KR102088262B1 - One-step isothermal detection method of gene mutation using hairpins formed on a gold nanoshell - Google Patents

Abstract

The present invention provides a target nucleic acid detection kit comprising a primer designed to be used for hybridization of another primer set by separating the target nucleic acid molecule by ligation to form a hairpin structure when two primer sets hybridize with the target sequence, and a detection method using the same to provide. By the method of the present invention, KRAS mutations within 1 hour can be detected with a sensitivity of 20 attomole (10 ^-18 mole).
The kit for detecting a target nucleic acid of the present invention and a detection method using the same are usefully used as a technique capable of sensitive and specific direct and rapid detection of a target nucleic acid to be detected without using a thermal cycle device such as PCR in the field of SNP detection Can.

Description

One-step isothermal detection method of gene mutation using hairpins formed on a gold nanoshell}

The present invention relates to a method of detecting a target nucleic acid to be detected without using a thermal cycling device such as PCR, and more specifically, when two primer sets hybridize with a target sequence, it is ligated to separate the target nucleic acid molecule by forming a hairpin structure. It relates to a target nucleic acid detection kit comprising a primer designed to be used for hybridization of different primer sets and a detection method using the same.

Single nucleotide polymorphism (SNP) is a single nucleotide variation of DNA found in more than 1% of the population. It is known that some SNPs are closely related to the progression of disease or drug sensitivity because SNPs in the coding region occur less frequently than SNPs in the non-coding region. Therefore, SNP has been used as a biomarker for predicting disease risk, and especially for evaluating drug efficacy for personalized medicine.

Until recently, several analytical methods using SNP as a biomarker have been commercially available. Most of the methods that can be used are based on amplification of the target gene using PCR to detect it. Basically, in the above methods, all specific products are generated during or after PCR, and then quantified by one of several methods including MALDI-TOF MS, gel electrophoresis, fluorescence detection and sequencing (base analysis). The allele discrimination strategy of the method is divided into four groups including primer extension, hybridization, ligation and enzymatic cleavage. In the primer extension method, an extension product corresponding to one of alleles of each SNP is generated using SNP-specific primers. Hybridization-based assays utilize differences in the binding affinity of a probe to a match or mismatch target. The ligation approach uses DNA ligase to generate SNP-specific ligation products. They enable effective cancer treatment, but rely on expensive equipment and thermocyclers, requiring relatively high cost and long analysis time. Therefore, the challenge remains to develop a cost-effective and rapid SNP typing (detection) method.

Isothermal nucleic acid amplification (IAA) without PCR has been considered as an alternative to PCR-based methods. However, isothermal methods for SNP detection are not yet commercially available, probably due to the low specificity of IAA due to its relatively low operating temperature. Due to the dual specificity of ligation due to enzymes and probes, specificity in ligation is greater than in other methods. Ligase chain reaction (LCR), ligase detection reaction (LDR), and ramification amplification (RAM) are representative ligation-based methods for SNP typing. In LCR and LDR, two primers that perfectly match the target gene are linked. The complex of the ligated primer (LP) and the target gene is thermally denatured, and the target gene is reused as a template for new ligation, thus inducing exponential production of LP. In contrast, in RAM, two ends of a linear probe are connected (ligated) to create a circularized probe that is perfectly matched and hybridized with the target gene and isothermally performed rolling circle amplification (RCA). do. In the case of LCR, there are still high cost limitations due to the use of PCR. RAM produces isothermally amplified products, but RCA's protocol involves several complex steps such as target gene capture, washing of unbound probes, ligase reaction, RAM reaction, and detection of amplified products. In an effort to develop an isothermal method for SNP detection, nuclease reactions following cyclic ligation reactions have been reported. In this method, a primer-target DNA complex ligated by a strand-displacing hairpin is separated without a heat denaturation process, thereby allowing a new set of two primers to be ligated cyclically. The ligated product was also circulated to cleave the fluorescently labeled substrate by RNase H on gold nanoparticles to induce target specific fluorescence amplification. As a result, 10 attomole (10 ^-18 mole) target DNA containing a point mutation of the KRAS gene was detected. Although the combination of ligation and degradation by ligase and nuclease induced high specificity and sensitivity, respectively, the two-step process is an obstacle to direct and simple detection of point mutations.

Korean Patent Publication No. 10-2015-0143347 (2015.12.23.) Korean Patent Publication No. 10-2013-0082495 (2013.07.19) Korean Patent Publication No. 2003-0055343 (2013.07.19)

The inventors of the present invention were studying a technique for detecting SNP by isothermal nucleic acid amplification without expensive thermal cycling devices such as PCR, and when two primer sets hybridize with a target sequence, they are ligated to form a hairpin structure, thereby separating the target nucleic acid molecule By using a primer design technique used for hybridization of different primer sets, a single step isothermal ligase reaction in which multiple ligase reactions per single target nucleic acid can be performed, and the use of a thermal cycling device such as PCR in the prior art Compared to the analysis time for a long time by, a detection reaction within 1 hour can be achieved by a single step isothermal ligase reaction, and 5 times lower detection limit can be achieved, and SNP detection can be performed with excellent detection efficiency of 1% sensitivity. I found it.

Accordingly, the present invention is a target nucleic acid detection kit comprising a primer designed to be used for hybridization of another primer set by separating a target nucleic acid molecule by ligation to form a hairpin structure when two primer sets hybridize with a target sequence, and detection using the same It aims to provide a method.

According to an aspect of the present invention, the primary primer comprises a fixed Au nanoshell and a secondary primer having a SERS active dye, and the sequence of the ligation primer ligated with the primary primer and the secondary primer is identical to the sequence of the target nucleic acid. Complementary, having a sequence that forms a hairpin structure after the primary and secondary primers are ligated, the ligation temperature of the primary and secondary primers is higher than Tm between the primary and secondary primers, and the formed hairpin structure Provided is a target nucleic acid detection kit, characterized in that it has a Tm value higher than the Tm of the ligation primer and target nucleic acid.

In one embodiment, the Au nanoshell may have a diameter of 10-1000 nm.

In one embodiment, the target nucleic acid may be a mutation gene of the KRAS gene, preferably a 35G> A mutation or 35G> T mutation gene at codon 12 of the KRAS gene.

In one embodiment, the ligation temperature may be 35-55 ℃.

In one embodiment, the primary primer has a nucleotide sequence of SEQ ID NO: 1, the secondary primer may have a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

In one embodiment, the SERS active dye may be TAMRA or CY3.

According to another aspect of the present invention, (i) obtaining an Au nanoshell by attaching seed gold (Au) to a silica core; And (ii) fixing a thiolated primary primer on the surface of the Au nanoshell obtained in step (iii), to provide a method for preparing an Au nanoshell with a fixed primary primer.

According to another aspect of the present invention, (a) mixing a primary primer immobilized Au nanoshell on a sample to be detected to hybridize the primary primer with a target nucleic acid; (b) mixing the secondary primer having SERS active dye and ligase in the mixture obtained in step (a) and incubating to form an isothermal ligation reaction and a hairpin structure; And (c) detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS.

In one embodiment, the incubation of step (b) may be performed for 30 minutes to 1 hour 30 minutes.

According to the present invention, when two primer sets hybridize with a target sequence, they are ligated to form a hairpin structure, thereby separating the target nucleic acid molecule and using a primer design technique used for hybridization of other primer sets, multiple ligase per single target nucleic acid A single step isothermal ligase reaction in which the reaction is performed can be carried out, and compared to a long analysis time by the use of a thermal cycle device such as PCR in the prior art, detection within 1 hour by a single step isothermal ligase reaction It has been found that the reaction can achieve a 5-fold lower detection limit, and SNP detection can be performed with an excellent detection efficacy of 1% sensitivity.

Accordingly, the kit for detecting a target nucleic acid containing a primer designed specifically for the present invention and a detection method using the same are sensitive and specifically directly and rapidly detect the target nucleic acid to be detected without using a thermal cycling device such as PCR in the field of SNP detection. It can be usefully used as a detectable technology.

1 is a schematic diagram showing single step isothermal detection of multiple KRAS mutations using a hairpin-forming probe specific for AuNS and SNP.
2 is an electrophoresis image on the TBE gel (4-20%) of the oligonucleotides used (Table 1) and ligation products [lane 1: FP1, lane 2: FP2A, lane 3: FP2AC, lane 4: 35G. > A, lane 5: LPA, lane 6: mixture of FP1 and FP2A, lane 7: mixture of FP1 and FP2A treated with DNA ligase for 1 hour in the presence of 35G> A, lane 8: in the presence of 35G> A Mixture of FP1 and FPAC treated with DNA ligase for 1 hour, lane 9: mixture of FP1 FP2A treated with DNA ligase for 1 hour without 35G> A].
3 is a schematic (a) of the synthesis of AuNS, amino-modified silica spheres (b), and TEM images of AuNS (c).
4 is a SERS spectrum obtained after performing an isothermal ligase reaction of FP1 immobilized on AU2 and FP2A (a) or FP2T (b) according to the target sequence.
Figure 5 is a SERS spectrum after performing the isothermal ligase reaction for 1 hour by changing the concentration of the target SNP, (a) 35G> A SERS spectrum of different concentrations of the KRAS gene point mutation, (b) 35G> A concentration comparison It is a plot of 1385 cm ⁻¹ band intensity, and the inset shows a linear relationship between the band intensity and the logarithm of the target nucleic acid concentration of 1.0 × 10 ⁻¹¹ to 1.0 × 10 ⁻⁸ M.
Figure 6 is the SERS spectrum after performing the isothermal ligase reaction for 1 hour by changing the concentration of the target SNP, (a) 35G> T SERS spectrum of different concentrations of the KRAS gene point mutation, (b) 35 G> T concentration It is a plot of contrast 1588 cm ⁻¹ band intensity, and the inset shows a linear relationship between the band intensity and the logarithm of the target nucleic acid concentration of 1.0 × 10 ⁻¹¹ to 1.0 × 10 ⁻⁸ M.
Figure 7 shows the diagnostic sensitivity of the assay using the present invention, S / N ratio of SERS intensity at the characteristic wavenumbers of TAMRA and CY3 for 35G> A and 35G> T in the presence of wild-type KRAS gene.
8 is the SERS intensity obtained according to the concentration of the KRAS mutation (35G> A) shown in the graph of FIG. 5.
9 is the SERS intensity obtained according to the concentration of the KRAS mutation (35G> T) shown in the graph of FIG. 6.

The present invention includes a secondary primer having an Au nanoshell with a primary primer immobilized thereon and a SERS active dye, and the sequence of the ligation primer ligated with the primary primer and the secondary primer is complementary to the sequence of the target nucleic acid, and the primary After the primers and secondary primers are ligated, they have a sequence that forms a hairpin structure, and the ligation temperature of the primary and secondary primers is higher than Tm between the primary and secondary primers, and the formed hairpin structure is identical to the ligation primers. Provided is a target nucleic acid detection kit characterized by having a Tm value higher than that of the target nucleic acid.

In the present invention, when two primer sets hybridize with a target sequence, they are ligated to form a hairpin structure, so that the target nucleic acid molecule is separated and designed to be used for hybridization of other primer sets. As a result, multiple hairpins per target DNA can form on a gold nanoshell (AuNS) surface, which provides highly enhanced and reliable Raman scattering near the surface. Gold nanoparticles (AuNP) can provide a hot spot with a high SERS enhancing factor, but the number of hot spots is irregular, so a gold nanoshell (AuNS) was used in the present invention. Since the primer was labeled with a SERS reporter (active) dye, the present invention can discriminate a single base mismatched target sequence by 1 pM after 1 hour ligation reaction.

In one embodiment, the Au nanoshell may have a diameter of 10-1000 nm, preferably 50-500 nm, more preferably 100-200 nm. At this time, the thickness of the Au nanoshell (thickness of the shell) may be 1-200 nm, preferably 10-100 nm, more preferably 20-40 nm.

In one embodiment, the target nucleic acid is complementary to a ligation primer in which the primary and secondary primers are ligated; Any gene can be detected as long as the Tm of the ligation primer and the target nucleic acid is higher than the Tm and ligation temperature between the primary and secondary primers, and lower than the Tm of the hairpin structure, for example, malaria and tuberculosis It may be a mutation of the same human infectious agent, but is not limited thereto.

In one embodiment, the target nucleic acid may be a mutation gene of the KRAS gene, preferably a 35G> A mutation or 35G> T mutation gene at codon 12 of the KRAS gene.

In one embodiment, the ligation temperature is higher than the Tm between the primary primer and the secondary primer, and may be designed in a range lower than the Tm of the ligation primer and the target nucleic acid, for example, 35-55 ° C, preferably 40 -It may be 50 ℃, but is not limited thereto.

In one embodiment, the primary primer may have a base sequence of SEQ ID NO: 1, and the secondary primer may have a base sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

CAGCTCCAACA (SEQ ID NO: 1)

AAGGAGCTGGTGGACCTACGCCAT (SEQ ID NO: 2)

AAGGAGCTGGTGGACCTACGCCAA (SEQ ID NO: 3)

In one embodiment, the SERS active dye is not limited as long as it can be measured by SERS (surface enhanced Raman scattering), and may be, for example, TAMRA or CY3, but is not limited thereto.

The present invention also (i) attaching the seed gold (Au) to the silica core to obtain an Au nanoshell; And (ii) fixing a thiolated primary primer on the surface of the Au nanoshell obtained in step (iii), to provide a method for preparing an Au nanoshell with a fixed primary primer.

The present invention also, (a) mixing the primary primer immobilized Au nano-shell on the sample to be detected to hybridize the primary primer with the target nucleic acid; (b) mixing the secondary primer having SERS active dye and ligase in the mixture obtained in step (a) and incubating to form an isothermal ligation reaction and a hairpin structure; And (c) detecting a hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS.

The method for detecting a target nucleic acid of the present invention includes a step of mixing the primary primer immobilized Au nanoshell with a target nucleic acid to hybridize the primary primer with the target nucleic acid (that is, step (a)). Step (a) is a step of hybridizing a portion of the sequence of FP1 and a portion of the target nucleic acid by mixing FP1 (primary primer) fixed to the Au nanoshell and a sample (a sample to be detected containing the target nucleic acid).

The method for detecting a target nucleic acid of the present invention is a step of forming an isothermal ligation reaction and a hairpin structure by mixing and incubating a secondary primer having a SERS active dye and a ligase in the mixture obtained in step (a) [ie, step (b )]. Step (b) hybridizes a single-stranded non-hybridized portion of the target nucleic acid and FP2 (secondary primer) in a state where a portion of the sequence of the target nucleic acid and a portion of the sequence of FP1 (primary primer) immobilized on the Au nanoshell are hybridized. Once, FP1 (primary primer) and FP2 (secondary primer) are ligated and linked. At this time, the ligated primer includes a sequence capable of forming a hairpin structure, and since the Tm of the hairpin structure is higher than the Tm of the ligation primer and the target nucleic acid, the target nucleic acid that is bound (hybridized) with the ligation primer reacts (ligation). It is isolated from the ligated primer without changing the temperature, and the isolated target nucleic acid can be reused in the reaction (ligation) of another unligated primer pair. Accordingly, the recycled target nucleic acid causes a single target nucleic acid to participate in multiple ligation reactions on the surface of the AuNS to form multiple hairpins. As a result, the SERS active dye of FP2 of hairpin accumulates on the surface of AuNS and the SERS is amplified in a point-mutation-specific manner.

In one embodiment, the incubation time of step (b) may be performed for 30 minutes to 1 hour 30 minutes, and preferably for 1 hour. SERS measurements amplified in a point-mutation-specific manner can also be obtained by ligation and amplification times for 1 hour.

The method for detecting a target nucleic acid of the present invention includes the step of detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS [ie, step (c)]. In the present invention, surface enhanced Raman scattering (SERS) was introduced as a detection signal for detecting complex DNA and sensitive DNA due to single molecule detection sensitivity, molecular specific fingerprint, and optical stability.

As described above, by using the kit for detecting a target nucleic acid of the present invention, a single step isothermal ligase reaction in which multiple ligase reactions per single target nucleic acid can be performed, and the LOD obtained in the detection method of the present invention is both mutants. It was confirmed to be a very sensitive detection method since it was obtained with 20 atomoles. In addition, compared to the analysis time of a long time by the use of a thermal cycle device such as PCR in the prior art, in the detection method of the present invention, the detection limit of 5 times lower by detection reaction within 1 hour by a single step isothermal ligase reaction It can be achieved and can be performed with good detection efficacy of 1% sensitivity. In the detection method of the present invention, since the amplification of SERS is achieved during the ligation reaction without an additional step for signal amplification, it is possible to detect target nucleic acids to be detected directly and more rapidly and sensitively than the previous method, and various pathogens or their It can be used as an alternative to PCR in countries with limited resources for mutation.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not limited thereto.

<Example>

1. Materials and Methods

(1) Reagent

All chemicals were purchased from Sigma-Aldrich (St. Louis, MO), except where specifically noted, and used without further purification. Oligonucleotides were purchased from Bioneer (Daejeon, Korea).

(2) Synthesis of AuNS

26 nm thick AuNS (diameter: ~ 128 nm) was synthesized according to the method of the prior literature (T. Pham, JB Jackson, NJ Halas and TR Lee, Langmuir , 2002, 18 , 4915-4920). First, silica nanoparticles were prepared by a Stober method. 1.5 mL of tetraethyl orthosilicate (TEOS) (Sigma) was added to 45 mL of ethanol (14.8 N) with 2.8 mL of NH ₄ OH. After reacting for 8 hours, 126 μL of APTES [(3-Aminopropyl) triethoxysilane] was added to the mixture. After incubation for 8 hours, the APTES treated silica core was boiled for 2 hours. The silica core was centrifuged at 2000 g for 30 minutes to remove unreacted reagents. After discarding the supernatant, the pellet was suspended for 10 min in 50 mL of fresh ethanol using a probe sonicator (VC 750, Sonics). The centrifugation purification of the silica core was repeated twice more. Then, a seed gold colloid (2-3 nm) was placed in the silica core. After incubation overnight, the mixture was suspended in 10 mL of ultrapure water and centrifuged at 2000 g for 30 minutes to remove unbound seed gold. The centrifugation step was repeated two more times. The silica core with seed gold colloid was mixed with 1 mL of 0.0148% HAuCl ₄ . 6.7 μL of 30% formaldehyde was added, followed by vigorous vortexing for 10 minutes to initiate the growth of the nanoshell. The thickness of the nanoshell can be controlled by changing the amount of silica core. In order to measure the size and thickness of the nanoshell, high-resolution pictures of the nanoparticles synthesized using TEM (JEM-2100F, JEOL) were obtained.

(3) Immobilization of oligonucleotide on AuNS

All oligonucleotides (see Table 1) were purchased from Bioneer (Daejeon, Korea). Thiol of FP1 [5 '(OP) -CAGCTCCAACA- (SH) 3'] is 10 mM Sigma Aldrich (TCEP) (Tris) in 10 mM sodium phosphate buffer (pH 7.0) for 30 minutes at room temperature. It was activated by treatment with-(2-Carboxyethyl) phosphine). A 200-fold molar excess of thiol-activated FP1 was mixed with AuNS in 1 mL of ultrapure water for 16 hours at room temperature. In order to increase the density of the FP1 coverage at the gold surface, the NaCl concentration was gradually increased to 0.1 M. After an additional 48 hours, excess unbound FP1 was removed by centrifugation with ultrapure water at 8,000 rpm for 25 minutes and repeated 4 times. The AuNS modified with the primer was redispersed in 200 μL of water at room temperature. Table 1 below shows the sequences of the oligonucleotides used in the present invention.

Oligonucleotide order FP1 5 '-(OP) -CAGCTCCAACA- (SH) -3' FP2A 5'-TAMRA-AAG GAGCTGGTGGACCTACGCCAT-3 ' FP2T 5'-Cy3-AAG GAGCTGGTGGACCTACGCCAA-3 ' FP2AC TTTTACGCCAT 35G> A TGG AGCTGATGGCGTA 35G> T TGG AGCTGTTGGCGTA LPA (ligated FP1 and FP2A) AAGGAGCTGGTGGACCTACGCCATCAGCTCCAACA 35G (wild type target) TGG AGCTGGTGGCGTA

(4) Gel electrophoresis of oligonucleotides

Electrophoresis of the oligonucleotides and ligated products used was carried out by loading the sample on a TBE polyacrylamide gel (4-20%) and deploying the gel at 180 V for 50 minutes. After electrophoresis, the gel was stained for 40 min in 1 x TBE buffer (pH 8.0) containing dye [1 x SYBR Green I Nucleic Acid Gel Stain (Thermo Fisher Scientific, USA)]. UV excitation fluorescence pictures of the stained gel were obtained using a Davinchi-Gel Imaging System (Davinchi-K, Korea).

(5) Isothermal ligand reaction and SERS measurement

20 μL with 20 mM Tris-HCl (pH 7.6), 25 mM Mg (CH ₃ COOH) ₂ , 10 mM KCH ₃ COOH, 1 mM NAD and 0.1% Triton X-100 in the presence of varying amounts of target nucleic acid To a solution containing FP1 modified AuNS (0.2 nM) in the reaction buffer, FP2A (0.2 μM final) or FP2T (0.2 μM final) and Taq DNA ligase (3 U / μL final) were added. The mixture was incubated at 45 ° C. for 1 hour. 10 μl of the reacted sample was dried in a clean glass with nitrogen gas. Using a confocal Raman microscope (LabRAM HR Evolution, HORIBA), the spot of the sample (the diameter of the focused 633 nm laser was 1.03 μm) was scanned 10 times using a 3 second integration time for each scan.

2. Results

1 is a schematic diagram showing multiple linkage of primers to a single target on AuNS. For isothermal recycling of targets for sensitive SNP screening, primer sets FP1 and FP2 are designed to form a hairpin structure when ligated after complexing with the target. Since the ligated primer turns into a hairpin by itself, the bound target can be separated from the ligated primer without changing the reaction temperature and reused for another ligation of the unligated primer pair. In the course of the ligation reaction, the recycled target causes the formation of multiple hairpins per single target on the surface of the AuNS. As a result, the SERS active dye of FP2 of hairpin accumulates on the surface of AuNS so that the SERS is amplified in a point-mutation-specific manner.

35G> A and 35G> T at codon 12 of the KRAS gene were selected for multiple detection of point mutations in the KRAS gene. Before performing the reaction on AuNS, the design of primer sets FP1 and FP2 for multiple formation of target specific hairpins should be verified. The sequence of the primers should be carefully designed such that they are ligated upon hybridization with a specific target and form hairpins only thereafter. Otherwise, self-hybridization between the stem sequences of the primer set may occur, resulting in a false-positive signal. In order to avoid self-hybridization, the fusion temperature, Tm of the complex between FP1 and FP2, that is, the melting point must be sufficiently lower than the ligation temperature. The calculated Tm of the two complexes, FP1 / FP2A and FP1 / FP2T, was 25.5 ° C. The ligation reaction was performed at 45 ° C. higher than the Tm of hybridization, so self-hybridization is negligible.

For multiple ligations, the hairpin's Tm must be high enough to separate the bound target. The Tm (77.5 ° C for 35G> A, 79.6 ° C for 35G> T) of the hairpin was higher than the Tm (60.7 ° C for 35G> A, 61.3 ° C for 35G> T) of the ligated primer and target complex. Gel electrophoresis was performed to identify sequences designed to avoid target specific multiple ligation and self-hybridization. 2 is a photograph of acrylamide gel irradiated with ultraviolet light after electrophoresis at 180 V for 50 minutes.

The self-hybridized primer should appear as a fluorescent band closer to the origin than the bands of lane 1 and lane 2 loaded with FP1 or FP2A, respectively. However, the two bands of lane 6 loaded with a mixture of FP1 and FP2A were located at the same position as the bands of lane 1 and lane 2, and there was no additional band in lane 6 near the origin than the two bands. The accuracy of the sequence was demonstrated to avoid self-hybridization between the two primers from the band position in lane 6. The role of hairpin formation in multiple ligations of primers hybridized to a single target was also demonstrated by electrophoresis analysis. Lanes 7 and 8 were loaded with a mixture of FP1 and FP2A and FP2AC for 1 hour, respectively, in the presence of target nucleic acid and DNA ligase. FP2AC can hybridize to 35G> A but did not form hairpins after ligation to FP1. In both lanes, the same band close to the origin was located at the same spot as the band in lane 5, which is an oligonucleotide having the sequence of the ligated primer. In contrast to the same band located in both lanes, the signal strength of the band in lane 7 was higher than that of lane 8. The relatively high intensity of the lane 7 band means a greater number of ligated primers in lane 8 of the same amount of target nucleic acid, thus confirming that there is multiple ligation per single target nucleic acid by the formation of hairpins after ligation of the primer Became. To identify self-ligating primers without target nucleic acids, the ligase and the same primers in lane 7 were loaded in lane 9 without target nucleic acids. No band corresponding to the ligated primer was shown, confirming that there was no self-ligation without the target nucleic acid. Since it was proved that multiple hairpin formation for SNP-specific SERS was accurately designed by gel electrophoresis, FP1 was immobilized on AuNS (see FIG. 3), and an isothermal ligation reaction was performed. After reacting with FP1 immobilized in AuNS in the presence of FP2A and FP2T according to the point mutation sequence of 35G> A or 35G> T, the SERS signal was measured and the results are shown in FIG. 4. To detect 35G> A and 35G> T, TAMRA (Tetramethylrhodamine) and CY3 were labeled with FP2A and FP2T, respectively. As shown in Figure 4, the SERS signal obtained from the spot was exactly consistent with the added type of mutation and probe. That is, in the SERS spectrum obtained from the spot where the added probe and the target SNP matched, a characteristic wave number of each TAMRA and CY3 for 35G> A and 35G> T was shown. In contrast, no characteristic wavenumber was observed in spots to which wild type targets or inconsistent SNP-containing mutants were added. It can be seen from FIG. 4 that SNPs of KRAS mutations can be successfully detected by analyzing SERS measured using FP1 immobilized AuNS in combination with other non-fixed primers.

Next, an isothermal ligation reaction was performed by varying the amount of addition of the target nucleic acid from 0 to 100 nM. For 35G> A and 35G> T, 1385 cm ^-1 and 1588 cm ^-1 , respectively, were selected as representative wave numbers, which correspond to the distinct and strong wave numbers of the labeled dyes. 5 and 6 show the intensity of a representative wave number according to the amount of target nucleic acid added. The intensity of wave number increased proportionally as the amount of target added increased. A linear relationship between SERS intensity and target concentration for each mutation in the range of 10 pM to 10 nM was obtained. The values after background subtraction of the SERS signal for low 35G> T and 35G> A of 10 pM corresponding to 20 atomolar were 9.5 ± 1.3 and 7.5 ± 1.2, respectively. No signal was obtained for the 0.1 pM mutant target. Therefore, the LOD of the detection method of the present invention was determined to be 20 atomoles in both mutations. Prior literature [HT Ngo, N. Gandra, AM Fales and SM Taylor, Biosen. Bioelectron., 2016, 81, 8-14] has reported that 100 Atomol malaria SNPs were detected using SERS nanorattle. In the detection method of the present invention, it was designed to form multiple hairpins for a single target in AuNS. In addition, a SERS signal was generated while the hairpin was being formed. As a result, in the present invention, it was possible to achieve a detection limit 5 times lower with a detection reaction within 1 hour than the prior art method.

Finally, the sensitivity of the present invention was investigated. An isothermal ligation reaction was performed with a mixture of each point mutation and wild type target. 7 shows that the SERS intensity of each representative wave decreases as the proportion of mutants decreases in the presence of a wild-type target. A relatively high SERS intensity was detected until the point mutant became 1% compared to the intensity of 100% of the wild type target. The SERS intensity obtained after detection was performed on 1% mutants by the method of the present invention was at least about 1.5 times higher than the intensity obtained in the case of 100% wild type target. Therefore, the sensitivity of the present invention can be evaluated as 1%.

In conclusion, a single-step isothermal multiple ligase reaction per single target, combined with SERS, has been successfully developed for sensitive and specific detection of point mutations in the KRAS gene. In the isothermal ligase reaction, primers that form hairpins upon target specific ligation were first introduced in the present invention. The role of hairpin forming primers for multiple ligation was demonstrated by electrophoresis analysis and sensitive detection. Nanomaterials including AuNP and graphene oxide have been used for DNA ligase reactions as fluorescent receptors. The present invention has shown excellent results in discriminating single base mismatches in target sequences. Since there was no amplification of the ligated product in the prior art, the detection sensitivity of the assay was limited to an amount of 1 picomolar.

Among the reported SNP detection isothermal analysis, an invader assay combined with fluorescence amplification can detect a target at a level of 1 zeptomole (10 ^-21 mole). However, the invader assay requires 4 hours of enzymatic reaction for such sensitivity. Analysis sensitivity in the present invention is an effect that can be achieved within 1 hour without PCR.

In the conventional ligase chain reaction, ligation and separation between the primer and the target are thermally controlled, and thus, a sophisticated and expensive thermocycling device is required. Previously, the inventors of the present invention have reported an isothermal ligation reaction that combines a recycling probe assay without PCR. In the above method, it was possible to detect the level of 10 Atomol of 35G> A of the KRAS mutation. However, the steps for ligation reaction and signal generation consist of individual steps requiring a minimum of 2 hours of reaction to achieve the sensitivity. In contrast, the method of the present invention is a more direct method than the previous method because SERS is obtained during the ligation reaction without additional steps for signal amplification.

In the method of the present invention, it is possible to detect 20 atomolar KRAS mutations within 1 hour. Compared to other reported isothermal SNP detection methods using SERS, the LOD of the single step ligase reaction of the present invention was determined to be at least 5 times lower. In clinical applications, commercial kits have a diagnostic sensitivity of 5%. The method of the present invention can detect 1% variation in both 35G> A and 35G> T in the presence of a wild type target. Thus, it has been demonstrated that the method of the present invention can successfully detect two different point mutations. In the present invention, the hairpin forming primer was used as a thermocycler to separate the target at a fixed temperature. Amplification of SERS was achieved without additional steps for signal amplification by direct ligation of primers in AuNS. Since SNP-specific signal amplification was performed at a fixed, mild condition temperature, cost-effective SNP detection can be performed with ordinary inexpensive equipment, such as a microplate reader. Therefore, the method of the present invention can be used through proper sample preparation as an alternative to PCR in countries where resources are limited for SNP detection of KRAS mutations as well as mutations of human infectious agents such as malaria and tuberculosis.

<110> Daegu-Gyeongbuk Medical Innovation Foundation <120> One-step isothermal detection method of gene mutation using          hairpins formed on a gold nanoshell <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 11 <212> DNA <213> Homo sapiens <400> 1 cagctccaac a 11 <210> 2 <211> 24 <212> DNA <213> Homo sapiens <400> 2 aaggagctgg tggacctacg ccat 24 <210> 3 <211> 24 <212> DNA <213> Homo sapiens <400> 3 aaggagctgg tggacctacg ccaa 24

Claims (10)

The primary primers include Au nanoshells with a fixed diameter of 10-1000 nm and secondary primers with SERS active dye, and the sequences of the ligation primers ligated with primary and secondary primers are complementary to those of the target nucleic acid, , After the primary and secondary primers are ligated, have a sequence that forms a hairpin structure, and the ligation temperature of the primary and secondary primers is higher than Tm between the primary and secondary primers, and the formed hairpin structure is Kit for detecting a target nucleic acid, characterized in that it has a Tm value higher than the Tm of the ligation primer and the target nucleic acid. delete The kit for detecting a target nucleic acid according to claim 1, wherein the target nucleic acid is a variant gene of the KRAS gene. The kit for detecting a target nucleic acid according to claim 1, wherein the target nucleic acid is a 35G> A mutation or a 35G> T mutation gene in codon 12 of the KRAS gene. The kit for detecting a target nucleic acid according to claim 1, wherein the ligation temperature is 35-55 ° C. The kit for detecting a target nucleic acid according to claim 1, wherein the primary primer has a nucleotide sequence of SEQ ID NO: 1, and the secondary primer has a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The kit for detecting a target nucleic acid according to claim 1, wherein the SERS active dye is TAMRA or CY3. The method of claim 1, wherein the primary primer is Au nanoshell having a fixed diameter of 10-1000 nm
(Iii) attaching seed gold (Au) to the silica core to obtain an Au nanoshell having a diameter of 10-1000 nm; And
(Ii) fixing the thiolated primary primer on the surface of the Au nanoshell obtained in step (i)
A kit for detecting a target nucleic acid comprising a primary primer, which is prepared by a method of manufacturing an Au nanoshell having a fixed diameter of 10-1000 nm. (a) mixing a primary primer with a target target nucleic acid by mixing Au nanoshells having a diameter of 10-1000 nm with a primary primer fixed thereon;
(b) mixing the secondary primer having SERS active dye and ligase in the mixture obtained in step (a) and incubating to form an isothermal ligation reaction and a hairpin structure; And
(c) detecting the hairpin structure formed on the Au nanoshell by measuring the product obtained in step (b) with SERS
Including,
The sequences of the ligation primers in which the primary and secondary primers are ligated are complementary to the sequence of the target nucleic acid, and have a sequence that forms a hairpin structure after the primary and secondary primers are ligated, primary and secondary Method of detecting a target nucleic acid, characterized in that the ligation temperature of the primer is higher than the Tm between the primary primer and the secondary primer, and the formed hairpin structure has a Tm value higher than the Tm of the ligation primer and the target nucleic acid. The method of claim 9, wherein the incubation of step (b) is performed for 30 minutes to 1 hour 30 minutes.

Images