KR20190053733A - Primers for multiple detection of the virus in Rehmannia glutinosa and detection method by using the same - Google Patents

Abstract

The present invention relates to a primer set for diagnosing viruses infected in Rehmannia glutinosa, a diagnostic method, a diagnostic kit, and a diagnostic composition comprising the same. Specifically, the present invention relates to a primer set capable of diagnosing broad bean wilt virus 2 (BBWV2), plantago asiatica mosaic virus (PIAMV), rehmannia mosaic virus (ReMV) and tobamovirus subgroup 3 (T-sg3) singly or multiply, a diagnostic method, a diagnostic kit, and a diagnostic composition comprising the same. According to the present invention, it is possible to diagnose viruses infected in Rehmannia glutinosa effectively.

Description

TECHNICAL FIELD [0001] The present invention relates to a primer set for multiple diagnosis of influenza virus and a diagnostic method using the primer set.

The present invention relates to a primer set for diagnosis of avian influenza virus, a diagnostic composition comprising the same, a diagnostic kit, and a diagnostic method. More particularly, the present invention relates to a primer set for diagnosis of avian influenza virus, (ReMV) and a virus-subgroup 3 (T-sg3) in a tobacco virus, a diagnostic kit comprising the primer set, a diagnostic kit, and a diagnostic method.

Rhenmannia glutinosa Libosch is a perennial herbaceous herbaceous plant belonging to the ginseng family, and is widely distributed in temperate regions such as Korea, Japan, and Vietnam. Chrysanthemum has been cultivated in China since 1590, and it is cultivated in Andong and Nutrition in Gyeongbuk, Jeongeup in Jeonbuk, Jecheon in Chungbuk and Danyang in Chungbuk. Rhubarb is a typical vegetative propagation crop, not only has a low proliferation rate because it is propagated as a root or fine root, but also has a high incidence and incidence of pathogens during storage of breeding roots. In particular, when the leaves are not well drained due to continued high temperature and high humidity between the end of July and the beginning of September, root rot caused by Fusarium spp. Occurs when the foliage is coated due to excessive use of serial or nitrogen fertilizer.

Viruses infected with rhubarb are globally known as broad bean wilt virus 2 (BBWV2), plantago asiatica mosaic virus (PlAMV), Rehmannia mosaic virus (ReMV) Ribgrass mosaic virus (RMV), Youcai mosaic virus (YoMV) and Tobacco mosaic virus (TMV) belonging to subgroup 3 of the virus are known (see Table 1) Most of the viruses are infected with the compound. The symptoms are mainly depression of the leaves, necrotic spots, veins of the veins, mosaic, deformity symptoms, and atrophy that the plants do not grow (Fig. 1).

No. Virus name Abbreviation Group (system, genus) infection One Forgery virus 2
Broad bean wilt virus 2 BBWV2 Secoviridae (Fabavirus) aphid
(Non-permanent) 2 Plantain Mosaic Fotex virus
Plantago asiatica mosaic virus PlAMV Alphaflexiviridae (Potexvirus) Juice transmission 3 Rhizome Mosaic Virus
Rehmannia mosaic virus ReMV Virgaviridae (Tobamovirus) Juice transmission 4 Window plantain mosaic virus
Ribgrass mosaic virus RMV Virgaviridae (Tobamovirus) Juice transmission 5 Yukai Mosaic Virus
Youcai mosaic virus YoMV Virgaviridae (Tobamovirus) Juice transmission 6 Tobacco Mosaic Virus
Tobacco mosaic virus TMV Virgaviridae (Tobamovirus) Juice transmission

Scarlet fever virus 2 (BBWV2) belongs to the genus Secoviridae (Fabavirus) and is non-permanently mediated by aphids. BBWV2 has a wide host range and is reported in various host markets around the world. Recently, BBWV2 has become one of the major viruses infecting pepper crops in Korea, and its damage is less than that of pepper crops, but infection of natural host such as spinach, pea, and bean sprouts is also confirmed. Representative symptoms include leaf veins, spots, stains, mosaics, spots, necrosis, falsification, deformities, etc. in the leaves. Recently, it has been reported in domestic medicinal crops such as hemp, motherwort,

Plantain mosaic phytex virus (PlAMV) belongs to the genus Potexvirus (Alphaflexiviridae), the particle shape is mapped, length is 490-530nm, and genome is 6.1kb. It was first found in plantain, and the insect is unknown and is known to spread by juice transmission. It was first discovered in Russia and is reported to occur mainly in Central Asia. In Korea, it was first found in lilies imported from the Netherlands in 2012 and recently reported in plantain collected in 2014 (Non-Patent Document 1). PlAMV-RG showed about 87% homology to the PlAMV strain isolated from plantain, and about 80% homology to the PlAMV strain isolated from the lily. PlAMV has a wide range of hosts and has been isolated from a variety of plants such as plantain, primrose, south river, fishing violet and lily.

The Rhizo Mosaic Virus (ReMV) belongs to the genus Tobamovirus (Virgaviridae), and the particle is a bar of about 300 nm in length. It has been reported in Chinese and Taiwanese rhubarb (Non-Patent Documents 2 and 3), and ReMV has recently been reported in red pepper in Japan. Typical symptoms are necrosis and mosaic symptoms, which are generally observed in plants.

(RMV) and Yukai Mosaic virus (YoMV), which have been reported in rhubarb, belong to subgroup 3 of Birgavirus and Tobamovirus (Non-Patent Documents 4 and 5). RMV is associated with systemic necrosis in several crops belonging to the ribgrass (Plantago lanceolata), crucifera, and plantain, and was first reported in cabbage in Korea. RMV-Korea 66, isolated from rhizosphere, has 9099% homology with the Youcai mosaic virus (YoMV), but is closer to RMV than YoMV due to biological differences such as host range and pathogenesis 6). YoMV was first reported in Korean corn borer (Non-Patent Document 7), and occurrence in boron was first confirmed in China and gene registered (Genbank No. JX422022).

However, since a pharmaceutical control method directly acting on plant diseases caused by the virus has not been developed so far, the most effective method for reducing the damage caused by viruses is to develop a variety of viruses resistant to the virus, It is very difficult to cultivate resistant varieties that are resistant to the consumer even if there are resistant genetic resources. Since the viral disease of a plant can not be controlled by the pesticide once it is infected, it is necessary to discard the infectious agent if the infection by the virus is confirmed. Therefore, in order to manage the plant disease caused by the virus, However, since the virus can not be observed by an optical microscope even if the virus is a pathogen having a size of less than 1 탆 and requires an electron microscope, It is difficult to diagnose the virus that occurs in the plant. Accordingly, various methods for diagnosing viruses have been developed and used.

So far, serological diagnostic methods such as ELISA have been used to diagnose viruses. However, the serological diagnosis method was not large in the case of using a large number of samples for diagnosis in general precision, but in the presence of a virus having a serologically related relationship with the virus to be diagnosed, The host-derived material was different depending on the kind of plant infected with the virus, and the virus was misdiagnosed due to nonspecific reaction with this substance.

Recently, reverse transcription-polymerase chain reaction (RT-PCR) has been used for the precise diagnosis of viruses in plants. However, since the primers used in the RT-PCR method are generally designed for the purpose of gene cloning of viruses, they are not species-specific and may be unsuitable for diagnostic use because they may produce nonspecific products by plants or other viruses There is a lot of concern. In addition, in order to diagnose various viruses in the same sample, it is necessary to use a variety of primers to perform a reverse-transcription-polymerase chain reaction.

Therefore, there is a need for a rapid and effective diagnostic method for the virus reported in domestic rhinosomes.

1. Korean Patent Publication No. 2009-0055178 2. Korea Patent No. 625019 3. Korean Patent Publication No. 10-2017-0001071

1. Lim, S., Igori, D., Zhao, F., Do, Y. S., Cho, I. S., Choi, S. S., & Moon, J. S. (2016). Molecular detection and characterization of a divergent isolate of Plantago asiatica mosaic virus in Plantago asiatica. Virus Disease, 27 (3), 307-310. 2. Liao, J. Y., Hu, C. C., Kao, J. L., & Deng, T. C. (2007). Identification of Tobacco mosaic virus infecting Rehmannia glutinosa. Plant Pathology Bulletin, 16 (2), 61-69. 3. Zhang, Z. C., Lei, C. Y., Zhang, L. F., Yang, X. X., Chen, R., & Zhang, D. S. (2008). The complete nucleotide sequence of a novel Tobamovirus, Rehmannia mosaic virus. Archives of virology, 153 (3), 595-599. 4. Heinze, C., Lesemann, D. E., Ilmberger, N., Willingmann, P., & Adam, G. (2006). The phylogenetic structure of the cluster of tobamovirus species serologically related to ribgrass mosaic virus (RMV) and the sequence of streptocarpus flower break virus (SFBV). Archives of virology, 151 (4), 763-774. 5. Zhu, H., Hong, J., Ye, R., Chen, J., Yu, S., & Adams, M.J. (2001). Sequence analysis shows that Ribgrass mosaic virus isolate (RMV-Sh) is closely related to Youcai mosaic virus. Archives of virology, 146 (6), 1231-1238. Kim, M., Kwak, H. R., Lee, D. K., Ko, S. J., Lee, S. H., Kim, J. S., Park, K. H., Cha, B., & Choi, H. S. (2011). Biological and molecular characterization of Ribgrass mosaic tobamovirus infecting Rehmannia glutinosa. 2011 APS · IPPC Joint Meeting 7. Park, C. Y., Lee, M. A., Lee, S. H., Kim, J. S., & Kim, H. G. (2016). First Report of Youcai mosaic virus in Daisy Fleabane (Erigeron annuus). Plant Disease, 100 (6), 1250-1250.

In order to solve the above-mentioned technical problems, the present invention relates to a method for screening for viruses and viruses in domestic rhizosphere, such as fowlpox virus 2 (BBWV2), plantain mosaic phytatex virus (PIAMV), rhizome mosaic virus (ReMV) (T-sg3) can be specifically detected, and a primer set having high sensitivity among the primers can be selected and provided.

The present invention also provides a virus diagnostic method and a diagnostic kit capable of detecting the viruses individually or simultaneously using a primer composition comprising the primer set.

In order to achieve the above object, the present invention provides a primer pair comprising a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6; A pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8; A pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10; A pair of primers represented by SEQ ID NO: 11 and SEQ ID NO: 12; A pair of primers represented by SEQ ID NO: 13 and SEQ ID NO: 14; A pair of primers represented by SEQ ID NO: 15 and SEQ ID NO: 16; And at least one primer pair selected from the group consisting of primers represented by SEQ ID NO: 17 and SEQ ID NO: 18.

According to one aspect of the present invention, a group A) a pair of primers represented by SEQ ID NO: 1 and SEQ ID NO: 2, or a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4; B group) a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6, a pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8, or a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10; C group) a pair of primers represented by SEQ ID NO: 11 and SEQ ID NO: 12, or a pair of primers represented by SEQ ID NO: 13 and SEQ ID NO: 14; And D group) Two or more kinds of influenza viruses including a pair of primers selected from the group consisting of two or more of the primer pairs shown in SEQ ID NO: 15 and SEQ ID NO: 16, or the pair of primers shown in SEQ ID NO: Provided is a primer set for diagnosis of rhinosinusitis that can be diagnosed multiple times at the same time.

According to one aspect of the present invention, a primer set of the present invention comprises a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10, A pair of primers, and a pair of primers represented by SEQ ID NO: 15 and SEQ ID NO: 16.

According to one aspect of the present invention, there is provided a composition for diagnosing avian influenza virus comprising the above-described primer set.

According to one aspect of the present invention, there is provided a kit for the diagnosis of influenza viruses comprising at least one of the above-described primer set and a reagent for performing an amplification reaction.

According to one aspect of the present invention, there is provided a method for detecting a virus, comprising the steps of: obtaining DNA or RNA from a sample; amplifying the obtained DNA or RNA using the above-described primer set; and analyzing the obtained product The method comprising the steps of:

According to one aspect of the present invention, the avian influenza virus diagnosed by the diagnostic method of the present invention is selected from the group consisting of fowlpox virus 2 (BBWV2), plantain mosaic virus (PlAMV), rhizome mosaic virus (ReMV) RMV) and Yukai Mosaic virus (YoMV).

A primer set for the diagnosis of avian infectious virus according to the present invention is characterized in that the primer set for the diagnosis of avian infectious virus comprises at least one virus selected from the group consisting of bovine spongiform encephalopathies virus 2 (BBWV2), plantain mosaic virus (PIAMV), rhizome mosaic virus (ReMV), vivax mosaic virus Not only can they be diagnosed individually, but they can be diagnosed at the same time.

The virus can be accurately and specifically diagnosed using the primer set according to the present invention. In addition, since there is little interference between primers, it is possible to diagnose the infection of the influenza virus with high sensitivity, accurately or quickly, alone or simultaneously.

The diagnosis method of the present invention can reduce the cost and time required for the diagnosis of the virus, which is economical and can diagnose virus infection early, thereby preventing the economic loss of the farm due to the infection.

FIG. 1 is a diagram showing the main symptoms of a zoonotic infection virus.
Figure 2 shows the RT-PCR assay results for the BBWV2 diagnostic primer combination.
Figure 3 shows the results of RT-PCR assays of primer combinations for PlAMV diagnosis.
Figure 4 shows the RT-PCR assay results of a ReMV diagnostic primer combination.
Figure 5 shows RT-PCR results of a T-sg3 diagnostic primer combination.
6 is a key summary diagram of the one-step multiplex diagnostic PCR method according to the present invention.
FIG. 7 is a photograph showing the results of multiple RT-PCR electrophoresis of a zoonotic infection virus using a primer set finally selected in the present invention.

In order to accomplish the above-mentioned object, the present invention provides a primer set for the diagnosis of influenza viruses comprising a primer pair of a specific sequence, a composition comprising the primer pair, a kit and a diagnostic method.

The inventors of the present invention designed a primer to diagnose each of the above-described influenza viruses, and then designed primers were subjected to the actual soft-transcription-polymerase chain reaction (RT-PCR) A combination with no sensitivity to nonspecific reaction and excellent sensitivity to a target virus was finally selected and a primer set capable of simultaneously diagnosing a plurality of viruses by one RT-PCR and a multiple diagnosis method using the primer set were completed.

The term " primer " of the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form base pairs with a complementary template of a plant nucleic acid, Quot; means a short nucleic acid sequence which functions as a starting point. The primers can initiate DNA / RNA amplification in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

The primer set for the diagnosis of influenza virus according to the present invention was developed in order to induce species-specific RNA amplification against influenza virus. Species specific means that the primers can synthesize a specific RT-PCR product from the genomic sequence of the virus to be diagnosed, and it should work for all lines in the virus species to be diagnosed, Nonspecific reactions with other similar species or nucleic acids derived from plants should not occur. The primers of the present invention are species-specific and are used for the diagnosis of influenza viruses, unlike general primers that produce nonspecific products by nucleic acids of plants or other viruses.

The present invention relates to a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2; A pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6; A pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8; A pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10; A pair of primers represented by SEQ ID NO: 11 and SEQ ID NO: 12; A pair of primers represented by SEQ ID NO: 13 and SEQ ID NO: 14; A pair of primers represented by SEQ ID NO: 15 and SEQ ID NO: 16; And at least one primer pair selected from the group consisting of primers represented by SEQ ID NO: 17 and SEQ ID NO: 18.

The primers specifically detect viruses reported in domestic rhizosphere, and specifically detect the viruses such as Broad bean wilt virus 2 (BBWV2), Plantago asiatica mosaic virus (PlAMV), Rehmannia mosaic virus virus, ReMV), viruses of tobacco virus subgroup 3 (T-sg3) (specifically, Ribgrass mosaic virus (RMV) and Youcai mosaic virus (YoMV)) Do.

The primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 of the present invention show an amplification product of about 370 bp from BBWV2 and the primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4 of the present invention amplified about 270 bp amplified product from BBWV2 The primer pair shown in SEQ ID NO: 5 and SEQ ID NO: 6 of the present invention shows an amplification product of about 970 bp from PlAMV and the primer pair shown in SEQ ID NO: 7 and SEQ ID NO: 8 of the present invention amplify about 545 bp from PlAMV The primer pair of SEQ ID NO: 9 and SEQ ID NO: 10 of the present invention shows an amplification product of about 458 bp from PlAMV and the primer pair of SEQ ID NO: 11 and SEQ ID NO: 12 of the present invention is amplified from ReMV at about 611 bp And the primer pair shown in SEQ ID NO: 13 and SEQ ID NO: 14 of the present invention shows an amplification product of about 343 bp from ReMV And the primer pair shown in SEQ ID NO: 15 and SEQ ID NO: 16 of the present invention shows an amplification product of about 830 bp from RMV or YoMV, and the primer pairs shown in SEQ ID NO: 17 and SEQ ID NO: 18 of the present invention are T- sg3 to about 958 bp, whereby each of the viruses can be specifically detected and diagnosed.

The present invention also provides a primer set capable of simultaneously diagnosing any two or more of the above viruses.

According to one aspect of the present invention, a group A) a pair of primers represented by SEQ ID NO: 1 and SEQ ID NO: 2, or a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4; B group) a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6, a pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8, or a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10; C group) a pair of primers represented by SEQ ID NO: 11 and SEQ ID NO: 12, or a pair of primers represented by SEQ ID NO: 13 and SEQ ID NO: 14; And D group) Two or more kinds of influenza viruses including a pair of primers selected from the group consisting of two or more of the primer pairs shown in SEQ ID NO: 15 and SEQ ID NO: 16, or the pair of primers shown in SEQ ID NO: Provided is a primer set for diagnosis of rhinosinusitis that can be diagnosed multiple times at the same time. Here, A group is for BBWV2 diagnosis, B group is for PlAMV diagnosis, C group is for ReMV diagnosis, and D group is for T-sg3 (RMV, YoMV) diagnosis.

In order to enable multiple diagnosis of multiple viruses, it is necessary that the individual primers are species-specific as well as the primers should not interfere with each other and the amplification product should be distinguished. For example, it is desirable that the amplification positions of the respective primers overlap or are not close enough so that the amplification products do not affect each other and the size of the final amplification product is significantly different and can be clearly distinguished by RT-PCR electrophoresis. Preferably, the combination of primer sets for multiple detection of the present invention comprises a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10, a pair of SEQ ID NO: 11 and SEQ ID NO: 12 A primer pair shown, and a pair of primers represented by SEQ ID NO: 15 and SEQ ID NO: 16. The primer set including the four pairs of primer pairs can simultaneously diagnose BBWV2, PlAMV, ReMV, and T-sg3 with high efficiency.

The present invention also provides a composition for diagnosing avian influenza virus comprising a primer set according to the present invention.

The zoonotic infection virus composition of the present invention further comprises a reagent necessary for carrying out a viral RNA amplification reaction, for example, reagents necessary for carrying out RT-PCR, polymerase, dNTP and divalent metal cation, .

The present invention provides a primer set for the diagnosis of influenza virus according to the present invention and a kit for the diagnosis of avian influenza virus comprising a reagent for carrying out an amplification reaction. The primer set may be provided in the above-described composition for the diagnosis of influenza virus infection.

The kit for the diagnosis of influenza virus of the present invention may contain a reagent for performing an amplification reaction (including reverse transcription), and the reagent may include reverse transcriptase, DNA polymerase, dNTPs, buffer and the like. In addition, components necessary for performing electrophoresis to confirm amplification can be further included in the kit of the present invention. Further, it may contain an RNase inhibitor, DEPC-water, sterilized water and the like if necessary.

In addition, the kit for the diagnosis of influenza virus of the present invention can be prepared by putting the diagnostic composition into a plastic tube in a lyophilized form, and the kit may further comprise, in addition to the diagnostic composition, appropriate reagents and tools used for analysis, Such reagents and tools may include suitable carriers, labels capable of generating detectable signals, solubilizers, detergents, and the like. Such suitable carriers include, but are not limited to, soluble carriers such as physiologically acceptable buffers known in the art such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, polyester , Polyacrylonitrile, fluorine resin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

According to one aspect of the present invention, there is provided a method for producing a DNA or RNA product comprising the steps of (1) obtaining DNA or RNA from a sample, (2) amplifying the DNA or RNA obtained using the primer set of the present invention And determining whether the virus is infected (step 3).

In the first step, DNA or RNA may be obtained according to a method commonly used in the art, and may be carried out using a commercially available extraction kit.

The amplification in the above step 2 can be carried out using a suitable method for the primer of the present invention. Examples of the amplification include a polymerase chain reaction (PCR), a ligase chain reaction (LCR), a Gap-LCR, The sequence of the amplification of the target polynucleotide sequences may be selected from the group consisting of repair chain reaction, transcription-mediated amplification (TMA), self sustained sequence replication, selective amplification of target polynucleotide sequences, PCR was performed using consensus primer polymerase chain reaction (CP-PCR), arbitrary primed polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA ), Strand displacement amplification, loop-mediated isothermal amplification (LAMP) (PCR), nested polymerase chain reaction (PCR), single-tube nested polymerase chain reaction (PCR), single-tube nested-PCR ), Reverse transcription polymerase chain reaction (RT-PCR), inverse polymerase chain reaction (RT-PCR) one or more methods selected from the group consisting of inverse PCR, real-time polymerase chain reaction (RT-PCR), and real-time quantitative polymerase chain reaction (RQ-PCR) Can be used. Preferably, it can be used in a method of RT-PCR (RT-PCR), but is not limited thereto.

For example, when RT-PCR is performed, cDNA strands are synthesized by reverse transcription using reverse transcriptase using the RNA isolated in step 1 as a template and the reverse primer of the primer pair of the present invention as a primer, A mixed solution may be used. The PCR reaction may be performed using a PCR reaction mixture containing various components known in the art necessary for the PCR reaction. In the PCR reaction mixture, a suitable amount of DNA polymerase, dNTP, PCR buffer solution and water are contained in addition to the cDNA synthesized by the reverse transcription reaction and the primer pair provided in the present invention. The PCR buffer solution may include Tris-HCl, MgCl ₂ , KCl, and the like. In this case, MgCl ₂ concentration greatly affects the specificity and yield of amplification. In general, when Mg ²⁺ is excessive, nonspecific PCR amplification product is increased, and when Mg ²⁺ is insufficient, the yield of PCR product is decreased . The PCR buffer solution may further contain an appropriate amount of Triton X-100 (Triton X-100). Also, PCR was performed by denaturing the template DNA at 94-95 ° C, followed by denaturation; Annealing; Followed by a cycle of amplification and extension followed by final elongation at 72 ° C. Modification and amplification may be performed at 94-95 ° C and 72 ° C, respectively, and the temperature at the time of binding may vary depending on the type of the primer, but is preferably 50-57 ° C, more preferably 55 ° C . The time and number of cycles in each step can be determined according to the conditions commonly practiced in the art.

In the above step 3, the DNA of the PCR product can be separated by size according to a method well known in the art. Preferably by agarose gel or polyacrylamide gel electrophoresis or an ABI prism 3100 genetic analyzer-electropherogram. At this time, in order to use the fluorescence analyzer, PCR is performed in the above two steps using a primer pair attached with a fluorescent dye known in the art.

The PCR amplification result can preferably be confirmed by agarose gel electrophoresis. After electrophoresis, electrophoresis results can be analyzed by ethidium bromide staining. Methods for performing general reverse transcription, PCR and analysis of the results are well known in the art.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these are only for the purpose of illustrating the present invention in more detail, but the scope of the present invention is not limited thereto.

[Example 1] Design and selection of BBWV2 diagnostic primer

The BBWV2 diagnostic primers were designed for two pairs of size 370 bp and 270 bp for the protease cofactor (Co-Pro) of RNA1 and large coat protein (LCP) of RNA2 (Table 2).

Name of the primer SEQ ID NO: location The sequence (5 '- > 3') Expected size BBWV2 1-1u One 19-40 AAACAAACAGCTTTCGTTCCG 370 bp BBWV2 1R 2 388-370 GCCATCTCATTGGCATGGA bbwv2 2-2nu 3 2177-2194 CCAGCATTCATGTTTCGC 270bp bbwv2 2-2nr 4 2446-2424 TAGGCTCCAGCAACATATGCAAT

As a result of RT-PCR, BBWV2 was selected as a specific primer for diagnosis of BBWV2 (Table 3).

lane Sample number Primer used One One BBWV2 1-1u BBWV2 1R 2 2 3 3 4 One bbwv2 2-2nu bbwv2 2-2nr 5 2 6 3

Among the designed BBWV2 primer sets shown in Table 3, a primer set for high specificity BBWV2 diagnosis was selected and the PCR results are shown in FIG.

[Example 2] Design and selection of PlAMV diagnostic primer

 PlAMV diagnostic primers designed three pairs of size 970 bp, 545 bp and 483 bp for RNA-dependent RNA polymerase (RdRp), triple gene block protein 3 (TGB3) and coat protein (CP) regions.

Name of the primer SEQ ID NO: location The sequence (5 '- > 3') Expected size PlMAV_up1 5 2343 AACGTCAACAGACATACACGG 970bp PlAMV_down1 6 992973 TGTAGAAGAACATCTGCATC PlMAV_up7 7 55545573 GCCTTCGTCACCCTCAGCGG 545bp PlAMV_down7 8 60986081 CACCAGACTTTCACTGGTT PlAMV_3race-F 9 56415660  CGGAAGTTYTGCCGCTTCTA 458bp PlAMV_down7 10 60986081  CACCAGACTTTCACTGGTT

RT-PCR was performed on PlAMV-infected samples and selected as a specific primer for PlAMV diagnosis (Table 5).

lane Sample number Primer used One One PlMAV_up1 PlAMV_down1 2 2 3 One PlMAV_up7 PlAMV_down7 4 2 5 One PlAMV_3race-F PlAMV_down7 6 2

Among the designed PlAMV primer sets shown in Table 5, a primer set for high specificity PlAMV diagnosis was selected, and the PCR results are shown in FIG.

[Example 3] Design and selection of ReMV diagnostic primer

 ReMV diagnostic primers were designed for two pairs of 611 bp and 343 bp sizes in the replicase (Rep) region (Table 6).

Name of the primer SEQ ID NO: location The sequence (5 '- > 3') Expected size ReMV-u1 11 1491-1513 AGTCTCGGGCCAAAAACTGTATG 611bp ReMV-d1 12 2101-2077 TCCAATGACTCAATTTCCTCGTTCC ReMV-u2 13 2747-2768 CGGAAAGGCTGCGCGCTGTCAG 343bp ReMV-d2 14 3089-3068 GATGGTCGCCGCACCACTCACC

RT-PCR was performed on samples infected alone with ReMV, and was selected as a specific primer for ReMV diagnosis (Table 7).

lane Sample number Primer used One One ReMV-u1 ReMV-d1 2 2 3 3 4 One ReMV-u2 ReMV-d2 5 2 6 3

Among the designed ReMV primer sets shown in Table 7, a primer set for high specificity ReMV diagnosis was selected, and the PCR result was shown in FIG.

[Example 4] Design and selection of a diagnostic primer for Tobamovirus subgroup (T-sg) 3

 Tobamovirus subgroup 3 diagnostic primers were designed for two pairs of 830 bp and 958 bp sizes in the replicase (Rep) region (Table 8).

Name of the primer SEQ ID NO: location The sequence (5 '- > 3') Expected size RMV 3F 15 1523-1540 AGTCTCTGCGATGCCCTG 830bp RMV 3R 16 2352-2337 GCATCTTCCGCAACWCCCC RMV 4F 17 2111-2130 ATGATGTCAGCGGTGTACAC 958 bp RMV 4R 18 3068-3045 CTAACGGTAAAGTTATYGGGTTT

 RT-PCR was performed on RMV-infected specimens, and both pairs were selected as specific primers for diagnosis of Tobamovirus subgroup 3 (Table 9).

lane Sample number Primer used One One RMV 3F RMV 3R 2 2 3 3 4 One RMV 4F RMV 4R 5 2 6 3

A primer set for T-sg3 diagnosis with high specificity was selected from the designed T-sg3 primer sets shown in Table 5, and PCR results are shown in Fig.

[Example 5] Development of multiplex diagnosis method for rhinovirus

We have developed a multiplex RT-PCR method that can simultaneously diagnose five viruses with one RT-PCR among the specific diagnostic primers designed for BBWV2, PlAMV, ReMV and T-sg3. Based on the results of the primary selection of BBWV2, PlAMV, ReMV and T-sg3 primers, candidate primers for multiple diagnosis were selected (Table 10).

virus Name of the primer SEQ ID NO: The sequence (5 '- > 3') location Expected size density BBWV2 bbwv2 2-2nu 3  CCAGCATTCATGTTTCGC 2177-2194 270bp 48 pmol bbwv2 2-2nr 4  TAGGCTCCAGCAACATATGCAAT 2446-2424 PlAMV PlAMV_3race-F 9  CGGAAGTTYTGCCGCTTCTA 56415660 458bp 48 pmol PlAMV_down7 10  CACCAGACTTTCACTGGTT 60986081 ReMV ReMV-u1 11 AGTCTCGGGCCAAAAACTGTATG 1491-1513 611bp 16 pmol ReMV-d1 12 TCCAATGACTCAATTTCCTCGTTCC 2101-2077 T-SG3 RMV 3F 15 AGTCTCTGCGATGCCCTG 1523-1540 830bp 32 pmol RMV 3R 16 GCATCTTCCGCAACWCCCC 2352-2337

The rhizosphere samples were obtained by crushing the diseased leaves with liquid nitrogen and then extracting whole genomes using a total RNA extraction kit (Intron Co.). The extracted genome was subjected to one-step RT-PCR with template (Fig. 6).

 One-step RT-PCR was performed by taking 1 μl of the extracted total RNA as a template, mixing the same amount of 3'-primer and 5'-primer at the concentrations shown in Table 10, and then adding 1 μl of each mixture , 10 μl of 2x RT-PCR reaction mixture (reverse transcriptase, Taq polymerase, dNTPs, buffer) and 7 μl of distilled water. The reverse transcription reaction was carried out at 50 ° C for 30 minutes and in an enzyme inactivation step at 94 ° C for 10 minutes. The PCR reaction was carried out for 20 seconds at 94 ° C for DNA denaturation, 30 seconds at 55 ° C for primer binding annealing, At 72 ° C for 1 minute] was repeated 35 times, and finally, DNA chain extension was carried out at 72 ° C for 10 minutes under PCR reaction conditions.

RT-PCR products were confirmed by 1.5% agarose gel electrophoresis at 100 mV for 1 hour, and a photograph of the result was shown in FIG. As a result, it was confirmed that each of the four pairs of primers selected in the above (lanes 1, 2, 3 and 4), two pairs of lanes 5, 6, 7, 8, 9 and 10, , 12, 13, 14) and all four (lane 15) combinations showed that the primer pairs of the present invention can simultaneously diagnose multiple influenza viruses effectively.

The nucleotide sequence of the RT-PCR product of the primers selected for the multiplex diagnosis was 96% to 99% homologous with the nucleotide sequence registered in NCBI (Table 11).

object
virus primer product
size The base sequence (5 '- > 3') comparison target
/ Homology BBWV2 bbwv2 2-2nu / bbwv2 2-2nr 270bp
TCCAGCATTCATTTTCGCAAAGAGCTGGGAACTCTAGCTTTCAAGCAgGGAGAGCGTGTTGCTTATTCTTTTGAGGTCAATTTTGGCAAGCCACAAACTGATGGAgAAGGAGGTGACCTCAACTTTCGCTTCTTCTTATTGTGGTCTCAGCCAATATATGCAATCGGATGTCATTTTAGACTTCACCCTTATGAGTAGTCCTATGATTGGTGGAATTTCTCGATTGCATATGTTGCTGGAGCCTTA X686590
/ 97% PlAMV PlAMV_3race-F
/ PlAMV_down7 458bp
CCGCTTCTACGCCAAGATCATCTGGAACGCCCGCCTGGCACGCAACCTTCCCCCAGCGGGCTTCGCCAGAGCCAACATCAAGTTCGAACACCGCTGGGCCGGCTTCGACTTCTTCGACGGCCTGCTCAACCCCGCCGCACTAGAGCCCCCGGGCGGCCTCTCGCGCACCCCCACCCCAGACGAGGTCGTCGCCAACGAGACCGCCCGCTCCCTCAACCTGTTCGAAGCAAGAGCCAACTCCTCCAACCTCGCCTCGACCTCGACCCAATTCACCCGCGGCCAGCTCTCCAACACAGCCCCACAAGTCCAGTTCCTGCCCGCCCCCTCCGACTAGTCCTGAACCGTGGAAGGACCATAAAATCCACGTATCGCCAAACTTAACCAGCCCTCAACCCGGTGTGTATTTTACCGTTTTCT Z21647 / 90% ReMV ReMV-u1
/ ReMV-d1 611bp
CAAAACTGTATGTCAACACATATGGGATGAGATCTCATTGGCTTTTGGCAACGCTTTCCCGTCGATTAAAGAAAGACTTTTGAACAAGAAACTGATCAAAGTGGCTGGCGACGCGTTAGAGATTAGGGTGCCTGACCTTTACGTAACTTTCCACGATAGATTGGTGACCGAGTACAAAGCCTCGGTGGATATGCCTGCACTTGACATAAGGAAAAGGATGGAAGAAACTGAAACGATGTACAACGCGCTTTCAGAGTTGTCGGTTCTAAAAGAGTCTGACAAATTCGATGTTGATGTTTTTTCCCAGATGTGCCAAAAATTGGAGGTAGACCCAATGACGGCTGCAAAGGTTATAGTGGCAGTGATGAGTAATGAGAGTGGTCTCACGCTCACGTTTGAACAACCAACAGAAGCTAACGTCGCTTTGGCCTTGCATGATTCAGAGAAGGCTTCAGAAGGTGCACTTGTGGTCACCTCTCGTGATGTAGAAGAGCCCTCCATGAAAGGTTCAATGGCAAGGGGTGAGTTACAATTAGCTGGTCTtACCGGAGACCATCCGGAGTCAACCTATACAAGGAACGAGGAA JX575184
/ 97% T-SG3 RMV 3F
/ RMV 3R 830bp
CCTGAAGGGGGTTATTCCCTCGGTCAAGGAGACACTTGCGCGCGGTGGTTTCGTTAAACTCGCTGAAGAGAGTTTGGAGATAAAAATTCCAGAGTTATACTGCACTTTTACCGATCGATTGGTACTTCAGTATAAGATGGCTGAAGAGTTTCAATCATGCGACCTGTCAAAACCTTTGGAAGAGTCTGAGAAATACTACAATGCGTTGTCTGAGCTATCAGTGCTCGAAAATCTTGACTCTTTTGATCTGGACGGCTTTAAAGAGTTGTGTCAAAAGAGGAACGTCGACCCTGATGTCGCTGCAAAGGTGGTGGTGGCGATTATGAATAATGAGTTAACGTTACCGTTCAAGAAACCAACGGAAGAGGAAGTTGCCGAGGCGCTTAGTGGAGAAGTGGTGCAGAATGAGGTTTTGAGTTTAAGCAACAACGCACCCTTCCCTTGTGTGAACAATCTAACGGAAGGTTTGGTTCCAGCATGTGGAGTGTGTCCGACAGGTGTTAACTTCGACAGAGTAGATATGGACATATCCGAGTTCCATCTCAAGAGTGTAGATGCAGTAAAGAAAGGGGCTATGATGTCAGCGGTGTATACGGGAAAGATCAAGGTTCAGCAAATGAAGAACTACGTCGATTACCTAAGTGCGTCACTGTCAGCTACAGTCTCAAACCTCTGCAAAGTGCTCAGGGATGTTCATGGTGTTGACCCTGAATCTCAAGAGAAGTCTGGTGTGTGGGATGTGAGAAGAGGACGCTGGTTGTTAAAACCTAACGCAAAATGTCACGCTTGGGG AB812747
/ 91%

As a result, RT-PCR was carried out using the primer set of the above combination. As a result, the primer set was suitable for multiple diagnosis due to low interference between primers. The primer set was excellent in sensitivity to viruses, Respectively.

While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, Should be interpreted as belonging to the scope.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primers for multiple detection of the virus in Rehmannia          glutinosa and detection method by using the same <130> P17-233 <160> 18 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect BBWV2 <400> 1 aaacaaacag ctttcgttcc g 21 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect BBWV2 <400> 2 gccatctcat tggcatgga 19 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect BBWV2 <400> 3 ccagcattca tgtttcgc 18 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect BBWV2 <400> 4 taggctccag caacatatgc aat 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect PlMAV <400> 5 aacgtcaaca gacatacacg g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect PlMAV <400> 6 tgtagaagaa catctgcatc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect PlMAV <400> 7 gccttcgtca ccctcagcgg 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect PlMAV <400> 8 caccagactt tcactggtt 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect PlMAV <400> 9 cggaagttyt gccgcttcta 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect PlMAV <400> 10 caccagactt tcactggtt 19 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect ReMV <400> 11 agtctcgggc caaaaactgt atg 23 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect ReMV <400> 12 tccaatgact caatttcctc gttcc 25 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect ReMV <400> 13 cggaaaggct gcgcgctgtc ag 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect ReMV <400> 14 gatggtcgcc gcaccactca cc 22 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect RMV <400> 15 agtctctgcg atgccctg 18 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect RMV <400> 16 gcatcttccg caacwcccc 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect RMV <400> 17 atgatgtcag cggtgtacac 20 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primers to detect RMV <400> 18 ctaacggtaa agttatyggg ttt 23

Claims (7)

A primer set for the diagnosis of influenza virus comprising at least one primer pair selected from the group consisting of the following a) to h);
a) a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4;
b) a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6;
c) a pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8;
d) a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10;
e) a pair of primers represented by SEQ ID NO: 11 and SEQ ID NO: 12;
f) a pair of primers represented by SEQ ID NO: 13 and SEQ ID NO: 14;
g) a pair of primers represented by SEQ ID NO: 15 and SEQ ID NO: 16; And
h) a pair of primers represented by SEQ ID NO: 17 and SEQ ID NO: 18; A group of primers set forth in any one of the following groups A) to D) to simultaneously diagnose two or more types of influenza virus;
A group) a pair of primers represented by SEQ ID NO: 1 and SEQ ID NO: 2, or a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4;
B group) a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6, a pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8, or a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10;
C group) a pair of primers represented by SEQ ID NO: 11 and SEQ ID NO: 12, or a pair of primers represented by SEQ ID NO: 13 and SEQ ID NO: 14; And
D group) A pair of primers represented by SEQ ID NO: 15 and SEQ ID NO: 16, or a pair of primers represented by SEQ ID NO: 17 and SEQ ID NO: 18. The primer set according to claim 2, wherein the primer set comprises a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, a primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair represented by SEQ ID NO: 11 and SEQ ID NO: 12, And a primer pair represented by SEQ ID NO: 15 and SEQ ID NO: 16. A composition for the diagnosis of influenza virus comprising a primer set according to any one of claims 1 to 3. A kit for the diagnosis of influenza virus comprising a primer set according to any one of claims 1 to 3 and a reagent for carrying out an amplification reaction. Obtaining DNA or RNA from the sample, amplifying the DNA or RNA obtained using the primer set according to any one of claims 1 to 3, and analyzing the obtained product to determine whether the virus is infected or not And determining whether the virus is infectious. 7. The method according to claim 6, wherein the influenza virus is selected from the group consisting of the viruses of Vigorous Fowl Virus 2 (BBWV2), Plantain Mosaic Fetex Virus (PlAMV), Rhizopus Mosaic Virus (ReMV), and Tovomovirus Subgroup 3 (T-sg3) Wherein the method comprises the steps of:

Images