KR102028703B1 - Biomarker for diagnosis and treatment of breast cancer - Google Patents

Abstract

The present invention relates to a biomarker for diagnosing and treating breast cancer, and more particularly, a marker composition for predicting the reactivity of a breast cancer agent comprising the ICAM-1 gene or a protein encoded by the gene, and a composition for predicting the reactivity of the therapeutic agent using the same, and The present invention relates to a method for providing information for predicting therapeutic response.
The inventors have derived ICAM-1 as a novel biomarker that can be used for the diagnosis and treatment of breast cancer, and confirmed both its effectiveness and specific mechanisms regulated by ICAM-1. As a new target for the treatment of, it can be usefully used to diagnose the metastasis of breast cancer, the prognosis or to predict the therapeutic responsiveness of a therapeutic agent.

Description

Biomarker for diagnosis and treatment of breast cancer

The present invention relates to a biomarker for diagnosing and treating breast cancer, and more particularly, a marker composition for predicting the reactivity of a breast cancer agent comprising the ICAM-1 gene or a protein encoded by the gene, and a composition for predicting the reactivity of the therapeutic agent using the same, The present invention relates to a method for providing information for predicting therapeutic response.

Breast cancer is a malignant tumor that occurs in cells of the breast. Although the cause of breast cancer is not clear, various factors such as female hormones, family history, past history, fertility, and dietary habits have been discussed. The 5-year survival rate of breast cancer is known to be less than 20% in stage 4 compared to stage 0 cancer, which is 100%. In women undergoing physiologically active physical changes such as low birthrate, short lactation period, early menstruation, and late menopause, increased sensitivity of the mammary tissue due to the rapid increase in the number of female hormone stimuli, westernization of diet, and pollution of the living environment For this reason, the incidence of breast cancer has recently increased rapidly, and the incidence of breast cancer and the increase in mortality due to breast cancer are expected to continue for some time in view of the current westernization.

Heterogeneous breast cancer cells have subtypes according to the expression patterns of various biomarkers and are undergoing radiation therapy as well as drug treatment accordingly. These subtypes are reported to be divided according to the expression of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor (HER2). Types with three hormone receptors (ER +, PR +, HER2 +) are called the luminal type, and drug treatment targeting these receptors is progressing effectively, but tissues that are negative for the three receptors (ER -, PR-, HER2-), ie basal type breast cancer tissue, is not only easy to treat, but also has a poor prognosis due to its high penetration and metastasis compared to the lumen type.

Therefore, in order to treat breast cancer, the development of a diagnostic method of cancer with high sensitivity and specificity in the pre-treatment stage is of paramount importance, and such a diagnosis must be one that can be found early in cancer. In addition, the development of an agent for screening biomarkers and measuring diagnostic markers for the development of a diagnostic agent for cancer that enables accurate determination of the onset and progression of such cancer, and a therapeutic agent that compensates for the disadvantages of surgical resection or anticancer agent. Is an indispensable means of conquering cancer, an incurable disease.

Thus, there is a need for the development of new targets that can be used to diagnose metastasis of breast cancer, prognosis or therapeutic responsiveness of therapeutic agents, and research on this is being done (Korea Patent Publication No. 10-2014-0019833). It is a slight level.

The present inventors have studied new targets that can be used to diagnose metastasis, prognosis or therapeutic response of breast cancer, and as a result, ICAM-1 has been shown to affect basal type breast cancer tissue that is poorly responsive to drug treatment. The expression of high specificity, ICAM-1 induces sub-signal activation through binding to activated EGFR has been identified for the first time to play an important role in the invasiveness and metastasis of breast cancer, the present invention was completed based on this .

Accordingly, the present invention provides an intracellular adhesion molecule 1 (IMC-1) gene or a marker composition for predicting the reactivity of a breast cancer drug comprising the protein encoded by the gene, and a composition, a kit for predicting the reactivity and a therapeutic response using the same It aims to provide a providing method.

In addition, the present invention comprises the steps of (1) treating the candidate substance to breast cancer cells; (2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And (3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic agent, as compared to the non-treatment candidate, as another object of the present invention.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention provides a marker composition for predicting the reactivity of breast cancer therapeutic agent comprising an ICAM-1 (Intracellular adhesion molecule 1) gene or a protein encoding the gene.

In one embodiment of the present invention, the ICAM-1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

In another aspect, the present invention provides a composition for predicting the reactivity of breast cancer therapeutic agent comprising an agent for measuring the mRNA level of the intracellular adhesion molecule 1 (IMC-1) gene or the protein encoded by the gene.

In one embodiment of the invention, the agent for measuring the mRNA level of the gene may be a sense and antisense primer, or probe that complementarily binds to the mRNA of the gene.

In another embodiment of the invention, the agent for measuring the protein level may be an antibody that specifically binds to the protein encoded by the gene.

The present invention also provides a kit for predicting reactivity of breast cancer, comprising the composition.

In addition, the present invention comprises the steps of (1) treating the candidate substance to breast cancer cells; (2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And (3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic substance, as compared to the candidate non-treatment group.

The inventors have derived ICAM-1 as a novel biomarker that can be used for the diagnosis and treatment of breast cancer, and confirmed both its effectiveness and specific mechanisms regulated by ICAM-1. As a new target for the treatment of, it can be usefully used for diagnosing the metastasis of breast cancer, prognosis or predicting the therapeutic reactivity of a therapeutic agent.

Figure 1a shows the results of confirming the expression level of ICAM-1 for each type of breast cancer through the GOBO database system.
Figure 1b shows the results of confirming the expression level of the ICAM family in breast cancer cells through Realtime PCR.
Figure 1c, after inhibiting the ICAM family (ICAM-1 ~ 5) by using siRNA to the basal breast cancer cells, MDAMB-231, respectively, shows the results confirmed the change in infiltration and mobility through the boyden chamber assay.
Figure 2a shows the results of confirming the change of invasiveness through the boyden chamber assay after the inhibition of ICAM-1 using shRNA in the basal breast cancer cells MDAMB-231.
Figure 2b shows the results of confirming the expression changes of EMT markers and regulators through Western blot after suppressing ICAM-1 using shRNA in MDAMB-231, a basal breast cancer cell.
Figure 2c, after overexpressing ICAM-1 in SK-BR3 cells, shows the result of confirming the change in infiltration through the boyden chamber assay.
Figure 2d, after overexpressing ICAM-1 in SK-BR3 cells, shows the results of confirming the expression changes of EMT markers and regulators via Western blot.
Figure 3a shows the process of injecting the fatpad after reducing the expression of ICAM-1 using shRNA in MDAMB-231 cells to confirm the metastatic capacity according to ICAM-1 expression.
Figure 3b, after performing the process of Figure 3a, shows the result of confirming the change in size of the cancer tissue every three days every 36 days.
Figure 3c shows the result of confirming the weight change of the cancer tissue by obtaining the breast cancer tissue 30 days after the process of Figure 3a.
Figure 3d, after performing the process of Figure 3a, shows the result of confirming the number of transfer furnaces to obtain lung tissue 30 days.
Figure 3e, after performing the process of Figure 3a, to obtain the lung tissue 30 days showing the result of confirming the degree of metastasis to the lung through H & E staining.
Figure 4a shows the result of confirming the protein binding to ICAM-1 through ICAM-1 GST-pulldown experiment.
FIG. 4B shows the result of EGFR binding to ICAM-1 obtained through IP based on FIG. A.
Figure 4c shows the result of confirming the binding of ICAM-1 and EGFR in MCF7 cells as luminal cells through the DTSSP experiment method.
5A shows an ICAM-1 deletion Construct constructed to identify sites of ICAM-1 that bind to EGFR.
5b shows the result of confirming the binding between the extracellular domain and EGFR through IP (Immunoprecipitation).
5C shows the results of confirming the change in binding to EGFR when overexpressing ΔD1-5, respectively.

The inventors have identified a novel use of ICAM-1 that can be used to predict the metastasis of breast cancer, the prognosis or the therapeutic responsiveness of a therapeutic agent, and thus completed the present invention.

Accordingly, the present invention provides a marker composition for diagnosing breast cancer metastasis, predicting prognosis or predicting therapeutic agent reactivity, comprising an intracellular adhesion molecule 1 (ICAM-1) gene or a protein encoded by the gene.

In addition, the present invention includes a composition for measuring breast cancer metastasis diagnosis, prognosis prediction or therapeutic agent reactivity comprising the mRNA or the level of the protein encoding the gene of the intracellular adhesion molecule 1 (ICAM-1) gene and the composition comprising the composition The present invention provides a kit for diagnosing breast cancer metastasis, predicting prognosis, or predicting therapeutic response.

In the present invention, the ICAM-1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1, the homologue of the nucleotide sequence is also included within the scope of the present invention. Specifically, the gene may include a nucleotide sequence having a sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95%, with the base sequence of SEQ ID NO: 1, respectively. Can be.

In addition, the protein encoded by the ICAM-1 gene may be composed of the amino acid sequence of SEQ ID NO: 2, it is interpreted to include a sequence showing a substantial identity (substantial identity) with the sequence described in SEQ ID NO: 2. This substantial identity is at least 80% when the sequences of the present invention are aligned with each other as closely as possible and the aligned sequences are analyzed using algorithms commonly used in the art. Sequences that show homology, more preferably 90%, 91%, 92%, 93%, 94%, 95% homology, most preferably 96%, 97%, 98%, 99% homology it means.

The term "diagnosis" of the present invention means confirming the presence or characteristic of a pathological state. In the present invention, the diagnosis may be interpreted as confirming the metastasis of breast cancer.

The term "prognosis" used in the present invention means a prediction about the progression and recovery of a condition, and refers to a prospective or preliminary evaluation. In the present invention, the prognosis means, but is not limited to, prediction about breast cancer progression, treatment result, or recovery.

In the present invention, "therapeutic responsiveness prediction" means predicting whether a patient will respond favorably or unfavorably to a therapeutic agent, such as an anticancer agent, or predicting the risk of resistance to an anticancer agent, Prognosis, that is, predicting relapse, metastasis, survival, or disease-free survival. Biomarkers for predicting therapeutic agent reactivity according to the present invention may provide information to help select the most appropriate treatment modality for breast cancer patients.

In the present invention, the agent for measuring the mRNA level may be a sense and antisense primer, or probe that complementarily binds to the mRNA of the gene.

As used herein, the term "primer" refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, and the like, as a short gene sequence that is a starting point for DNA synthesis. The primers can be synthesized in a conventional length of 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, or the like by a known method.

As used herein, the term "probe" refers to a nucleic acid capable of specifically binding to mRNA of several bases to several hundred bases in length, which has been produced through enzymatic chemical separation or purification. The presence of mRNA can be confirmed by labeling radioisotopes or enzymes, and can be designed and modified by known methods.

In the present invention, the agent for measuring the protein level may be an antibody that specifically binds to a protein encoded by a gene, but is not limited thereto.

As used herein, the term “antibody” includes immunoglobulin molecules that are immunologically reactive with specific antigens, and include both monoclonal and polyclonal antibodies. In addition, such antibodies include forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).

Prediction kits of the present invention consist of one or more other component compositions, solutions or devices suitable for analytical methods.

For example, the kit of the present invention may be used to perform genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer, and water to perform PCR. It may be a kit comprising. The PCR buffer may contain KCl, Tris-HCl and MgCl ₂ . In addition, the components necessary for performing electrophoresis to confirm amplification of PCR products may be further included in the kit of the present invention.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. RT-PCR kits include test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC, as well as individual primer pairs specific for the marker gene. -May include DEPC-water, sterile water, and the like. It may also include primer pairs specific for the gene used as a quantitative control.

In addition, the kit of the present invention may be a kit containing essential elements necessary for carrying out the DNA chip. The DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached with a probe, and the substrate may include a cDNA corresponding to a quantitative gene or a fragment thereof. In addition, the kit of the present invention may be in the form of a microarray having a substrate on which the marker gene of the present invention is immobilized.

In addition, the kit of the present invention may be a kit comprising the necessary elements necessary to perform an ELISA. ELISA kits include antibodies specific for the marker protein and include agents that measure the protein level. The ELISA kit may comprise reagents capable of detecting an antibody that has formed an “antigen-antibody complex”, such as labeled secondary antibodies, chromopores, enzymes, and substrates thereof. It may also include antibodies specific for quantitative control proteins.

As used herein, the term “antigen-antibody complex” means a combination of a protein encoded by a gene and an antibody specific to it. The amount of antigen-antibody complex formed can be measured quantitatively through the magnitude of the signal of the detection label. Such detection labels may be selected from the group consisting of enzymes, fluorescent materials, ligands, luminescent materials, microparticles, redox molecules and radioisotopes, but are not limited thereto.

In another aspect of the present invention, the present invention provides a method for predicting metastasis, prognostic prediction, or therapeutic response of breast cancer, comprising detecting mRNA of the ICAM-1 gene or a protein encoded by a biological sample from a subject. Provide information

The expression level of the mRNA according to conventional methods known in the art NanoString nCounter analysis (NanoString nCounter analysis), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RNase protection assay; RPA), microarray, and northern blotting can be measured by one or more methods selected from the group consisting of, It is not limited.

The protein expression level is Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme-linked immunoassay (ELISA), immunoprecipitation (immunoprecipitation) according to conventional methods known in the art ), Flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, and protein chip. It may be measured through, but is not limited thereto.

The inventors have identified the use of ICAM-1 according to the invention as a novel biomarker in breast cancer through specific examples.

In one embodiment of the present invention, it was confirmed that the expression of ICAM-1 is high in basal type breast cancer tissue that is not responsive to drug treatment, and confirmed that there is no correlation except ICAM-1 in the ICAM family. .

In another embodiment of the present invention, as a result of in vitro and in vivo experiments confirmed changes in the invasive capacity and metastatic capacity of breast cancer cells according to ICAM-1 expression regulation, inhibition of ICAM-1 is invasive and metastatic capacity of breast cancer cells In contrast, ICAM-1 was related only to the invasiveness and metastatic capacity of breast cancer cells by confirming that it did not affect cell growth and cancer tissue weight.

In still another embodiment of the present invention, after making an ICAM-1-GST construct to confirm which signaling is regulated by the increase in metastatic capacity and invasiveness by ICAM-1, overexpression in MDAMD-231 cells and ICAM IP (immunoprecipitation) was performed using -1 Ab. And confirmed by mass spectrometry (MS), and it was confirmed that EGFR occupies a large proportion of proteins that bind to ICAM-1. In addition, IP experiments confirmed that ICAM-1 and EGFR bind, and to further clarify, the binding of EGFR and ICAM-1 increases when CAMFR is treated after overexpressing ICAM-1 and EGFR in MCF7 cells. By confirming that the regulation of invasiveness of breast cancer cells by ICAM-1 was found to be induced by binding to EGFR.

These results indicate that the ICAM-1 protein or the gene encoding the protein can be used as a molecular marker for diagnosing metastasis, prognostic prediction or therapeutic response of breast cancer.

In another aspect of the invention, the present invention comprises the steps of (1) treating the candidate substance to breast cancer cells; (2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And (3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic agent, as compared to the candidate non-treatment group.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

Example  1. In breast cancer cells ICAM -1 expression confirmation

First, the expression level of ICAM-1 by breast cancer type was confirmed through the GOBO database system. As a result, as shown in FIG. 1A, it was confirmed that ICAM-1 expression was high in basal breast cancer tissue.

Next, the expression level of the ICAM family in five breast cancer cells was confirmed by Realtime PCR. As a result, as shown in FIG. 1B, ICAM-1 was expressed in the basal breast cancer cells known to be the most malignant type of breast cancer cells. It was confirmed that the expression was specifically increased.

Next, after inhibiting the ICAM family using siRNA on the basal breast cancer cells, MDAMB-231, and confirming the change in invasiveness and mobility through boyden chamber assay, as shown in Figure 1c, when compared with the control, Only in the group that inhibited ICAM-1 it was confirmed that the infiltration ability is specifically reduced. On the other hand, specific sequence information of the siRNA used is shown in Table 1 below.

division Sequence information siICAM-1 sense 5 '-GCC AGC UUA UAC ACA AGA A (dTdT) -3'
(SEQ ID NO: 3) anti sense 5 '-UUC UUG UGU AUA AGC UGG C (dTdT)-3' (SEQ ID NO: 4)

Example  2. ICAM Of breast cancer cells according to -1 expression regulation Infiltration ability  Check increase or decrease

First, ICAM-1 was suppressed by using shRNA on basal breast cancer cells MDAMB-231, and then the change in invasiveness was confirmed by boyden chamber assay. As shown in FIG. 2A, ICAM-1 was compared with the control group. It was confirmed that the infiltration ability was reduced in the suppressed group. On the other hand, specific sequence information of the shRNA used is as follows:

shICAM-1: CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG (SEQ ID NO: 5)

Next, as a result of confirming the expression changes of EMT (epithelial-mesenchymal transition) markers and regulators through Western blot, as shown in Figure 2b, compared to the control group, EMT markers and regulators in the ICAM-1 inhibitory group It was confirmed that the expression of.

On the other hand, after overexpression of ICAM-1 in SK-BR3 cells with relatively low expression of ICAM-1 compared to the baseline, the change in invasiveness and expression of EMT markers / regulators were confirmed in the same manner as above. And, as shown in Figure 2d, compared with the control group, not only increased the invasion ability in the group overexpressing ICAM-1, it was confirmed that the expression of EMT markers (Vimentin, Fibronectin) and regulator (Zeb1) also increased. .

Example  3. ICAM Of breast cancer cells according to inhibition of -1 expression Metastatic power  Inhibition Confirmation (in vivo)

Animal experiments were performed as follows to confirm the metastatic capacity according to ICAM-1 expression.

ShRNA was used to reduce expression of ICAM-1 in MDAMB-231 cells and then injected into fatpad (FIG. 3A). As a result of confirming the size of the cancer tissue every three days for 36 days, as shown in Figure 3b, there was no difference in the size of the cancer tissue as compared to the control group, as shown in Figure 3c, the weight of breast cancer 30 days after cancer cell injection When the change was confirmed, there was no change.

However, as a result of obtaining lung tissue and confirming the degree of metastasis to the lung, as shown in FIGS. 3D and 3E, it was confirmed that the metastatic capacity was decreased by decreasing the number of metastatic furnaces in the group that inhibited ICAM-1 expression as compared to the control group.

Example  4. ICAM -1's Infiltration ability  Identify lower signaling mechanisms for increase

In order to confirm whether the increase in infiltration by ICAM-1 is regulated by which signaling, ICAM-1 GST-pulldown experiment was conducted first. More specifically, after overexpressing GST-ICAM-1, IP was performed using ICAM-1 Ab. Subsequently, as a result of confirming the protein binding to ICAM-1 by MS, as shown in FIGS. 4A and 4B, it was confirmed that ICAM-1 and EGFR bind to MDAMB231 cells.

In addition, when ICAM-1 and EGFR were overexpressed in the luminal type MCF7 cells and then treated with EGF, it was confirmed that ICAM-1 and EGFR bind as shown in FIG. 4C.

Example  5. EGFR  Combined ICAM A domain of -1

To identify the sites of ICAM-1 that bind to EGFR, ICAM-1 deletion Constructs were first constructed. WT-ICAM-1 (wild type), sol-ICAM-1 (transmembrane deletion form), △ ECD (extracellualr domain deletion form), △ ICD (intracellular domain deletion form), △ D1-5 (domains 1-5) Each deletion form) (FIG. 5A).

Next, overexpression of EGFR in HEK293T cells and overexpression of ΔECD and ΔICD, respectively. As shown in Figure 5b, it was confirmed that the extracellular domain binds by confirming the binding of the two proteins in the EGF-dependent overexpression of EGFR and △ ICD-ICAM-1. In addition, WT-ICAM-1 and sol-ICAM-1, which have extracellular domains, could also be identified by IP binding to EGFR.

In addition, as a result of confirming the change in binding to EGFR when overexpressing ΔD1-5, respectively, as shown in FIG.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis and treatment of breast cancer <130> PD17-108 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 1625 <212> DNA <213> ICAM-1 <400> 1 atggctccca gcagcccccg gcccgcgctg cccgcactcc tggtcctgct cggggctctg 60 ttcccaggac ctggcaatgc cgaattcccc tcaaaagtca tcctgccccg gggaggctcc 120 gtgctggtga catgcagcac ctcctgtgac cagcccaagt tgttgggcat agagaccccg 180 ttgcctaaaa aggagttgct cctgcctggg aacaaccgga aggtgtatga actgagcaat 240 gtgcaagaag atagccaacc aatgtgctat tcaaactgcc ctgatgggca gtcaacagct 300 aaaaccttcc tcaccgtgta ctggactcca gaacgggtgg aactggcacc cctcccctct 360 tggcagccag tgggcaagaa ccttacccta cgctgccagg tggagggtgg ggcaccccgg 420 gccaacctca ccgtggtgct gctccgtggg gagaaggagc tgaaacggga gccagctgtg 480 ggggagcccg ctgaggtcac gaccacggtg ctggtgagga gagatcacca tggagccaat 540 ttctcgtgcc gcactgaact ggacctgcgg ccccaagggc tggagctgtt tgagaacacc 600 tcggccccct accagctcca gacctttgtc ctgccagcga ctcccccaca acttgtcagc 660 ccccgggtcc tagaggtgga cacgcagggg accgtggtct gttccctgga cgggctgttc 720 ccagtctcgg aggcccaggt ccacctggca ctgggggacc agaggttgaa ccccacagtc 780 acctatggca acgactcctt ctcggccaag gcctcagtca gtgtgaccgc agaggacgag 840 ggcacccagc ggctgacgtg tgcagtaata ctggggaacc agagccagga gacactgcag 900 acagtgacca tttacagttt tccggcgccc aacgtgattc tgacgaagcc agaggtctca 960 gaagggaccg aggtgacagt gaagtgtgag gcccacccta gagccaaggt gacgctgaat 1020 ggggttccag cccagccact gggcccgagg gcccagctcc tgctgaaggc caccccagag 1080 gacaacgggc gcagcttctc ctgctctgca accctggagg tggccggcca gcttatacac 1140 aagaaccaga cccgggagct tcgtgtcctg tatggccccc gactggacga gagggattgt 1200 ccgggaaact ggacgtggcc agaaaattcc cagcagactc caatgtgcca ggcttggggg 1260 aacccattgc ccgagctcaa gtgtctaaag gatggcactt tcccactgcc catcggggaa 1320 tcagtgactg tcactcgaga tcttgagggc acctacctct gtcgggccag gagcactcaa 1380 ggggaggtca cccgcgaggt gaccgtgaat gtgctctccc cccggtatga gattgtcatc 1440 atcactgtgg tagcagccgc agtcataatg ggcactgcag gcctcagcac gtacctctat 1500 aaccgccagc ggaagatcaa gaaatacaga ctacaacagg cccaaaaagg gacccccatg 1560 aaaccgaaca cacaagccac gcctccctac ccatacgatg ttccagatta cgcttgagcg 1620 gccgc 1625 <210> 2 <211> 532 <212> PRT <213> ICAM-1 <400> 2 Met Ala Pro Ser Ser Pro Arg Pro Ala Leu Pro Ala Leu Leu Val Leu   1 5 10 15 Leu Gly Ala Leu Phe Pro Gly Pro Gly Asn Ala Gln Thr Ser Val Ser              20 25 30 Pro Ser Lys Val Ile Leu Pro Arg Gly Gly Ser Val Leu Val Thr Cys          35 40 45 Ser Thr Ser Cys Asp Gln Pro Lys Leu Leu Gly Ile Glu Thr Pro Leu      50 55 60 Pro Lys Lys Glu Leu Leu Leu Pro Gly Asn Asn Arg Lys Val Tyr Glu  65 70 75 80 Leu Ser Asn Val Gln Glu Asp Ser Gln Pro Met Cys Tyr Ser Asn Cys                  85 90 95 Pro Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu Thr Val Tyr Trp Thr             100 105 110 Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser Trp Gln Pro Val Gly         115 120 125 Lys Asn Leu Thr Leu Arg Cys Gln Val Glu Gly Gly Ala Pro Arg Ala     130 135 140 Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys Glu Leu Lys Arg Glu 145 150 155 160 Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr Thr Thr Val Leu Val Arg                 165 170 175 Arg Asp His His Gly Ala Asn Phe Ser Cys Arg Thr Glu Leu Asp Leu             180 185 190 Arg Pro Gln Gly Leu Glu Leu Phe Glu Asn Thr Ser Ala Pro Tyr Gln         195 200 205 Leu Gln Thr Phe Val Leu Pro Ala Thr Pro Pro Gln Leu Val Ser Pro     210 215 220 Arg Val Leu Glu Val Asp Thr Gln Gly Thr Val Val Cys Ser Leu Asp 225 230 235 240 Gly Leu Phe Pro Val Ser Glu Ala Gln Val His Leu Ala Leu Gly Asp                 245 250 255 Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn Asp Ser Phe Ser Ala             260 265 270 Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu Gly Thr Gln Arg Leu         275 280 285 Thr Cys Ala Val Ile Leu Gly Asn Gln Ser Gln Glu Thr Leu Gln Thr     290 295 300 Val Thr Ile Tyr Ser Phe Pro Ala Pro Asn Val Ile Leu Thr Lys Pro 305 310 315 320 Glu Val Ser Glu Gly Thr Glu Val Thr Val Lys Cys Glu Ala His Pro                 325 330 335 Arg Ala Lys Val Thr Leu Asn Gly Val Pro Ala Gln Pro Leu Gly Pro             340 345 350 Arg Ala Gln Leu Leu Leu Lys Ala Thr Pro Glu Asp Asn Gly Arg Ser         355 360 365 Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly Gln Leu Ile His Lys     370 375 380 Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly Pro Arg Leu Asp Glu 385 390 395 400 Arg Asp Cys Pro Gly Asn Trp Thr Trp Pro Glu Asn Ser Gln Gln Thr                 405 410 415 Pro Met Cys Gln Ala Trp Gly Asn Pro Leu Pro Glu Leu Lys Cys Leu             420 425 430 Lys Asp Gly Thr Phe Pro Leu Pro Ile Gly Glu Ser Val Thr Val Thr         435 440 445 Arg Asp Leu Glu Gly Thr Tyr Leu Cys Arg Ala Arg Ser Thr Gln Gly     450 455 460 Glu Val Thr Arg Lys Val Thr Val Asn Val Leu Ser Pro Arg Tyr Glu 465 470 475 480 Ile Val Ile Ile Thr Val Val Ala Ala Ala Val Ile Met Gly Thr Ala                 485 490 495 Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg Lys Ile Lys Lys Tyr             500 505 510 Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro Met Lys Pro Asn Thr Gln         515 520 525 Ala Thr Pro Pro     530 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 sense <400> 3 gccagcuuau acacaagaa 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siICAM-1 antisense <400> 4 uucuugugua uaagcuggc 19 <210> 5 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> shICAM-1 <400> 5 ccgggatcac catggagcca atttcctcga ggaaattggc tccatggtga tctttttg 58

Claims (7)

delete delete delete delete delete delete (1) treating candidate cancer cells with breast cancer cells;
(2) measuring the level of binding of intracellular adhesion molecule 1 (IGM-1) to EGFR in the cell; And
(3) selecting a substance that reduces the level of binding of ICAM-1 to EGFR as a therapeutic agent, as compared to the candidate non-treatment group.

Images