KR20190058082A - Biomarker for diagnosis and treatment of breast cancer - Google Patents
Biomarker for diagnosis and treatment of breast cancer Download PDFInfo
- Publication number
- KR20190058082A KR20190058082A KR1020170155727A KR20170155727A KR20190058082A KR 20190058082 A KR20190058082 A KR 20190058082A KR 1020170155727 A KR1020170155727 A KR 1020170155727A KR 20170155727 A KR20170155727 A KR 20170155727A KR 20190058082 A KR20190058082 A KR 20190058082A
- Authority
- KR
- South Korea
- Prior art keywords
- icam
- breast cancer
- gene
- present
- leu
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70525—ICAM molecules, e.g. CD50, CD54, CD102
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Abstract
Description
본 발명은 유방암의 진단 및 치료를 위한 바이오 마커에 관한 것으로서, 보다 구체적으로 ICAM-1 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는 유방암 치료제 반응성 예측용 마커 조성물, 및 이를 이용한 치료제 반응성 예측용 조성물, 치료제 반응성 예측을 위한 정보제공방법 등에 관한 것이다.The present invention relates to a biomarker for diagnosis and treatment of breast cancer, and more specifically, to a marker composition for predicting the reactivity of a breast cancer therapeutic agent comprising the ICAM-1 gene or a protein encoded by the gene, A method for providing information for predicting therapeutic agent reactivity, and the like.
유방암이란 유방의 세포에서 발생하는 악성종양을 말한다. 유방암의 원인에 대해 명확하게 밝혀진 것은 없지만, 여성 호르몬, 가족력, 과거력, 출산력, 식생활 습관 등의 다양한 인자들이 거론되고 있다. 유방암의 5년 생존율은, 100%인 0기 암에 비해 4기일 경우 20% 미만으로 알려져 있다. 저출산, 짧은 수유기간, 이른 초경, 늦은 폐경 등 생리적으로 왕성한 신체적 변화를 겪는 시기의 여성들에서는 여성호르몬의 자극을 받는 횟수의 급격한 증가로 인한 유선조직의 민감도 증가, 식생활의 서구화, 생활환경의 오염 등의 이유로 최근 유방암 발생이 급격하게 증가하고 있으며, 이러한 유방암의 발생빈도 및 유방암으로 인한 사망률의 증가는 현재의 서구화 실태로 보아 앞으로도 상당기간 지속될 것으로 예상된다.Breast cancer is a malignant tumor that occurs in the cells of the breast. Although the cause of breast cancer has not been clearly elucidated, various factors such as female hormone, family history, history, fertility and dietary habits are being discussed. The 5-year survival rate of breast cancer is known to be less than 20% when it is 4th, compared with 100% cancer. Women who are experiencing a physiologically vigorous physical change, such as low fertility, short lactation period, early menarche, late menopause, increase the sensitivity of the mammary gland tissue due to the rapid increase in the frequency of female hormone stimulation, westernization of dietary life, The incidence of breast cancer and the increase in mortality due to breast cancer are expected to continue for a considerable period of time in view of the present westernization situation.
이질성을 가지는 유방암 세포들은 다양한 바이오마커의 발현양상에 따라 서브타입을 가지고 있으며 그에 따른 약물 치료뿐만 아니라 방사선 치료를 진행하고 있다. 이러한 서브타입은 에스트로겐수용체 (ER), 프로게스테론수용체 (PR) 및 인간상피성장인자 수용체(HER2)의 발현 유무에 따라 나누어진다고 보고되고 있다. 3가지의 호르몬 수용체를 가진 유형(ER+,PR+,HER2+)을 내강형(luminal type)이라고 하며 그 수용체를 타겟으로 하는 약물치료가 효과적으로 진행되어지고 있지만, 3가지 수용체에 대해 음성을 보인 조직 (ER-,PR-,HER2-) 즉, 기저형 (basal type) 유방암 조직은 약물 치료가 쉽지 않을 뿐만 아니라 내강형과 비교하였을 때 침투능이 높고 전이가 잘 일어남으로써 좋지 않은 예후를 보여주고 있다.Breast cancer cells with heterogeneity have subtypes depending on the expression patterns of various biomarkers, and thus medicines are being treated as well as radiation therapy. These subtypes have been reported to be divided according to the expression of estrogen receptor (ER), progesterone receptor (PR) and human epithelial growth factor receptor (HER2). Three types of hormone receptors (ER +, PR +, and HER2 +) are called luminal types, and drug therapies that target the receptors are effective. However, -, PR-, HER2-) In other words, basal type breast cancer tissues are not easy to treat and have a poor prognosis as they are highly invasive and metastasized when compared with intact stiffness.
따라서, 유방암을 치료하기 위해서는, 치료 이전의 단계에서 높은 민감도와 특이도를 가진 암의 진단 방법의 개발이 무엇보다 중요하며, 이러한 진단은 암의 초기에 발견될 수 있는 것이어야 한다. 또한, 이러한 암의 발병여부 및 진행 단계의 정확한 판별이 가능하게 하는 암의 진단제 및 외과적 절제술이나 항암제의 단점을 보완한 치료제의 개발을 위한 바이오 마커의 선별 및 진단 마커를 측정하는 제제의 개발은 난치병인 암을 정복하는 필수 불가결한 수단이라 할수 있다.Therefore, in order to treat breast cancer, the development of diagnostic methods for cancer with high sensitivity and specificity at the pre-treatment stage is of utmost importance, and such diagnosis should be found in the early stages of cancer. Also, a diagnostic agent for cancer that enables accurate identification of the onset and progression stage of cancer, and a method for selecting a biomarker for the development of therapeutic agents complementing the disadvantages of surgical resection or anticancer drugs and a diagnostic agent for measuring diagnostic markers Is an indispensable means of conquering cancer, an incurable disease.
이에, 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성 등을 예측하는데 이용할 수 있는 새로운 표적에 대한 개발이 필요한 실정이고, 이에 대한 연구가 이루어지고 있으나(한국공개특허 10-2014-0019833 등), 아직 미미한 수준이다.Therefore, it is necessary to develop a new target that can be used for predicting the metastasis diagnosis of breast cancer, the prognosis, or the therapeutic response of the therapeutic agent, and studies have been conducted (Korean Patent Publication No. 10-2014-0019833 etc.) It is minimal.
본 발명자들은 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 이용할 수 있는 새로운 표적에 대한 연구를 진행한 결과, 약물 치료에 대한 반응성이 좋지 않은 기저형 (basal type) 유방암 조직에서 ICAM-1이 특이적으로 높게 발현하고, ICAM-1이 활성화된 EGFR과의 결합을 통해 하위신호 활성화를 유도하여 유방암의 침윤능 및 전이에 중요한 역할을 한다는 것을 최초로 규명하였는바, 이에 기초하여 본 발명을 완성하였다.As a result of studies on new targets that can be used to predict the metastasis, prognosis, or therapeutic response of breast cancer metastasis, we found that ICAM-1 in basal-type breast cancer tissues, Specific expression of EGFR and that it plays an important role in invasiveness and metastasis of breast cancer by inducing activation of low signal through binding with ICAM-1 activated EGFR. Based on this, the present invention has been completed .
이에, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는 유방암 치료제 반응성 예측용 마커 조성물, 및 이를 이용한 치료제 반응성 예측용 조성물, 키트 및 치료제 반응성 예측을 위한 정보제공방법을 제공하는 것을 목적으로 한다.Accordingly, the present invention provides a marker composition for predicting the reactivity of a breast cancer therapeutic agent comprising an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein encoded by the gene, and a composition for predicting the reactivity of a therapeutic agent using the same, And a method of providing the same.
또한, 본 발명은 (1) 유방암 세포에 후보물질을 처리하는 단계; (2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및 (3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는 유방암 치료제 스크리닝 방법을 제공하는 것을 또 다른 목적으로 한다.The present invention also provides a method for treating cancer, comprising the steps of (1) treating a candidate substance to a breast cancer cell; (2) measuring the binding level of ICAM-1 (Intracellular adhesion molecule 1) and EGFR in the cell; And (3) selecting a substance that reduces the binding level of ICAM-1 and EGFR to the candidate substance-free group as a therapeutic substance.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는, 유방암 치료제 반응성 예측용 마커 조성물을 제공한다.In order to achieve the object of the present invention, the present invention provides a marker composition for predicting the reactivity of a breast cancer therapeutic agent, comprising an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein encoded by the gene.
본 발명의 일 구현예로, 상기 ICAM-1 유전자는 서열번호 1의 염기서열로 이루어질 수 있다.In one embodiment of the present invention, the ICAM-1 gene may comprise the nucleotide sequence of SEQ ID NO: 1.
또한, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자의 mRNA 또는 상기 유전자가 암호화하는 단백질 수준을 측정하는 제제를 포함하는, 유방암 치료제 반응성 예측용 조성물을 제공한다.In addition, the present invention provides a composition for predicting the reactivity of a breast cancer therapeutic agent, comprising an agent for measuring mRNA of an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein level encoded by the gene.
본 발명의 일 구현예로, 상기 유전자의 mRNA 수준을 측정하는 제제는 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있다.In one embodiment of the present invention, the agent for measuring the mRNA level of the gene may be a sense and antisense primer that binds complementarily to the mRNA of the gene, or a probe.
본 발명의 다른 구현예로, 상기 단백질 수준을 측정하는 제제는 상기 유전자가 암호화하는 단백질에 특이적으로 결합하는 항체일 수 있다.In another embodiment of the present invention, the agent for measuring the protein level may be an antibody that specifically binds to the protein encoded by the gene.
또한, 본 발명은 상기 조성물을 포함하는, 유방암 치료제 반응성 예측용 키트를 제공한다.The present invention also provides a kit for predicting the responsiveness of a breast cancer therapeutic agent comprising the above composition.
또한, 본 발명은 (1) 유방암 세포에 후보물질을 처리하는 단계; (2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및 (3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는, 유방암 치료제 스크리닝 방법을 제공한다.The present invention also provides a method for treating cancer, comprising the steps of (1) treating a candidate substance to a breast cancer cell; (2) measuring the binding level of ICAM-1 (Intracellular adhesion molecule 1) and EGFR in the cell; And (3) a substance which decreases the binding level of ICAM-1 and EGFR with respect to the candidate substance-untreated group as a therapeutic substance.
본 발명자들은 유방암의 진단 및 치료에 이용할 수 있는 신규한 바이오마커로 ICAM-1을 도출하였고, 그 유효성 및 ICAM-1에 의해 조절되는 구체적인 메커니즘을 모두 확인하였는바, 본 발명에 따른 바이오마커는 유방암의 치료를 위한 새로운 표적으로서, 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 유용하게 이용될 수 있다.The present inventors have derived ICAM-1 as a novel biomarker that can be used for the diagnosis and treatment of breast cancer, and confirmed its effectiveness and specific mechanisms controlled by ICAM-1. The biomarker according to the present invention, As a novel target for the treatment of breast cancer, can be usefully used to predict the metastatic diagnosis of breast cancer, the prognosis, or the therapeutic response of therapeutic agents.
도 1a는, 유방암 유형별 ICAM-1의 발현량을 GOBO database system을 통해 확인한 결과를 나타낸 것이다.
도 1b는, 유방암 세포에서의 ICAM family의 발현량을 Realtime PCR을 통해 확인한 결과를 나타낸 것이다.
도 1c는, 기저형 유방암 세포인 MDAMB-231에 siRNA를 사용하여 ICAM family (ICAM-1~5)를 각각 억제한 후, boyden chamber assay을 통해 침윤능 및 이동능 변화를 확인한 결과를 나타낸 것이다.
도 2a는, 기저형 유방암 세포인 MDAMB-231에 shRNA를 사용하여 ICAM-1을 억제한 후, boyden chamber assay을 통해 침윤능 변화를 확인한 결과를 나타낸 것이다.
도 2b는, 기저형 유방암 세포인 MDAMB-231에 shRNA를 사용하여 ICAM-1을 억제한 후, Western blot을 통해 EMT 마커 및 조절인자의 발현변화를 확인한 결과를 나타낸 것이다.
도 2c는, SK-BR3 세포에 ICAM-1을 과발현한 후, boyden chamber assay을 통해 침윤능 변화를 확인한 결과를 나타낸 것이다.
도 2d는, SK-BR3 세포에 ICAM-1을 과발현한 후, Western blot을 통해 EMT 마커 및 조절인자의 발현변화를 확인한 결과를 나타낸 것이다.
도 3a는, ICAM-1 발현에 따른 전이능을 확인하기 위하여 MDAMB-231 세포에 shRNA를 사용하여 ICAM-1의 발현을 감소시킨 후 fatpad에 주입하는 과정을 도시한 것이다.
도 3b는, 상기 도 3a의 과정을 실시한 후, 36일간 3일 간격으로 암조직의 크기 변화를 확인한 결과를 나타낸 것이다.
도 3c는, 상기 도 3a의 과정을 실시한 후, 30일째 유방암 조직을 얻어 암조직의 무게 변화를 확인한 결과를 나타낸 것이다.
도 3d는, 상기 도 3a의 과정을 실시한 후, 30일째 폐조직을 얻어 전이 노들의 수를 확인한 결과를 나타낸 것이다.
도 3e는, 상기 도 3a의 과정을 실시한 후, 30일째 폐조직을 얻어 H&E 염색을 통해 폐로의 전이 정도를 확인한 결과를 나타낸 것이다.
도 4a는, ICAM-1 GST-pulldown 실험을 통해 ICAM-1과 결합하는 단백질을 확인한 결과를 나타낸 것이다.
도 4b는, 상기 도 a를 바탕으로 얻어낸 결과 EGFR이 ICAM-1과 결합한다는 결과를 IP를 통해 나타낸 것이다.
도 4c는, DTSSP 실험 방법을 통해 내강형 세포인 MCF7 세포에서 ICAM-1과 EGFR과의 결합 여부를 확인한 결과를 나타낸 것이다.
도 5a는, EGFR에 결합하는 ICAM-1의 부분(site)을 확인하기 위하여 제작된 ICAM-1 deletion Construct를 나타낸 것이다.
도 5b는, extracellular domain과 EGFR의 결합 여부를 IP(Immunoprecipitation)를 통해 확인한 결과를 나타낸 것이다.
도 5c는, △D1-5를 각각 과발현 하는 경우의 EGFR과의 결합 변화를 확인한 결과를 나타낸 것이다.FIG. 1A shows the results of checking the expression level of ICAM-1 by breast cancer type through the GOBO database system.
FIG. 1B shows the result of real-time PCR for the expression amount of the ICAM family in breast cancer cells.
FIG. 1c shows the results of inhibiting the ICAM family (ICAM-1 to 5) by using siRNA for MDAMB-231 as a basal breast cancer cell, and then examining the invasion ability and the migration ability through a boyden chamber assay.
FIG. 2A shows the results of inhibition of ICAM-1 by using shRNA for MDAMB-231 as a basal breast cancer cell, followed by change in invasiveness through a boyden chamber assay.
FIG. 2B shows the results of inhibition of ICAM-1 by using shRNA for MDAMB-231 as a basal breast cancer cell, followed by Western blot analysis of changes in the expression of EMT markers and regulatory factors.
FIG. 2C shows the results of confirming the change of invasiveness by ICAM-1 overexpression in SK-BR3 cells followed by a boyden chamber assay.
Figure 2d shows the results of Western blot analysis of the expression of EMT markers and regulators after ICAM-1 overexpression in SK-BR3 cells.
FIG. 3A shows the process of reducing the expression of ICAM-1 by using shRNA in MDAMB-231 cells and injecting it into the fatpad in order to confirm the transposability by ICAM-1 expression.
FIG. 3B shows the result of checking the size change of the cancer tissue at intervals of 3 days for 36 days after the process of FIG. 3A.
FIG. 3C shows the result of obtaining the breast cancer tissue at 30 days after the procedure of FIG. 3A, and confirming the change in the weight of the cancer tissue.
FIG. 3D shows the result of counting the number of transition nodules by obtaining the lung tissue at 30 days after the process of FIG. 3A.
FIG. 3E shows the result of confirming the degree of metastasis to the lung through H & E staining after obtaining the lung tissue at 30 days after the procedure of FIG. 3A.
FIG. 4A shows the result of confirming the protein binding to ICAM-1 through the ICAM-1 GST-pulldown experiment.
FIG. 4B shows the result of binding of EGFR to ICAM-1 as a result of IP based on FIG.
FIG. 4C shows the result of confirming whether or not ICAM-1 and EGFR bind to MCF7 cells, which are intact hard cells, through the DTSSP test method.
Figure 5a shows the ICAM-1 deletion construct constructed to identify the site of ICAM-1 binding to EGFR.
FIG. 5B shows the result of confirming the binding of the extracellular domain and EGFR through IP (Immunoprecipitation).
FIG. 5C shows the result of confirming the change in binding with EGFR when each of Δ D1-5 is overexpressed.
본 발명자들은 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 이용할 수 있는 ICAM-1의 신규 용도를 규명하였는바, 이에 기초하여 본 발명을 완성하였다.The present inventors have uncovered a new use of ICAM-1 that can be used for predicting metastasis diagnosis, prognosis, or therapeutic response of a breast cancer metastasis. Based on this finding, the present invention has been completed.
이에, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는, 유방암 전이 진단, 예후 예측 또는 치료제 반응성 예측용 마커 조성물을 제공한다.Accordingly, the present invention provides a marker composition for prediction of breast cancer metastasis diagnosis, prognosis prediction, or therapeutic agent reactivity, comprising an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein encoded by the gene.
또한, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자의 mRNA 또는 상기 유전자가 암호화하는 단백질 수준을 측정하는 제제를 포함하는, 유방암 전이 진단, 예후 예측 또는 치료제 반응성 예측용 조성물 및 상기 조성물을 포함하는 유방암 전이 진단, 예후 예측 또는 치료제 반응성 예측용 키트를 제공한다.The present invention also includes a composition for predicting breast cancer metastasis, prediction of prognosis or therapeutic agent reactivity, and a composition for the measurement of mRNA of ICAM-1 (Intracellular adhesion molecule 1) gene or protein level encoded by the gene And a kit for predicting breast cancer metastasis, prognosis prediction, or therapeutic agent response.
본 발명에 있어서, 상기 ICAM-1 유전자는 서열번호 1의 염기서열로 이루어 질 수 있으며, 상기 염기서열의 상동체도 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기서열과 각각 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다.In the present invention, the ICAM-1 gene may comprise the nucleotide sequence of SEQ ID NO: 1, and homologues of the nucleotide sequence are also included within the scope of the present invention. Specifically, the gene includes a nucleotide sequence having a sequence homology of 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 .
또한, 상기 ICAM-1 유전자가 암호화하는 단백질은 서열번호 2의 아미노산 서열로 이루어질 수 있으며, 서열번호 2에 기재된 서열과 실질적인 동일성 (substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 80%의 상동성, 보다 바람직하게는 90%, 91%, 92%, 93%, 94%, 95%의 상동성, 가장 바람직하게는 96%, 97%, 98%, 99%의 상동성을 나타내는 서열을 의미한다.In addition, the protein encoded by the ICAM-1 gene may be composed of the amino acid sequence of SEQ ID NO: 2 and also includes a sequence showing substantial identity with the sequence of SEQ ID NO: 2. The above-mentioned substantial identity is determined by aligning the above-described sequence of the present invention with any other sequence as much as possible, and analyzing the aligned sequence using an algorithm commonly used in the art, at least 80% More preferably 90%, 91%, 92%, 93%, 94%, 95% homology, most preferably 96%, 97%, 98%, 99% homology it means.
본 발명의 용어 "진단"이란, 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명에 있어서, 상기 진단은 유방암의 전이 여부를 확인하는 것으로 해석될 수 있다.The term " diagnosing " of the present invention means identifying the presence or characteristic of a pathological condition. In the present invention, the diagnosis can be interpreted as confirming whether breast cancer has metastasized.
본 발명에서 사용되는 용어, "예후(prognosis)"란, 병세의 진행, 회복에 관한 예측을 의미하는 것으로, 전망 내지는 예비적 평가를 말한다. 본 발명에서 예후는 유방암의 진행, 치료 결과, 또는 회복에 관한 예측을 의미하는 것이나, 이것으로 한정되는 것은 아니다.As used herein, the term " prognosis " refers to a prediction of the progression or recovery of a disease, and refers to an outlook or a preliminary evaluation. Prognosis in the present invention refers to prediction of breast cancer progress, treatment result, or recovery, but is not limited thereto.
본 발명에서 있어서 "치료제 반응성 예측"이란, 환자가 치료제, 예컨대 항암제에 대해 선호적으로 또는 비선호적으로 반응할지 여부를 예측하는 것, 또는 항암제에 대한 내성의 위험성을 예측하는 것, 치료 후 환자의 예후 즉, 재발, 전이, 생존, 또는 무병생존 등을 예측하는 것을 의미한다. 본 발명에 따른 치료제 반응성 예측을 위한 바이오마커는 유방암 환자에 대한 가장 적절한 치료 방식을 선택하도록 하기 위한 정보를 제공를 제공할 수 있다.In the present invention, " prediction of therapeutic reactivity " is used to predict whether a patient will preferentially or non-preferentially respond to a therapeutic agent, such as an anticancer agent, or predict a risk of resistance to an anticancer agent, Prognosis, that is, prediction of recurrence, metastasis, survival, or disease free survival. The biomarker for predicting therapeutic response according to the present invention can provide information for selecting the most appropriate treatment method for a breast cancer patient.
본 발명에서, 상기 mRNA 수준을 측정하는 제제는 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있다.In the present invention, the agent for measuring the mRNA level may be a sense and antisense primer that binds complementarily to the mRNA of the gene, or a probe.
본 발명에서 사용되는 용어, "프라이머"란 DNA 합성의 기시점이 되는 짧은 유전자 서열로써, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화 등으로 변형시킬 수 있다.As used herein, the term " primer " means a short gene sequence which is a starting point of DNA synthesis, and means an oligonucleotide synthesized for diagnosis, DNA sequencing and the like. The primers may be synthesized to have a length of 15 to 30 base pairs. The primers may be used depending on the purpose of use, and can be modified by methylation, capping or the like by a known method.
본 발명에서 사용되는 용어, "프로브"란 효소 화학적인 분리정제 또는 합성과정을 거쳐 제작된 수 염기 내지 수백 염기 길이의 mRNA와 특이적으로 결합할 수 있는 핵산을 의미한다. 방사성 동위원소나 효소 등을 표지하여 mRNA의 존재 유무를 확인할 수 있으며, 공지된 방법으로 디자인하고 변형시켜 사용할 수 있다.As used herein, the term " probe " refers to a nucleic acid capable of specifically binding to mRNA of a length of several hundreds to several hundreds of nucleotides prepared through enzymatic chemical separation purification or synthesis. Radioactive isotopes or enzymes can be labeled to confirm the presence or absence of mRNA and can be designed and modified by known methods.
본 발명에서, 상기 단백질 수준을 측정하는 제제는 유전자가 암호화하는 단백질에 특이적으로 결합하는 항체일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the agent for measuring the protein level may be an antibody that specifically binds to a protein encoded by the gene, but is not limited thereto.
본 발명에서 사용되는 용어, "항체"는 면역학적으로 특정 항원과 반응성을 갖는 면역글로불린 분자를 포함하며, 단클론(monoclonal) 항체 및 다클론(polyclonal) 항체를 모두 포함한다. 또한, 상기 항체는 키메라성 항체(예를 들면, 인간화 뮤린 항체) 및 이종결합항체(예를 들면, 양특이성 항체)와 같은 유전공학에 의해 생산된 형태를 포함한다.As used herein, the term " antibody " includes immunoglobulin molecules immunologically reactive with specific antigens and includes both monoclonal and polyclonal antibodies. The antibody also includes forms produced by genetic engineering such as chimeric antibodies (e. G., Humanized murine antibodies) and heterologous binding antibodies (e. G., Bispecific antibodies).
본 발명의 예측용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치로 구성된다.The predictive kit of the present invention comprises one or more other component compositions, solutions or devices suitable for the analytical method.
예컨대, 본 발명의 키트는 PCR을 수행하기 위해, 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 함유할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.For example, the kit of the present invention includes a genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of a DNA polymerase, a dNTP mixture, a PCR buffer solution and water May be included. The PCR buffer may contain KCl, Tris-HCl and MgCl 2. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.
또한, 본 발명의 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.In addition, the kit of the present invention may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits can be used for the detection of enzymes such as test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control.
또한, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. DNA 칩 키트는, 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판을 포함하고, 기판은 정량구조 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다. 또한, 본 발명의 키트는 본 발명의 마커 유전자가 고정화되어 있는 기판을 갖는 마이크로어레이 형태일 수 있다.In addition, the kit of the present invention may be a kit containing essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative structural gene or a fragment thereof. In addition, the kit of the present invention may be in the form of a microarray having a substrate on which the marker gene of the present invention is immobilized.
또한, 본 발명의 키트는 ELISA를 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 키트일 수 있다. ELISA 키트는 마커 단백질에 대한 특이적인 항체를 포함하며, 상기 단백질 수준을 측정하는 제제를 포함한다. 상기 ELISA 키트는 "항원-항체 복합체"를 형성한 항체를 검출할 수 있는 시약, 예를 들면 표지된 2차 항체, 발색단(chromopores), 효소, 및 그의 기질을 포함할 수 있다. 또한, 정량 대조군 단백질에 특이적인 항체를 포함할 수 있다.In addition, the kit of the present invention may be a kit comprising essential elements necessary for performing ELISA. An ELISA kit comprises an antibody specific for a marker protein and comprises an agent that measures said protein level. The ELISA kit may comprise a reagent capable of detecting an antibody that forms an " antigen-antibody complex ", such as a labeled secondary antibody, chromopores, an enzyme, and its substrate. In addition, antibodies specific for the quantitation control protein may be included.
본 발명에서 사용되는 용어 "항원-항체 복합체"란 유전자가 코딩하는 단백질과 이에 특이적인 항체의 결합물을 의미한다. 항원-항체 복합체의 형성량은 검출 라벨(detection label)의 시그널의 크기를 통해서 정량적으로 측정할 수 있다. 이러한 검출 라벨은 효소, 형광물, 리간드, 발광물, 미세입자(microparticle), 레독스 분자 및 방사선 동위원소로 이루어진 그룹 중에서 선택할 수 있으며, 이에 제한되는 것은 아니다.As used herein, the term " antigen-antibody complex " refers to a combination of a protein encoded by a gene and an antibody specific thereto. The amount of antigen-antibody complex formed can be determined quantitatively through the size of the signal of the detection label. Such detection labels may be selected from the group consisting of enzymes, minerals, ligands, emitters, microparticles, redox molecules and radioisotopes, but is not limited thereto.
본 발명의 다른 양태로서, 본 발명은 피검자 유래의 생물학적 시료에서 ICAM-1 유전자의 mRNA 또는 상기 유전자가 암호화하는 단백질을 검출하는 단계를 포함하는, 유방암의 전이 진단, 예후 예측 또는 치료제 반응성 예측을 위한 정보제공방법을 제공한다.In another aspect of the present invention, the present invention provides a method for predicting metastasis diagnosis, prognosis prediction, or therapeutic agent response of breast cancer, comprising the step of detecting mRNA of ICAM-1 gene or a protein encoded by the gene in a biological sample derived from a subject. Provide information providing method.
상기 mRNA의 발현수준은 당업계에 알려진 통상적인 방법에 따라 나노스트링 엔카운터 분석(NanoString nCounter analysis), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 1종 이상의 방법을 통해 측정될 수 있으나, 이에 제한되는 것은 아니다.The level of expression of the mRNA may be determined by a method known in the art such as NanoString nCounter analysis, PCR, reverse transcription polymerase chain reaction (RT-PCR), real-time PCR Can be measured through one or more methods selected from the group consisting of real-time PCR, RNase protection assay (RPA), microarray, and northern blotting, But is not limited to.
상기 단백질 발현수준은 당업계에 알려진 통상적인 방법에 따라 웨스턴 블롯팅(western blotting), 방사선면역분석법(radioimmunoassay; RIA), 방사 면역 확산법(radioimmunodiffusion), 효소면역분석법(ELISA), 면역침강법(immunoprecipitation), 유세포분석법(flow cytometry), 면역형광염색법(immunofluorescence), 오우크테로니(ouchterlony), 보체 고정 분석법(complement fixation assay), 및 단백질 칩(protein chip)으로 이루어진 군으로부터 선택되는 1종 이상의 방법을 통해 측정되는 것일 수 있으나, 이에 제한되는 것은 아니다.The protein expression level may be determined by Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation), immunoprecipitation ), One or more methods selected from the group consisting of flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, and protein chip. But is not limited thereto.
본 발명자들은 구체적인 실시예을 통해 유방암에서의 신규한 바이오마커로써 본 발명에 따른 ICAM-1의 용도를 규명하였다.The inventors have identified the use of ICAM-1 according to the present invention as a novel biomarker in breast cancer through a specific example.
본 발명의 일 실시예에서는, 약물 치료에 대한 반응성이 좋지 않은 기저형 (basal type) 유방암 조직에서 ICAM-1의 발현이 높은 것을 확인하였고, ICAM family 중 ICAM-1을 제외하고 연관성이 없다는 것을 확인하였다. In one embodiment of the present invention, the expression of ICAM-1 was found to be high in basal type breast cancer tissues with poor responsiveness to drug therapy, and it was confirmed that ICAM-1 was not involved in the ICAM family except for ICAM-1 .
본 발명의 다른 실시예에서는, ICAM-1 발현 조절에 따른 유방암 세포의 침윤능 및 전이능 변화를 in vitro 및 in vivo 실험을 통해 확인한 결과, ICAM-1의 억제는 유방암 세포의 침윤능 및 전이능을 감소시키는 반면, 세포 성장 및 암조직 무게에는 영향을 주지 않는 것을 확인함으로써 ICAM-1이 유방암 세포의 침윤능 및 전이능에만 관련이 있음을 규명하였다.In another embodiment of the present invention, the in vitro and in vivo changes in the invasiveness and metastatic potential of breast cancer cells according to ICAM-1 expression control were examined. As a result, the inhibition of ICAM-1 was confirmed by the invasiveness and metastatic potential , But not on cell growth and cancer tissue weights, suggesting that ICAM-1 is only involved in the invasiveness and metastatic potential of breast cancer cells.
본 발명의 또 다른 실시예에서는, ICAM-1에 의한 전이능 및 침윤능 증가가 어떠한 신호전달에 의하여 조절되는지 확인하기 위하여 ICAM-1-GST construct를 만든 후, MDAMD-231세포에 과발현을 하고 ICAM-1 Ab.를 사용하여 IP(immunoprecipitation)를 진행하고, 이를 MS(mass spectrometry)를 통해 확인한 결과, ICAM-1과 결합하는 단백질 중 EGFR이 많은 비중을 차지한다는 것을 확인하였다. 또한, IP 실험을 통해서 ICAM-1과 EGFR이 결합하는 것을 확인하고, 이를 좀더 명확히 하기 위해 MCF7세포에 ICAM-1과 EGFR를 과발현한 후 EGFR를 처리 하였을때 EGFR과 ICAM-1의 결합이 증가함을 확인함으로써 ICAM-1에 의한 유방암세포의 침윤능 조절은 EGFR과 결합을 함으로써 유도되어짐을 규명하였다.In another embodiment of the present invention, an ICAM-1-GST construct was constructed to determine what signal transduction regulated transitivity and invasiveness by ICAM-1, and overexpressed in MDAMD-231 cells, -1 Ab. As a result of MS (mass spectrometry), it was confirmed that EGFR occupies a large portion of the protein binding to ICAM-1. In order to clarify the binding of ICAM-1 and EGFR through IP experiments, the binding of EGFR to ICAM-1 was increased when EGFR was treated with ICAM-1 and EGFR overexpression in MCF7 cells , We found that ICAM-1 induced the invasiveness of breast cancer cells by binding to EGFR.
상기 결과들을 통해 ICAM-1 단백질 또는 상기 단백질을 암호화하는 유전자가 유방암의 전이 진단, 예후 예측 또는 치료제 반응성 예측을 위한 분자 마커로 이용될 수 있음을 알 수 있다.These results indicate that the ICAM-1 protein or a gene encoding the protein can be used as a molecular marker for breast cancer metastasis diagnosis, prognosis prediction, or therapeutic agent response prediction.
본 발명의 다른 양태로서, 본 발명은 (1) 유방암 세포에 후보물질을 처리하는 단계; (2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및 (3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는 유방암 치료제 스크리닝 방법을 제공한다.In another aspect of the present invention, the present invention provides a method for treating breast cancer, comprising: (1) treating a candidate substance to a breast cancer cell; (2) measuring the binding level of ICAM-1 (Intracellular adhesion molecule 1) and EGFR in the cell; And (3) selecting a substance that decreases the binding level of ICAM-1 and EGFR with respect to the candidate substance-untreated group as a therapeutic substance.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.
실시예Example 1. 유방암 세포에서 1. In breast cancer cells ICAMICAM -1 발현 확인-1 expression confirmation
먼저, GOBO database system을 통해 유방암 유형별 ICAM-1의 발현량을 확인하였다. 그 결과, 도 1a에 나타낸 바와 같이, 기저형(basal) 유방암 조직에서 ICAM-1의 발현이 높은 것을 확인할 수 있었다.First, the amount of ICAM-1 expressed by breast cancer type was confirmed through the GOBO database system. As a result, it was confirmed that the expression of ICAM-1 was high in basal breast cancer tissues as shown in Fig.
다음으로, 5가지 유방암 세포에서의 ICAM family의 발현량을 Realtime PCR을 통해 확인하였고, 그 결과, 도 1b에 나타낸 바와 같이, 유방암세포의 유형 중 가장 악성화 되어있다고 알려진 기저형 유방암세포에서 ICAM-1의 발현이 특이적으로 증가된 것을 확인할 수 있었다. Next, the expression level of the ICAM family in 5 types of breast cancer cells was confirmed by Realtime PCR. As a result, as shown in Fig. 1B, the expression of ICAM-1 in basal breast cancer cells which is known to be the most malignant of the types of breast cancer cells Expression was specifically increased.
다음으로, 기저형 유방암 세포인 MDAMB-231에 siRNA를 사용하여 ICAM family를 각각 억제한 후, boyden chamber assay을 통해 침윤능 및 이동능 변화를 확인한 결과, 도 1c에 나타낸 바와 같이, 대조군과 비교할 때, ICAM-1을 억제한 군에서만 구체적으로 침윤능이 감소함을 확인할 수 있었다. 한편, 사용한 siRNA의 구체적인 서열정보는 하기 표 1에 나타내었다.Next, the ICAM family was inhibited by using siRNA in MDAMB-231, a basal breast cancer cell, and the invasion ability and migration ability were examined through a boyden chamber assay. As a result, as shown in Fig. 1C, It was confirmed that the infiltration capacity was specifically decreased only in the group inhibiting ICAM-1. The specific sequence information of the siRNA used is shown in Table 1 below.
(서열번호 3)5 '- GCC AGC UUA UAC ACA AGA A (dTdT) -3'
(SEQ ID NO: 3)
실시예Example 2. 2. ICAMICAM -1 발현 조절에 따른 유방암 세포의 -1 expression of breast cancer cells 침윤능Invasiveness 증감 확인 Increase / decrease confirmation
먼저, 기저형 유방암 세포인 MDAMB-231에 shRNA를 사용하여 ICAM-1을 억제한 후, boyden chamber assay을 통해 침윤능 변화를 확인한 결과, 도 2a에 나타낸 바와 같이, 대조군과 비교할 때, ICAM-1을 억제한 군에서 침윤능이 감소함을 확인할 수 있었다. 한편, 사용한 shRNA의 구체적인 서열정보는 하기와 같다:First, ICAM-1 was inhibited by shRNA on MDAMB-231, which is a breast cancer cell, and then examined for changes in invasiveness using a boyden chamber assay. As shown in FIG. 2A, ICAM-1 And decreased invasiveness in the suppressed group. The specific sequence information of the shRNA used is as follows:
shICAM-1 : CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG (서열번호 5)shICAM-1: CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG (SEQ ID NO: 5)
다음으로, Western blot을 통해 EMT(epithelial-mesenchymal transition) 마커 및 조절인자의 발현변화를 확인한 결과, 도 2b에 나타내 바와 같이, 대조군과 비교할 때, ICAM-1을 억제한 군에서 EMT 마커 및 조절인자의 발현이 감소함을 확인할 수 있었다.Next, the expression of EMT (epithelial-mesenchymal transition) markers and regulatory factors was examined by Western blot. As shown in FIG. 2B, EMT markers and regulatory factors Was decreased.
한편, 기저형과 비교할 때 상대적으로 ICAM-1의 발현이 낮은 SK-BR3 세포에 ICAM-1을 과발현 후, 상기와 동일한 방법으로 침윤능 변화 및 EMT 마커/조절인자의 발현변화를 확인한 결과, 도 2c 및 도 2d에 나타낸 바와 같이, 대조군과 비교할 때, ICAM-1을 과발현한 군에서 침윤능이 증가할 뿐만 아니라, EMT 마커(Vimentin, Fibronectin) 및 조절인자(Zeb1)의 발현도 증가함을 확인할 수 있었다.On the other hand, when ICAM-1 was overexpressed in SK-BR3 cells, in which expression of ICAM-1 was relatively low as compared with the basal form, changes in invasiveness and expression of EMT marker / As shown in FIG. 2d, it was confirmed that the expression of EMT markers (Vimentin, Fibronectin) and regulatory factor (Zeb1) was increased as well as the increase in invasiveness in the ICAM-1 overexpressing group as compared with the control group .
실시예Example 3. 3. ICAMICAM -1 발현 억제에 따른 유방암 세포의 -1 expression inhibition of breast cancer cells 전이능Transferability 억제 확인(in vivo) Inhibition confirmation (in vivo)
ICAM-1 발현에 따른 전이능을 확인하기 위하여 하기와 같이 동물실험을 진행하였다. Animal experiments were carried out as follows to confirm the transposability by ICAM-1 expression.
MDAMB-231세포에 shRNA를 사용하여 ICAM-1의 발현을 감소시킨 후 fatpad에 주입하였다(도 3a). 36일간 3일 간격으로 암조직의 크기를 확인한 결과, 도 3b에 나타낸 바와 같이, 대조군과 비교할 때 암조직의 크기에서는 차이가 없었을 뿐만 아니라 도 3c에 나타낸 바와 같이, 암세포 주입 후 30일째 유방암의 무게변화를 확인하였을 때 역시 변화가 없음을 확인할 수 있었다.MDAMB-231 cells were reduced in the expression of ICAM-1 using shRNA and injected into fatpad (Fig. 3a). As shown in FIG. 3B, there was no difference in the size of cancer tissues when compared with the control group, and as shown in FIG. 3C, at 30 days after the injection of cancer cells, When the change was confirmed, it was confirmed that there was no change.
하지만 폐 조직을 얻어 폐로의 전이정도를 확인한 결과, 도 3d 및 도 3e에 나타낸 바와 같이, 대조군에 비교할 때 ICAM-1 발현은 억제한 군에서 전이 노들의 수가 감소하여 전이능이 감소됨을 확인할 수 있었다.However, as shown in FIG. 3D and FIG. 3E, when the lung tissues were obtained, the degree of metastasis to the lungs was confirmed. As a result, the number of metastatic nodules was decreased in the group suppressing ICAM-1 expression as compared with the control group,
실시예Example 4. 4. ICAMICAM -1의 -1 of 침윤능Invasiveness 증가에 대한 하위 신호전달 기전 확인 Confirmation of the lower signaling mechanism for the increase
ICAM-1에 의한 침윤능 증가가 어떠한 신호전달에 의하여 조절되는지 확인하기 위하여, 우선적으로 ICAM-1 GST-pulldown 실험을 진행하였다. 보다 구체적으로, GST-ICAM-1을 과발현 시킨 후, ICAM-1 Ab를 사용하여 IP를 하였다. 이후 MS를 진행하여 ICAM-1과 결합하는 단백질을 확인한 결과, 도 4a 및 도 4b에 나타낸 바와 같이, MDAMB231 세포에서 ICAM-1과 EGFR이 결합함을 확인할 수 있었다.ICAM-1 GST-pulldown experiments were performed to determine whether the increase in invasiveness by ICAM-1 was mediated by signal transduction. More specifically, after overexpressing GST-ICAM-1, IP was performed using ICAM-1 Ab. As a result of confirming the protein binding to ICAM-1 by proceeding with MS, it was confirmed that ICAM-1 and EGFR bind to MDAMB231 cells as shown in FIGS. 4A and 4B.
추가적으로, 내강형 세포인 MCF7 세포에 ICAM-1과 EGFR를 같이 과발현시킨 후 EGF를 처리하였을 때, 도 4c에 나타낸 바와 같이, ICAM-1과 EGFR이 결합함을 확인할 수 있었다.In addition, when EGF was treated with ICAM-1 and EGFR overexpression in MCF7 cells, which were resistant to intact cells, it was confirmed that ICAM-1 and EGFR bind to each other as shown in FIG.
실시예Example 5. 5. EGFR에EGFR 결합하는 Combine ICAMICAM -1의 도메인(domain) 확인Identify the domain of -1
EGFR에 결합하는 ICAM-1의 부분(site)을 확인하기 위하여, 먼저 ICAM-1 deletion Construct를 제작하였다. WT-ICAM-1(wild type), sol-ICAM-1(transmembrane deletion form), △ECD (extracellualr domain deletion form), △ICD (intracellular domain deletion form), △D1-5 (domain 1~5번을 각각 deletion form)(도 5a).To identify the site of ICAM-1 binding to EGFR, the ICAM-1 deletion construct was first constructed. WT-ICAM-1 (wild type), sol-ICAM-1 (transmembrane deletion form), △ ECD (extracellular domain deletion form), △ ICD (intracellular domain deletion form) Respectively deletion form (Fig. 5A).
다음으로, HEK293T 세포에 EGFR을 과발현시킨 후 △ECD와 △ICD를 각각 과발현시켰다. 도 5b에 나타낸 바와 같이, EGF 의존적으로 EGFR과 △ICD-ICAM-1을 과발현 시킨 곳에서 두 단백질이 결합하는 것을 확인함으로써 extracellular domain이 결합함을 확인할 수 있었다. 더욱이, extracellular domain을 가진 WT-ICAM-1과 sol-ICAM-1도 EGFR과 결합하는 것을 IP를 통해 확인할 수 있었다.Next, HEK293T cells were overexpressed with EGFR and overexpressed with ΔECD and ΔICD, respectively. As shown in FIG. 5B, it was confirmed that the extracellular domain binds by confirming that the two proteins bind to each other when EGFR and Δ ICD-ICAM-1 are overexpressed by EGF. Furthermore, WT-ICAM-1 and sol-ICAM-1 with the extracellular domain could also be identified via IP binding to EGFR.
추가적으로, △D1-5를 각각 과발현하는 경우의 EGFR과의 결합 변화를 확인한 결과, 도 5c에 나타낸 바와 같이, △D1를 과발현하는 경우, EGFR과의 결합이 감소함을 확인할 수 있었다.In addition, as shown in FIG. 5C, when the overexpression of? D1-5 was overexpressed, it was confirmed that the binding with EGFR was decreased.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.
<110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis and treatment of breast cancer <130> PD17-108 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 1625 <212> DNA <213> ICAM-1 <400> 1 atggctccca gcagcccccg gcccgcgctg cccgcactcc tggtcctgct cggggctctg 60 ttcccaggac ctggcaatgc cgaattcccc tcaaaagtca tcctgccccg gggaggctcc 120 gtgctggtga catgcagcac ctcctgtgac cagcccaagt tgttgggcat agagaccccg 180 ttgcctaaaa aggagttgct cctgcctggg aacaaccgga aggtgtatga actgagcaat 240 gtgcaagaag atagccaacc aatgtgctat tcaaactgcc ctgatgggca gtcaacagct 300 aaaaccttcc tcaccgtgta ctggactcca gaacgggtgg aactggcacc cctcccctct 360 tggcagccag tgggcaagaa ccttacccta cgctgccagg tggagggtgg ggcaccccgg 420 gccaacctca ccgtggtgct gctccgtggg gagaaggagc tgaaacggga gccagctgtg 480 ggggagcccg ctgaggtcac gaccacggtg ctggtgagga gagatcacca tggagccaat 540 ttctcgtgcc gcactgaact ggacctgcgg ccccaagggc tggagctgtt tgagaacacc 600 tcggccccct accagctcca gacctttgtc ctgccagcga ctcccccaca acttgtcagc 660 ccccgggtcc tagaggtgga cacgcagggg accgtggtct gttccctgga cgggctgttc 720 ccagtctcgg aggcccaggt ccacctggca ctgggggacc agaggttgaa ccccacagtc 780 acctatggca acgactcctt ctcggccaag gcctcagtca gtgtgaccgc agaggacgag 840 ggcacccagc ggctgacgtg tgcagtaata ctggggaacc agagccagga gacactgcag 900 acagtgacca tttacagttt tccggcgccc aacgtgattc tgacgaagcc agaggtctca 960 gaagggaccg aggtgacagt gaagtgtgag gcccacccta gagccaaggt gacgctgaat 1020 ggggttccag cccagccact gggcccgagg gcccagctcc tgctgaaggc caccccagag 1080 gacaacgggc gcagcttctc ctgctctgca accctggagg tggccggcca gcttatacac 1140 aagaaccaga cccgggagct tcgtgtcctg tatggccccc gactggacga gagggattgt 1200 ccgggaaact ggacgtggcc agaaaattcc cagcagactc caatgtgcca ggcttggggg 1260 aacccattgc ccgagctcaa gtgtctaaag gatggcactt tcccactgcc catcggggaa 1320 tcagtgactg tcactcgaga tcttgagggc acctacctct gtcgggccag gagcactcaa 1380 ggggaggtca cccgcgaggt gaccgtgaat gtgctctccc cccggtatga gattgtcatc 1440 atcactgtgg tagcagccgc agtcataatg ggcactgcag gcctcagcac gtacctctat 1500 aaccgccagc ggaagatcaa gaaatacaga ctacaacagg cccaaaaagg gacccccatg 1560 aaaccgaaca cacaagccac gcctccctac ccatacgatg ttccagatta cgcttgagcg 1620 gccgc 1625 <210> 2 <211> 532 <212> PRT <213> ICAM-1 <400> 2 Met Ala Pro Ser Ser Pro Arg Pro Ala Leu Pro Ala Leu Leu Val Leu 1 5 10 15 Leu Gly Ala Leu Phe Pro Gly Pro Gly Asn Ala Gln Thr Ser Val Ser 20 25 30 Pro Ser Lys Val Ile Leu Pro Arg Gly Gly Ser Val Leu Val Thr Cys 35 40 45 Ser Thr Ser Cys Asp Gln Pro Lys Leu Leu Gly Ile Glu Thr Pro Leu 50 55 60 Pro Lys Lys Glu Leu Leu Leu Pro Gly Asn Asn Arg Lys Val Tyr Glu 65 70 75 80 Leu Ser Asn Val Gln Glu Asp Ser Gln Pro Met Cys Tyr Ser Asn Cys 85 90 95 Pro Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr 100 105 110 Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser Trp Gln Pro Val Gly 115 120 125 Lys Asn Leu Thr Leu Arg Cys Gln Val Glu Gly Gly Ala Pro Arg Ala 130 135 140 Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys Glu Leu Lys Arg Glu 145 150 155 160 Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr Thr Val Leu Val Arg 165 170 175 Arg Asp His His Gly Ala Asn Phe Ser Cys Arg Thr Glu Leu Asp Leu 180 185 190 Arg Pro Gln Gly Leu Glu Leu Phe Glu Asn Thr Ser Ala Pro Tyr Gln 195 200 205 Leu Gln Thr Phe Val Leu Pro Ala Thr Pro Pro Gln Leu Val Ser Pro 210 215 220 Arg Val Leu Glu Val Asp Thr Gln Gly Thr Val Val Cys Ser Leu Asp 225 230 235 240 Gly Leu Phe Pro Val Ser Glu Ala Gln Val His Leu Ala Leu Gly Asp 245 250 255 Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn Asp Ser Phe Ser Ala 260 265 270 Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu Gly Thr Gln Arg Leu 275 280 285 Thr Cys Ala Val Ile Leu Gly Asn Gln Ser Gln Glu Thr Leu Gln Thr 290 295 300 Val Thr Ile Tyr Ser Phe Pro Ala Pro Asn Val Ile Leu Thr Lys Pro 305 310 315 320 Glu Val Ser Glu Gly Thr Glu Val Thr Val Lys Cys Glu Ala His Pro 325 330 335 Arg Ala Lys Val Thr Leu Asn Gly Val Pro Ala Gln Pro Leu Gly Pro 340 345 350 Arg Ala Gln Leu Leu Leu Lys Ala Thr Pro Glu Asp Asn Gly Arg Ser 355 360 365 Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly Gln Leu Ile His Lys 370 375 380 Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly Pro Arg Leu Asp Glu 385 390 395 400 Arg Asp Cys Pro Gly Asn Trp Thr Trp Pro Glu Asn Ser Gln Gln Thr 405 410 415 Pro Met Cys Gln Ala Trp Gly Asn Pro Leu Pro Glu Leu Lys Cys Leu 420 425 430 Lys Asp Gly Thr Phe Pro Leu Pro Ile Gly Glu Ser Val Thr Val Thr 435 440 445 Arg Asp Leu Glu Gly Thr Tyr Leu Cys Arg Ala Arg Ser Thr Gln Gly 450 455 460 Glu Val Thr Arg Lys Val Thr Val Asn Val Leu Ser Pro Arg Tyr Glu 465 470 475 480 Ile Val Ile Ile Thr Val Val Ala Ala Ala Val Ile Met Gly Thr Ala 485 490 495 Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg Lys Ile Lys Lys Tyr 500 505 510 Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro Met Lys Pro Asn Thr Gln 515 520 525 Ala Thr Pro Pro 530 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 sense <400> 3 gccagcuuau acacaagaa 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 antisense <400> 4 uucuugugua uaagcuggc 19 <210> 5 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> shICAM-1 <400> 5 ccgggatcac catggagcca atttcctcga ggaaattggc tccatggtga tctttttg 58 <110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis and treatment of breast cancer <130> PD17-108 <160> 5 <170> KoPatentin 3.0 <210> 1 <211> 1625 <212> DNA <213> ICAM-1 <400> 1 atggctccca gcagcccccg gcccgcgctg cccgcactcc tggtcctgct cggggctctg 60 ttcccaggac ctggcaatgc cgaattcccc tcaaaagtca tcctgccccg gggaggctcc 120 gtgctggtga catgcagcac ctcctgtgac cagcccaagt tgttgggcat agagaccccg 180 ttgcctaaaa aggagttgct cctgcctggg aacaaccgga aggtgtatga actgagcaat 240 gtgcaagaag atagccaacc aatgtgctat tcaaactgcc ctgatgggca gtcaacagct 300 aaaaccttcc tcaccgtgta ctggactcca gaacgggtgg aactggcacc cctcccctct 360 tggcagccag tgggcaagaa ccttacccta cgctgccagg tggagggtgg ggcaccccgg 420 gccaacctca ccgtggtgct gctccgtggg gagaaggagc tgaaacggga gccagctgtg 480 ggggagcccg ctgaggtcac gaccacggtg ctggtgagga gagatcacca tggagccaat 540 ttctcgtgcc gcactgaact ggacctgcgg ccccaagggc tggagctgtt tgagaacacc 600 tcggccccct accagctcca gacctttgtc ctgccagcga ctcccccaca acttgtcagc 660 ccccgggtcc tagaggtgga cacgcagggg accgtggtct gttccctgga cgggctgttc 720 ccagtctcgg aggcccaggt ccacctggca ctgggggacc agaggttgaa ccccacagtc 780 acctatggca acgactcctt ctcggccaag gcctcagtca gtgtgaccgc agaggacgag 840 ggcacccagc ggctgacgtg tgcagtaata ctggggaacc agagccagga gacactgcag 900 acagtgacca tttacagttt tccggcgccc aacgtgattc tgacgaagcc agaggtctca 960 gaagggaccg aggtgacagt gaagtgtgag gcccacccta gagccaaggt gacgctgaat 1020 ggggttccag cccagccact gggcccgagg gcccagctcc tgctgaaggc caccccagag 1080 gacaacgggc gcagcttctc ctgctctgca accctggagg tggccggcca gcttatacac 1140 aagaaccaga cccgggagct tcgtgtcctg tatggccccc gactggacga gagggattgt 1200 ccgggaaact ggacgtggcc agaaaattcc cagcagactc caatgtgcca ggcttggggg 1260 aacccattgc ccgagctcaa gtgtctaaag gatggcactt tcccactgcc catcggggaa 1320 tcagtgactg tcactcgaga tcttgagggc acctacctct gtcgggccag gagcactcaa 1380 ggggaggtca cccgcgaggt gaccgtgaat gtgctctccc cccggtatga gattgtcatc 1440 atcactgtgg tagcagccgc agtcataatg ggcactgcag gcctcagcac gtacctctat 1500 aaccgccagc ggaagatcaa gaaatacaga ctacaacagg cccaaaaagg gacccccatg 1560 aaaccgaaca cacaagccac gcctccctac ccatacgatg ttccagatta cgcttgagcg 1620 gccgc 1625 <210> 2 <211> 532 <212> PRT <213> ICAM-1 <400> 2 Met Ala Pro Ser Ser Pro Pro Ala Leu Pro Ala Leu Le Val Leu 1 5 10 15 Leu Gly Ala Leu Phe Pro Gly Pro Gly Asn Ala Gln Thr Ser Val Ser 20 25 30 Pro Ser Lys Val Ile Leu Pro Arg Gly Gly Ser Val Leu Val Thr Cys 35 40 45 Ser Thr Ser Cys Asp Gln Pro Lys Leu Leu Gly Ile Glu Thr Pro Leu 50 55 60 Pro Lys Lys Glu Leu Leu Leu Pro Gly Asn Asn Arg Lys Val Tyr Glu 65 70 75 80 Leu Ser Asn Val Gln Glu Asp Ser Gln Pro Met Cys Tyr Ser Asn Cys 85 90 95 Pro Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr 100 105 110 Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser Trp Gln Pro Val Gly 115 120 125 Lys Asn Leu Thr Leu Arg Cys Gln Val Glu Gly Gly Ala Pro Arg Ala 130 135 140 Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys Glu Leu Lys Arg Glu 145 150 155 160 Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr Thr Val Leu Val Arg 165 170 175 Arg Asp His His Gly Ala Asn Phe Ser Cys Arg Thr Glu Leu Asp Leu 180 185 190 Arg Pro Gln Gly Leu Glu Leu Phe Glu Asn Thr Ser Ala Pro Tyr Gln 195 200 205 Leu Gln Thr Phe Val Leu Pro Ala Thr Pro Pro Gln Leu Val Ser Pro 210 215 220 Arg Val Leu Glu Val Asp Thr Gln Gly Thr Val Val Cys Ser Leu Asp 225 230 235 240 Gly Leu Phe Pro Val Ser Glu Ala Gln Val His Leu Ala Leu Gly Asp 245 250 255 Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn Asp Ser Phe Ser Ala 260 265 270 Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu Gly Thr Gln Arg Leu 275 280 285 Thr Cys Ala Val Ile Leu Gly Asn Gln Ser Gln Glu Thr Leu Gln Thr 290 295 300 Val Thr Ile Tyr Ser Phe Pro Ala Pro Asn Val Ile Leu Thr Lys Pro 305 310 315 320 Glu Val Ser Glu Gly Thr Glu Val Thr Val Lys Cys Glu Ala His Pro 325 330 335 Arg Ala Lys Val Thr Leu Asn Gly Val Pro Ala Gln Pro Leu Gly Pro 340 345 350 Arg Ala Gln Leu Leu Leu Lys Ala Thr Pro Glu Asp Asn Gly Arg Ser 355 360 365 Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly Gln Leu Ile His Lys 370 375 380 Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly Pro Arg Leu Asp Glu 385 390 395 400 Arg Asp Cys Pro Gly Asn Trp Thr Trp Pro Glu Asn Ser Gln Gln Thr 405 410 415 Pro Met Cys Gln Ala Trp Gly Asn Pro Leu Pro Glu Leu Lys Cys Leu 420 425 430 Lys Asp Gly Thr Phe Pro Leu Pro Ile Gly Glu Ser Val Thr Val Thr 435 440 445 Arg Asp Leu Glu Gly Thr Tyr Leu Cys Arg Ala Arg Ser Thr Gln Gly 450 455 460 Glu Val Thr Arg Lys Val Thr Val Asn Val Leu Ser Pro Arg Tyr Glu 465 470 475 480 Ile Val Ile Ile Thr Val Ala Ala Ala Val Ile Met Gly Thr Ala 485 490 495 Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg Lys Ile Lys Lys Tyr 500 505 510 Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro Met Lys Pro Asn Thr Gln 515 520 525 Ala Thr Pro Pro 530 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 sense <400> 3 gccagcuuau acacaagaa 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 antisense <400> 4 uucuugugua uaagcuggc 19 <210> 5 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> shICAM-1 <400> 5 ccgggatcac catggagcca atttcctcga ggaaattggc tccatggtga tcttttttg 58
Claims (7)
A marker composition for predicting the reactivity of a breast cancer therapeutic agent, comprising an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein encoded by the gene.
상기 ICAM-1 유전자는 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는, 마커 조성물.
The method according to claim 1,
Wherein the ICAM-1 gene comprises the nucleotide sequence of SEQ ID NO: 1.
A composition for predicting the responsiveness of a therapeutic agent for breast cancer, comprising an agent for measuring mRNA of an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein level encoded by the gene.
상기 유전자의 mRNA 수준을 측정하는 제제는 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브인 것을 특징으로 하는, 조성물.
The method of claim 3,
Wherein the agent for measuring the mRNA level of the gene is a sense and antisense primer that binds complementarily to the mRNA of the gene, or a probe.
상기 단백질 수준을 측정하는 제제는 상기 유전자가 암호화하는 단백질에 특이적으로 결합하는 항체인 것을 특징으로 하는, 조성물.
The method of claim 3,
Wherein the agent for measuring the protein level is an antibody that specifically binds to a protein encoded by the gene.
A kit for predicting the responsiveness of a breast cancer therapeutic agent, comprising the composition of claim 3.
(2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및
(3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는, 유방암 치료제 스크리닝 방법.(1) treating a candidate substance to a breast cancer cell;
(2) measuring the binding level of ICAM-1 (Intracellular adhesion molecule 1) and EGFR in the cell; And
(3) selecting a substance that reduces the binding level of ICAM-1 and EGFR with respect to the candidate substance-untreated group as a therapeutic substance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020170155727A KR102028703B1 (en) | 2017-11-21 | 2017-11-21 | Biomarker for diagnosis and treatment of breast cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020170155727A KR102028703B1 (en) | 2017-11-21 | 2017-11-21 | Biomarker for diagnosis and treatment of breast cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20190058082A true KR20190058082A (en) | 2019-05-29 |
| KR102028703B1 KR102028703B1 (en) | 2019-10-04 |
Family
ID=66673090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020170155727A KR102028703B1 (en) | 2017-11-21 | 2017-11-21 | Biomarker for diagnosis and treatment of breast cancer |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR102028703B1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102489405B1 (en) | 2020-04-07 | 2023-01-17 | 서울대학교병원 | COMPOSITION FOR PREDICTING REACTIVITY Of ANTICANCER AGENT IN BREAST CANCER PATIENTS AND KIT COMPRISING SAME |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150024342A (en) * | 2012-06-26 | 2015-03-06 | 에프. 호프만-라 로슈 아게 | Blood plasma biomarkers for bevacizumab combination therapies for treatment of breast cancer |
-
2017
- 2017-11-21 KR KR1020170155727A patent/KR102028703B1/en active IP Right Grant
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150024342A (en) * | 2012-06-26 | 2015-03-06 | 에프. 호프만-라 로슈 아게 | Blood plasma biomarkers for bevacizumab combination therapies for treatment of breast cancer |
Non-Patent Citations (2)
| Title |
|---|
| Carcinogenesis, 26(5), pp. 943-950 (2005.03.17.)* * |
| Oncol Rep, 35(3), pp. 1541-1548 (2016.01.05.)* * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102028703B1 (en) | 2019-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20050003390A1 (en) | Targets for controlling cellular growth and for diagnostic methods | |
| CA2882759C (en) | Detection of the ntrk1-mprip gene fusion for cancer diagnosis | |
| EP2126566B1 (en) | Metastasis specific splice variants of mena and uses thereof in diagnosis, prognosis and treatment of tumors | |
| KR20070061893A (en) | Methods and compositions for evaluating breast cancer prognosis | |
| WO2004076682A2 (en) | Targets for controlling cellular growth and for diagnostic methods | |
| US8747867B2 (en) | Cancer markers | |
| EP2361315A1 (en) | Cxcl4l1 as a biomarker of pancreatic cancer | |
| WO2007075672A2 (en) | Prognostic cancer markers | |
| Malta-Vacas et al. | eRF3a/GSPT1 12-GGC allele increases the susceptibility for breast cancer development | |
| KR102028703B1 (en) | Biomarker for diagnosis and treatment of breast cancer | |
| KR101200194B1 (en) | Use of SOCS6 as a hepatocellular carcinomar diagnostic marker | |
| EP3460476B1 (en) | Biomarker composition comprising lrp-1 as active ingredient, for diagnosis of radiation-resistant cancer or prediction of radiation therapy prognosis | |
| US20130058966A1 (en) | Anti-pdef antibodies and uses thereof | |
| KR20190051364A (en) | Biomarker for diagnosis of metastatic breast cancer and uses thereof | |
| KR102434324B1 (en) | Biomarker for diagnosis or prognosis prediction of metastatic breast cancer and use thereof | |
| KR20220061425A (en) | Biomarker predictive of responsiveness to an anticancer agent and use thereof | |
| EP1573069A2 (en) | Amplified cancer target genes useful in diagnosis and therapeutic screening | |
| KR100861464B1 (en) | A carcinoma gene tip41, a protein translated from the gene and a diagnostic kit using the same | |
| KR102549771B1 (en) | Method for screening an inhibitor for metastasis of colorectal cancer | |
| US20230288399A1 (en) | Method for screening colorectal cancer metastasis inhibitor | |
| KR102431271B1 (en) | Biomarker predictive of responsiveness to an anticancer agent and use thereof | |
| KR102528973B1 (en) | Biomarkers for cancer immunotherapy and use thereof | |
| KR101968962B1 (en) | Compositions for diagnosing obesity resistance | |
| KR102084658B1 (en) | Metastasis-specific markers for diagnosing prognosis and determining treatment strategies of patient of clear cell renal cell carcinoma | |
| KR101927577B1 (en) | Use of H2A.Z.1 as a hepatocellular carcinomar biomarker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right |