KR20190098455A - Novel microalgae having high productivity for lutein - Google Patents

Abstract

The present invention relates to novel microalgae with high lutein productivity. Chlorella sp. HS3 of the present invention has high biomass production and high lutein content, and thus can be used as a biological resource capable of producing lutein. Also, raw materials derived from Chlorella sp. HS3 can be used in pharmaceutical compositions, nutraceuticals or feed compositions that require lutein.

Description

Novel microalgae having high productivity for lutein

The present invention relates to the genus Chlorella microalgae, which has good growth rate and is characterized by high lutein content.

Macular degeneration is a disease that causes vision disorders due to degeneration of the macular tissue, a nerve tissue located in the center of the inner retina of the eye.Most of the cells are collected in the macula and the image is formed at the center of the macula. Is in charge of. The most common causes of macular degeneration are age-related macular degeneration and are known to be associated with family history, race, and smoking. Since the macula is responsible for central vision, degeneration occurs here, such as decreased vision, central dark spots, and opacity, which is a symptom of crushing objects.

Macular degeneration is largely divided into non-exudative (dry) and exudative (wet). In the case of non-exudative, most of the lesions do not have a significant effect on visual acuity except for the late stage of retinal and choroidal atrophy. On the other hand, in exudative cases, a yellow deposit called drusen appears under the retina, but subretinal hemorrhage, subretinal fluid, and pigment epithelial detachment appear, and if the location of the lesion is directly under or in the macula, Decreased vision. Exudative macular degeneration accounts for about 10-20% of the total macular degeneration, but if left untreated without exudative macular degeneration, visual acuity quickly deteriorates, leading to blindness within two years after diagnosis. In order to prevent macular degeneration, it is important to regularly detect the macular abnormality through regular fundus examination and to reduce the control factors such as obesity, smoking and hypertension.

Cataracts are mainly the aging of the lens with free radicals as we age. When the tissue of the lens is destroyed, the lens becomes cloudy and the vision decreases. Lutein is known to inhibit this oxidation. It has also been reported that the incidence of cataracts is reduced in people with high blood carotenoid levels, and lutein intake may reduce the risk of visual impairment in the elderly population.

As an example of preventing macular degeneration or cataracts, there is a method of ingesting a pigment such as lutein, which serves to reduce damage due to aging to keep the retina healthy or to prevent damage to the lens. Lutein can be taken from vegetables and fruits, or you can take commercially available vitamins.

Macular pigment is a carotenoid-based oxycarotenoid pigment produced by oxygenation of carotenoids. There is this. Lutein is a pigment belonging to the xanthophylls. Lutein acts as an antioxidant that protects the interior of the eye, which is damaged by oxygen free radicals that are naturally produced in the body, and kills cancer cells by reducing the growth of blood vessels that supply cancer tumors, resulting in breast, colon, lung, It is known to be effective in preventing ovarian cancer and skin cancer.

Animals cannot produce xanthophylls and can only obtain them through ingestion of food. These xanthophylls are present with chlorophyll and carotene in the green part of the leaves, flowers and fruits of plants. Recently, health functional foods for eye health, including xanthophylls, have been in the spotlight.

As a raw material of lutein, conventional marigold flowers are representative, and extraction from other higher plants is also studied. In addition, bacteria produce genetically altered pigment synthesis mechanisms to produce lutein. Research into obtaining these pigments from microalgae has also been conducted. Among these conventional raw materials, marigold flowers take a long time to breed flowers for production, have a disadvantage that they can be harvested only once a year, and have a high production cost because they do not produce much compared to the land area for production. have.

To reduce the cost of lutein production, the development of lutein-producing algae incorporating the mechanism of pigment synthesis using bacterial systems to replace higher plant systems, but the problem is that pigments obtained from bacteria are ultimately unsuitable for use as food additives. have. In addition, since genetically modified organisms (GMOs) using gene insertion technology are not preferred in Korea, it is a fatal disadvantage in the food additives market where the recognition of consumers is important. It is expensive to maintain the reactor and so on. Therefore, there is a continuing need for development of a method of replacing a previously used raw material, introducing a separate culture method so that a living organism as a raw material generates a lot of lutein, or efficiently extracting lutein from the raw material. For example, Patent Document 1 discloses a technique of applying vibration to microalgae in order to promote the generation of various lipids including lutein from microalgae. Microalgae accumulate carotenoids in cells to collect light during photosynthesis, transfer energy, and protect themselves from high light. Therefore, techniques for obtaining large amounts of pigments such as carotenoids from microalgae have been studied.

The present inventors investigated whether wild-type microalgae with high lutein content and high growth rate among microalgae that can be produced annually by replacing plant raw materials that can be harvested only once a year, and that microalgae Chlorella genus HS3 isolated from rivers accumulate lutein. Lutein content is higher than other known microalgae, and due to rapid growth, the present invention was completed by confirming that lutein productivity is superior to existing microalgae.

Korean Unexamined Patent Publication No. 2015-0054525

It is to secure microalgae with high lutein productivity compared to known microalgae, and to secure biological resources for lutein production throughout the year by optimizing the culture of new microalgae.

In order to solve the above problems, the present invention provides Chlorella sp. HS3 ( Chlorella sp. HS3), deposited with the accession number KCTC 13133BP.

The present invention also provides a pharmaceutical composition for preventing or treating ocular disease, comprising an extract of Chlorella genus HS3 or a fraction thereof, deposited under accession number KCTC 13133BP.

The present invention also provides a health functional food for preventing or ameliorating eye diseases, or improving eye function, including an extract of Chlorella genus HS3 or a fraction thereof, deposited under accession number KCTC 13133BP.

Chlorella genus HS3 newly isolated in the present invention can accumulate a high content of lutein in cells compared to other microalgae previously published, and can be cultured at a high growth rate in fresh water medium to ensure high lutein productivity. This high lutein productivity is expected to be able to reduce the production cost of lutein by expanding lutein production, which is limited to marigold, to the microalgae base, so that it can be used in a variety of dietary supplements, quasi-drugs and feeds.

Figure 1 shows a schematic diagram of Chlorella sp. HS3 (hereinafter referred to as Chlorella sp. HS3) isolated from the present invention and deposited with the accession number KCTC13133BP.
Figure 2 is a micrograph of the genus Chlorella HS3 isolated in the present invention.
3 is a temperature and light optimum conditions of the Chlorella genus HS3 isolated in the present invention; A) represents the biomass according to the temperature change, and B) the biomass according to the light quantity change.
4A and 4B show the result of the dye analysis of the genus Chlorella HS3 isolated in the present invention, FIG. 4A shows the pigment content, and FIG. 4B shows the composition ratio of the dye.
Figure 5 shows the increase in cell weight according to the increase in the amount of light of the Chlorella genus HS3 isolated in the present invention.
Figure 6 shows the effect of carbon dioxide for pigment production of isolated Chlorella HS3 in the present invention.
Figure 7 shows the lutein content and productivity results in the increase in the amount of light of Chlorella genus HS3 isolated in the present invention.

Hereinafter, the present invention will be described in detail.

 One. New Chlorella Microalgae

The present invention provides novel Chlorella microalgae.

The novel microalgae of the present invention is Chlorella sp. HS3 ( Chlorella sp. HS3) deposited under accession number KCTC 13133BP.

The genus Chlorella HS3 was similar to the genus Parachlorella and Chlorella in sequencing analysis, but it was classified as belonging to the genus Chlorella because it was found to be incompatible with characteristics such as the optimum culture temperature reported for the parachlorella parachlorella kessieri . This was specifically named HS3 (FIG. 1).

The Chlorella genus HS3 is isolated in rivers and is capable of fast growth in fresh water and brackish water, and has excellent pigment productivity. In particular, the Chlorella genus HS3 can produce a very high content of lutein in the pigment, Chlorella sorokiniana JD02, Chlorella sp. Lutein was more productive than JD04, Chlamydomonas reinhardtiiCC124, Tetraselmis sp., And Chlorella vulgarisOW-01 . Chlorella sorokiniana JD02, Chlorella sp. Compared with the lutein content of JD04, Chlorella vulgarisOW-01 , the lutein productivity of the Chlorella genus HS3 is excellent. Thus, the Chlorella genus HS3 of the present invention can replace the system previously used for lutein production.

In a specific embodiment of the present invention, the lutein content after culturing Chlorella HS3 and other microalgae in an optical incubator (50 rpm, 25 ° C., 50 μmol / m ² / s), which is a condition generally used in microalgae culture. It was confirmed that Chlorella genus HS3 had higher lutein productivity than microalgae of Chlamydomonas genus and Tetraselmis genus including other species included in Chlorella genus under normal culture conditions.

According to the embodiments of the present invention, the chlorella in HS3, that of producing a conventional lutein known Chlorella fusca, Chlorococcum citroforme, Coelastrum proboscideum, Muriell aaurantiaca, Muriella decolor, Neospondiococcum gelatinosum, Tetracysis aplanosporum, Tetracystis intermedium, Tetracysti stetrasporum, Chlorella zofingiensis When cultivated at 1000 μmol / m ² / s brightness at 35 ° C. under 5% carbon dioxide conditions, the lutein productivity of Chlorella genus HS3 is at least 1.5 times higher than that of the existing strain. The lutein productivity of Chlorella genus HS3 is excellent compared to the lutein contents of Chlorella fusca and Chlorella zofingiensis , which have high similarity in sequence analysis. Thus, the Chlorella genus HS3 of the present invention can replace the system previously used for lutein production.

The genus Chlorella HS3 may produce not only lutein, but also one or more pigments selected from the group consisting of neoxanthine, beta-carotene, and chlorophyll-a, which may accumulate in cells or release them into cells. Specifically, the Chlorella genus HS3 may be one or more pigments selected from the group consisting of lutein, neoxanthine, beta-carotene, and chlorophyll-a to accumulate in cells, but is not limited thereto.

The Chlorella genus HS3 may exhibit the highest growth rate at luminous conditions between 500 μmol / m ² / s and 600 μmol / m ² / s. These properties differ from the optimal culture conditions reported for Parachlorella kessieri and correspond only to the genus Chlorella HS3.

In a specific embodiment of the present invention, Chlorella genus HS3 cell line has been identified through 18S rDNA sequencing of microalgae isolated from the stream, it is possible to grow rapidly in fresh water and brackish water, biomass productivity and pigment productivity, in particular lutein productivity Was excellent. In comparison with other microalgae that have been reported to produce lutein, the new microalgae of the present invention, Chlorella genus HS3, have a high lutein content. Therefore, Chlorella genus HS3 can replace lutein-producing microalgae and secure lutein. It is useful as a biological resource.

 2. Pharmaceutical composition for preventing or treating eye diseases

The present invention provides a pharmaceutical composition for preventing or treating eye diseases.

The pharmaceutical composition for preventing or treating eye diseases of the present invention comprises an extract or fraction of Chlorella sp. HS3 deposited with the accession number KCTC 13133BP as an active ingredient. Macular degeneration, including cataracts, exudative senile macular degeneration, cataracts, choroidal neovascularization, retinopathy, diabetic retinopathy, acute and chronic macular neuroretinopathy, central serous chorioretinopathy, macular edema, acute multiple plaque pigment epithelium, Bud-shot retinal chorioretinopathy, scleritis, mesenteric choroiditis, subretinal fibrosis, uveitis syndrome, retinal artery occlusion, central retinal vein occlusion, disseminated intravascular coagulation, branched retinal vein occlusion, hypertensive fundus change, ischemic syndrome , Retinal arterial microvascular perfusion, Koout's disease, central condyle near capillary dilatation, lateral retinal vein occlusion, papillary veinitis, central retinal artery occlusion, Branched retinal artery occlusion, branched vasculitis, sickle cell retinopathy, angioplasty retinopathy, familial exudate vitreoretinopathy, Ills disease, proliferative vitreoretinopathy, proliferative diabetic retinopathy, tumor-associated retinal disease, retinal pigment epithelium (RPE) Congenital thickening, posterior uveal melanoma, choroidal hemangioma, choroidal osteoma, choroid metastasis, retinopathy of the retinal and retinal pigment epithelium, retinoblastoma, fundus angioproliferative tumor, retinal glioma, intraocular lymphoid tumor, myopic retina Degenerative and acute retinal pigment epithelial disease, and glaucoma. Preferably, the ocular disease may be at least one of age-related macular degeneration and cataract, but is not limited thereto.

The extract is culturing the Chlorella genus HS3; Drying the culture of the cultured Chlorella HS3 to obtain a dried product; And it may be obtained by a method comprising a; and extracting the organic solvent in the dried product obtained.

The culturing of the genus Chlorella HS3 may be performed in fresh water or brackish water, preferably in fresh water, but is not limited thereto. Since Chlorella genus HS3 of the present invention can be grown in fresh water as well as brackish water, there are various types of water that can be used in the production of the medium, there is an advantage that the kind of water can be selectively used according to convenience. The Chlorella genus HS3 may preferably have a biomass productivity of 2 mg / L / day, a lutein content of 11.8 mg / g and a pigment yield of 25 mg / L / day when cultured in fresh water.

The culturing of the genus Chlorella HS3 may be carried out under 3% to 10% carbon dioxide conditions, preferably under 3% to 8% carbon dioxide conditions, more preferably under 5% to 8% carbon dioxide conditions. But it is not limited thereto. When carbon dioxide is included in the volume below the lower limit, the biomass productivity and lutein content of the Chlorella genus HS3 may be low, resulting in a significant decrease in the lutein productivity finally obtained. If carbon dioxide is included in excess of the upper limit, it may affect the growth of the cell and thus may not achieve the desired biomass productivity. For example, excessive supply of carbon dioxide decreases the pH of the culture and inhibits cell growth. The carbon dioxide concentration used in microalgae culture may vary depending on the rate of division and the amount of light of the cells, but when the carbon dioxide is supplied above the upper limit, and more than 15%, most microalgae die at low pH.

According to a specific embodiment of the present invention, when culturing Chlorella HS3 under 5% carbon dioxide conditions, the lutein content is about 3.2 times or more, and the lutein productivity is 31 times or more, compared to the case of culturing in the air. Therefore, it was found that the high concentration of carbon dioxide conditions are required to obtain high content of lutein by culturing the novel microalgae of the present invention Chlorella HS3.

The culturing of the genus Chlorella HS3 may be carried out at a temperature condition of 26 ℃ to 40 ℃, preferably may be carried out at a temperature condition of 30 ℃ to 37 ℃, more preferably of 35 ℃ to 37 ℃ It may be performed at a temperature condition, but is not limited thereto. Incubating at a temperature below the lower limit or above the upper limit reduces the biomass productivity, resulting in a lower lutein content.

The step of culturing the genus Chlorella HS3 may be carried out at luminous conditions between 900 μmol / m ² / s and 1500 μmol / m ² / s, preferably 950 μmol / m ² / s to 1300 μmol / m ² / l may be carried out at luminous conditions between / s, more preferably at luminous conditions between 950 μmol / m ² / s to 1200 μmol / m ² / s, even more preferably 1000 μmol / m ^It may be performed at luminous conditions between ² / s to 1200μmol / m ² / s, but is not limited thereto. When the chlorella genus HS3 culture is carried out under luminous conditions below the lower limit, there is a problem that biomass productivity does not increase even when the culture is performed for a long time. When the chlorella genus HS3 culture is performed at luminous conditions exceeding the upper limit, excessive heat is accompanied, thereby changing the temperature of the culture medium to inhibit the growth of algae, and excessive light may cause a photoinhibitory effect. Therefore, even if it is possible to culture in the luminous conditions exceeding the upper limit, there is a problem that the content of lutein contained in the culture can be reduced.

According to a specific embodiment of the present invention, when the Chlorella genus HS3 of the present invention is incubated at 5 ° C. under carbon dioxide at 1000 μmol / m ² / s at 35 ° C., the carbon dioxide conditions and the temperature conditions are the same and only the luminous conditions are used. Lutein productivity increased by 10 times or more compared with the case where it changed to 100 micromol / m <^2> / s. Therefore, in order to increase lutein productivity from the novel microalgae of the present invention, Chlorella genus HS3, it was found that high concentrations of carbon dioxide conditions, temperature suitable for growth, and light intensity conditions should be satisfied.

According to the embodiments of the present invention, the chlorella in HS3, that of producing a conventional lutein known Chlorella fusca, Chlorococcum citroforme, Coelastrum proboscideum, Muriell aaurantiaca, Muriella decolor, Neospondiococcum gelatinosum, Tetracysis aplanosporum, Tetracystis intermedium, Tetracysti stetrasporum, Chlorella zofingiensis When cultivated at 1000 μmol / m ² / s brightness at 35 ° C. under 5% carbon dioxide conditions, the lutein productivity of Chlorella genus HS3 is at least 1.5 times higher than that of the existing strain. The lutein productivity of Chlorella genus HS3 is excellent compared to the lutein contents of Chlorella fusca and Chlorella zofingiensis , which have high similarity in sequence analysis. Thus, the Chlorella genus HS3 of the present invention can replace the system previously used for lutein production.

The culture of the genus Chlorella HS3 may be a microalgae proliferation and culture medium, and preferably, a culture of microalgae except culture medium in the culture.

When the extract is obtained by extracting from the raw material, as the extraction method, any conventionally known conventional extraction methods such as solvent extraction (including low temperature dark condition extraction), ultrasonic extraction, filtration and reflux extraction can be used, and preferably solvent extraction Or by using a reflux extraction method. The extraction process may be repeated several times, after which it may be further subjected to steps such as concentration or lyophilization. Specifically, the obtained extract may be concentrated under reduced pressure to obtain a concentrate, and the extract may be lyophilized to prepare a high concentration of extract powder using a grinder.

Lutein has 40 carbons and 56 hydrogens, but it shows fat solubility due to its structural features including only a few hydroxyl groups (OH). Therefore, since it is insoluble in a completely polar solvent such as water, it is preferable to use a polar or non-polar organic solvent as the extraction solvent. Examples of the polar or non-polar organic solvent include organic solvents such as lower alcohols having 1 to 5 carbon atoms, acetone, acetonitrile, ethyl acetate, chloroform, dichloromethane, ethyl ether, xylene, hexane, and the like. The solvent may be a lower alcohol having 1 to 5 carbon atoms, more preferably the organic solvent may be ethanol.

The ethanol used as the extraction solvent may be used in a volume of 500 ml to 1.5 L, preferably in a volume of 800 ml to 1.3 L, more preferably 1 L to 1.2 L with respect to 10 g of the freeze-dried chlorella HS3. It may be used as the volume of, but is not limited thereto. If ethanol is included below the lower limit, the extraction efficiency of lutein is lowered and the final obtained lutein content is reduced.

In the extract of Chlorella genus HS3 obtained as described above, the lutein may be included in the amount of 7 mg / g to 25 mg / g, preferably in the range of 9 mg / g to 20 mg / g, more Preferably in the range of 11 mg / g to 17 mg / g.

In a specific embodiment of the present invention, the extract obtained by treating the lyophilisate of Chlorella genus HS3 obtained by incubating at 35 ° C. for 36 hours at 35 ° C. at 1000 μmol / m ² / s brightness for 36 hours, the lutein is about It was included in the amount of 11mg / g, it was confirmed that the lutein is present in the highest content of 35% of the total pigment.

The extract of the genus Chlorella HS3 may be further fractionated, and the fraction obtained as described above may also be used as an active ingredient of the pharmaceutical composition for preventing or treating eye diseases of the present invention.

In order to increase the lutein content, the extract of the genus Chlorella HS3 may be obtained to obtain a fraction of the genus Chlorella HS3. Solvents that may be used in the preparation of the fractions may be organic solvents such as acetone, acetonitrile, ethyl acetate, chloroform, dichloromethane, ethyl ether, xylene, hexane and combinations thereof, but are not limited thereto.

In addition, the fractions of the present invention may further be obtained by performing a conventional fractionation process in order to concentrate the lutein content. For example, fractions obtained by passing an extract of the genus Chlorella HS3 according to the present invention through an ultrafiltration membrane having a constant molecular weight cut-off value, various chromatography (manufactured for separation according to size, charge, hydrophobicity or affinity). Active fractions obtained through various purification methods additionally carried out by separation by, etc. are also included in the fractions of the present invention.

The active fraction is a fraction having a higher lutein content from the fraction, also referred to as an active fraction or an effective fraction. Particularly active fractions with higher lutein content can be prepared by separating them according to the nature of the active ingredient through concentration gradient column chromatography among the fractions obtained by the usual fractionation process such as systematic fractionation. have. The column chromatography performs column chromatography using a filler selected from the group consisting of silica gel, Sephadex, LH-20, ODS gel, RP-18, polyamide, Toyopearl and XAD resin to separate active fractions. And may be purified, and column chromatography may be performed several times by selecting an appropriate filler as necessary, but is not limited thereto. In using the chromatography, an eluting solvent, an eluting rate, and an eluting time may apply a solvent, a rate, or a time generally used in the art.

The lutein plays a role in the antioxidant effect and protects the plant from ultraviolet rays in the plant, and is widely known to humans as a major component of the macular and lens of the eye to enhance eye health and vision. In addition, the macular pigment density is affected by the concentration of lutein in the serum according to the intake of lutein, and if the macular pigment density is increased by the intake of lutein, the visual acuity is improved, especially in the state of macular degeneration. Increasing the content of lutein as a diet may stimulate the production of macular pigmentation and inhibit the progression of macular degeneration.

Therefore, extracts or fractions of the genus Chlorella HS3 of the present invention containing a high amount of lutein may be used as an active ingredient of the composition for the treatment, prevention, or improvement of eye diseases such as macular degeneration or cataract. In addition, the extract of the genus Chlorella HS3 of the present invention has the effect of reducing vision, eye fatigue, and preventing presbyopia in addition to eye diseases.

Pharmaceutical composition for the prevention or treatment of eye diseases comprising the extract or fraction of the genus Chlorella HS3 as an active ingredient is administered orally or parenterally to mammals, including livestock, humans, for example, intravenous and arterial, intramuscular , Subcutaneous, intraperitoneal, mucosal or topical (eg, eye drops), ocular, transdermal and the like.

The pharmaceutical compositions may be formulated for oral administration such as tablets, troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs. ) And the like. Binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin for formulation into tablets and capsules; Excipients such as dicalcium phosphate; Disintegrants such as corn starch or sweet potato starch; Lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax may be contained. In the case of capsule formulation, in addition to the above-mentioned substances, it may contain a liquid carrier such as fatty oil.

When parenteral administration of the composition of the present invention is applied to subcutaneous injection, intravenous injection, intramuscular injection, intrathoracic injection and mucosa or topical, dispersant, suppository, powder, aerosol (nasal spray or inhalant), eye drops, Gels, suspensions (aqueous or non-aqueous liquid suspensions, oil-in-water emulsions or water-in-oil emulsions), solutions, liquid dosage forms suitable for parenteral administration, and the like. To formulate into a parenteral formulation, the composition is mixed in water with a stabilizer or buffer to prepare a solution, which may be formulated in unit dosage forms of ampoules or vials.

The effective dosage of the extract of the genus Chlorella HS3 of the present invention or fractions thereof depends on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and response to response of the patient. Can be varied, but is generally 1 to 20 mg / day per kg of adult patient weight, preferably 5 to 10 mg / day, several times a day at regular time intervals, as determined by the physician or pharmacist Preferably, two to three divided doses per day.

 3. Health functional foods for preventing or improving eye diseases or for improving eye function

The present invention provides a health functional food for preventing or improving eye disease or improving eye function.

Health functional food of the present invention includes the extract or fraction of Chlorella sp. HS3 ( Chlorella sp. HS3) deposited with the accession number KCTC 13133BP as an active ingredient.

The method of preparing extracts or fractions of the genus Chlorella sp. HS3 ( Chlorella sp. HS3) is described in "2. Pharmaceutical compositions for preventing or treating eye diseases", and thus description thereof is omitted.

When the extract or fraction of the genus Chlorella HS3 is included in the health functional food, it can be used in the range of 0.01 to 50% (w / w), preferably 1 to 30% (w / w) of the total weight.

For example, extracts or fractions of the genus Chlorella HS3 are added to conventional palatable foods such as noodles, tofu, cereals, breads, chewing gum, candy, confectionary, such as ramen noodles, raw noodles, etc. to prepare various foods by commonly known methods. Can be applied as an edible food additive, and can also be formulated into general formulations such as tablets, granules, pills, hard capsules, soft capsules or liquid formulations, and prepared as fresh juices, pouches, beverages, or teas. In addition to the above components, other components may be appropriately selected and blended by those skilled in the art according to the dosage form.

Hereinafter, the present invention will be described in detail by the following experimental example.

However, the following experimental examples are merely illustrative of the present invention and the scope of the invention is not limited by the experimental examples.

 Example 1 Isolation and Identification of Microalgae

Genomic DNA was isolated from microalgae HS3 isolated as a single cell line in domestic rivers, PCR of 18S rDNA using microalgae identification primers (ch165F, ch1200R), and the obtained PCR products were sequenced and searched in NCBI blast. The primer sequence is as follows.

ch165F: CGACTTCTGGAAGGGACGTA (SEQ ID NO: 1)

ch1200R: GAGTCAAATTAAGCCGCAGG (SEQ ID NO: 2)

Isolated microalgae HS3 is parachlorella , Chlorella (Chlorella) and, but the homology is high (FIG. 1), the optimum culture showing the temperature and the characteristic is lowered sequencing the same affinity (similiarity) characteristics that meet the Chlorella genus (Chlorella sp.), Reported about the Parachlorella kessieri Named HS3. The present inventors deposited the isolated Chlorella HS3 cell line to the Korea Institute of Bioscience and Biotechnology Microbial Resource Center on October 18, 2016 (Accession No .: KCTC 13133BP). The "Record" was submitted to change the " parachlorella kessieri HS3 ", the taxonomic location indicated on the deposit, to " Chlorella sp. HS3". The form of the microalgae HS3 is shown in FIG.

 Example 2 Analysis of Optimal Culture Conditions of Chlorella HS3

Optimal culture conditions were analyzed via Photo-Biobox (Heo et al. 2015 Biochemical Engineering Journal, 103, 193-197). Photo-Biobox is a high throughput photo bioreactor that is useful for quickly finding microalgal conditions with temperature, light and carbon dioxide by implementing 96 different environments in a batch. The medium used was BG11 medium which is widely used as a green algae culture medium.

As a result of confirming the culture conditions of the Chlorella genus HS3 using a photobiobox, the Chlorella genus HS3 has a biomass content at a temperature of 35 to 37 ° C. and a light of 500 to 600 μmol · m ⁻² · s ⁻¹ under 5% carbon dioxide conditions. The highest was confirmed as the optimum culture conditions (Fig. 3).

 Example 3 Pigment Content and Productivity

In the dye analysis, 10 mg of silica beads were put into 10 mg of biomass obtained by freeze-drying Chlorella genus HS3 in 96 hours at the optimum culture conditions identified in Example 2, and 1 ml of 100% ethanol was beated. ) And extracted. The obtained extract was centrifuged at 10,000 x g for 1 minute to remove cell debris and filtered using a 0.2 μm PTFE filter to prepare an HPLC assay sample. HPLC was used to analyze the amount of pigment contained in the pigment extract. HPLC analysis conditions are as follows.

Column: waters Spherisorb S5 ODS1 4.6x250 mm, 5 μm Cartridge column

Oven Temperature: 40 ℃

Mobile phase eluents: 0.1M Tris-HCl pH 8.0, acetonitrile, methanol, ethyl acetate

Detector: photodiode array detector (SPD-M20A, Shimadzu) 476 nm, 450 nm

program:

(0-15 minutes) 14% 0.1M TrisHCl (pH 8.0), 84% acetonitrile, 2% methanol

(15 min-19 min) 68% methanol and 32% ethyl acetate

(19-25) 14% 0.1M TrisHCl (pH 8.0), 84% acetonitrile, 2% methanol

Flow rate: 1.2 ml / min

As a result of the pigment analysis, lutein was the highest after chlorophyll-a and chlorophyll-b (Figs. 4A and 4B). The total content of pigment was 32 mg / g, 1.5% of the dry weight of the novel Chlorella HS3 as a pigment.

 Example 4 Comparison of Lutein Production of Chlorella HS3 with Other Algae

The same method as Example 3 after inoculating Chlorella HS3, other species of Chlorella genus, or strains of other genera in equal amounts into 250 ml flasks and incubating in a photoincubator (50 rpm, 25 ° C., 50 μmol / m ² / s) The lutein content was checked using HPLC. The confirmation results are shown in Table 1.

Microalgae RetTime Area Lutein
content [min] [mAU * s] [mg / g] Chlorella sp. HS3 17.141 4050.2 3.66 Chlorella sorokiniana JD02 17.14 2438.3 2.20 Chlorella sp. JD04 17.139 2799.1 2.46 Chlamydomonas reinhardtii CC124 17.138 2955.3 2.67 Tetraselmis sp. 17.141 238.51 0.21 Chlorella vulgaris OW-01 17.139 2626.8 2.37 Achnanthidium sp. BS-003 N.D 0 0 Amphidinium carterae N.D 0 0 Chaetoceros difficilis N.D 0 0 Nannochloropsis oceanica N.D 0 0 Pavlova lutheri N.D 0 0

As can be seen in Table 1, Chlorella genus HS3 of the present invention had the highest lutein content under the same culture conditions as other strains. Through this, Chlorella genus HS3 was found to produce a large amount of lutein under normal culture conditions.

 Example 5 Lutein Productivity Enhancement Method by Light Amount

Chlorella genus HS3 was cultivated under 5% carbon dioxide conditions with a light amount ranging from 100 to 1,000 μmol · m ⁻² · s ⁻¹ to increase pigment productivity. As a negative control for 5% carbon dioxide conditions, an air phase was used instead of 5% carbon dioxide. Table 2 shows the results of comparing the productivity with and without the high concentration of carbon dioxide. Lutein content was determined by obtaining the extract in the same manner as in Example 3 except that the sample was changed differently.

Condition Biomass
(g / L) Biomass Productivity
(g / L / day) Lutein Content
(mg / g) Lutein Productivity
(mg / L / day) Air 1.2 0.275 3.66 0.79 5% CO ₂ 8.5 2.095 11.87 25.03

As a result of the culture, the biomass of Chlorella genus HS3 increased with increasing light quantity, and biomass productivity was 2.095 g / L / day and lutein content was 11.87 mg after 96 hours of incubation at 1,000 μmol · m ⁻² · s ^-1 . Lutein productivity at 25 g was 25.03 mg / L / day (FIG. 5). In the case of treatment with a light quantity of 1,000 μmol · m ⁻² · s ^{− 1} , the increase in productivity was confirmed to be about 10 times or more as compared with the case of treatment with a light quantity of 100 μmol · m ⁻² · s ^{− 1} . This lutein productivity increase effect did not appear in the air supply (air) conditions, it was confirmed in the light amount of 5% CO ₂ and 1,000 μmol · m ^-2 · s ^{- 1} (Table 2 and Figure 6). As a result of the pigment analysis, the lutein content also increased as the amount of light increased (FIG. 7).

 [Comparative Example 1] Comparison of Lutein Content of Chlorella genus HS3 and Other Microalgae Producing Lutein

The lutein production of Chlorella HS3 was compared with the lutein production of other microalgae that have been reported to produce lutein. Each microalgae was incubated for 36 hours at a light quantity of 5% CO ₂ and 1,000 μmol · m ⁻² · s ^{− 1} . Lutein content was confirmed by the same method as in Example 3 except that the sample was changed. The comparison results are shown in Table 3.

Microalgae Lutein Content (mg / g) Chlorella fusca 4.2-4.7 Chlorococcum citroforme 7.4 Coelastrum proboscideum 3.4-5.0 Muriell aaurantiaca 2.6 Muriella decolor 0.5 Neospondiococcum gelatinosum 4.4 Tetracysis aplanosporum 5.9 Tetracystis intermedium 3.5 Tetracysti stetrasporum 4.4 Chlorella zofingiensis 2.4-2.8 Chlorella sp. HS3 11.8

Lutein content at the optimum conditions for lutein production of Chlorella HS3 was at least 50% higher than other lutein producing microalgae, and the lutein productivity was higher than that of all published microalgae.

 Example 6 Confirmation of Treatment Effect in Animal Model of Blue Light-Induced Macular Degeneration

Macular degeneration is reported to be promoted by a variety of factors, including smoking, obesity, eating habits, elevated cholesterol in the blood, irradiation with blue light, and these factors induce photoreceptor cell damage and subsequent cell death. (Denature). Chlorella HS3 extract or fraction of the present invention was confirmed to have a therapeutic effect in the macular degeneration animal model irradiated with blue light.

After culturing Balb / C mice for one week, the Chlorella HS3 extract prepared in Example 5 was administered once daily for 5 days, and after 2 hours of dark adaptation, the blue light at 10000 lux for 1 hour per day for 2 weeks. Chlorella HS3 extract was administered once a day and then autopsied after 7 days to extract the eye including the optic nerve. The extracted ocular tissues were fixed in Davidson fixative for 10 days, and then fixed in formalin for 1-2 days. Then, paraffin blocks were prepared and H & E stained.

The stained eye tissues were observed to confirm the thickness of the outer cell and the nucleus of the outer nuclear layer. It was confirmed that the outer nuclear layer thickness and the outer nuclear layer of the inner cell were remarkably recovered by treatment with the Chlorella HS3 extract.

 Example 7 Checking the Effect of Cataract Treatment

The causes of cataracts are various, such as oxidative stress and protein aggregation, and it is thought that the lens becomes turbid because the protection ability against oxidative disorder is lowered. Chlorella HS3 extract or fraction of the present invention was confirmed to have a therapeutic effect in the macular degeneration animal model irradiated with blue light.

Cataracts were induced by subcutaneous injection of sodium selenite 15μmol / kg bwt into the 70 negative rats, divided into 6 groups of 10 rats, except the normal group. Negative control group was physiological saline, positive control group was ascorbic acid (1000mg / kg bwt), experimental group was intraperitoneally 25mg / kg bwt, 50mg / kg bwt, 100mg / kg bwt using chlorella HS3 extract prepared in Example 5, respectively. Administered into. Cataract development was confirmed on day 4 of sodium selenite injection.

Cataracts occurred in the positive control group, the negative control group, and the experimental group except for the normal group, and the experimental group treated with the Chlorella genus HS3 extract had fewer cataracts than the positive control group and the negative control group. It can be seen that the extract can be used to treat cataracts in place of conventional antioxidants.

 Preparation Example 1 Preparation of Tablets, Syrups and Health Functional Foods

1) Preparation of Tablets

Tablet containing Chlorella genus HS3 extract according to the present invention as an active ingredient was prepared by the following method [active ingredient 15mg].

250 g of the Chlorella genus HS3 extract was mixed with 175.9 g of lactose, 180 g of potato starch, and 32 g of colloidal silicic acid, to which 10% gelatin solution was added, followed by grinding to pass through a 14 mesh sieve. It was dried and tablets were prepared from a mixture obtained by adding 160 g of potato starch, 50 g of talc and 5 g of magnesium stearate.

2) Preparation of Syrup

Syrup containing Chlorella genus HS3 extract according to the present invention as an active ingredient was prepared by the following method.

The Chlorella genus HS3 extract (2% by weight), saccharin, sugar was dissolved in 80 g of warm water and then cooled, and a solution consisting of glycerin, sweetener, flavoring agent, ethanol, sorbic acid and distilled water was prepared and mixed therein. Water was added to make 100 mL.

3) Manufacturing of dietary supplements

Health functional food containing Chlorella genus HS3 extract according to the present invention as an active ingredient was prepared by the following method.

1000 mg of dried Chlorella HS3 extract, appropriate amount of vitamin mixture, 70 μg of vitamin A acetate, 1.0 mg of vitamin E, 0.13 mg of vitamin B1, 0.15 mg of vitamin B2, 0.5 mg of vitamin B6, 0.2 μg of vitamin B12, vitamin C 10 mg, biotin 10 μg, nicotinic acid amide 1.7 mg, folic acid 50 μg, pantothenate 0.5 mg, mineral mixture appropriate amount, ferrous sulfate 1.75 mg, zinc oxide 0.82 mg, magnesium carbonate 25.3 mg, potassium monophosphate 15 mg, dicalcium phosphate 55 MG, potassium citrate 90 mg, calcium carbonate 100 mg, and magnesium chloride 24.8 mg were prepared by mixing according to a conventional health food preparation method.

Korea Institute of Bioscience and Biotechnology, Center for Biological Resources (KCTC) KCTC13133BP 20161018

<110> Korea Research Institute of Bioscience and Biotechnology <120> Novel microalgae having high productivity for lutein <130> 2017-dpa-2475 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ch165F <400> 1 cgacttctgg aagggacgta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ch1200R <400> 2 gagtcaaatt aagccgcagg 20

Claims (8)

Chlorella sp. HS3 deposited with accession number KCTC 13133BP.
The method according to claim 1,
The Chlorella genus HS3 is a genus Chlorella HS3 that can produce any one or more pigments selected from the group consisting of lutein, neoxanthin, beta carotene and chlorophyll-a.
Pharmaceutical composition for the prevention or treatment of eye diseases comprising an extract of Chlorella genus HS3 deposited with the accession number KCTC 13133BP or a fraction thereof as an active ingredient.
The method according to claim 3,
The extract of the genus Chlorella HS3 is at least one organic solvent selected from the group consisting of lower alcohols having 1 to 5 carbon atoms, acetone, acetonitrile, ethyl acetate, chloroform, dichloromethane, ethyl ether, xylene and hexane, water or their Pharmaceutical composition for the prevention or treatment of eye diseases to be extracted in a mixture.
The method according to claim 4,
The extract of the genus Chlorella HS3 is a pharmaceutical composition for preventing or treating ocular disease that is extracted with a lower alcohol having 1 to 5 carbon atoms.
The method according to claim 5,
The lower alcohol is ethanol pharmaceutical composition for preventing or treating eye diseases.
The method according to claim 3,
The ocular disease is age-related macular degeneration (Agerelated macular degeneration) or cataract (cataract) is a pharmaceutical composition for preventing or treating eye diseases.
Health functional food for the prevention or improvement of eye diseases, or improvement of eye function, comprising an extract or fraction of Chlorella genus HS3 deposited with accession number KCTC 13133BP as an active ingredient.

Images