer is higher than the Tm between the primary primer and the secondary primer, and the formed hairpin structure is formed with the ligation primer. It provides a kit for detecting a target nucleic acid, characterized in that having a Tm value higher than the Tm of the target nucleic acid.

In the present invention, when two primer sets hybridize with a target sequence, they are ligated to form a hairpin structure so that the target nucleic acid molecule is separated and used for hybridization of another primer set. As a result, multiple hairpins per target DNA can form on the gold nanoshell (AuNS) surface, providing highly enhanced and reliable Raman scattering near the surface. Gold nanoparticles (AuNP) can provide hot spots with a high SERS enhancing factor, but because the number of hot spots is irregular, gold nanoshells (AuNS) were used in the present invention. Since the primers were labeled with the SERS reporter (active) dye, the present invention can discriminate single base mismatched target sequences by 1 pM after 1 hour ligation reaction.

In one embodiment, the Au nanoshells may have a diameter of 10-1000 nm, preferably 50-500 nm, more preferably 100-200 nm. At this time, the thickness of the Au nanoshell (thickness of the shell) may be 1-200 nm, preferably 10-100 nm, more preferably 20-40 nm.

In one embodiment, the target nucleic acid is complementary to the ligation primer ligated between the primary primer and the secondary primer; Any gene can be detected as long as the Tm of the ligation primer and the target nucleic acid is higher than the Tm and ligation temperature between the primary primer and the secondary primer and lower than the Tm of the hairpin structure, for example, malaria and tuberculosis. It may be a mutation of the same human infection pathogen, but is not limited thereto.

In one embodiment, the target nucleic acid may be a variant gene of the KRAS gene, preferably a 35G> A mutation or a 35G> T variant gene at codon 12 of the KRAS gene.

In one embodiment, the ligation temperature is higher than the Tm between the primary primer and the secondary primer, and can be designed in a range lower than the Tm of the ligation primer and the target nucleic acid, for example, 35-55 ° C, preferably 40 50 ° C., but is not limited thereto.

In one embodiment, the primary primer may have a nucleotide sequence of the following SEQ ID NO: 1, the secondary primer may have a nucleotide sequence of the following SEQ ID NO: 2 or the following SEQ ID NO: 3.

CAGCTCCAACA (SEQ ID NO: 1)

AAGGAGCTGGTGGACCTACGCCAT (SEQ ID NO: 2)

AAGGAGCTGGTGGACCTACGCCAA (SEQ ID NO: 3)

In one embodiment, the SERS active dye is not limited as long as it can be measured by surface enhanced Raman scattering (SERS), for example, may be TAMRA or CY3, but is not limited thereto.

The present invention also comprises the steps of (i) attaching seed gold (Au) to the silica core to obtain Au nanoshells; And (ii) fixing the thiolated primary primer to the Au nanoshell surface obtained in step (iii).

The present invention also comprises the steps of (a) mixing the primary primer is fixed in the sample to be detected Au nanoshell hybridization of the primary primer with the target nucleic acid; (b) mixing a secondary primer having a SERS active dye and a ligase with the mixture obtained in step (a) and incubating to form an isothermal ligation reaction and a hairpin structure; And (c) detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS.

The detection method of the target nucleic acid of the present invention includes mixing the primary primer with the target nucleic acid by mixing Au nanoshells to which the primary primer is fixed (ie, step (a)). Step (a) is a step of hybridizing FP1 (primary primer) immobilized on the Au nanoshell and a sample (a sample to be detected including a target nucleic acid) to hybridize a portion of the sequence of FP1 with a portion of the target nucleic acid.

In the method for detecting a target nucleic acid of the present invention, the mixture obtained in step (a) is mixed with a secondary primer having a SERS active dye and a ligase, and then incubated to form an isothermal ligation reaction and a hairpin structure (ie, step (b). )]. Step (b) hybridizes the unhybridized single stranded portion of the target nucleic acid with the FP2 (secondary primer) while a portion of the sequence of the FP1 (primary primer) immobilized on the Au nanoshell is partially hybridized. When FP1 (primary primer) and FP2 (secondary primer) are ligated and linked. At this time, the ligated primer includes a sequence capable of forming a hairpin structure, and since the Tm of the hairpin structure is higher than the Tm of the ligating primer and the target nucleic acid, the target nucleic acid that has been bound (hybridized) with the ligation primer is reacted (ligated). Separated from the ligated primer without changing the temperature, the isolated target nucleic acid can be reused for the reaction (ligation) of another ligated primer pair. Accordingly, the recycled target nucleic acid causes a single target nucleic acid to participate in multiple ligation reactions on the surface of AuNS to form multiple hairpins. As a result, the SERS activating dye of FP2 of the hairpin accumulates on the surface of AuNS, resulting in amplification of SERS in a point mutation specific manner.

In one embodiment, the incubation time of step (b) can be carried out for 30 minutes to 1 hour 30 minutes, preferably for 1 hour. Ligation and amplification times for 1 hour can also yield SERS measurements amplified in a point mutation specific manner.

The method for detecting a target nucleic acid of the present invention includes detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS (ie, step (c)). In the present invention, surface enhanced Raman scattering (SERS) was introduced as a detection signal for detection of complexed DNA and sensitive DNA due to single molecule detection sensitivity, molecular specific fingerprint and optical stability.

As described above, using the target nucleic acid detection kit of the present invention, it is possible to proceed with a single step isothermal ligase reaction in which multiple ligase reactions are performed per single target nucleic acid. Obtained as 20 Atomol at, it was confirmed that it is a very sensitive detection method. In addition, compared to the long time analysis time by the use of a thermocycler such as PCR in the prior art, the detection method of the present invention has a detection limit of 5 times lower than the detection reaction within 1 hour by a single step isothermal ligase reaction. Can be achieved and can be performed with good detection efficacy of 1% sensitivity. In the detection method of the present invention, since the amplification of the SERS is achieved during the ligation reaction without an additional step for signal amplification, the target nucleic acid to be detected can be detected more sensitively and specifically directly and faster than the previous method. It can be used as an alternative to PCR in countries with limited resources for mutations.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited thereto.

<Example>

1. Materials and Methods

(1) reagent

All chemicals were purchased from Sigma-Aldrich (St. Louis, Mo.) and used without further purification, except where noted. Oligonucleotides were purchased from Bioneer (Bioneer, Daejeon, Korea).

(2) Synthesis of AuNS

A 26 nm thick AuNS (diameter: ˜128 nm) was synthesized according to the method of the prior art (T. Pham, JB Jackson, NJ Halas and TR Lee, Langmuir , 2002, 18 , 4915-4920). First, silica nanoparticles were prepared by Stober method. 1.5 mL of tetraethyl orthosilicate (TEOS) (Sigma) was added to 45 mL (14.8 N) of ethanol including 2.8 mL of NH ₄ OH. After reacting for 8 hours, 126 μL of APTES [(3-Aminopropyl) triethoxysilane] was added to the mixture. After incubation for 8 hours, the APTES treated silica cores were boiled for 2 hours. The silica core was centrifuged at 2000 g for 30 minutes to remove unreacted reagents. After discarding the supernatant, the pellet was suspended in 50 mL of fresh ethanol for 10 minutes using a probe sonicator (VC 750, Sonics). Centrifugation purification of the silica core was repeated two more times. Then, seed gold colloid (2-3 nm) was placed in the silica core. After incubation overnight, the mixture was suspended in 10 mL of ultrapure water and centrifuged at 2000 g for 30 minutes to remove unbound seed gold. The centrifugation step was repeated two more times. Seed gold colloidal attached silica cores were mixed with 1 mL of 0.0148% HAuCl ₄ . 6.7 μL of 30% formaldehyde was added and then vigorously vortexed for 10 minutes to initiate the growth of the nanoshells. The thickness of the nanoshells can be controlled by varying the amount of silica core. In order to measure the size and shell thickness of nanoshells, high-resolution photographs of nanoparticles synthesized using TEM (JEM-2100F, JEOL) were obtained.

(3) Immobilization of Oligonucleotides on AuNS

All oligonucleotides (see Table 1) were purchased from Bioneer (Bioneer, Daejeon, Korea). Thiol [5 '(OP) -CAGCTCCAACA- (SH) 3'] of FP1 was dissolved in 10 mM TCEP (Sigma Aldrich) (Tris) in 10 mM sodium phosphate buffer (pH 7.0) for 30 minutes at room temperature. Activated by treatment with-(2-Carboxyethyl) phosphine). A 200-fold molar excess of thiol activated FP1 was mixed with AuNS in 1 mL of ultrapure water for 16 hours at room temperature. In order to increase the density of the FP1 coverage on the gold surface, the NaCl concentration was gradually increased to 0.1 M. After an additional 48 hours, excess unbound FP1 was removed by centrifugation with ultrapure water for 25 minutes at 8,000 rpm and repeated four times. AuNS modified with primers was redispersed in 200 μL of water at room temperature. Table 1 below shows the sequence of the oligonucleotides used in the present invention.

Oligonucleotide order FP1 5 '-(OP) -CAGCTCCAACA- (SH) -3' FP2A 5'-TAMRA-AAG GAGCTGGTGGACCTACGCCAT-3 ' FP2T 5'-Cy3-AAG GAGCTGGTGGACCTACGCCAA-3 ' FP2AC TTTTACGCCAT 35G> A TGG AGCTGATGGCGTA 35G> T TGG AGCTGTTGGCGTA LPA (ligated FP1 and FP2A) AAGGAGCTGGTGGACCTACGCCATCAGCTCCAACA 35G (wild type target) TGG AGCTGGTGGCGTA

(4) Gel Electrophoresis of Oligonucleotides

Electrophoresis of the oligonucleotides and ligation products used was carried out by loading the sample into a TBE polyacrylamide gel (4-20%) and running the gel at 180 V for 50 minutes. After electrophoresis, the gels were stained for 40 minutes in 1 × TBE buffer (pH 8.0) containing dye [1 × SYBR Green I Nucleic Acid Gel Stain (Thermo Fisher Scientific, USA)]. UV excitation fluorescence pictures of the stained gels were obtained using the Davinchi-Gel Imaging System (Davinchi-K, Korea).

(5) isothermal ligand reaction and SERS measurement

20 μL with 20 mM Tris-HCl (pH 7.6), 25 mM Mg (CH ₃ COOH) ₂ , 10 mM KCH ₃ COOH, 1 mM NAD and 0.1% Triton X-100 with varying amounts of target nucleic acid To a solution containing FP1 modified AuNS (0.2 nM) in reaction buffer was added FP2A (final 0.2 μM) or FP2T (final 0.2 μM) and Taq DNA ligase (final 3 U / μl). The mixture was incubated at 45 ° C. for 1 hour. 10 μl of the reacted sample was dried with nitrogen gas in a clean glass. Confocal Raman microscopy (LabRAM HR Evolution, HORIBA) was used to scan 10 spots of the sample (diameter of focused 633 nm laser was 1.03 μm) using an integration time of 3 seconds for each scan.

2. Results

1 is a schematic showing multiple ligation of primers to a single target on AuNS. For isothermal recycling of targets for sensitive SNP screening, primer sets FP1 and FP2 were designed to form hairpin structures upon ligation after complexing with the target. Since the ligated primers spontaneously turn into hairpins, the bound targets can be separated from the ligated primers and reused for another ligated pair of unligated primers without changing the reaction temperature. In the course of the ligation reaction, the recycled targets form multiple hairpins per single target on the surface of AuNS. As a result, the SERS active dye of FP2 of the hairpin accumulates on the AuNS surface, allowing SERS to be amplified in a point mutation specific manner.

35G> A and 35G> T at codon 12 of the KRAS gene were selected for multiple detection of point mutations in the KRAS gene. Before performing the reaction on AuNS, the design of primer sets FP1 and FP2 for multiple formation of target specific hairpins should be verified. The sequences of the primers should be carefully designed so that they are ligated upon hybridization with specific targets and only form hairpins thereafter. Otherwise self-hybridization between the stem sequences of the primer sets can occur, resulting in false-positive signals. In order to avoid self-hybridization, the fusion temperature, Tm of the complex between FP1 and FP2, i.e., the melting point, must be sufficiently lower than the ligation temperature. The calculated Tm of the two complexes, FP1 / FP2A and FP1 / FP2T, was 25.5 ° C. The ligation reaction was carried out at 45 ° C. higher than the Tm of hybridization, so self hybridization can be neglected.

For multiple ligations, the Tm of the hairpin should be high enough to separate the bound target. The Tm of the hairpin (77.5 ℃ for 35G> A, 79.6 ℃ for 35G> T) was higher than the Tm (60.7 ℃ for 35G> A and 61.3 ℃ for 35G> T) of the ligated primer and the target complex. Gel electrophoresis was performed to identify sequences designed to avoid target specific multiple ligation and self hybridization. Figure 2 is a photograph of acrylamide gel irradiated with ultraviolet light after electrophoresis at 180 V for 50 minutes.

Self-hybridized primers should appear as fluorescence bands closer to the origin than the bands in lanes 1 and 2 loaded with FP1 or FP2A, respectively. However, two bands of lane 6 loaded with a mixture of FP1 and FP2A were located in the same position as the bands of lane 1 and lane 2, and there was no additional band in lane 6 near the origin than the two bands. The accuracy of the sequence to avoid self hybridization between the two primers from the band position in lane 6 was demonstrated. The role of hairpin formation in multiple ligation of primers hybridized to a single target was also demonstrated by electrophoretic analysis. Lanes 7 and 8 were loaded with a mixture of FP1 and FP2A and FP2AC for 1 hour in the presence of target nucleic acid and DNA ligase, respectively. FP2AC can hybridize to 35G> A but does not form hairpins after ligation to FP1. In both lanes, the same band near the origin was located in the same position as the band in lane 5, which is an oligonucleotide having the sequence of the ligated primer. In contrast to the same band located in both lanes, the signal strength of the band of lane 7 was higher than that of lane 8. The relatively high intensity of lane 7 bands means a greater number of ligation primers in lane 8 of the same amount of target nucleic acid, thus confirming that there is multiple ligation per single target nucleic acid by ligation of the primer followed by the formation of hairpins. It became. To identify self-ligating primers without target nucleic acid, ligase in lane 7 and the same primers were loaded in lane 9 without target nucleic acid. There was no band corresponding to the ligated primer, confirming that there was no self-ligation without the target nucleic acid. As gel electrophoresis demonstrated that multiple hairpin formation for SNP specific SERS was correctly designed, FP1 was immobilized on AuNS (see FIG. 3) and an isothermal ligation reaction was performed. After reacting with FP1 immobilized on AuNS in the presence of FP2A and FP2T according to a point mutation sequence of 35G> A or 35G> T, SERS signals were measured and the results are shown in FIG. 4. To detect 35G> A and 35G> T, TAMRA (Tetramethylrhodamine) and CY3 were labeled with FP2A and FP2T, respectively. As shown in FIG. 4, the SERS signal obtained from the spot was exactly identical to the type of mutations and probes added. In other words, the SERS spectra obtained from the spot where the added probe and the target SNP matched showed characteristic wavenumbers of TAMRA and CY3 for 35G> A and 35G> T, respectively. In contrast, no characteristic wavenumber was observed in the spots to which wild-type targets or mismatched SNP containing mutations were added. From FIG. 4, it can be seen that SNPs of KRAS mutants can be successfully detected by analyzing SERS measured using FP1 immobilized AuNS together with other unfixed primers.

Next, the isothermal ligation reaction was performed by varying the amount of the target nucleic acid from 0 to 100 nM. Representative wavenumbers of 1385 cm ⁻¹ and 1588 cm ⁻¹ were chosen for 35G> A and 35G> T, respectively, which corresponded to the distinct and strong wavenumber of the labeled dye. 5 and 6 show the representative wave strengths depending on the amount of target nucleic acid added. As the amount of target added was increased, the intensity of the wavenumber increased proportionally. A linear relationship between SERS intensity and target concentration for each mutation in the range of 10 pM to 10 nM was obtained. The values after background subtraction of the SERS signal were 9.5 ± 1.3 and 7.5 ± 1.2, respectively, for low 35G> T and 35G> A of 10 pM corresponding to 20 atomoles. No signal was obtained for a 0.1 pM mutant target. Therefore, the LOD of the detection method of the present invention was determined to be 20 atomoles in both mutations. Prior Art [HT Ngo, N. Gandra, AM Fales and SM Taylor, Biosen. Bioelectron., 2016, 81, 8-14] reported the detection of 100 atomolar malaria SNPs using SERS nanorattle. The detection method of the present invention is designed to form multiple hairpins for a single target in AuNS. In addition, the SERS signal was generated during hairpin formation. As a result, in the present invention, a detection limit of 5 times lower than that of the prior art method can be achieved with a detection reaction within 1 hour.

Finally, the sensitivity of the present invention was investigated. Isothermal ligation reactions were performed with a mixture of each point mutation and wild-type target. 7 shows that the SERS intensity of each representative wave is decreased as the proportion of mutants in the presence of wild-type targets decreases. A relatively high SERS intensity was detected until the point mutant became 1% compared to the 100% intensity of the wild type target. The SERS intensity obtained after performing detection on 1% mutant with the method of the present invention was at least about 1.5 times higher than that obtained for 100% wild type target. Therefore, the sensitivity of the present invention can be evaluated as 1%.

In conclusion, a single step isothermal multiple ligase reaction per single target coupled with SERS has been successfully developed for sensitive and specific detection of point mutations in the KRAS gene. In an isothermal ligase reaction, primers which form hairpins upon target specific ligation were first introduced in the present invention. Electrophoretic analysis and sensitive detection demonstrated the role of hairpin forming primers for multiple ligation. Nanomaterials containing AuNP and graphene oxide have been used for DNA ligase reactions as fluorescent receptors. The present invention has shown excellent results in determining single base mismatches in target sequences. In the prior art, since there is no amplification of the ligated product, the detection sensitivity of the assay was limited to an amount on the order of 1 picomole.

Among the reported SNP detection isothermal assays, invader assays combined with fluorescence amplification can detect targets at the level of 1 zeptomole (10 ^-21 mole). Invader assays, however, require enzymatic reactions for 4 hours for such sensitivity. Assay sensitivity in the present invention is an effect that can be achieved within 1 hour without PCR.

In conventional ligase chain reactions, ligation and separation between primers and targets is thermally controlled, requiring a sophisticated and expensive thermocycler. Previously, the inventors of the present invention have reported an isothermal ligation reaction that combines a recycling probe assay without PCR. In this method, 10 Atomol levels of 35G> A of KRAS mutants could be detected. However, the steps for ligation reactions and signal generation are individual steps requiring at least 2 hours of response to achieve the sensitivity. In contrast, the method of the present invention is a more direct method than the previous method because SERS is obtained during the ligation reaction without additional steps for signal amplification.

In the method of the present invention, 20 Atomol KRAS mutations can be detected within 1 hour. Compared to other reported isothermal SNP detection methods using SERS, the LOD of the single step ligase reaction of the present invention was determined to be at least 5 times lower. In clinical applications, commercial kits have a diagnostic sensitivity of 5%. The method of the present invention can detect 1% variation in both 35G> A and 35G> T in the presence of wild-type targets. Thus, it has been demonstrated that the method of the present invention can successfully detect two different point mutations. In the present invention, the hairpin forming primer was used as a thermocycler to separate the target at a fixed temperature. Direct ligation of the primers in AuNS resulted in amplification of SERS without additional steps for signal amplification. Since SNP specific signal amplification was performed at fixed mild conditions of temperature, cost-effective SNP detection can be performed with ordinary inexpensive equipment such as a microplate reader. Thus, the method of the present invention can be used as an alternative to PCR in countries with limited resources for SNP detection of KRAS mutations as well as mutations in human infectious agents such as malaria and tuberculosis.

<110> Daegu-Gyeongbuk Medical Innovation Foundation <120> One-step isothermal detection method of gene mutation using          hairpins formed on a gold nanoshell <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 11 <212> DNA <213> Homo sapiens <400> 1 cagctccaac a 11 <210> 2 <211> 24 <212> DNA <213> Homo sapiens <400> 2 aaggagctgg tggacctacg ccat 24 <210> 3 <211> 24 <212> DNA <213> Homo sapiens <400> 3 aaggagctgg tggacctacg ccaa 24

Claims (10)

A secondary primer having an Au nanoshell and a SERS active dye to which the primary primer is immobilized, wherein the sequence of the ligation primer ligated with the primary primer and the secondary primer is complementary to the sequence of the target nucleic acid, and the primary primer and 2 Having a sequence to form a hairpin structure after the primary primer is ligated, the ligation temperature of the primary primer and the secondary primer is higher than the Tm between the primary primer and the secondary primer, and the formed hairpin structure is formed of the ligation primer and the target nucleic acid. Kit for detecting a target nucleic acid, characterized in that having a Tm value higher than Tm. The kit for detecting a target nucleic acid according to claim 1, wherein the Au nanoshells have a diameter of 10 to 1000 nm. The kit for detecting a target nucleic acid according to claim 1, wherein the target nucleic acid is a mutated gene of the KRAS gene. The kit for detecting a target nucleic acid according to claim 1, wherein the target nucleic acid is a 35G> A mutation or a 35G> T mutation gene at codon 12 of the KRAS gene. The kit for detecting a target nucleic acid according to claim 1, wherein the ligation temperature is 35-55 ° C. The kit for detecting a target nucleic acid according to claim 1, wherein the primary primer has a nucleotide sequence of SEQ ID NO: 1, and the secondary primer has a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The kit for detecting a target nucleic acid according to claim 1, wherein the SERS active dye is TAMRA or CY3. (Iii) attaching seed gold (Au) to the silica core to obtain Au nanoshells; And
(Ii) fixing the thiolated primary primer to the Au nanoshell surface obtained in step (iii)
Comprising a, a method for producing a Au nanoshell fixed primary primer. (a) hybridizing the primary primer with the target nucleic acid by mixing the Au nanoshell to which the primary primer is immobilized to the sample to be detected;
(b) mixing a secondary primer having a SERS active dye and a ligase with the mixture obtained in step (a) and incubating to form an isothermal ligation reaction and a hairpin structure; And
(c) detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS.
Target nucleic acid detection method comprising a. The method of claim 9, wherein the incubation of step (b) is carried out for 30 minutes to 1 hour 30 minutes.

Images