KR20190142555A - Method for detecting microorganisms using multiple probe hybridization - Google Patents

Abstract

The present invention relates to a method for detecting microorganisms using multi-probe hybridization. The detection method according to one aspect may detect microorganisms without culturing microorganisms, or purifying or amplifying genetic materials by a step of concentrating the microorganisms in a sample. In addition, since the microorganisms contained in the sample may be immobilized and repeatedly detected by a washing process, multiple detection may be performed using various probes.

Description

Method for detecting microorganisms using multiple probe hybridization

A microbial detection method using multiple probe hybridization.

In general, as a method for diagnosing pathogenic microorganisms, a method of observing using a microscope, an immunological method for detecting a specific antigen of a pathogenic microorganism, and a method for amplifying a specific gene using PCR techniques are used. However, the application of microscopic methods requires pathogens to be large enough to be observed under normal microscopy, dense enough to be easily found in the specimen, and distinct in form from other organisms. In other words, microscopic organisms such as viruses or bacteria that are similar in shape to each other are difficult to accurately diagnose using a microscope. In addition, immunological methods of tracking antigens of pathogenic microorganisms can accurately diagnose the causative organism, but this requires that the causative pathogenic microorganisms have a high density and that it is always possible to obtain antibodies to the unique antigen of all pathogenic microorganisms. There is a problem that it does not. In addition, the PCR method of amplifying a specific gene possessed only by pathogenic microorganisms and then confirming the existence of the gene is capable of accurate diagnosis, but it is greatly influenced by various factors because the gene amplification process must be performed. For example, impurities remaining in the process of refining the genetic material may inhibit amplification or cause nonspecific amplification, and the process of purifying the genetic material and amplifying the gene may be time consuming and expensive. There is a problem such as requiring a skilled professional. Therefore, the microorganism may be cultured to obtain a high concentration of pathogenic microorganisms without amplifying the gene, but it is difficult to culture the microorganisms because it is difficult to know the culture conditions of the microorganisms. In addition, the microbial detection method using fluorescence staining immunologically has the disadvantage that it can not selectively detect the microorganisms.

Accordingly, the present inventors have made a thorough research to solve the problems of the conventional methods for diagnosing and detecting the above-described microorganisms. As a result, the present inventors have developed a method for identifying microorganisms that can be repeatedly detected without microbial culture or gene amplification by concentrating microorganisms. The present invention has been completed.

One aspect provides a method by which microorganisms can be detected by enriching and immobilizing microorganisms without culturing the microorganisms or amplifying genetic material, and by hybridizing one or more probes sequentially.

One aspect includes concentrating or immobilizing microorganisms contained in a sample; And hybridizing the labeled probe to the microorganism by sequentially contacting the labeled probe, and detecting a signal emitted from the sequentially hybridized probe, respectively.

The multiple detection method of the microorganism includes the step of concentrating or immobilizing the microorganism contained in the sample.

In the present specification, the "sample" may include a biological sample, an environmental sample, or a food sample.

The biological sample may refer to a sample obtained from a biological subject including a sample of biological tissue or body fluid origin obtained in vivo or in vitro. Specifically, the biological sample may be, but is not limited to, body fluids (eg, blood, plasma, serum, saliva, sputum or urine), organs, tissues, fractions, and cells isolated from mammals, including humans. Do not. It may also include extracts from biological samples, such as antibodies, proteins, and the like, from biological fluids (eg, blood or urine).

The environmental sample may include a water sample or a soil sample.

The sample may include a microorganism.

In the method, the step of concentrating or immobilizing may further include contacting the sample with the magnetic particles to bind the microorganisms contained in the sample with the magnetic particles.

In the present specification, the "magnetic particles" may refer to particles having paramagnetic. Paramagnetic refers to the property of weakly magnetizing in the direction of a magnetic field when it is present. The magnetic particles may be prepared by known methods or may be commercially available. The diameter of the magnetic particles is not particularly limited, but may be small magnetic nanoparticles, 1 nm to 500 nm, 50 nm to 400 nm, or 100 nm to 300 nm, the magnetic material of the magnetic particles It is characterized in that it is a magnetic metal or a magnetic metal oxide (for example, a metal oxide such as iron oxide). The magnetic metal is iron group metal elements (Fe, Ni, Co), rare earth elements (La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu), money Metal elements (Cu, Ag, Au), zinc group elements (Zn, Cd, Hg), aluminum group elements (Al, Ga, In, Tl), alkaline earth metal elements (Ca, Sr, Ba, Ra) and platinum group elements ( Pt, Pd, etc.) may be made of one or more selected metals or alloys thereof. The magnetic particle of one embodiment may include, for example, at least one selected from the group consisting of Co, Mn, Fe, Ni, Gd, Mo, MM ' ₂ O ₄ and MpOq. Herein, M and M 'each represent Co, Fe, Ni, Mn, Zn, Gd or Cr, and 0 <p <= 3 and 0 <q <= 5.

The magnetic particles may be coated with a microorganism adhesion factor on the surface. As used herein, the term “microbial adhesion factor” is a factor capable of binding to (glue) glycoproteins or carbohydrates on the surface of various microorganisms such as viruses, bacteria, protozoa, and the like, for example, any of various kinds of microorganisms. An antibody capable of binding to, a fragment of the antibody, an aptamer, a nucleic acid, a peptide, a protein, or any compound. The microorganism adhesion factor is, for example, mannose binding lectin (MBL), C-reactive protein (CRP), opsonin, CD14, toll like receptor 4 (Toll like receptor 4: TLR4) It may comprise one or more selected from the group consisting of, NET (Neutrophil extracellular trap), and cytokine receptor.

When various kinds of microorganism adhesion factors capable of binding various kinds of microorganisms are coated on the surface of the magnetic particles, the magnetic particles may bind to any microorganism included in the sample through the microorganism adhesion factors.

When the surface of the magnetic particle is coated with a target microorganism adhesion factor capable of binding to a specific kind of microorganism, the magnetic particle may bind with a specific microorganism included in the sample through the target microorganism adhesion factor.

In the step of contacting the sample with the magnetic particles and the microorganisms contained in the sample and the magnetic particles, a magnetic field may be applied to the sample containing the microorganisms combined with the magnetic particles to immobilize the microorganisms. The magnetic field can be formed by any conventional method. For example, it may be performed using an electromagnet by electromagnetic induction, a magnet such as a permanent magnet, or the like. One or more magnets may be included, and may be applied in various arrangements, such as series, parallel, and circular. The magnetic field is not affected by the surrounding environment such as pH, temperature, ions, etc., and thus has excellent stability.

In one embodiment of the present invention, the microparticles contained in the sample are bound to the magnetic particles by contacting the sample and the magnetic particles coated with the microorganism adhesion factor. As such, by applying a magnetic field to a sample including magnetic particles to which microorganisms are bound to fix the magnetic particles, the microorganisms contained in the sample may be immobilized together with the magnetic particles and separated from the remaining samples except for the microorganisms. can do. In addition, since microorganisms can be immobilized, multiple microorganisms can be detected by sequentially contacting probes.

The multiple detection method of the microorganisms includes the steps of sequentially contacting the labeled probes with the microorganisms to hybridize with the microorganisms, and detecting the signals emitted from the sequentially hybridized probes, respectively.

In the detecting of the signal, after detecting the signal emitted from one probe hybridized with the microorganism, the method may include washing the one probe before hybridizing the other probe. The washing may be performed by any sample used to wash the probe in the art, for example, may be performed with a solution containing formamide. The concentration of formamide may be selected by a person skilled in the art to a preferred concentration, but from about 10% (v / v) to about 90% (v / v), or from about 40% (v / v) to about 80% (v / v) concentration.

The washing may be performed once, or repeatedly performed two or more times.

The washing may be washing with a formamide solution at about 70 to 75 ℃.

By the washing step, one probe bound to the microorganism may be removed. After washing, the single probe is 10% or less than before washing, for example 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or 0 May remain as a%.

By effectively removing one probe bound to the microorganism by the washing step, noise is not generated even after hybridizing the other probe, so that the microorganism can be detected with high sensitivity, high specificity, and high reproducibility.

The one probe and the other probe may be different distinguishing probes which may each hybridize sequentially to two or more different microorganisms in the sample. In addition, the probe may be the same probe that can be repeatedly hybridized with the same microorganism in the sample. In addition, the probe may be the same probe capable of hybridizing to the same region in two or more different microorganisms in the sample. In addition, the probe may be a different probe capable of hybridizing to different regions in the same kind of microorganism in the sample, respectively.

The same probe may be labeled with the same or different label. In addition, the different probes may be labeled with the same or different label.

In the method, the labeled probe may be labeled with a fluorescent material, a coloring material, or a chemiluminescent material. The probe may be labeled with a fluorescent material, a coloring material, or a label of a chemiluminescent material to visualize (or image) the microorganism and detect the microorganism.

The fluorescent material is selected from the group consisting of FAM, VIC, HEX, Cy5, Cy3, SYBR Green, DAPI, TAMRA, FITC, RITC, Rhodamine, Fluoredite, FluorePrime, and ROX It may include one or more fluorescent materials, but is not limited thereto. By using a probe labeled with such a fluorescent substance, hybridization and dissociation can be easily confirmed only by simple imaging by variation of each fluorescent signal.

-D-갈락토시다제(

-D-galactosidase:

-Gal)를 포함할 수 있으나, 이에 제한되는 것은 아니다.The coloring material is horse radish peroxidase (HRP), alkaline phosphatase (Alkaline Phosphatase: ALP),

-D-galactosidase (

-D-galactosidase:

-Gal), but is not limited thereto.

The chemiluminescent material may include GFP, luciferin, and the like, but is not limited thereto.

In this method, the "probe" is a part of the microorganism, for example, a polysaccharide expressed on the surface of the microorganism, genetic material in the microorganism (DNA, RNA, etc.), an antibody binding to the protein of the microorganism, aptamers, DNA, RNA , PNA (Peptide Nucleic Acid), oligosaccharides, peptides or proteins.

In this method, the step of detecting a signal emitted from the hybridized probe may be performed by methods known in the art, for example, histology, immunohistochemistry, immunofluorescence, in situ hybridization, fluorescence in situ hybridization (FISH), or the like. have.

The presence or absence of the microorganism and the type of the microorganism can be determined by comparing the signal of the portion where the signal emitted from the probe hybridized with the microorganism exists and the signal of the other portion. In addition, the concentration of the microorganisms contained in the sample can be obtained by comparison using a standard sample containing the microorganisms at a known concentration.

The method does not include culturing the microorganism or amplifying the genetic material of the microorganism. In general, since microorganisms contained in biological samples, environmental samples, or food samples are often very small, the method of measuring signals emitted from labeled probes by combining a conventionally labeled probe with a microorganism is inefficient. have. In order to increase measurement efficiency, microorganisms in a sample are purified, microorganism genetic material is amplified by PCR, or a method of culturing microorganisms. However, in the process of purifying microorganisms, modification may occur, and The amplification process takes a long time and cannot be used when genetic information is not known, and it is difficult to set culture conditions when unknown microorganisms are included or when a large number of microorganisms are included. However, according to one embodiment of the method includes culturing the microorganism or amplifying the genetic material of the microorganism because the microorganism can be concentrated or immobilized by attaching the microorganism to the magnetic particle and separating the magnetic particle by the magnetic field. Microbes can be detected efficiently without

In the method, the microorganism may include bacteria, viruses, fungi, fungi, or a combination thereof.

Another aspect includes concentrating or immobilizing microorganisms contained in a sample; And contacting the labeled probes sequentially with the microorganisms to hybridize with the microorganisms, and detecting the signals emitted from the sequentially hybridized probes, respectively.

In the method of providing the above information, the sample, the microorganism enrichment, the immobilization, the labeled probe, and the signal detection are as described above.

The method of providing the information may include determining whether the microorganism is present or the type of the microorganism by using information of the probe from which the signal is emitted.

For example, if probes specific for E. coli are used, E. coli can be determined by the type of microorganisms contained in the sample if signals are emitted from these probes. By determining the type of microorganisms contained in the sample, it is possible to provide information regarding the possibility of the development of an infectious disease, whether or not it has occurred, or the diagnosis of the type of infectious disease.

The detection method according to one aspect may detect the microorganism without culturing the microorganism or purifying or amplifying the genetic material by concentrating the microorganism in the sample. In addition, since the microorganisms contained in the sample may be immobilized and repeatedly detected by a washing process, multiple detection may be performed using various probes.

FIG. 1 is a photograph of microorganisms bound to magnetic nanoparticles by concentrating a magnetic field in a microfluidic channel.
2 is a micrograph of FISH results (A) using a common probe labeled with Cy3, FISH results (B) using an E. coli 16s rRNA specific probe labeled with Cy5, and merge (C).
Figure 3 is a micrograph of FISH results (A) using a common probe labeled with Cy3, FISH results (B) using a S. aureus 16s rRNA specific probe labeled with Cy5, and merge (C).
Figure 4 is a fluorescence micrograph of the first FISH result (A), the result was washed with formamide solution (B), 2 car FISH result (C) of the S, aureus for the S, aureus.
5 is a photograph showing the results of the primary FISH for E. coli , phase contrast microscope (A), Cy5 fluorescence detection (B), Cy3 fluorescence detection (C).
FIG. 6 is a photograph showing the results of the second-order FISH for E. coli , phase contrast microscope (A), Cy3 fluorescence detection (B), and Cy5 fluorescence detection (C).
7 is a photograph showing the results of the third-order FISH for E. coli , phase contrast microscope (A), Cy5 fluorescence detection (B), Cy3 fluorescence detection (C).
8 is a photograph showing the results of phase difference microscope (A), Cy3 fluorescence detection (B), and Cy5 fluorescence detection (C) as a result of the fourth order FISH for E. coli .
Figure 9 is a graph of the multiple FISH results for E. coli by Image J (n = 10).

Hereinafter, the present invention will be described in more detail with reference to examples, which are merely illustrative and are not intended to limit the scope of the present invention. It is apparent to those skilled in the art that the embodiments described below may be modified without departing from the essential gist of the invention.

Example 1 Treatment of Sample

Magnetic nanoparticles were used to fix and concentrate the samples. Specifically, lectin (10405-HNAS, Human Mannose Binding Lectin, Sinobio, China), which is a microbial adhesion protein, was coated on the surface of the magnetic nanoparticles (200 nm, Ademtec, France). Lactin-coated magnetic nanoparticles were mixed with TBST buffer (including 5 mM CaCl ₂ ) containing microorganisms ( E. coli or S. aureus ). Microorganisms are attached to the magnetic nanoparticles by the lectins coated on the surface of the magnetic nanoparticles, and the magnetic susceptibility of the entire sample is changed by the mixed magnetic nanoparticles. The sample was processed and prepared in this way.

Example 2 Concentration of Pathogenic Microorganisms in a Sample Using Magnetic Particles

In order to concentrate the pathogenic microorganisms present in the sample, first, 99.9% ethanol, distilled water, and 1X Phosphate Buffered Saline (PBS) are sequentially flowed into the inlet of the microfluidic channel using a syringe pump or a pneumatic pump. Washed. The microfluidic channels used were fabricated by photolithography and PDMS micromolding methods. After washing the microfluidic channel, the sample treated as in Example 1 was flowed into the microfluidic channel and at the same time a magnetic field was formed using a permanent magnet or an electromagnet. When a magnetic field is formed around the microfluidic channel, magnetic nanoparticles mixed in the sample are collected around the magnetic field. Here, the magnetic nanoparticles captured around the magnetic field are bound to the pathogenic microorganisms in the sample by lectins immobilized on the surface of the magnetic nanoparticles.

Therefore, when the sample flows through the microfluidic channel, the magnetic nanoparticles in which the microorganisms in the sample are bound are attached to the magnetic field and only the sample flows, so that the microorganisms are concentrated.

FIG. 1 is a photograph of microorganisms bound to magnetic nanoparticles by concentrating on a channel by forming a magnetic field in a microfluidic channel.

Example 3: Detection of Microorganisms

3.1 Fluorescent in situ hybridization (FISH) analysis method

FISH analysis was performed to detect the concentrated microorganisms in Example 2. FISH analysis was performed on the captured microorganisms by flowing the cell permeability reagent, FISH buffer (Fluorescence in situ Hybridization buffer), DAPI, and 2X SSC buffer into the channels in order to the microfluidic channel with microorganisms concentrated. . After all treatments, image analysis was performed via fluorescence microscopy.

3.2 Identification of Microbes by Microbial Specific Probe Staining

The microorganisms attached to and captured by the magnetic nanoparticles may have various kinds of microbial species since they are attached to the magnetic nanoparticles through lectins, which are immunoproteins that recognize various polysaccharides expressed on the surface of the microorganisms. In order to identify various kinds of microorganisms, they were stained with a microorganism specific probe as follows.

3.2.1 E.coli  detection

FISH was performed in the same manner as above 3.1 using a common probe labeled with Cy3 (GGTGTGACGGGCGGTGTGTACAAG), and an E. coli 16s rRNA specific probe labeled with Cy5 (GGTAAGCGCCCTCCCGAAGGTTAAGCTACC). Using an epi-fluorescence microscope, the results were confirmed under conditions of a light source: 130 W Xenon lamp, acquisition condition: 20% power, CCD exposure time: 100 ms.

Figure 2A is a micrograph confirming the results of FISH using a common probe labeled with Cy3.

Figure 2B is a micrograph confirming the FISH results using an E. coli 16s rRNA specific probe labeled with Cy5.

FIG. 2C is a photograph in which FIG. 2A and FIG. 2B are merged.

As shown in Fig. 2A-C, by concentrating the microorganisms, various microorganisms present in the sample were detected without the process of purifying or culturing the microorganism or amplifying the nucleic acid, and among them, E. coli can be specifically detected. Confirmed.

3.2.2 S.aureus  detection

In the same sample from which the E. coli was detected, FISH was carried out in the same manner as in 3.2.1 to detect S. aureus , but the probes were a common probe labeled with Cy3, and a 16s rRNA S. labeled with Cy5. aureus Changed to specific probes (GGGATTTGCTTGACCTCGCGGTTTCGCTGCCC).

Figure 3A is a micrograph confirming the FISH results using a common probe labeled with Cy3.

3B shows S. aureus labeled Cy5 It is a photomicrograph which confirmed the FISH result using the 16s rRNA specific probe.

3C is a photograph of the merged FIGS. 3A and 3B.

As shown in FIGS. 3A-C, by concentrating the microorganisms, various microorganisms present in the sample were detected without the process of purifying or culturing the microorganisms or amplifying the nucleic acid. Among them, S. aureus can be specifically detected. Confirmed.

Example 4. Multiple FISH Assays

Through Example 3, it was confirmed that the microorganisms can be effectively detected by concentrating the microorganisms without a separate purification step, culture step, or amplification step.

In order to concentrate the microorganisms in the sample and to confirm that multiple detection can be performed on the same sample, multiple FISH was performed as follows.

For the first FISH, immunostaining was performed using S. aureus 16s rRNA specific probe labeled with Cy5 in microfluidic channels enriched with microorganisms as in Example 2, and microorganisms were detected by a phase contrast microscope. 4A.

For washing, 40% formamide solution was flowed into the microfluidic channel and washed at 73 ° C for 3 minutes. 4B shows the result of detecting the microorganisms under a fluorescence microscope to confirm the washing well.

For the second FISH, after washing, immunostaining was performed using S. aureus 16s rRNA specific probe labeled with Cy5, and microorganisms were detected by fluorescence microscopy.

As shown in FIG. 4A, since the signal detected from the S. aureus specific probe was confirmed, it was confirmed that S. aureus concentrated in the microfluidic channel could be effectively detected without a separate amplification process.

As shown in Fig. 4B, since almost no fluorescence signal was detected, it can be seen that the washing efficiency by formamide treatment was excellent.

As shown in FIG. 4C, signals detected from S. aureus specific probes disappeared by washing.

According to the results, it was confirmed that the signal by the fluorescent probe is reduced to a level similar to the noise level by formamide washing. In addition, since the microorganisms are fixed and concentrated by the magnetic nanoparticles, it was confirmed that the microorganisms can be repeatedly detected and identified using one or more fluorescent probes in one sample.

Example 5: Concentration and Detection of Microorganisms Using Centrifugation

The sample treated as in Example 1 was placed in an EP tube, concentrated using centrifugation, and multiple FISH was performed.

Specifically, for the first FISH, immunostaining was performed using a Cy5 labeled E. coli 16s rRNA consensus probe (GGTGTGACGGGCGGTGTGTACAAG) in a tube enriched with microorganisms, and the result of detecting the microorganisms with a phase contrast microscope is shown in FIG. 5A. And Cy5 were detected by fluorescence microscope in FIG. 5B and Cy3 was detected by fluorescence microscope in FIG. 5C.

For secondary FISH, 40% formamide solution was flowed into the tube and washed. After washing, immunostaining was performed using a Cy3 labeled E. coli 16s rRNA consensus probe (GGTGTGACGGGCGGTGTGTACAAG), and microorganisms were detected by phase contrast microscopy. FIG. 6A and Cy3 were detected by fluorescence microscopy. , Cy5 was detected by fluorescence microscopy, and the results are shown in FIG. 6C.

For the third FISH, 40% formamide solution was poured into the tube and washed. After washing, immunostaining was performed using a Cy5 labeled E. coli 16s rRNA consensus probe (GGTGTGACGGGCGGTGTGTACAAG), and microorganisms were detected by phase contrast microscopy. , Cy3 was detected by fluorescence microscopy, and the results are shown in FIG. 7C.

For the fourth FISH, 40% formamide solution was poured into the tube and washed. After washing, immunostaining was performed using a Cy3 labeled E. coli 16s rRNA consensus probe (GGTGTGACGGGCGGTGTGTACAAG), and microorganisms were detected by phase contrast microscopy. FIG. 8A and Cy3 were detected by fluorescence microscopy. , Cy5 was detected by a fluorescence microscope in Fig. 8C.

With respect to the above results, a graph analyzing the result of performing multiple FISH by Image J is shown in FIG. 9 (n = 10).

As shown in FIG. 9, it was confirmed that the signal by the fluorescent probe was reduced to a level similar to the noise level by formamide washing. In addition, since the microorganisms are fixed and concentrated by centrifugation, it was confirmed that one or more fluorescent probes can be repeatedly detected and identified in one sample.

Claims (16)

Concentrating or immobilizing the microorganisms contained in the sample; And
And contacting the labeled probes sequentially with the microorganisms to hybridize with the microorganisms, and detecting the signals emitted from the sequentially hybridized probes, respectively. The method of claim 1, wherein the sample is a biological sample, an environmental sample, or a food sample. The method of claim 1, wherein the concentrating or immobilizing further comprises contacting the sample with the magnetic particles to bind the microorganisms contained in the sample with the magnetic particles. The method of claim 3, wherein the magnetic particles are coated with a microorganism adhesion factor on a surface thereof. The method according to claim 4, wherein the microorganism adhesion factor is mannose binding lectin (MBL), C-reactive protein (CRP), opsonin, CD14, Toll like receptor 4: (Tll4 receptor) ), NET (Neutrophil extracellular trap), and cytokine receptors. The method of claim 3, wherein the microorganism is immobilized by applying a magnetic field to a sample including the microorganism bound to the magnetic particles. The method of claim 1, wherein the detecting of the signal comprises detecting the signal emitted from one probe hybridized with the microorganism and then washing the one probe before hybridizing the other probe. Way. The method of claim 1, wherein said washing is performed with a solution comprising formamide. The method of claim 1, wherein the labeled probe is labeled with a fluorophore, chromophore, or chemiluminescent material. The method according to claim 9, wherein the fluorescent material is FAM, VIC, HEX, Cy5, Cy3, SYBR Green, DAPI, TAMRA, FITC, RITC, rhodamine, Fluoredite, Fluoreprime, and ROX At least one selected from the group consisting of: The method of claim 1, wherein the probe is an antibody, aptamer, DNA, RNA, Peptide Nucleic Acid (PNA), oligosaccharide, peptide or protein. The method of claim 1, which is performed in a well, channel, tube, or combination thereof. The method of claim 1, comprising culturing the microorganism or amplifying the genetic material of the microorganism. The method of claim 1, wherein the microorganism comprises bacteria, viruses, fungi, fungi, or combinations thereof. Concentrating or immobilizing the microorganisms contained in the sample; And
And contacting said labeled probes sequentially with said microorganisms to hybridize with said microorganisms and detecting signals emitted from said sequentially hybridized probes, respectively. The method of claim 15, comprising determining the presence or type of microorganism using information of the probe from which the signal is emitted.

Images