KR102028703B1 - Biomarker for diagnosis and treatment of breast cancer - Google Patents
Biomarker for diagnosis and treatment of breast cancer Download PDFInfo
- Publication number
- KR102028703B1 KR102028703B1 KR1020170155727A KR20170155727A KR102028703B1 KR 102028703 B1 KR102028703 B1 KR 102028703B1 KR 1020170155727 A KR1020170155727 A KR 1020170155727A KR 20170155727 A KR20170155727 A KR 20170155727A KR 102028703 B1 KR102028703 B1 KR 102028703B1
- Authority
- KR
- South Korea
- Prior art keywords
- icam
- breast cancer
- leu
- pro
- present
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70525—ICAM molecules, e.g. CD50, CD54, CD102
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Bioinformatics & Computational Biology (AREA)
- Oncology (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 유방암의 진단 및 치료를 위한 바이오 마커에 관한 것으로서, 보다 구체적으로 ICAM-1 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는 유방암 치료제 반응성 예측용 마커 조성물, 및 이를 이용한 치료제 반응성 예측용 조성물 및 치료제 반응성 예측을 위한 정보제공방법 등에 관한 것이다.
본 발명자들은 유방암의 진단 및 치료에 이용할 수 있는 신규한 바이오마커로 ICAM-1을 도출하였고, 그 유효성 및 ICAM-1에 의해 조절되는 구체적인 메커니즘을 모두 확인하였는바, 본 발명에 따른 바이오마커는 유방암의 치료를 위한 새로운 표적으로서, 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 유용하게 이용될 수 있다.The present invention relates to a biomarker for diagnosing and treating breast cancer, and more particularly, a marker composition for predicting the reactivity of a breast cancer agent comprising the ICAM-1 gene or a protein encoded by the gene, and a composition for predicting the reactivity of the therapeutic agent using the same, and The present invention relates to a method for providing information for predicting therapeutic response.
The inventors have derived ICAM-1 as a novel biomarker that can be used for the diagnosis and treatment of breast cancer, and confirmed both its effectiveness and specific mechanisms regulated by ICAM-1. As a new target for the treatment of, it can be usefully used to diagnose the metastasis of breast cancer, the prognosis or to predict the therapeutic responsiveness of a therapeutic agent.
Description
본 발명은 유방암의 진단 및 치료를 위한 바이오 마커에 관한 것으로서, 보다 구체적으로 ICAM-1 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는 유방암 치료제 반응성 예측용 마커 조성물, 및 이를 이용한 치료제 반응성 예측용 조성물, 치료제 반응성 예측을 위한 정보제공방법 등에 관한 것이다.The present invention relates to a biomarker for diagnosing and treating breast cancer, and more particularly, a marker composition for predicting the reactivity of a breast cancer agent comprising the ICAM-1 gene or a protein encoded by the gene, and a composition for predicting the reactivity of the therapeutic agent using the same, The present invention relates to a method for providing information for predicting therapeutic response.
유방암이란 유방의 세포에서 발생하는 악성종양을 말한다. 유방암의 원인에 대해 명확하게 밝혀진 것은 없지만, 여성 호르몬, 가족력, 과거력, 출산력, 식생활 습관 등의 다양한 인자들이 거론되고 있다. 유방암의 5년 생존율은, 100%인 0기 암에 비해 4기일 경우 20% 미만으로 알려져 있다. 저출산, 짧은 수유기간, 이른 초경, 늦은 폐경 등 생리적으로 왕성한 신체적 변화를 겪는 시기의 여성들에서는 여성호르몬의 자극을 받는 횟수의 급격한 증가로 인한 유선조직의 민감도 증가, 식생활의 서구화, 생활환경의 오염 등의 이유로 최근 유방암 발생이 급격하게 증가하고 있으며, 이러한 유방암의 발생빈도 및 유방암으로 인한 사망률의 증가는 현재의 서구화 실태로 보아 앞으로도 상당기간 지속될 것으로 예상된다.Breast cancer is a malignant tumor that occurs in cells of the breast. Although the cause of breast cancer is not clear, various factors such as female hormones, family history, past history, fertility, and dietary habits have been discussed. The 5-year survival rate of breast cancer is known to be less than 20% in
이질성을 가지는 유방암 세포들은 다양한 바이오마커의 발현양상에 따라 서브타입을 가지고 있으며 그에 따른 약물 치료뿐만 아니라 방사선 치료를 진행하고 있다. 이러한 서브타입은 에스트로겐수용체 (ER), 프로게스테론수용체 (PR) 및 인간상피성장인자 수용체(HER2)의 발현 유무에 따라 나누어진다고 보고되고 있다. 3가지의 호르몬 수용체를 가진 유형(ER+,PR+,HER2+)을 내강형(luminal type)이라고 하며 그 수용체를 타겟으로 하는 약물치료가 효과적으로 진행되어지고 있지만, 3가지 수용체에 대해 음성을 보인 조직 (ER-,PR-,HER2-) 즉, 기저형 (basal type) 유방암 조직은 약물 치료가 쉽지 않을 뿐만 아니라 내강형과 비교하였을 때 침투능이 높고 전이가 잘 일어남으로써 좋지 않은 예후를 보여주고 있다.Heterogeneous breast cancer cells have subtypes according to the expression patterns of various biomarkers and are undergoing radiation therapy as well as drug treatment accordingly. These subtypes are reported to be divided according to the expression of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor (HER2). Types with three hormone receptors (ER +, PR +, HER2 +) are called the luminal type, and drug treatment targeting these receptors is progressing effectively, but tissues that are negative for the three receptors (ER -, PR-, HER2-), ie basal type breast cancer tissue, is not only easy to treat, but also has a poor prognosis due to its high penetration and metastasis compared to the lumen type.
따라서, 유방암을 치료하기 위해서는, 치료 이전의 단계에서 높은 민감도와 특이도를 가진 암의 진단 방법의 개발이 무엇보다 중요하며, 이러한 진단은 암의 초기에 발견될 수 있는 것이어야 한다. 또한, 이러한 암의 발병여부 및 진행 단계의 정확한 판별이 가능하게 하는 암의 진단제 및 외과적 절제술이나 항암제의 단점을 보완한 치료제의 개발을 위한 바이오 마커의 선별 및 진단 마커를 측정하는 제제의 개발은 난치병인 암을 정복하는 필수 불가결한 수단이라 할수 있다.Therefore, in order to treat breast cancer, the development of a diagnostic method of cancer with high sensitivity and specificity in the pre-treatment stage is of paramount importance, and such a diagnosis must be one that can be found early in cancer. In addition, the development of an agent for screening biomarkers and measuring diagnostic markers for the development of a diagnostic agent for cancer that enables accurate determination of the onset and progression of such cancer, and a therapeutic agent that compensates for the disadvantages of surgical resection or anticancer agent. Is an indispensable means of conquering cancer, an incurable disease.
이에, 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성 등을 예측하는데 이용할 수 있는 새로운 표적에 대한 개발이 필요한 실정이고, 이에 대한 연구가 이루어지고 있으나(한국공개특허 10-2014-0019833 등), 아직 미미한 수준이다.Thus, there is a need for the development of new targets that can be used to diagnose metastasis of breast cancer, prognosis or therapeutic responsiveness of therapeutic agents, and research on this is being done (Korea Patent Publication No. 10-2014-0019833). It is a slight level.
본 발명자들은 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 이용할 수 있는 새로운 표적에 대한 연구를 진행한 결과, 약물 치료에 대한 반응성이 좋지 않은 기저형 (basal type) 유방암 조직에서 ICAM-1이 특이적으로 높게 발현하고, ICAM-1이 활성화된 EGFR과의 결합을 통해 하위신호 활성화를 유도하여 유방암의 침윤능 및 전이에 중요한 역할을 한다는 것을 최초로 규명하였는바, 이에 기초하여 본 발명을 완성하였다.The present inventors have studied new targets that can be used to diagnose metastasis, prognosis or therapeutic response of breast cancer, and as a result, ICAM-1 has been shown to affect basal type breast cancer tissue that is poorly responsive to drug treatment. The expression of high specificity, ICAM-1 induces sub-signal activation through binding to activated EGFR has been identified for the first time to play an important role in the invasiveness and metastasis of breast cancer, the present invention was completed based on this .
이에, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는 유방암 치료제 반응성 예측용 마커 조성물, 및 이를 이용한 치료제 반응성 예측용 조성물, 키트 및 치료제 반응성 예측을 위한 정보제공방법을 제공하는 것을 목적으로 한다.Accordingly, the present invention provides an intracellular adhesion molecule 1 (IMC-1) gene or a marker composition for predicting the reactivity of a breast cancer drug comprising the protein encoded by the gene, and a composition, a kit for predicting the reactivity and a therapeutic response using the same It aims to provide a providing method.
또한, 본 발명은 (1) 유방암 세포에 후보물질을 처리하는 단계; (2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및 (3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는 유방암 치료제 스크리닝 방법을 제공하는 것을 또 다른 목적으로 한다.In addition, the present invention comprises the steps of (1) treating the candidate substance to breast cancer cells; (2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And (3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic agent, as compared to the non-treatment candidate, as another object of the present invention.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는, 유방암 치료제 반응성 예측용 마커 조성물을 제공한다.In order to achieve the object of the present invention as described above, the present invention provides a marker composition for predicting the reactivity of breast cancer therapeutic agent comprising an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein encoding the gene.
본 발명의 일 구현예로, 상기 ICAM-1 유전자는 서열번호 1의 염기서열로 이루어질 수 있다.In one embodiment of the present invention, the ICAM-1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.
또한, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자의 mRNA 또는 상기 유전자가 암호화하는 단백질 수준을 측정하는 제제를 포함하는, 유방암 치료제 반응성 예측용 조성물을 제공한다.In another aspect, the present invention provides a composition for predicting the reactivity of breast cancer therapeutic agent comprising an agent for measuring the mRNA level of the intracellular adhesion molecule 1 (IMC-1) gene or the protein encoded by the gene.
본 발명의 일 구현예로, 상기 유전자의 mRNA 수준을 측정하는 제제는 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있다.In one embodiment of the invention, the agent for measuring the mRNA level of the gene may be a sense and antisense primer, or probe that complementarily binds to the mRNA of the gene.
본 발명의 다른 구현예로, 상기 단백질 수준을 측정하는 제제는 상기 유전자가 암호화하는 단백질에 특이적으로 결합하는 항체일 수 있다.In another embodiment of the invention, the agent for measuring the protein level may be an antibody that specifically binds to the protein encoded by the gene.
또한, 본 발명은 상기 조성물을 포함하는, 유방암 치료제 반응성 예측용 키트를 제공한다.The present invention also provides a kit for predicting reactivity of breast cancer, comprising the composition.
또한, 본 발명은 (1) 유방암 세포에 후보물질을 처리하는 단계; (2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및 (3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는, 유방암 치료제 스크리닝 방법을 제공한다.In addition, the present invention comprises the steps of (1) treating the candidate substance to breast cancer cells; (2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And (3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic substance, as compared to the candidate non-treatment group.
본 발명자들은 유방암의 진단 및 치료에 이용할 수 있는 신규한 바이오마커로 ICAM-1을 도출하였고, 그 유효성 및 ICAM-1에 의해 조절되는 구체적인 메커니즘을 모두 확인하였는바, 본 발명에 따른 바이오마커는 유방암의 치료를 위한 새로운 표적으로서, 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 유용하게 이용될 수 있다.The inventors have derived ICAM-1 as a novel biomarker that can be used for the diagnosis and treatment of breast cancer, and confirmed both its effectiveness and specific mechanisms regulated by ICAM-1. As a new target for the treatment of, it can be usefully used for diagnosing the metastasis of breast cancer, prognosis or predicting the therapeutic reactivity of a therapeutic agent.
도 1a는, 유방암 유형별 ICAM-1의 발현량을 GOBO database system을 통해 확인한 결과를 나타낸 것이다.
도 1b는, 유방암 세포에서의 ICAM family의 발현량을 Realtime PCR을 통해 확인한 결과를 나타낸 것이다.
도 1c는, 기저형 유방암 세포인 MDAMB-231에 siRNA를 사용하여 ICAM family (ICAM-1~5)를 각각 억제한 후, boyden chamber assay을 통해 침윤능 및 이동능 변화를 확인한 결과를 나타낸 것이다.
도 2a는, 기저형 유방암 세포인 MDAMB-231에 shRNA를 사용하여 ICAM-1을 억제한 후, boyden chamber assay을 통해 침윤능 변화를 확인한 결과를 나타낸 것이다.
도 2b는, 기저형 유방암 세포인 MDAMB-231에 shRNA를 사용하여 ICAM-1을 억제한 후, Western blot을 통해 EMT 마커 및 조절인자의 발현변화를 확인한 결과를 나타낸 것이다.
도 2c는, SK-BR3 세포에 ICAM-1을 과발현한 후, boyden chamber assay을 통해 침윤능 변화를 확인한 결과를 나타낸 것이다.
도 2d는, SK-BR3 세포에 ICAM-1을 과발현한 후, Western blot을 통해 EMT 마커 및 조절인자의 발현변화를 확인한 결과를 나타낸 것이다.
도 3a는, ICAM-1 발현에 따른 전이능을 확인하기 위하여 MDAMB-231 세포에 shRNA를 사용하여 ICAM-1의 발현을 감소시킨 후 fatpad에 주입하는 과정을 도시한 것이다.
도 3b는, 상기 도 3a의 과정을 실시한 후, 36일간 3일 간격으로 암조직의 크기 변화를 확인한 결과를 나타낸 것이다.
도 3c는, 상기 도 3a의 과정을 실시한 후, 30일째 유방암 조직을 얻어 암조직의 무게 변화를 확인한 결과를 나타낸 것이다.
도 3d는, 상기 도 3a의 과정을 실시한 후, 30일째 폐조직을 얻어 전이 노들의 수를 확인한 결과를 나타낸 것이다.
도 3e는, 상기 도 3a의 과정을 실시한 후, 30일째 폐조직을 얻어 H&E 염색을 통해 폐로의 전이 정도를 확인한 결과를 나타낸 것이다.
도 4a는, ICAM-1 GST-pulldown 실험을 통해 ICAM-1과 결합하는 단백질을 확인한 결과를 나타낸 것이다.
도 4b는, 상기 도 a를 바탕으로 얻어낸 결과 EGFR이 ICAM-1과 결합한다는 결과를 IP를 통해 나타낸 것이다.
도 4c는, DTSSP 실험 방법을 통해 내강형 세포인 MCF7 세포에서 ICAM-1과 EGFR과의 결합 여부를 확인한 결과를 나타낸 것이다.
도 5a는, EGFR에 결합하는 ICAM-1의 부분(site)을 확인하기 위하여 제작된 ICAM-1 deletion Construct를 나타낸 것이다.
도 5b는, extracellular domain과 EGFR의 결합 여부를 IP(Immunoprecipitation)를 통해 확인한 결과를 나타낸 것이다.
도 5c는, △D1-5를 각각 과발현 하는 경우의 EGFR과의 결합 변화를 확인한 결과를 나타낸 것이다.Figure 1a shows the results of confirming the expression level of ICAM-1 for each type of breast cancer through the GOBO database system.
Figure 1b shows the results of confirming the expression level of the ICAM family in breast cancer cells through Realtime PCR.
Figure 1c, after inhibiting the ICAM family (ICAM-1 ~ 5) by using siRNA to the basal breast cancer cells, MDAMB-231, respectively, shows the results confirmed the change in infiltration and mobility through the boyden chamber assay.
Figure 2a shows the results of confirming the change of invasiveness through the boyden chamber assay after the inhibition of ICAM-1 using shRNA in the basal breast cancer cells MDAMB-231.
Figure 2b shows the results of confirming the expression changes of EMT markers and regulators through Western blot after suppressing ICAM-1 using shRNA in MDAMB-231, a basal breast cancer cell.
Figure 2c, after overexpressing ICAM-1 in SK-BR3 cells, shows the result of confirming the change in infiltration through the boyden chamber assay.
Figure 2d, after overexpressing ICAM-1 in SK-BR3 cells, shows the results of confirming the expression changes of EMT markers and regulators via Western blot.
Figure 3a shows the process of injecting the fatpad after reducing the expression of ICAM-1 using shRNA in MDAMB-231 cells to confirm the metastatic capacity according to ICAM-1 expression.
Figure 3b, after performing the process of Figure 3a, shows the result of confirming the change in size of the cancer tissue every three days every 36 days.
Figure 3c shows the result of confirming the weight change of the cancer tissue by obtaining the
Figure 3d, after performing the process of Figure 3a, shows the result of confirming the number of transfer furnaces to obtain
Figure 3e, after performing the process of Figure 3a, to obtain the
Figure 4a shows the result of confirming the protein binding to ICAM-1 through ICAM-1 GST-pulldown experiment.
FIG. 4B shows the result of EGFR binding to ICAM-1 obtained through IP based on FIG. A.
Figure 4c shows the result of confirming the binding of ICAM-1 and EGFR in MCF7 cells as luminal cells through the DTSSP experiment method.
5A shows an ICAM-1 deletion Construct constructed to identify sites of ICAM-1 that bind to EGFR.
5b shows the result of confirming the binding between the extracellular domain and EGFR through IP (Immunoprecipitation).
5C shows the results of confirming the change in binding to EGFR when overexpressing ΔD1-5, respectively.
본 발명자들은 유방암의 전이 진단, 예후 또는 치료제의 치료 반응성을 예측하는데 이용할 수 있는 ICAM-1의 신규 용도를 규명하였는바, 이에 기초하여 본 발명을 완성하였다.The inventors have identified a novel use of ICAM-1 that can be used to predict the metastasis of breast cancer, the prognosis or the therapeutic responsiveness of a therapeutic agent, and thus completed the present invention.
이에, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자 또는 상기 유전자가 암호화하는 단백질을 포함하는, 유방암 전이 진단, 예후 예측 또는 치료제 반응성 예측용 마커 조성물을 제공한다.Accordingly, the present invention provides a marker composition for diagnosing breast cancer metastasis, predicting prognosis or predicting therapeutic agent reactivity, comprising an intracellular adhesion molecule 1 (ICAM-1) gene or a protein encoded by the gene.
또한, 본 발명은 ICAM-1(Intracellular adhesion molecule 1) 유전자의 mRNA 또는 상기 유전자가 암호화하는 단백질 수준을 측정하는 제제를 포함하는, 유방암 전이 진단, 예후 예측 또는 치료제 반응성 예측용 조성물 및 상기 조성물을 포함하는 유방암 전이 진단, 예후 예측 또는 치료제 반응성 예측용 키트를 제공한다.In addition, the present invention includes a composition for measuring breast cancer metastasis diagnosis, prognosis prediction or therapeutic agent reactivity comprising the mRNA or the level of the protein encoding the gene of the intracellular adhesion molecule 1 (ICAM-1) gene and the composition comprising the composition The present invention provides a kit for diagnosing breast cancer metastasis, predicting prognosis, or predicting therapeutic response.
본 발명에 있어서, 상기 ICAM-1 유전자는 서열번호 1의 염기서열로 이루어 질 수 있으며, 상기 염기서열의 상동체도 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기서열과 각각 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다.In the present invention, the ICAM-1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1, the homologue of the nucleotide sequence is also included within the scope of the present invention. Specifically, the gene may include a nucleotide sequence having a sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95%, with the base sequence of SEQ ID NO: 1, respectively. Can be.
또한, 상기 ICAM-1 유전자가 암호화하는 단백질은 서열번호 2의 아미노산 서열로 이루어질 수 있으며, 서열번호 2에 기재된 서열과 실질적인 동일성 (substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 80%의 상동성, 보다 바람직하게는 90%, 91%, 92%, 93%, 94%, 95%의 상동성, 가장 바람직하게는 96%, 97%, 98%, 99%의 상동성을 나타내는 서열을 의미한다.In addition, the protein encoded by the ICAM-1 gene may be composed of the amino acid sequence of SEQ ID NO: 2, it is interpreted to include a sequence showing a substantial identity (substantial identity) with the sequence described in SEQ ID NO: 2. This substantial identity is at least 80% when the sequences of the present invention are aligned with each other as closely as possible and the aligned sequences are analyzed using algorithms commonly used in the art. Sequences that show homology, more preferably 90%, 91%, 92%, 93%, 94%, 95% homology, most preferably 96%, 97%, 98%, 99% homology it means.
본 발명의 용어 "진단"이란, 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명에 있어서, 상기 진단은 유방암의 전이 여부를 확인하는 것으로 해석될 수 있다.The term "diagnosis" of the present invention means confirming the presence or characteristic of a pathological state. In the present invention, the diagnosis may be interpreted as confirming the metastasis of breast cancer.
본 발명에서 사용되는 용어, "예후(prognosis)"란, 병세의 진행, 회복에 관한 예측을 의미하는 것으로, 전망 내지는 예비적 평가를 말한다. 본 발명에서 예후는 유방암의 진행, 치료 결과, 또는 회복에 관한 예측을 의미하는 것이나, 이것으로 한정되는 것은 아니다.The term "prognosis" used in the present invention means a prediction about the progression and recovery of a condition, and refers to a prospective or preliminary evaluation. In the present invention, the prognosis means, but is not limited to, prediction about breast cancer progression, treatment result, or recovery.
본 발명에서 있어서 "치료제 반응성 예측"이란, 환자가 치료제, 예컨대 항암제에 대해 선호적으로 또는 비선호적으로 반응할지 여부를 예측하는 것, 또는 항암제에 대한 내성의 위험성을 예측하는 것, 치료 후 환자의 예후 즉, 재발, 전이, 생존, 또는 무병생존 등을 예측하는 것을 의미한다. 본 발명에 따른 치료제 반응성 예측을 위한 바이오마커는 유방암 환자에 대한 가장 적절한 치료 방식을 선택하도록 하기 위한 정보를 제공를 제공할 수 있다.In the present invention, "therapeutic responsiveness prediction" means predicting whether a patient will respond favorably or unfavorably to a therapeutic agent, such as an anticancer agent, or predicting the risk of resistance to an anticancer agent, Prognosis, that is, predicting relapse, metastasis, survival, or disease-free survival. Biomarkers for predicting therapeutic agent reactivity according to the present invention may provide information to help select the most appropriate treatment modality for breast cancer patients.
본 발명에서, 상기 mRNA 수준을 측정하는 제제는 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있다.In the present invention, the agent for measuring the mRNA level may be a sense and antisense primer, or probe that complementarily binds to the mRNA of the gene.
본 발명에서 사용되는 용어, "프라이머"란 DNA 합성의 기시점이 되는 짧은 유전자 서열로써, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화 등으로 변형시킬 수 있다.As used herein, the term "primer" refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, and the like, as a short gene sequence that is a starting point for DNA synthesis. The primers can be synthesized in a conventional length of 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, or the like by a known method.
본 발명에서 사용되는 용어, "프로브"란 효소 화학적인 분리정제 또는 합성과정을 거쳐 제작된 수 염기 내지 수백 염기 길이의 mRNA와 특이적으로 결합할 수 있는 핵산을 의미한다. 방사성 동위원소나 효소 등을 표지하여 mRNA의 존재 유무를 확인할 수 있으며, 공지된 방법으로 디자인하고 변형시켜 사용할 수 있다.As used herein, the term "probe" refers to a nucleic acid capable of specifically binding to mRNA of several bases to several hundred bases in length, which has been produced through enzymatic chemical separation or purification. The presence of mRNA can be confirmed by labeling radioisotopes or enzymes, and can be designed and modified by known methods.
본 발명에서, 상기 단백질 수준을 측정하는 제제는 유전자가 암호화하는 단백질에 특이적으로 결합하는 항체일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the agent for measuring the protein level may be an antibody that specifically binds to a protein encoded by a gene, but is not limited thereto.
본 발명에서 사용되는 용어, "항체"는 면역학적으로 특정 항원과 반응성을 갖는 면역글로불린 분자를 포함하며, 단클론(monoclonal) 항체 및 다클론(polyclonal) 항체를 모두 포함한다. 또한, 상기 항체는 키메라성 항체(예를 들면, 인간화 뮤린 항체) 및 이종결합항체(예를 들면, 양특이성 항체)와 같은 유전공학에 의해 생산된 형태를 포함한다.As used herein, the term “antibody” includes immunoglobulin molecules that are immunologically reactive with specific antigens, and include both monoclonal and polyclonal antibodies. In addition, such antibodies include forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).
본 발명의 예측용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치로 구성된다.Prediction kits of the present invention consist of one or more other component compositions, solutions or devices suitable for analytical methods.
예컨대, 본 발명의 키트는 PCR을 수행하기 위해, 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 함유할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.For example, the kit of the present invention may be used to perform genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer, and water to perform PCR. It may be a kit comprising. The PCR buffer may contain KCl, Tris-HCl and MgCl 2 . In addition, the components necessary for performing electrophoresis to confirm amplification of PCR products may be further included in the kit of the present invention.
또한, 본 발명의 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. RT-PCR kits include test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC, as well as individual primer pairs specific for the marker gene. -May include DEPC-water, sterile water, and the like. It may also include primer pairs specific for the gene used as a quantitative control.
또한, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. DNA 칩 키트는, 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판을 포함하고, 기판은 정량구조 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다. 또한, 본 발명의 키트는 본 발명의 마커 유전자가 고정화되어 있는 기판을 갖는 마이크로어레이 형태일 수 있다.In addition, the kit of the present invention may be a kit containing essential elements necessary for carrying out the DNA chip. The DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached with a probe, and the substrate may include a cDNA corresponding to a quantitative gene or a fragment thereof. In addition, the kit of the present invention may be in the form of a microarray having a substrate on which the marker gene of the present invention is immobilized.
또한, 본 발명의 키트는 ELISA를 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 키트일 수 있다. ELISA 키트는 마커 단백질에 대한 특이적인 항체를 포함하며, 상기 단백질 수준을 측정하는 제제를 포함한다. 상기 ELISA 키트는 "항원-항체 복합체"를 형성한 항체를 검출할 수 있는 시약, 예를 들면 표지된 2차 항체, 발색단(chromopores), 효소, 및 그의 기질을 포함할 수 있다. 또한, 정량 대조군 단백질에 특이적인 항체를 포함할 수 있다.In addition, the kit of the present invention may be a kit comprising the necessary elements necessary to perform an ELISA. ELISA kits include antibodies specific for the marker protein and include agents that measure the protein level. The ELISA kit may comprise reagents capable of detecting an antibody that has formed an “antigen-antibody complex”, such as labeled secondary antibodies, chromopores, enzymes, and substrates thereof. It may also include antibodies specific for quantitative control proteins.
본 발명에서 사용되는 용어 "항원-항체 복합체"란 유전자가 코딩하는 단백질과 이에 특이적인 항체의 결합물을 의미한다. 항원-항체 복합체의 형성량은 검출 라벨(detection label)의 시그널의 크기를 통해서 정량적으로 측정할 수 있다. 이러한 검출 라벨은 효소, 형광물, 리간드, 발광물, 미세입자(microparticle), 레독스 분자 및 방사선 동위원소로 이루어진 그룹 중에서 선택할 수 있으며, 이에 제한되는 것은 아니다.As used herein, the term “antigen-antibody complex” means a combination of a protein encoded by a gene and an antibody specific to it. The amount of antigen-antibody complex formed can be measured quantitatively through the magnitude of the signal of the detection label. Such detection labels may be selected from the group consisting of enzymes, fluorescent materials, ligands, luminescent materials, microparticles, redox molecules and radioisotopes, but are not limited thereto.
본 발명의 다른 양태로서, 본 발명은 피검자 유래의 생물학적 시료에서 ICAM-1 유전자의 mRNA 또는 상기 유전자가 암호화하는 단백질을 검출하는 단계를 포함하는, 유방암의 전이 진단, 예후 예측 또는 치료제 반응성 예측을 위한 정보제공방법을 제공한다.In another aspect of the present invention, the present invention provides a method for predicting metastasis, prognostic prediction, or therapeutic response of breast cancer, comprising detecting mRNA of the ICAM-1 gene or a protein encoded by a biological sample from a subject. Provide information
상기 mRNA의 발현수준은 당업계에 알려진 통상적인 방법에 따라 나노스트링 엔카운터 분석(NanoString nCounter analysis), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 1종 이상의 방법을 통해 측정될 수 있으나, 이에 제한되는 것은 아니다.The expression level of the mRNA according to conventional methods known in the art NanoString nCounter analysis (NanoString nCounter analysis), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RNase protection assay; RPA), microarray, and northern blotting can be measured by one or more methods selected from the group consisting of, It is not limited.
상기 단백질 발현수준은 당업계에 알려진 통상적인 방법에 따라 웨스턴 블롯팅(western blotting), 방사선면역분석법(radioimmunoassay; RIA), 방사 면역 확산법(radioimmunodiffusion), 효소면역분석법(ELISA), 면역침강법(immunoprecipitation), 유세포분석법(flow cytometry), 면역형광염색법(immunofluorescence), 오우크테로니(ouchterlony), 보체 고정 분석법(complement fixation assay), 및 단백질 칩(protein chip)으로 이루어진 군으로부터 선택되는 1종 이상의 방법을 통해 측정되는 것일 수 있으나, 이에 제한되는 것은 아니다.The protein expression level is Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme-linked immunoassay (ELISA), immunoprecipitation (immunoprecipitation) according to conventional methods known in the art ), Flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, and protein chip. It may be measured through, but is not limited thereto.
본 발명자들은 구체적인 실시예을 통해 유방암에서의 신규한 바이오마커로써 본 발명에 따른 ICAM-1의 용도를 규명하였다.The inventors have identified the use of ICAM-1 according to the invention as a novel biomarker in breast cancer through specific examples.
본 발명의 일 실시예에서는, 약물 치료에 대한 반응성이 좋지 않은 기저형 (basal type) 유방암 조직에서 ICAM-1의 발현이 높은 것을 확인하였고, ICAM family 중 ICAM-1을 제외하고 연관성이 없다는 것을 확인하였다. In one embodiment of the present invention, it was confirmed that the expression of ICAM-1 is high in basal type breast cancer tissue that is not responsive to drug treatment, and confirmed that there is no correlation except ICAM-1 in the ICAM family. .
본 발명의 다른 실시예에서는, ICAM-1 발현 조절에 따른 유방암 세포의 침윤능 및 전이능 변화를 in vitro 및 in vivo 실험을 통해 확인한 결과, ICAM-1의 억제는 유방암 세포의 침윤능 및 전이능을 감소시키는 반면, 세포 성장 및 암조직 무게에는 영향을 주지 않는 것을 확인함으로써 ICAM-1이 유방암 세포의 침윤능 및 전이능에만 관련이 있음을 규명하였다.In another embodiment of the present invention, as a result of in vitro and in vivo experiments confirmed changes in the invasive capacity and metastatic capacity of breast cancer cells according to ICAM-1 expression regulation, inhibition of ICAM-1 is invasive and metastatic capacity of breast cancer cells In contrast, ICAM-1 was related only to the invasiveness and metastatic capacity of breast cancer cells by confirming that it did not affect cell growth and cancer tissue weight.
본 발명의 또 다른 실시예에서는, ICAM-1에 의한 전이능 및 침윤능 증가가 어떠한 신호전달에 의하여 조절되는지 확인하기 위하여 ICAM-1-GST construct를 만든 후, MDAMD-231세포에 과발현을 하고 ICAM-1 Ab.를 사용하여 IP(immunoprecipitation)를 진행하고, 이를 MS(mass spectrometry)를 통해 확인한 결과, ICAM-1과 결합하는 단백질 중 EGFR이 많은 비중을 차지한다는 것을 확인하였다. 또한, IP 실험을 통해서 ICAM-1과 EGFR이 결합하는 것을 확인하고, 이를 좀더 명확히 하기 위해 MCF7세포에 ICAM-1과 EGFR를 과발현한 후 EGFR를 처리 하였을때 EGFR과 ICAM-1의 결합이 증가함을 확인함으로써 ICAM-1에 의한 유방암세포의 침윤능 조절은 EGFR과 결합을 함으로써 유도되어짐을 규명하였다.In still another embodiment of the present invention, after making an ICAM-1-GST construct to confirm which signaling is regulated by the increase in metastatic capacity and invasiveness by ICAM-1, overexpression in MDAMD-231 cells and ICAM IP (immunoprecipitation) was performed using -1 Ab. And confirmed by mass spectrometry (MS), and it was confirmed that EGFR occupies a large proportion of proteins that bind to ICAM-1. In addition, IP experiments confirmed that ICAM-1 and EGFR bind, and to further clarify, the binding of EGFR and ICAM-1 increases when CAMFR is treated after overexpressing ICAM-1 and EGFR in MCF7 cells. By confirming that the regulation of invasiveness of breast cancer cells by ICAM-1 was found to be induced by binding to EGFR.
상기 결과들을 통해 ICAM-1 단백질 또는 상기 단백질을 암호화하는 유전자가 유방암의 전이 진단, 예후 예측 또는 치료제 반응성 예측을 위한 분자 마커로 이용될 수 있음을 알 수 있다.These results indicate that the ICAM-1 protein or the gene encoding the protein can be used as a molecular marker for diagnosing metastasis, prognostic prediction or therapeutic response of breast cancer.
본 발명의 다른 양태로서, 본 발명은 (1) 유방암 세포에 후보물질을 처리하는 단계; (2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및 (3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는 유방암 치료제 스크리닝 방법을 제공한다.In another aspect of the invention, the present invention comprises the steps of (1) treating the candidate substance to breast cancer cells; (2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And (3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic agent, as compared to the candidate non-treatment group.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.
실시예Example 1. 유방암 세포에서 1. In breast cancer cells ICAMICAM -1 발현 확인-1 expression confirmation
먼저, GOBO database system을 통해 유방암 유형별 ICAM-1의 발현량을 확인하였다. 그 결과, 도 1a에 나타낸 바와 같이, 기저형(basal) 유방암 조직에서 ICAM-1의 발현이 높은 것을 확인할 수 있었다.First, the expression level of ICAM-1 by breast cancer type was confirmed through the GOBO database system. As a result, as shown in FIG. 1A, it was confirmed that ICAM-1 expression was high in basal breast cancer tissue.
다음으로, 5가지 유방암 세포에서의 ICAM family의 발현량을 Realtime PCR을 통해 확인하였고, 그 결과, 도 1b에 나타낸 바와 같이, 유방암세포의 유형 중 가장 악성화 되어있다고 알려진 기저형 유방암세포에서 ICAM-1의 발현이 특이적으로 증가된 것을 확인할 수 있었다. Next, the expression level of the ICAM family in five breast cancer cells was confirmed by Realtime PCR. As a result, as shown in FIG. 1B, ICAM-1 was expressed in the basal breast cancer cells known to be the most malignant type of breast cancer cells. It was confirmed that the expression was specifically increased.
다음으로, 기저형 유방암 세포인 MDAMB-231에 siRNA를 사용하여 ICAM family를 각각 억제한 후, boyden chamber assay을 통해 침윤능 및 이동능 변화를 확인한 결과, 도 1c에 나타낸 바와 같이, 대조군과 비교할 때, ICAM-1을 억제한 군에서만 구체적으로 침윤능이 감소함을 확인할 수 있었다. 한편, 사용한 siRNA의 구체적인 서열정보는 하기 표 1에 나타내었다.Next, after inhibiting the ICAM family using siRNA on the basal breast cancer cells, MDAMB-231, and confirming the change in invasiveness and mobility through boyden chamber assay, as shown in Figure 1c, when compared with the control, Only in the group that inhibited ICAM-1 it was confirmed that the infiltration ability is specifically reduced. On the other hand, specific sequence information of the siRNA used is shown in Table 1 below.
(서열번호 3)5 '-GCC AGC UUA UAC ACA AGA A (dTdT) -3'
(SEQ ID NO: 3)
실시예Example 2. 2. ICAMICAM -1 발현 조절에 따른 유방암 세포의 Of breast cancer cells according to -1 expression regulation 침윤능Infiltration ability 증감 확인 Check increase or decrease
먼저, 기저형 유방암 세포인 MDAMB-231에 shRNA를 사용하여 ICAM-1을 억제한 후, boyden chamber assay을 통해 침윤능 변화를 확인한 결과, 도 2a에 나타낸 바와 같이, 대조군과 비교할 때, ICAM-1을 억제한 군에서 침윤능이 감소함을 확인할 수 있었다. 한편, 사용한 shRNA의 구체적인 서열정보는 하기와 같다:First, ICAM-1 was suppressed by using shRNA on basal breast cancer cells MDAMB-231, and then the change in invasiveness was confirmed by boyden chamber assay. As shown in FIG. 2A, ICAM-1 was compared with the control group. It was confirmed that the infiltration ability was reduced in the suppressed group. On the other hand, specific sequence information of the shRNA used is as follows:
shICAM-1 : CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG (서열번호 5)shICAM-1: CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG (SEQ ID NO: 5)
다음으로, Western blot을 통해 EMT(epithelial-mesenchymal transition) 마커 및 조절인자의 발현변화를 확인한 결과, 도 2b에 나타내 바와 같이, 대조군과 비교할 때, ICAM-1을 억제한 군에서 EMT 마커 및 조절인자의 발현이 감소함을 확인할 수 있었다.Next, as a result of confirming the expression changes of EMT (epithelial-mesenchymal transition) markers and regulators through Western blot, as shown in Figure 2b, compared to the control group, EMT markers and regulators in the ICAM-1 inhibitory group It was confirmed that the expression of.
한편, 기저형과 비교할 때 상대적으로 ICAM-1의 발현이 낮은 SK-BR3 세포에 ICAM-1을 과발현 후, 상기와 동일한 방법으로 침윤능 변화 및 EMT 마커/조절인자의 발현변화를 확인한 결과, 도 2c 및 도 2d에 나타낸 바와 같이, 대조군과 비교할 때, ICAM-1을 과발현한 군에서 침윤능이 증가할 뿐만 아니라, EMT 마커(Vimentin, Fibronectin) 및 조절인자(Zeb1)의 발현도 증가함을 확인할 수 있었다.On the other hand, after overexpression of ICAM-1 in SK-BR3 cells with relatively low expression of ICAM-1 compared to the baseline, the change in invasiveness and expression of EMT markers / regulators were confirmed in the same manner as above. And, as shown in Figure 2d, compared with the control group, not only increased the invasion ability in the group overexpressing ICAM-1, it was confirmed that the expression of EMT markers (Vimentin, Fibronectin) and regulator (Zeb1) also increased. .
실시예Example 3. 3. ICAMICAM -1 발현 억제에 따른 유방암 세포의 Of breast cancer cells according to inhibition of -1 expression 전이능Metastatic power 억제 확인(in vivo) Inhibition Confirmation (in vivo)
ICAM-1 발현에 따른 전이능을 확인하기 위하여 하기와 같이 동물실험을 진행하였다. Animal experiments were performed as follows to confirm the metastatic capacity according to ICAM-1 expression.
MDAMB-231세포에 shRNA를 사용하여 ICAM-1의 발현을 감소시킨 후 fatpad에 주입하였다(도 3a). 36일간 3일 간격으로 암조직의 크기를 확인한 결과, 도 3b에 나타낸 바와 같이, 대조군과 비교할 때 암조직의 크기에서는 차이가 없었을 뿐만 아니라 도 3c에 나타낸 바와 같이, 암세포 주입 후 30일째 유방암의 무게변화를 확인하였을 때 역시 변화가 없음을 확인할 수 있었다.ShRNA was used to reduce expression of ICAM-1 in MDAMB-231 cells and then injected into fatpad (FIG. 3A). As a result of confirming the size of the cancer tissue every three days for 36 days, as shown in Figure 3b, there was no difference in the size of the cancer tissue as compared to the control group, as shown in Figure 3c, the weight of
하지만 폐 조직을 얻어 폐로의 전이정도를 확인한 결과, 도 3d 및 도 3e에 나타낸 바와 같이, 대조군에 비교할 때 ICAM-1 발현은 억제한 군에서 전이 노들의 수가 감소하여 전이능이 감소됨을 확인할 수 있었다.However, as a result of obtaining lung tissue and confirming the degree of metastasis to the lung, as shown in FIGS. 3D and 3E, it was confirmed that the metastatic capacity was decreased by decreasing the number of metastatic furnaces in the group that inhibited ICAM-1 expression as compared to the control group.
실시예Example 4. 4. ICAMICAM -1의 -1's 침윤능Infiltration ability 증가에 대한 하위 신호전달 기전 확인 Identify lower signaling mechanisms for increase
ICAM-1에 의한 침윤능 증가가 어떠한 신호전달에 의하여 조절되는지 확인하기 위하여, 우선적으로 ICAM-1 GST-pulldown 실험을 진행하였다. 보다 구체적으로, GST-ICAM-1을 과발현 시킨 후, ICAM-1 Ab를 사용하여 IP를 하였다. 이후 MS를 진행하여 ICAM-1과 결합하는 단백질을 확인한 결과, 도 4a 및 도 4b에 나타낸 바와 같이, MDAMB231 세포에서 ICAM-1과 EGFR이 결합함을 확인할 수 있었다.In order to confirm whether the increase in infiltration by ICAM-1 is regulated by which signaling, ICAM-1 GST-pulldown experiment was conducted first. More specifically, after overexpressing GST-ICAM-1, IP was performed using ICAM-1 Ab. Subsequently, as a result of confirming the protein binding to ICAM-1 by MS, as shown in FIGS. 4A and 4B, it was confirmed that ICAM-1 and EGFR bind to MDAMB231 cells.
추가적으로, 내강형 세포인 MCF7 세포에 ICAM-1과 EGFR를 같이 과발현시킨 후 EGF를 처리하였을 때, 도 4c에 나타낸 바와 같이, ICAM-1과 EGFR이 결합함을 확인할 수 있었다.In addition, when ICAM-1 and EGFR were overexpressed in the luminal type MCF7 cells and then treated with EGF, it was confirmed that ICAM-1 and EGFR bind as shown in FIG. 4C.
실시예Example 5. 5. EGFR에EGFR 결합하는 Combined ICAMICAM -1의 도메인(domain) 확인A domain of -1
EGFR에 결합하는 ICAM-1의 부분(site)을 확인하기 위하여, 먼저 ICAM-1 deletion Construct를 제작하였다. WT-ICAM-1(wild type), sol-ICAM-1(transmembrane deletion form), △ECD (extracellualr domain deletion form), △ICD (intracellular domain deletion form), △D1-5 (domain 1~5번을 각각 deletion form)(도 5a).To identify the sites of ICAM-1 that bind to EGFR, ICAM-1 deletion Constructs were first constructed. WT-ICAM-1 (wild type), sol-ICAM-1 (transmembrane deletion form), △ ECD (extracellualr domain deletion form), △ ICD (intracellular domain deletion form), △ D1-5 (domains 1-5) Each deletion form) (FIG. 5A).
다음으로, HEK293T 세포에 EGFR을 과발현시킨 후 △ECD와 △ICD를 각각 과발현시켰다. 도 5b에 나타낸 바와 같이, EGF 의존적으로 EGFR과 △ICD-ICAM-1을 과발현 시킨 곳에서 두 단백질이 결합하는 것을 확인함으로써 extracellular domain이 결합함을 확인할 수 있었다. 더욱이, extracellular domain을 가진 WT-ICAM-1과 sol-ICAM-1도 EGFR과 결합하는 것을 IP를 통해 확인할 수 있었다.Next, overexpression of EGFR in HEK293T cells and overexpression of ΔECD and ΔICD, respectively. As shown in Figure 5b, it was confirmed that the extracellular domain binds by confirming the binding of the two proteins in the EGF-dependent overexpression of EGFR and △ ICD-ICAM-1. In addition, WT-ICAM-1 and sol-ICAM-1, which have extracellular domains, could also be identified by IP binding to EGFR.
추가적으로, △D1-5를 각각 과발현하는 경우의 EGFR과의 결합 변화를 확인한 결과, 도 5c에 나타낸 바와 같이, △D1를 과발현하는 경우, EGFR과의 결합이 감소함을 확인할 수 있었다.In addition, as a result of confirming the change in binding to EGFR when overexpressing ΔD1-5, respectively, as shown in FIG.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.
<110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis and treatment of breast cancer <130> PD17-108 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 1625 <212> DNA <213> ICAM-1 <400> 1 atggctccca gcagcccccg gcccgcgctg cccgcactcc tggtcctgct cggggctctg 60 ttcccaggac ctggcaatgc cgaattcccc tcaaaagtca tcctgccccg gggaggctcc 120 gtgctggtga catgcagcac ctcctgtgac cagcccaagt tgttgggcat agagaccccg 180 ttgcctaaaa aggagttgct cctgcctggg aacaaccgga aggtgtatga actgagcaat 240 gtgcaagaag atagccaacc aatgtgctat tcaaactgcc ctgatgggca gtcaacagct 300 aaaaccttcc tcaccgtgta ctggactcca gaacgggtgg aactggcacc cctcccctct 360 tggcagccag tgggcaagaa ccttacccta cgctgccagg tggagggtgg ggcaccccgg 420 gccaacctca ccgtggtgct gctccgtggg gagaaggagc tgaaacggga gccagctgtg 480 ggggagcccg ctgaggtcac gaccacggtg ctggtgagga gagatcacca tggagccaat 540 ttctcgtgcc gcactgaact ggacctgcgg ccccaagggc tggagctgtt tgagaacacc 600 tcggccccct accagctcca gacctttgtc ctgccagcga ctcccccaca acttgtcagc 660 ccccgggtcc tagaggtgga cacgcagggg accgtggtct gttccctgga cgggctgttc 720 ccagtctcgg aggcccaggt ccacctggca ctgggggacc agaggttgaa ccccacagtc 780 acctatggca acgactcctt ctcggccaag gcctcagtca gtgtgaccgc agaggacgag 840 ggcacccagc ggctgacgtg tgcagtaata ctggggaacc agagccagga gacactgcag 900 acagtgacca tttacagttt tccggcgccc aacgtgattc tgacgaagcc agaggtctca 960 gaagggaccg aggtgacagt gaagtgtgag gcccacccta gagccaaggt gacgctgaat 1020 ggggttccag cccagccact gggcccgagg gcccagctcc tgctgaaggc caccccagag 1080 gacaacgggc gcagcttctc ctgctctgca accctggagg tggccggcca gcttatacac 1140 aagaaccaga cccgggagct tcgtgtcctg tatggccccc gactggacga gagggattgt 1200 ccgggaaact ggacgtggcc agaaaattcc cagcagactc caatgtgcca ggcttggggg 1260 aacccattgc ccgagctcaa gtgtctaaag gatggcactt tcccactgcc catcggggaa 1320 tcagtgactg tcactcgaga tcttgagggc acctacctct gtcgggccag gagcactcaa 1380 ggggaggtca cccgcgaggt gaccgtgaat gtgctctccc cccggtatga gattgtcatc 1440 atcactgtgg tagcagccgc agtcataatg ggcactgcag gcctcagcac gtacctctat 1500 aaccgccagc ggaagatcaa gaaatacaga ctacaacagg cccaaaaagg gacccccatg 1560 aaaccgaaca cacaagccac gcctccctac ccatacgatg ttccagatta cgcttgagcg 1620 gccgc 1625 <210> 2 <211> 532 <212> PRT <213> ICAM-1 <400> 2 Met Ala Pro Ser Ser Pro Arg Pro Ala Leu Pro Ala Leu Leu Val Leu 1 5 10 15 Leu Gly Ala Leu Phe Pro Gly Pro Gly Asn Ala Gln Thr Ser Val Ser 20 25 30 Pro Ser Lys Val Ile Leu Pro Arg Gly Gly Ser Val Leu Val Thr Cys 35 40 45 Ser Thr Ser Cys Asp Gln Pro Lys Leu Leu Gly Ile Glu Thr Pro Leu 50 55 60 Pro Lys Lys Glu Leu Leu Leu Pro Gly Asn Asn Arg Lys Val Tyr Glu 65 70 75 80 Leu Ser Asn Val Gln Glu Asp Ser Gln Pro Met Cys Tyr Ser Asn Cys 85 90 95 Pro Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr 100 105 110 Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser Trp Gln Pro Val Gly 115 120 125 Lys Asn Leu Thr Leu Arg Cys Gln Val Glu Gly Gly Ala Pro Arg Ala 130 135 140 Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys Glu Leu Lys Arg Glu 145 150 155 160 Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr Thr Val Leu Val Arg 165 170 175 Arg Asp His His Gly Ala Asn Phe Ser Cys Arg Thr Glu Leu Asp Leu 180 185 190 Arg Pro Gln Gly Leu Glu Leu Phe Glu Asn Thr Ser Ala Pro Tyr Gln 195 200 205 Leu Gln Thr Phe Val Leu Pro Ala Thr Pro Pro Gln Leu Val Ser Pro 210 215 220 Arg Val Leu Glu Val Asp Thr Gln Gly Thr Val Val Cys Ser Leu Asp 225 230 235 240 Gly Leu Phe Pro Val Ser Glu Ala Gln Val His Leu Ala Leu Gly Asp 245 250 255 Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn Asp Ser Phe Ser Ala 260 265 270 Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu Gly Thr Gln Arg Leu 275 280 285 Thr Cys Ala Val Ile Leu Gly Asn Gln Ser Gln Glu Thr Leu Gln Thr 290 295 300 Val Thr Ile Tyr Ser Phe Pro Ala Pro Asn Val Ile Leu Thr Lys Pro 305 310 315 320 Glu Val Ser Glu Gly Thr Glu Val Thr Val Lys Cys Glu Ala His Pro 325 330 335 Arg Ala Lys Val Thr Leu Asn Gly Val Pro Ala Gln Pro Leu Gly Pro 340 345 350 Arg Ala Gln Leu Leu Leu Lys Ala Thr Pro Glu Asp Asn Gly Arg Ser 355 360 365 Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly Gln Leu Ile His Lys 370 375 380 Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly Pro Arg Leu Asp Glu 385 390 395 400 Arg Asp Cys Pro Gly Asn Trp Thr Trp Pro Glu Asn Ser Gln Gln Thr 405 410 415 Pro Met Cys Gln Ala Trp Gly Asn Pro Leu Pro Glu Leu Lys Cys Leu 420 425 430 Lys Asp Gly Thr Phe Pro Leu Pro Ile Gly Glu Ser Val Thr Val Thr 435 440 445 Arg Asp Leu Glu Gly Thr Tyr Leu Cys Arg Ala Arg Ser Thr Gln Gly 450 455 460 Glu Val Thr Arg Lys Val Thr Val Asn Val Leu Ser Pro Arg Tyr Glu 465 470 475 480 Ile Val Ile Ile Thr Val Val Ala Ala Ala Val Ile Met Gly Thr Ala 485 490 495 Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg Lys Ile Lys Lys Tyr 500 505 510 Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro Met Lys Pro Asn Thr Gln 515 520 525 Ala Thr Pro Pro 530 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 sense <400> 3 gccagcuuau acacaagaa 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 antisense <400> 4 uucuugugua uaagcuggc 19 <210> 5 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> shICAM-1 <400> 5 ccgggatcac catggagcca atttcctcga ggaaattggc tccatggtga tctttttg 58 <110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis and treatment of breast cancer <130> PD17-108 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 1625 <212> DNA <213> ICAM-1 <400> 1 atggctccca gcagcccccg gcccgcgctg cccgcactcc tggtcctgct cggggctctg 60 ttcccaggac ctggcaatgc cgaattcccc tcaaaagtca tcctgccccg gggaggctcc 120 gtgctggtga catgcagcac ctcctgtgac cagcccaagt tgttgggcat agagaccccg 180 ttgcctaaaa aggagttgct cctgcctggg aacaaccgga aggtgtatga actgagcaat 240 gtgcaagaag atagccaacc aatgtgctat tcaaactgcc ctgatgggca gtcaacagct 300 aaaaccttcc tcaccgtgta ctggactcca gaacgggtgg aactggcacc cctcccctct 360 tggcagccag tgggcaagaa ccttacccta cgctgccagg tggagggtgg ggcaccccgg 420 gccaacctca ccgtggtgct gctccgtggg gagaaggagc tgaaacggga gccagctgtg 480 ggggagcccg ctgaggtcac gaccacggtg ctggtgagga gagatcacca tggagccaat 540 ttctcgtgcc gcactgaact ggacctgcgg ccccaagggc tggagctgtt tgagaacacc 600 tcggccccct accagctcca gacctttgtc ctgccagcga ctcccccaca acttgtcagc 660 ccccgggtcc tagaggtgga cacgcagggg accgtggtct gttccctgga cgggctgttc 720 ccagtctcgg aggcccaggt ccacctggca ctgggggacc agaggttgaa ccccacagtc 780 acctatggca acgactcctt ctcggccaag gcctcagtca gtgtgaccgc agaggacgag 840 ggcacccagc ggctgacgtg tgcagtaata ctggggaacc agagccagga gacactgcag 900 acagtgacca tttacagttt tccggcgccc aacgtgattc tgacgaagcc agaggtctca 960 gaagggaccg aggtgacagt gaagtgtgag gcccacccta gagccaaggt gacgctgaat 1020 ggggttccag cccagccact gggcccgagg gcccagctcc tgctgaaggc caccccagag 1080 gacaacgggc gcagcttctc ctgctctgca accctggagg tggccggcca gcttatacac 1140 aagaaccaga cccgggagct tcgtgtcctg tatggccccc gactggacga gagggattgt 1200 ccgggaaact ggacgtggcc agaaaattcc cagcagactc caatgtgcca ggcttggggg 1260 aacccattgc ccgagctcaa gtgtctaaag gatggcactt tcccactgcc catcggggaa 1320 tcagtgactg tcactcgaga tcttgagggc acctacctct gtcgggccag gagcactcaa 1380 ggggaggtca cccgcgaggt gaccgtgaat gtgctctccc cccggtatga gattgtcatc 1440 atcactgtgg tagcagccgc agtcataatg ggcactgcag gcctcagcac gtacctctat 1500 aaccgccagc ggaagatcaa gaaatacaga ctacaacagg cccaaaaagg gacccccatg 1560 aaaccgaaca cacaagccac gcctccctac ccatacgatg ttccagatta cgcttgagcg 1620 gccgc 1625 <210> 2 <211> 532 <212> PRT <213> ICAM-1 <400> 2 Met Ala Pro Ser Ser Pro Arg Pro Ala Leu Pro Ala Leu Leu Val Leu 1 5 10 15 Leu Gly Ala Leu Phe Pro Gly Pro Gly Asn Ala Gln Thr Ser Val Ser 20 25 30 Pro Ser Lys Val Ile Leu Pro Arg Gly Gly Ser Val Leu Val Thr Cys 35 40 45 Ser Thr Ser Cys Asp Gln Pro Lys Leu Leu Gly Ile Glu Thr Pro Leu 50 55 60 Pro Lys Lys Glu Leu Leu Leu Pro Gly Asn Asn Arg Lys Val Tyr Glu 65 70 75 80 Leu Ser Asn Val Gln Glu Asp Ser Gln Pro Met Cys Tyr Ser Asn Cys 85 90 95 Pro Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr 100 105 110 Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser Trp Gln Pro Val Gly 115 120 125 Lys Asn Leu Thr Leu Arg Cys Gln Val Glu Gly Gly Ala Pro Arg Ala 130 135 140 Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys Glu Leu Lys Arg Glu 145 150 155 160 Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr Thr Thr Val Leu Val Arg 165 170 175 Arg Asp His His Gly Ala Asn Phe Ser Cys Arg Thr Glu Leu Asp Leu 180 185 190 Arg Pro Gln Gly Leu Glu Leu Phe Glu Asn Thr Ser Ala Pro Tyr Gln 195 200 205 Leu Gln Thr Phe Val Leu Pro Ala Thr Pro Pro Gln Leu Val Ser Pro 210 215 220 Arg Val Leu Glu Val Asp Thr Gln Gly Thr Val Val Cys Ser Leu Asp 225 230 235 240 Gly Leu Phe Pro Val Ser Glu Ala Gln Val His Leu Ala Leu Gly Asp 245 250 255 Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn Asp Ser Phe Ser Ala 260 265 270 Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu Gly Thr Gln Arg Leu 275 280 285 Thr Cys Ala Val Ile Leu Gly Asn Gln Ser Gln Glu Thr Leu Gln Thr 290 295 300 Val Thr Ile Tyr Ser Phe Pro Ala Pro Asn Val Ile Leu Thr Lys Pro 305 310 315 320 Glu Val Ser Glu Gly Thr Glu Val Thr Val Lys Cys Glu Ala His Pro 325 330 335 Arg Ala Lys Val Thr Leu Asn Gly Val Pro Ala Gln Pro Leu Gly Pro 340 345 350 Arg Ala Gln Leu Leu Leu Lys Ala Thr Pro Glu Asp Asn Gly Arg Ser 355 360 365 Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly Gln Leu Ile His Lys 370 375 380 Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly Pro Arg Leu Asp Glu 385 390 395 400 Arg Asp Cys Pro Gly Asn Trp Thr Trp Pro Glu Asn Ser Gln Gln Thr 405 410 415 Pro Met Cys Gln Ala Trp Gly Asn Pro Leu Pro Glu Leu Lys Cys Leu 420 425 430 Lys Asp Gly Thr Phe Pro Leu Pro Ile Gly Glu Ser Val Thr Val Thr 435 440 445 Arg Asp Leu Glu Gly Thr Tyr Leu Cys Arg Ala Arg Ser Thr Gln Gly 450 455 460 Glu Val Thr Arg Lys Val Thr Val Asn Val Leu Ser Pro Arg Tyr Glu 465 470 475 480 Ile Val Ile Ile Thr Val Val Ala Ala Ala Val Ile Met Gly Thr Ala 485 490 495 Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg Lys Ile Lys Lys Tyr 500 505 510 Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro Met Lys Pro Asn Thr Gln 515 520 525 Ala Thr Pro Pro 530 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 sense <400> 3 gccagcuuau acacaagaa 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 antisense <400> 4 uucuugugua uaagcuggc 19 <210> 5 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> shICAM-1 <400> 5 ccgggatcac catggagcca atttcctcga ggaaattggc tccatggtga tctttttg 58
Claims (7)
(2) 상기 세포에서 ICAM-1(Intracellular adhesion molecule 1)과 EGFR과의 결합 수준을 측정하는 단계; 및
(3) 후보물질 비처리군에 비해 상기 ICAM-1과 EGFR과의 결합 수준을 감소시키는 물질을 치료물질로 선정하는 단계를 포함하는, 유방암 치료제 스크리닝 방법.(1) treating candidate cancer cells with breast cancer cells;
(2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And
(3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic agent, as compared to the candidate non-treatment group.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170155727A KR102028703B1 (en) | 2017-11-21 | 2017-11-21 | Biomarker for diagnosis and treatment of breast cancer |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170155727A KR102028703B1 (en) | 2017-11-21 | 2017-11-21 | Biomarker for diagnosis and treatment of breast cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20190058082A KR20190058082A (en) | 2019-05-29 |
KR102028703B1 true KR102028703B1 (en) | 2019-10-04 |
Family
ID=66673090
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020170155727A KR102028703B1 (en) | 2017-11-21 | 2017-11-21 | Biomarker for diagnosis and treatment of breast cancer |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102028703B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20210124772A (en) | 2020-04-07 | 2021-10-15 | 서울대학교병원 | COMPOSITION FOR PREDICTING REACTIVITY Of ANTICANCER AGENT IN BREAST CANCER PATIENTS AND KIT COMPRISING SAME |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MX2014014821A (en) * | 2012-06-26 | 2015-02-12 | Hoffmann La Roche | Blood plasma biomarkers for bevacizumab combination therapies for treatment of breast cancer. |
-
2017
- 2017-11-21 KR KR1020170155727A patent/KR102028703B1/en active IP Right Grant
Non-Patent Citations (2)
Title |
---|
Carcinogenesis, 26(5), pp. 943-950 (2005.03.17.)* |
Oncol Rep, 35(3), pp. 1541-1548 (2016.01.05.)* |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20210124772A (en) | 2020-04-07 | 2021-10-15 | 서울대학교병원 | COMPOSITION FOR PREDICTING REACTIVITY Of ANTICANCER AGENT IN BREAST CANCER PATIENTS AND KIT COMPRISING SAME |
Also Published As
Publication number | Publication date |
---|---|
KR20190058082A (en) | 2019-05-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20220251662A1 (en) | Metastasis specific splice variants of mena and uses thereof in diagnosis, prognosis and treatment of tumors | |
DK2456889T3 (en) | Markers of endometrial cancer | |
US20050003390A1 (en) | Targets for controlling cellular growth and for diagnostic methods | |
WO2014036387A2 (en) | Methods for diagnosis and treatment of cancer | |
WO2004076682A2 (en) | Targets for controlling cellular growth and for diagnostic methods | |
US8747867B2 (en) | Cancer markers | |
CN109709335B (en) | Application of heat shock protein HSPA4 in tumor metastasis prediction, prognosis evaluation and treatment | |
KR102028703B1 (en) | Biomarker for diagnosis and treatment of breast cancer | |
WO2007075672A2 (en) | Prognostic cancer markers | |
US7445892B2 (en) | Method of testing anticancer agent-sensitivity of tumor cells | |
KR102524548B1 (en) | Biomarker predictive of responsiveness to an anticancer agent and use thereof | |
US20130058966A1 (en) | Anti-pdef antibodies and uses thereof | |
KR20190051364A (en) | Biomarker for diagnosis of metastatic breast cancer and uses thereof | |
EP1954830A1 (en) | Methods and kits for breast cancer prognosis | |
KR102434324B1 (en) | Biomarker for diagnosis or prognosis prediction of metastatic breast cancer and use thereof | |
KR102549771B1 (en) | Method for screening an inhibitor for metastasis of colorectal cancer | |
KR100861464B1 (en) | A carcinoma gene tip41, a protein translated from the gene and a diagnostic kit using the same | |
KR101683961B1 (en) | Recurrence Marker for Diagnosis of Bladder Cancer | |
JP2005000056A (en) | Hormone-dependent cancer marker and its utilization | |
KR102431271B1 (en) | Biomarker predictive of responsiveness to an anticancer agent and use thereof | |
KR101968962B1 (en) | Compositions for diagnosing obesity resistance | |
US20230288399A1 (en) | Method for screening colorectal cancer metastasis inhibitor | |
KR20070027659A (en) | A breast cancer related protein, a gene encoding the same, and a method for diagnosing a breast cancer using the protein and gene | |
KR20230166775A (en) | Novel MFSD7-ATP5l fusion gene and uses thereof | |
JP2004137151A (en) | Therapeutic and diagnostic agent for cerebral tumor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right |