KR20190051510A - Method for Diagnosing Alzheimer's disease Using microRNA-485-3p - Google Patents

Abstract

The present invention relates to a method for providing information for the diagnosis of Alzheimer′s disease or a brain disease using miR-485-3p and to a composition and a kit for the diagnosis of Alzheimer′s disease or a brain disease. The present invention enables an objective data analysis of the diagnosis of Alzheimer′s disease or a brain disease by measuring the expression level of miR-485-3p in blood, minimizes risks to a patient by measuring the concentration of amyloid beta 42 in saliva, and enables a quick and accurate diagnosis. Accordingly, the present invention is very useful for the prevention of Alzheimer′s disease or a brain disease.

Description

(Method for Diagnosing Alzheimer's Disease Using microRNA-485-3p Using miR-485-3p)

The present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease using miR-485-3p, and more particularly, to a method for diagnosing Alzheimer's disease or brain disease using miR-485-3p comprising the step of measuring the expression level of microRNA miR- And a method for providing information for diagnosing Alzheimer's disease or brain disease. Further, the present invention relates to compositions and diagnostic kits for diagnosing Alzheimer's disease or brain disease using miR-485-3p or amyloid beta-42.

The current treatment strategy for Alzheimer's disease is centered on the possibility that Alzheimer's disease is caused by cholinergic signaling and transmission, which is impaired in the cerebral cortex and the hippocampus (Bartus et al. , Science 217 (4558): 408-14 (1982) and Coyle et al., Science 219 (4589): 1184-90 (1983)).

Because these areas of the brain are linked to memory and intelligence, functional defects in these parts of the brain impair memory and judgment and cause intellectual loss. Although the exact process of damage to neuronal signaling is controversial, senile plaques and neurofibrillary tangles (NFTs) are considered to be pathologically predominant.

In particular, senile plaques due to accumulation of amyloid beta (Aβ) are the most important features of this disease, and Alzheimer's disease can be confirmed by post-mortem examination (Khachaturian, Arch. Neurol. 42 (11): 1097-105 (1985)).

In the case of Alzheimer's disease, drugs and therapies for increasing the amount of acetylcholine to suppress the damage of cholinergic neurotransmission, allowing acetylcholine to be present for a long period of time, or allowing acetylcholine to act more effectively on nerve cell delivery Various compounds have been used to increase acetylcholine activity in Alzheimer's patients.

Currently, the most effective approach is to inhibit the activity of acetylcholinesterase, which rapidly cleaves acetylcholine in the synapse and blocks neuronal signaling. In fact, these inhibitors (eg, tacrine, donepezil, galantamine, and rivastigmine) are currently marketed in the market as FDA-approved treatments for Alzheimer's disease, but in many cases these drugs are effective in relieving disease progression, have.

In addition, certain compounds are aimed at improving the normal state of health of the nervous system so that the cells function normally as they age. For example, some drugs, such as NGF and estrogen, act as neuroprotective agents that slow down neuronal degeneration and other drugs, such as antioxidants, reduce the oxidation of cells to reduce the increase in damage to harmful cells that results from normal aging .

If the accumulation of amyloid beta peptides accumulates, the Alzheimer's disease becomes serious. Lowering the accumulation of amyloid beta in the neuritic space is thought to slow the progression of Alzheimer's disease. It is also believed that the amyloid precursor protein (APP) proceeds in many different forms in combination with intracellular proteolytic enzymes such as?,?, And? -Secretases. However, it is not yet possible to regulate the formation of amyloid beta, since the process of formation of amyloid beta has not been scientifically fully understood.

The process of accumulation of amyloid beta in abnormal neuronal signal transmission is not clear, and when APP is abnormally cleaved to produce amyloid beta, accumulation in neuritic space causes plaque formation. Thus, many other factors involved in this cleavage reaction, such as inflammatory responses, increase phosphorylation of tau proteins and increase the accumulation of paired helical filaments (PHFs) Lt; / RTI > All of these factors lead to nerve dysfunction and ultimately accelerate the progression of Alzheimer's disease to dementia.

Although the development of treatment modalities to reduce the effects of Alzheimer's disease is actively underway, it is now providing temporary symptomatic improvement. In conclusion, current Alzheimer's disease treatment focuses not on reversing disease progression but on improving symptoms of disease and more on the biological knowledge of the disease, but the clinical application has not yet been successful. not.

In this regard, U.S. Patent No. 5,532,219 discloses a composition for treating Alzheimer's disease comprising 4,4'-diaminodiphenylsulfone and the like, and U.S. Patent No. 5,506,097 discloses a composition for treating Alzheimer's disease comprising para-amidinophenylmethane sulfonyl fluoride Discloses a composition for treating Alzheimer's disease comprising lid or ravelectone A, and US Patent No. 6,136,861 discloses a composition for treating Alzheimer's disease comprising bicyclo [2.2.1] heptane.

ELAVL2 is an ELAVL-like neuron-specific RNA binding protein 2, a form of nELAVL2. nELAVL2 is a brain-specific RNA binding protien that is known to be involved in neurodegenerative disease. It is known that ELAVL2 is low expressed by high-throughput RNA sequence using brain tissue after post-mortem examination of patients with Alzheimer's disease.

Alzheimer's disease is the most common form of dementia, with 75% of Alzheimer's patients with dementia. In most cases, Alzheimer's disease is more than 65 years of age, but it can rarely occur before that. In the United States, about 3% of the population aged 65 to 74, about 19% of the population aged 75 to 84, and 50% of the population aged 85 or older suffer from the disease. In Korea, a recent research report focusing on rural areas shows that about 21% of people aged 60 or older in rural areas have dementia, and 63% of them are Alzheimer-type dementia. In 2006, there were 266,000 people worldwide. In 2050, one out of every 85 people is expected to develop.

Alzheimer's dementia has no cure, and diagnosis is the only way to relieve symptoms. In addition, there is no early diagnosis system. The existing diagnosis is proceeding in various ways, but there are many disadvantages. There is a possibility that there is an error due to cognitive difference, a structural brain image is expensive, a nuclear medicine brain image has a disadvantage of using a radioisotope and a high cost. Tau protein measurement by cerebrospinal fluid analysis is invasive and there is a risk of cerebrospinal fluid extraction.

Accordingly, the present inventors have tried to select a marker capable of diagnosing brain diseases such as Alzheimer's disease and develop a more accurate diagnostic method. As a result, they have found that the expression amount of miR-485-3p extracted from blood increases, .

The information described in the Background section is intended only to improve the understanding of the background of the present invention and thus does not include information forming a prior art already known to those skilled in the art .

It is an object of the present invention to provide a method for providing information for early diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p. It is also an object of the present invention to provide a diagnostic method for Alzheimer's disease or brain disease, a diagnostic composition and a diagnostic kit.

In order to achieve the above object, the present invention provides a method for providing information and a diagnostic method for diagnosing Alzheimer's disease or brain disease, which comprises measuring the expression level of miR-485-3p from the collected sample.

The present invention also provides a composition for diagnosing brain diseases such as Alzheimer's disease and a diagnostic kit for measuring the expression level of miR-485-3p or the concentration of amyloid beta 42.

According to the present invention, it is possible to perform objective data analysis for diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p in the blood, and furthermore, by measuring the concentration of amyloid beta 42 in saliva, Minimized, and fast and accurate diagnosis is possible. Therefore, according to the present invention, early diagnosis of Alzheimer's disease or brain disease is very useful for prevention of Alzheimer's disease or brain disease.

FIG. 1 (A) is a graph showing the results of miRNA expression pattern analysis (volcano blot) in the patient group versus the normal group, and (B) is a graph comparing the expression of miR-485-3p in the patient group versus the normal group.
Figure 2 shows the 3'-untranslated region (UTR) mRNA of 5xFAD and the Seed sequence of miR-485-3p.
FIG. 3 (A) is a graph comparing the expression of miR-485-3p in hippocampus and cortex, and (B) and (C) are results of ELAVL2 expression and related protein expression in hippocampus and cerebral cortex of 5xFAD.
Fig. 4 (A) is a graph showing a quantitative comparative analysis of Aβ 42 in the cerebral cortex of 5 × FAD, and Fig. 4 (B) is a graph showing a quantitative comparative analysis of Aβ 42 in the hippocampus.
5 is a schematic diagram of a magnetic particle collecting apparatus. Antigens, antibodies, magnetic particles, and fluorescent materials form complexes.
Fig. 6 shows the results of saliva-derived Aβ quantification using a magnetic particle collection device.
FIG. 7 shows that a dementia patient can be distinguished by measuring saliva-derived Aβ concentration using a magnetic particle collection device.
8 is a schematic diagram of a nucleic acid level measurement process for expressing amyloid beta (A [beta]).
FIG. 9 shows the results of ELAVL2 expression according to AM485-3p transfection in Hippocampal primary cells.
Figure 10 shows the results of ELAVL2-containing proteins and A [beta] 42 quantitative analysis in 5xFAD in which AM485-3p was intranasally treated.
FIG. 11 is a graph comparing the cognitive function in 5xFAD in which AM485-3p was intranasally treated. FIG.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In a specific example of the present invention, it was confirmed that the expression of miR-485-3p significantly increased in the blood obtained from a doctor who was diagnosed with Alzheimer's dementia.

Accordingly, the present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease, comprising the step of measuring the expression level of miR-485-3p from a sample collected from one aspect. Further, the present invention relates to a method for diagnosing Alzheimer's disease or brain disease comprising the step of measuring the expression level of miR-485-3p from the sample collected.

The present invention can be characterized in that it comprises the step of extracting microRNA miR-485-3p from a sample. The sample may be blood or plasma, but is not limited thereto.

In one embodiment of the present invention, from a physician's diagnosis of Alzheimer ' s dementia, Sod. Approximately 3 ml of blood was collected in a blood tube supplemented with citrate (3.2% w / v) (Becton Dickinson, Germany). Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80 ° C until RNA extraction. MiRNA was extracted using the miRNeasy Serum / Plasma Kit (Qiagen, USA) according to manufacturer's recommendations. miRNA extraction is performed in the following order. Plasma or serum samples are dissolved in QIAzol Lysis Reagent, chloroform is added, and the lysate is separated into aqueous and organic phases by centrifugation. The RNA portion is divided into the upper aqueous phase, the DNA portion into the intermediate layer, and the protein into the intermediate layer or the lower organic phase. The upper aqueous phase is extracted and ethanol is added to provide the appropriate conditions to bind RNA molecules above about 18 nucleotides. Apply the sample to the RNeasy MinElute spin column to bind all the RNA to the membrane and wash away phenol and other contaminants efficiently. High quality RNA is eluted from small amounts of RNase-free water. Since serum and plasma mainly contain small RNAs, it is not necessary to separately purify small RNAs and large RNA fractions.

The present invention includes a step of measuring the expression level of microRNA miR-485-3p.

In the present invention, the expression level of miR-485-3p is selected from the group consisting of rea-time PCR, quantitative PCR primer extension analysis, nucleic acid chip analysis, sequencing, aptamer-based assay and gel chromatography by electrophoresis , But the present invention is not limited thereto.

In one embodiment of the present invention, the concentration and purity of the extracted RNA was analyzed using a Bioanalyzer 2100 (Agilent, USA). The extracted RNA was screened using a miRNA array containing 84 different miRNAs known to be involved in the progression of Human Neurological Development and Neurological Disease.

The quantitative PCR assay method can be summarized as follows. Mature miRNAs are generally 22 nt, noncoding RNAs and are responsible for post-transcriptional regulation. Mature miRNAs were polyadenylated by poly (A) polymerase and synthesized as oligo-dT primers. The oligo-dT primers have a 3 'degenerate anchor and a universal tag sequence at the 5' end, allowing real-time PCR amplification of mature miRNAs. miRNA SYBR Green PCR Kit (Qiagen) was used to quantify mature miRNAs in real-time PCR.

In the present invention, when the expression level of miR-485-3p is 5 times, more specifically 9 times or more as compared with the normal group, it is characterized as diagnosing that it has Alzheimer's disease or brain disease. The normal group was selected from those aged 59 to 64 who had no history of Alzheimer's disease or brain disease.

In the present invention, the brain disease may be any one selected from the group consisting of autistic spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, but is not limited thereto.

The information providing method and the diagnostic method according to the present invention can further use the non-marker clinical information of the test subject for seizure disease when the expression level of the marker is diagnosed or the prognosis of Alzheimer's disease and / . The non-marker clinical information of the test object includes the age, sex, weight, dietary habit, body mass, baseline disease and EEG, seizure type, brain MRI, brain CT, brain spinal fluid test, blood test, saliva test , But is not limited thereto.

In the present invention, the method for providing information for diagnosing Alzheimer's disease or brain disease may further include the step of measuring the concentration of amyloid beta 42 (A? 42) from the collected sample.

The sample may be saliva or blood but is not limited thereto. Using saliva as a sample minimizes the risk to the patient and enables quick and accurate diagnosis.

The concentration of the amyloid beta 42 may be measured using an antigen-antibody reaction or a nucleic acid aptamer, but the present invention is not limited thereto. The antigen-antibody reaction may be well-known in the art including ELISA (enzyme-linked immunosorbent assay). When the concentration of amyloid beta 42 is measured from the sampled saliva, it is preferably, but not limited to, Korean Patent Publication 10-2014-0025978 or Korean Patent Publication 10-2013-0140528.

In the present invention, the term " aptamer " refers to a nucleic acid having a specific binding affinity for a target molecule. In the present invention, particularly, the target molecule is amyloid beta 42.

The specific binding affinity of the aptamer to the target means that the aptamer binds to its target with a generally higher degree of affinity than binding to other components in the sample. An aptamer is a set of one or more such molecules. Different aptamers can have the same or different numbers of nucleotides. An aptamer may be DNA or RNA or chemically modified nucleic acid, and may comprise a single strand, double stranded or double stranded region and may comprise a highly ordered structure. An aptamer may also be a photoaptamer, as long as it is contained in an aptamer such that a photoreactive or chemically reactive functional group can be covalently bound to its corresponding target. Any of the aptamer methods described herein can involve the use of two or more aptamers that specifically bind to the same target molecule.

The aptamers can be identified using any known method, including SELEX. Once identified, the aptamers can be made or synthesized according to any known method, including chemical synthesis methods and enzyme synthesis methods.

The terms " SELEX " and " SELEX process " are intended to encompass (1) screening for aptamers interacting with the target molecule in a preferred manner, e.g. binding with high affinity to the protein, and (2) Are used interchangeably herein to generally refer to a combination of amplifications. The SELEX process can be used to identify aptamers having high affinity for a particular target or biomarker. SELEX generally produces a candidate substance mixture of nucleic acids, binds the candidate substance mixture to the desired target molecule to form an affinity complex, separates the affinity complex from the unbound candidate substance nucleic acid, and separates the affinity complex from the affinity complex Isolating and isolating the nucleic acid, purifying the nucleic acid, and amplifying the specific aptamer sequence. The process may include multiple rounds to further improve the affinity of the selected aptamer. The process may include an amplification step at one or more points in the process (e. G., US 5,475,096: Nucleic Acid ligands). The SELEX process can be used to generate an aptamer that binds covalently to its target as well as an aptamer that binds non-covalently to its target (see, for example, US 5,705,337: Systematic Evolution of Nucleic Acid Ligands Exponential Enrichment: Chemi-SELEX). The SELEX process can be used to identify high affinity aptamers containing altered nucleotides that confer improved properties on the aptamer, such as, for example, improving in vivo stability or improving transport properties. have. Examples of such modifications include chemical substitutions at the ribose and / or phosphate and / or base positions. The aptamers identified in the SELEX process are described in U.S. Patent No. 5,660,985 (" High Affinity Nucleic Acid Ligands Containing Modified Nucleotides "), which describes oligonucleotides containing nucleotide derivatives chemically modified at the 5'- and 2'- Lt; / RTI > Reference is made to US 5,580,737, which is incorporated herein by reference in its entirety, to US 5,580,737, which is incorporated herein by reference in its entirety, to one or more of 2'-amino Lt; RTI ID = 0.0 > nucleotides. ≪ / RTI > Also, reference can be made to US 2009/0098549 (SELEX and PHOTOSELEX) which describes nucleic acid libraries with extended physical and chemical properties in SELEX and PHOTOSELEX and their uses. SELEX can also be used to identify an aptamer with desirable off-rate characteristics. See US 2009/0004667 (Method for Generating Aptamers with Improved Off-Rates) which describes an improved SELEX method for generating an aptamer capable of binding to a target molecule.

The aptamer is immobilized on a solid support prior to contact with the sample. However, under certain circumstances, immobilization of the aptamer before contacting the sample may not provide optimal assay. For example, pre-immobilization of an aptamer may lead to inefficient mixing of a target molecule and an aptamer on a solid support surface over a long reaction time, so that aptamers for its target molecule Long incubation periods are required for efficient binding. In addition, when optical aptamers are used in assays and depend on the material used as a solid support, the solid support tends to scatter or absorb light used to effect the formation of a covalent bond between the optical APAM and its target molecule . Moreover, depending on the method used, the detection of a target molecule bound to its aptamer affects imprecision, since the surface of the solid support can also be exposed to and influenced by any labeling reagent. It is easy to receive. Finally, immobilization of the aptamer on the solid support generally involves an aptamer-making step (i. E., Immobilization) prior to exposure of the aptamer to the sample, which step affects the activity or functionality of the aptamer I can go crazy.

The aptamer can be configured to facilitate separation of the assay components from the aptamer biomarker complex (or the photo-appaer biomarker covalent complex) and to isolate the aptamer for detection and / or quantification. In one embodiment, the structure may comprise a cleavable, releasable component within the aptamer sequence. In other implementations, additional functionality, such as a labeled or detectable component, a spacer component, or a specific binding tag or immobilization component, may be introduced into the aptamer. For example, the aptamer may include a cleavable moiety, a label, a spacer component separating the label, and a tag coupled to the aptamer through a releasable portion.

Such nucleic acid aptamers include, but are not limited to, DNA, RNA, anti-miR, antisense molecules, firefly RNA molecules (siRNA), small hairpin RNA molecules (shRNA), 2'-O-modified oligonucleotides , A phosphorothioate-backbone deoxyribonucleotide, a phosphorothioate-backbone ribonucleotide, a decoy oligonucleotide, a PNA (peptide nucleic acid) oligonucleotide, or a LNA (locked nucleic acid) oligonucleotide .

In one embodiment of the present invention, a structural feature that a quencher decreases when binding with amyloid beta 42 and a fluorescence is expressed using a sequence that specifically binds to amyloid beta 42 and a sequence that self-bonds in the nucleic acid is used Were synthesized. Since the size of the multi-nucleic acid is smaller than that of the antibody, it has excellent specificity and selectivity and can be sampled and mass-analyzed within 1 hour, so that it is possible to provide a diagnostic method with high diagnostic ease.

In the present invention, when the concentration of the amyloid beta 42 is less than 500 pg / ml, it is diagnosed as a severe case when the concentration is less than 500 pg / ml and less than 1 ng / ml, or when the concentration is more than 1 ng / can do.

In one embodiment of the present invention, amyloid beta 42 was quantitated in more than 100 demented patients through a previous study to achieve success in distinguishing between mild cognitive impairment and moderate dementia (more than 90% of clinician diagnoses).

In one embodiment of the present invention, it was determined that the increase pattern of miR-485-3p significantly affects the expression amount of APP known as amyloid beta precursor.

In another aspect, the present invention relates to a composition for diagnosing Alzheimer's disease or brain disease comprising a primer capable of amplifying miR-485-3p or a probe capable of hybridizing with miR-485-3p.

In the present invention, the primers are made to be substantially complementary to each strand of miR-485-3p to be amplified, and include appropriate G or C nucleotides. This means that the primer has sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions of performing the polymerization reaction. The primers of the present invention are used in an amplification process, wherein the amplification process is an enzymatic sequencing reaction in which the target locus increases in exponential numbers through many reaction steps, such as, for example, PCR. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus and the other one (sense primer) has homology to the positive (+) strand. Once the primer is annealed to the denatured nucleic acid, the chain is extended by enzymes and reagents such as DNA polymerase I (Klenow) and nucleotides, resulting in a new synthesis of the + and - strands containing the target locus sequence. When the newly synthesized target locus is also used as a template and the cycles of denaturation, primer annealing, and chain extension are repeated, exponential synthesis of the target locus sequence proceeds. The product of the continuous reaction is an independent double-stranded nucleic acid having a terminal end corresponding to the specific primer used in the reaction.

The amplification reaction is preferably a PCR commonly used in the art. However, alternative methods such as real-time PCR or linear amplification using isothermal enzymes can be used and multiplex amplification reactions can also be used.

In the present invention, the probe is detectably labeled and may be labeled with, for example, a radioactive isotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate, or an enzyme. It is well known in the art to appropriately label such a probe, and can be carried out by a conventional method. The probe can use a probe that specifically binds to a known nucleic acid biomarker for disease diagnosis. Through the binding with the probe, the presence or absence of the specific biomarker or fragment thereof can be checked to diagnose the disease.

In the present invention, the sequence of miR-485-3p may be characterized in that it is derived from a mammal, for example, a human, a mouse, or a rat.

In one embodiment of the invention, the sequence of miR-485-3p is human-derived and has the sequence of the 5'-ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUUUUU-3 '(SEQ ID NO: 1) as well as the matured sequence (5'GUCAUACACGGCUCUCCUCUCUC 3' Number 2)).

Accordingly, in the present invention, the primer or probe may be characterized in that it comprises a sequence complementary to all or a part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.

In the present invention, the composition for diagnosing Alzheimer's disease or brain disease may further comprise an antibody or a nucleic acid aptamer that specifically binds to amyloid beta 42. The antibody or nucleic acid aptamer is for detecting amyloid beta 42 and may be used in any form for the detection of amyloid beta 42 from a sample.

In another aspect, the present invention relates to a kit for diagnosing Alzheimer's disease or brain disease comprising the composition for diagnosing Alzheimer's disease or brain disease.

The diagnostic kit of the present invention can be used for diagnosis of Alzheimer's disease and various diseases of brain diseases, and most preferably for diagnosis of Alzheimer's disease.

The kit of the present invention may further include other components in addition to the above components. For example, when the kit of the present invention is applied to the PCR amplification process, it may optionally include reagents necessary for PCR amplification, such as buffers, DNA polymerase, DNA polymerase cofactor and dNTPs, It is not. The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

In addition, the kit according to the present invention may be a microarray, preferably a gene amplification kit. When the kit is a microarray, a probe is immobilized on the solid-phase surface of the microarray. When the kit of the present invention is a gene amplification kit, it includes a primer. The probe or primer specifically recognizes miR-485-3p according to the present invention and has a sequence complementary to the above sequence. The term " complementary " as used herein means having complementarity to selectively hybridize to the nucleotide sequence under certain hybridization or annealing conditions, as defined above, and the probe or primer of the present invention may be completely May have one or more mismatch nucleotide sequences, so long as it is capable of selectively hybridizing to the nucleotide sequence other than complementary. The nucleotide sequence of the miRNA of the present invention to be referred to in the preparation of the primer or probe can be confirmed by miRBase, and the primer or the probe can be designed by referring to this sequence.

The composition comprising a substance capable of inhibiting the activity of miR-485-3p according to the present invention and a pharmaceutically acceptable carrier can be provided as a pharmaceutical composition for preventing or treating Alzheimer's disease or brain disease.

Based on the finding that the decrease in expression of ELAVL2 by miR-485-3p of the present invention is associated with Alzheimer ' s disease, the present invention includes a pharmaceutical composition comprising a substance capable of inhibiting the activity of miR-485-3p and a pharmaceutically acceptable carrier , And a pharmaceutical composition for treating or preventing Alzheimer's disease.

Herein, the term " miR " refers to a noncoding RNA having 21 to 23 deoxyribonucleotides, which is known as a regulatory factor mainly involved in transcription after gene expression by suppressing translation of target RNA and promoting degradation.

In addition, the maturation sequence of the miR can be obtained from the miR database (http://www.mirbase.org). As of August 2012, 25,141 mature miRs from 193 species are registered according to the miR database (19th edition, miRBase).

In the present invention, miR-485-3p is expressed in the brain, particularly in the hippocampus and cortex, but not limited thereto, binds to the 3 ' untranslated region of ELAVL2 mRNA encoding the ELAVL2 protein, Reduce the concentration of ELAVL2 protein in the brain.

In the present invention, inhibition of the activity of miR-485-3p means inhibiting or interfering with the intracellular action or function of miR-485-3p. Typically miR-485-3p is a target thereof, for example ELAVL2 protein Or directly inhibit the function of miR-485-3p by using a small molecule inhibitor, antibody, or fragment of an antibody, or inhibit an inhibitor or small interfering RNA (siRNA) molecule And the like.

Furthermore, the inhibition or inhibition of the activity of miR-485-3p involves directly or indirectly inhibiting the activity of the full-length sequence (SEQ ID NO: 2) and the maturation sequence (SEQ ID NO: 1). Inhibition of the activity of miR-485-3p also includes inhibiting the transcription of miR-485-3p and lowering its intracellular concentration.

The substance capable of inhibiting the activity of miR-485-3p includes any substance capable of inhibiting its expression and / or activity, and examples thereof include compounds (low molecular weight, high molecular weight), antigomere, antisense An antibody that recognizes a molecule, a small hairpin RNA molecule (shRNA), a fire defense RNA molecule (siRNA), a seed target LNA (oligonucleotide), a decoy oligonucleotide, an aptamer, a ribozyme, or a DNA: RNA hybrid can do.

The antisense oligonucleotides encompass nucleic acid-based molecules that have a sequence complementary to all or part of the seed sequence of the targeted miRNA, in particular the miRNA, and are capable of forming a duplex with the miRNA. Thus, the antisense oligonucleotides may be represented as complementary nucleic acid-based inhibitors.

In addition, the antisense oligonucleotides include various molecules such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomir, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, Phosphorothioate-backbone ribonucleotide, PNA (peptide nucleic acid) oligonucleotide or LNA (locked nucleic acid) oligonucleotide, preferably ribonucleic acid.

The ribonucleic acid includes double-stranded small hairpin RNA molecules (shRNA), fire-resistant RNA molecules (siRNA), and ribozymes.

The LNA has a locked form between the 2 'to 4' carbon of the ribose sugar site as compared to the conventional oligonucleotide, thereby securing thermal stability.

The PNAs (peptide nucleic acids) include a peptide-based backbone instead of a sugar-phosphate backbone. The 2'-O-modified oligonucleotides are preferably 2'-O-alkyl oligonucleotides, more preferably 2'-O-C1-3 alkyl oligonucleotides, and most preferably 2'- It is a nucleotide.

The antisense oligonucleotides include antisense oligonucleotides, antigomes and inhibitory RNA molecules in the narrow sense.

The antigomere is a single-strand chemically modified oligonucleotide that is used for silencing of endogenous microRNAs. Antagomir contains a sequence that is not complementary at the Arganoute 2 (Ago 2) cleavage site, or that the base is cleaved to inhibit Ago2 cleavage, for example, a 2 'methoxy group, a 3' cholesterol group, And has a complementary sequence to the target sequence.

In the present invention, the antigomere has a sequence at least partially or completely complementary to miR-485-3p. In an embodiment of the invention, the antigomere comprises one or more modifications (e. G., 2'-O-methyl-sugar modifications, or 3'cholesterol modifications). In another embodiment, the antigomere comprises at least one phosphorothioate linkage and at least partially has a phosphorothioate backbone.

In the present invention, the length of an antigomere suitable for suppressing the expression of miR-485-3p is 7-50 nucleotides, particularly 10-40 nucleotides, particularly 15-30 nucleotides, more particularly 15-25 nucleotides, particularly 16 To 19 nt, but is not limited thereto.

The term " complementary " as used herein, means that the antisense oligonucleotide is sufficiently complementary to hybridize selectively to the miR-485-3p target under a given hybridization or annealing condition, preferably physiological conditions, Is meant to encompass both partially partially substantially complementary and perfectly complementary, and preferably means completely complementary. Substantially complementary is meant to be complementary to a target sequence which, although not entirely complementary, is sufficient to effect the invention, i. E., To interfere with the activity of miR-485-3p.

The "nucleic acid" includes oligonucleotides, DNA, RNA, and polynucleotides, analogues and derivatives thereof, such as peptide nucleic acid (PNA) or a mixture thereof. In addition, the nucleic acid can be single or double stranded and can encode molecules including mRNA, microRNA, siRNA or polypeptides, and the like.

In an embodiment of the present invention, a substance capable of inhibiting the activity of miR-485-3p may complementarily bind to all or part of the precursor and / or mature sequence of miR-485-3p, particularly the seed sequence, Lt; RTI ID = 0.0 > oligonucleotides < / RTI > Inhibition of this activity inhibits the transcription of miR-485-3p and / or the binding of miR-485-3p to the target mRNA. The antisense oligonucleotides according to the present invention may or may not include one or more of the following modifications in the backbone (skeleton) connecting the nucleotides or nucleotides constituting the antisense oligonucleotides. That is, the antisense oligonucleotides may comprise one or more nucleotides constituting the LNA, or the sugar of one or more nucleotides constituting it, may comprise 2'-O-methylated and methoxyl ethyl, or one or more phosphorothioates in its backbone have.

In an embodiment of the invention, the antisense oligonucleotide or nucleic acid molecule comprises a sequence complementary to all or part of the seed sequence of miR-485-3p. The seed sequence is a conserved sequence that is conserved in a variety of species that are critical for the recognition of the target molecule of the miRNA (Krenz, M. et al., J. Am. Coll Cardiol. 44: 2390-2397 (2004); H. Kiriazis, et al., Annu. Rev. Physiol. 62: 321 (2000)). Since miRNA binds to the target through the seed sequence, it can effectively suppress the translation of the target mRNA when the interaction of the seed sequence with the target is inhibited.

In an embodiment of the present invention, the nucleotide sequence is completely or partially complementary to the first or second to seventh or eighth nucleotide sequence of the nucleotide sequence of SEQ ID NO: 1, for example, the antisense oligonucleotide of the present invention UGUAUGAC-3 '(SEQ ID NO: 3), 5'-UGUAUGAC-3' (SEQ ID NO: 4), 5'-GUGUAUGA- ) Or 5'-AGAGAGGAGAGCCGUGUAUGAC-3 '(SEQ ID NO: 7), wherein each of the one or more nucleotides constituting the oligonucleotide is 2'-O-methylated or methoxylated, or each of the one or more nucleotides is LNA Or at least one of the chemical bonds constituting the backbone may be a phosphatite, but may not include the modifications.

The present invention is based on the discovery that miR-485-3p excessively suppresses the expression of ELAVL2 and is involved in the pathogenesis of Alzheimer's disease and various brain diseases.

Reduced ELAVL2 expression is known to be associated with Alzheimer's disease, autism spectrum disorder, mental retardation, and the development of amyotrophic lateral sclerosis. In particular, ELAVL2 protein levels decrease in substances such as kainic acid, NMDA, quisulate, AMPA, and glutamate, which cause excitotoxicity, and cause neuronal cell death resulting in impaired brain function, resulting in seizures, strokes, Parkinson's disease, (Kaminska, B. et al., Acta Biochim Pol. 44: 781-789).

Therefore, the recovery of ELAVL2 protein through inhibition of miR-485-3p activity of the present invention is inhibited by various brain such as Alzheimer's disease and / or autistic spectrum disorder, mental retardation, amyotrophic lateral sclerosis, seizure, stroke, Parkinson's disease, Can be used for the treatment of diseases.

In an embodiment of the present invention, the pharmaceutical composition comprising a substance capable of inhibiting the activity of miR-485-3p is used for the treatment of Alzheimer's disease, and the brain disease includes Alzheimer's disease, But are not limited to, delayed ischemic sclerosis, convulsions, stroke, Parkinson ' s disease, spinal cord injury.

As used herein, the terms "treatment", "relief" or "improvement" refer to any action that improves or alters the symptoms of a related disease upon administration of the composition. Those skilled in the art will be able to ascertain the precise criteria of the disease by referring to the data provided by the Korean Medical Association, and to judge the degree of improvement, improvement, and treatment of the disease.

The term " prophylactic " as used herein refers to any act that inhibits or delays the onset of a related disorder. It will be apparent to those skilled in the art that in the present invention, the above-mentioned pharmaceutical composition can prevent early symptoms, or related diseases when administered prior to appearance.

In the present invention, the pharmaceutical composition may contain at least one active ingredient which exhibits the same, similar or synergistic function for treatment of a related disease, or at least one miR-485-3p A substance capable of inhibiting -3p activity and a compound capable of maintaining / increasing the solubility and / or absorbability of the active ingredient. Also optionally, an immunomodulator and / or a chemotherapeutic agent may be further included.

In addition to the above-mentioned active ingredients, the pharmaceutical composition may further comprise at least one pharmaceutically acceptable diluent, carrier and / or adjuvant. The pharmaceutically acceptable carrier may be a mixture of one or more of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and components thereof, , A buffer solution, a bacteriostatic agent, and the like may be added.

In addition, it can be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, A target organ specific antibody or other ligand can be used in combination with the carrier.

Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA . For example, as a suspension, a liposome formulation, an emulsion, a tablet, a capsule, a gel, a syrup, or a suppository.

The method of administering the pharmaceutical composition according to the present invention is not particularly limited, and a known method of administering the inhibitor may be applied. In accordance with the intended method, parenteral administration (for example, intranasal, intravenous, subcutaneous, Or topical application) or oral administration. In order to obtain a rapid therapeutic effect, administration by intranasal administration is preferable.

In addition, the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically or therapeutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type of disease, severity, The sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts.

The pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage ranges vary widely depending on the patient's body weight, age, sex, health condition, diet, time of administration, method of administration, excretion rate and severity of the disease, and a proper dosage is, for example, The amount of the drug and / or the specific activity of the polynucleotide used. May be calculated on the basis of an EC50 generally measured as effective in an in vivo animal model and in vitro, for example from 0.01 micrograms to 1 gram per kilogram of body weight, with unit, week, week, May be administered once or several times per period, or may be administered continuously for a long period using an infusion pump. The number of repeated administrations is determined in consideration of the duration of the drug in the body, the drug concentration in the body, and the like. The pharmaceutical composition may be administered for recurrence, even after treatment according to the course of the disease treatment.

In an embodiment of the invention, the method comprises contacting miR-485-3p with a test material and determining the activity of miR-485-3p in contact with the test substance, wherein the ratio of the contacted miR-485-3p Activity is compared with the activity of miR-485-3p of the control group not in contact with the test substance, the candidate substance is screened for a substance for the treatment or prevention of Alzheimer's disease or brain disease.

The miR-485-3p is provided in the form of cells expressing it, and the activity is analyzed by expression of miR-485-3p. For example, after contacting cells expressing miR-485-3p according to the present invention with a test substance, the change in the expression level of miR-485-3p was compared with that of the control cells before or after the contact, Variations, especially reductions, are selected as candidates. The expression level of miR-485-3p can be measured using known methods such as Northern blotting, RT-PCR, hybridization using a microarray, and the like.

The miR-485-3p is provided in the form of a cell expressing the miR-485-3p. The activity of the miR-485-3p is related to the 3'-UTR of the target ELAVL2 protein (ELAVL2-specific RNA binding protein 2) It is determined by interaction analysis. For example, after contacting cells expressing miR-485-3p according to the present invention with a test substance, the degree of interaction between 3'-UTR and miR-485-3p of the ELAVL2 protein was measured before or after the contact with the control cells , It is selected as a candidate substance that has a variation in interaction, particularly a decrease. Methods for detecting RNA-RNA interactions used in the methods according to the present invention are known in the art and include, for example, those described in RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38 (1): e5 , Or Yeat two hybrid system (Piganeau et al., RNA 2006; 12: 177-184), and can be referred to RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011).

The kind of cell used in the screening method, the amount and type of test substance, and the like vary depending on the specific experimental method to be used and the kind of the test substance. Those skilled in the art will be able to select appropriate cell types, amounts and / or conditions . As a result of the experiment, a candidate substance is selected as a substance which causes a decrease in the activity of miR-485-3p in the presence of the test substance as compared with the control substance not in contact with the test substance. Less than about 99%, less than about 95%, about 90%, about 85%, about 80%, about 75%, about 70% less, less than about 65% , About 55% reduction, about 50% reduction, about 45% reduction, about 40% reduction, about 30% reduction, about 20% reduction,

Refers to a substance expected to inhibit the activity of miR-485-3p as described above, and may be a low molecular weight compound, a high molecular weight compound, a mixture of compounds (e.g., a natural extract or a cell or tissue culture) , Or biopharmaceuticals (e.g., proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzymes and DNAzymes) or sugars and lipids. The test substance may be a polypeptide having two or more amino acid residues, such as six, ten, twelve, twenty or fewer or more than twenty such as 50 amino acid residues. The test materials can be obtained from libraries of synthetic or natural compounds, and methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich Available from MycoSearch (USA). The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the desired synthetic library method, " 1-bead 1-compound " library method, and by synthetic library methods using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

For the purpose of screening a drug for treating Alzheimer's disease and / or various brain diseases according to the present invention, a compound having a low molecular weight therapeutic effect may be used. For example, compounds having a weight of about 1000 Da such as 400 Da, 600 Da or 800 Da can be used. Depending on the purpose, such compounds may constitute a part of a library of compounds, and the number of compounds constituting the library may vary from several tens to several millions. Such a library of compounds can be prepared by reacting peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular weight compounds based on a template, such as benzodiazepines, hydantoins, biaryls, carbocycles, and polycycle compounds such as naphthalene, Carbodihydrate and amino acid derivatives, dihydropyridines, benzhydryls and heterocycles (such as triazine, indole, thiazolidine, etc.), but this is merely exemplary It is not limited thereto.

Cells or biomolecules can also be used for screening. The biomolecules refer to proteins, nucleic acids, carbohydrates, lipids, or materials produced using in vivo or in vitro cell systems. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, proteins or biological organic materials found in polynucleotides, peptides, antibodies, or other plasma.

In an embodiment of the present invention, a method is provided for detecting the expression of a miR-485-3p marker from a sample; And a step of associating the expression level of the detected marker with the diagnosis or prognosis of Alzheimer's disease and / or various brain diseases of the test subject to provide information necessary for diagnosis or prognosis of Alzheimer's disease and / or various brain diseases A method for detecting the marker is proposed.

In the present invention, the associating step compares the expression level of the determined marker with the detection result for each marker determined in the control group, wherein the expression level of miR-485-3p is increased compared to the control group .

The non-marker clinical information of the test subject for seizure disorder may be additionally used when the expression level of the marker is diagnosed or the prognosis of Alzheimer's disease and / or various brain diseases of the test subject is discriminated. The non-marker clinical information of the test object includes the age, sex, weight, dietary habit, body mass, baseline disease and EEG, seizure type, brain MRI, brain CT, brain spinal fluid test, blood test, saliva test But is not limited thereto.

In an embodiment of the present invention, it is based on the discovery that miR-485-3p excessively inhibits the expression of ELAVL2 protein and is involved in the pathogenesis of Alzheimer's disease and / or various brain diseases. In another embodiment, , Particularly a method for treating or preventing Alzheimer's disease and / or brain disease through inhibition of miR-485-3p activity in brain cells or brain tissue or brain.

In an embodiment of the present invention, there is provided a method of treating Alzheimer's disease and / or a brain disease comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of a miR-485-3p activity inhibitor, A method for treating or preventing brain diseases is provided.

Further, the present invention provides a substance capable of inhibiting the activity of miR-485-3p in the use for the treatment or prevention of brain diseases, wherein the substance capable of inhibiting the activity of miR-485-3p is It is transmitted to the brain.

In addition, the miR-485-3p activity inhibitor, the miR-485-3p activity control or inhibition to be used, the administration method, the kind of the treatable disease, and the like can be referred to above.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example  1: Alzheimer's plasma  in miRNA qPCR array  Used miRNA  Expression Petton  analysis

(1) Patient and sample preparation

Table 1 shows the characteristics of the patients used in the study. From four patients who were diagnosed with Alzheimer's disease by a doctor, Sod. Approximately 3 ml of blood was collected in a blood tube (Becton Dickinson, Germany) supplemented with citrate (3.2% w / v) and healthy adults matched for age (4 years) .

Gender and age of normal group and patient group Group Sample No gender age Normal group N1 female 78 Normal group N2 south 72 Normal group N3 female 74 Normal group N4 south 79 Patient group S1 female 72 Patient group S2 female 82 Patient group S3 female 84 Patient group S4 south 75

Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80 ° C until RNA extraction. MiRNA was extracted using miRNAeasy Serum / Plasma kit (Qiagen, USA) according to the manufacturer's recommendations, and the concentration and purity of the extracted RNA were analyzed using Bioanalyzer 2100 (Agilent, USA) Eight groups were used for the study in accordance with the quality standards.

(2) miRNA qPCR array

Table 2 < RTI ID = 0.0 > The RNA extracted as the gene list used for the analysis was screened using miRNA arrays containing 84 different miRNAs known to be involved in the progression of Human Neurological Development and Neurological Disease.

miRNA qPCR array Gene list used for analysis No. Mature miRNA list No. Mature miRNA list One hsa-let-7b-5p 43 hsa-miR-298 2 hsa-let-7c-5p 44 hsa-miR-29a-3p 3 hsa-let-7d-5p 45 hsa-miR-29b-3p 4 hsa-let-7e-5p 46 hsa-miR-29c-3p 5 hsa-let-7i-5p 47 hsa-miR-302a-5p 6 hsa-miR-101-3p 48 hsa-miR-302b-5p 7 hsa-miR-105-5p 49 hsa-miR-30d-5p 8 hsa-miR-106b-5p 50 hsa-miR-320a 9 hsa-miR-107 51 hsa-miR-328-3p 10 hsa-miR-124-3p 52 hsa-miR-337-3p 11 hsa-miR-125b-5p 53 hsa-miR-338-3p 12 hsa-miR-126-5p 54 hsa-miR-339-5p 13 hsa-miR-128-3p 55 hsa-miR-342-3p 14 hsa-miR-130a-3p 56 hsa-miR-346 15 hsa-miR-132-3p 57 hsa-miR-34a-5p 16 hsa-miR-133b 58 hsa-miR-376b-3p 17 hsa-miR-134-5p 59 hsa-miR-381-3p 18 hsa-miR-135b-5p 60 hsa-miR-409-3p 19 hsa-miR-138-5p 61 hsa-miR-431-5p 20 hsa-miR-139-5p 62 hsa-miR-432-5p 21 hsa-miR-140-5p 63 hsa-miR-433-3p 22 hsa-miR-146a-5p 64 hsa-miR-455-5p 23 hsa-miR-146b-5p 65 hsa-miR-484 24 hsa-miR-148b-3p 66 hsa-miR-485-3p 25 hsa-miR-151a-3p 67 hsa-miR-485-5p 26 hsa-miR-152-3p 68 hsa-miR-487a-3p 27 hsa-miR-15a-5p 69 hsa-miR-488-3p 28 hsa-miR-15b-5p 70 hsa-miR-489-3p 29 hsa-miR-181a-5p 71 hsa-miR-499a-5p 30 hsa-miR-181d-5p 72 hsa-miR-509-3p 31 hsa-miR-191-5p 73 hsa-miR-511-5p 32 hsa-miR-193b-3p 74 hsa-miR-512-3p 33 hsa-miR-195-5p 75 hsa-miR-518b 34 hsa-miR-19b-3p 76 hsa-miR-539-5p 35 hsa-miR-203a-3p 77 hsa-miR-652-3p 36 hsa-miR-20a-5p 78 hsa-miR-7-5p 37 hsa-miR-212-3p 79 hsa-miR-9-5p 38 hsa-miR-22-3p 80 hsa-miR-9-3p 39 hsa-miR-24-3p 81 hsa-miR-92a-3p 40 hsa-miR-26b-5p 82 hsa-miR-93-5p 41 hsa-miR-27a-3p 83 hsa-miR-95-3p 42 hsa-miR-28-5p 84 hsa-miR-98-5p

The quantitative PCR assay method can be summarized as follows. Mature miRNAs are generally 22 nt, noncoding RNAs and are responsible for post-transcriptional regulation. Mature miRNAs were polyadenylated by poly (A) polymerase and synthesized as oligo-dT primers. The oligo-dT primers have a 3 'degenerate anchor and a universal tag sequence at the 5' end, allowing real-time PCR amplification of mature miRNAs. miRNA SYBR Green PCR Kit (Qiagen) was used to quantify mature miRNAs in real-time PCR.

(3) Analysis of miRNA expression pattern by volcano plot

FIG. 1 (A) analyzes miRNA expression patterns of 84 species in the patient group versus the normal group, using miRNA expression pattern analysis (volcano blot) in the patient group versus the normal group.

The x-axis represents Fold change and the y-axis represents the p-value of -log10. A horizontal black line indicates a p value of 0.05 or less. The results of the Volcano blot analysis showed that hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa- 3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, HSA-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, hsa-miR-146b-5p, HSA-miR-223p, hsa-miR-509-3p, hsa-miR-139-5p, hsa-miR-499a-5p, hsa-miR-203a-3p, HSA-miR-128-3p, hsa-miR-487a-3p, hsa-miR-485-3p, hsa-miR-195-5p, hsa-miR-433-3p, hs-miR-191-5p, hsa-miR-489-3p, hsa-miR-432-5p, hsa-miR-29c-3p, hsa-miR- miR-106b-5p, hsa-miR-101-3p, hsa-miR-328-3p, hsa-let-7b-5p, hsa-miR-539-5p, hsa- HSA-miR-515b, hsa-miR-148b-3p, hsa-miR-181d-5p, hsa-miR-7-5p, hsa-miR-512-3p, hsa- miR-18b-5p, hsa-miR-15b-5p, hsa-miR-15b-5p, hsa-miR- 34a-5p, hsa-miR-346, hsa-miR-511-5p, hsa-miR-485-3p, hsa-miR-485-5p, hsa hs-miR-489-3p, hsa-miR-499a-5p, hsa-miR-509-3p, hsa-miR-511-5p, hsa-miR-512-3p, hsa-miR HS-miR-93-5p, hsa-miR-652-3p, hsa-miR-7-5p, hsa-miR-92a-3p, hsa-miR-98-5p expression was elevated in this patient group. However, miRNA regulation except hsa-miR-485-3p was not statistically significant. In the case of hsa-485-3p, the p-value is 0.00439, which is significantly increased in Alzheimer's patients compared to the normal group. When the normal group was regarded as 1, severe dementia showed a difference of about 9 times, and in the case of between 1 and 9 times, it could be classified into hardness cognitive disorder (Fig. 1 (B)). Thus, hsa-miR-485-3p can be an expected index for diagnosing Alzheimer's disease.

Example  2: Human miRNA  Target gene prediction and the same in mice miRNA  Target gene conservation and anti-mmu-miR-485-3p synthesis

The 3-terminal untranslated region (UTR) of human-derived ELAVL2 was targeted with hsa-miR-485-3p using the target prediction software (miRDB) to analyze the base sequence and target position of hsa-miR- Respectively. It was confirmed that the seed sequence identified here was also conserved in the non-translational site of 3-terminal ELAVL2 derived from mmu-miR-485-3p and mouse.

Figure 2 is a listing of the ELAVL2 3'-untranslated region (UTR) mRNA known as the target of hsa-miR485-3p, showing the target ELAVL2 3'-untranslated region (UTR) mRNA of miR-485-3p. The 5 'seed sequence (ELAVL2) of miR-485-3p is shown in red. Table 3 shows the sequence of has-miR-485-3p, which was synthesized to investigate the physiological function of miR-485-3p using the Alzheimer's disease model.

The nucleotide sequence of has-miR-485-3p Gene Sequence (5 '-> 3') SEQ ID NO: hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU One

Table 4 shows the 3'-untranslated region (UTR) of mouse ELAVL2 and the amino acid sequence of mmu-miR-485-3p using the target prediction software (TargetScan, PicTar, and microT) It was confirmed that the target sequence of 3p was conserved. It was confirmed that the 3'-untranslated region (UTR) of mouse ELAVL2 was the target of mmu-miR-485-3p.

Sequence and target position analysis of mmu-miR485-3p Gene Sequence (5 '-> 3') SEQ ID NO: mmu-miR-485-3p AGUCAUACACGGCUCUCCUCUC 8 Target gene Gene name 3P-seq tags + 5 Total sites Representative miRNA ELAVL2 ELAV like neuron-specific RNA binding protein 2 78 3 mmu-miR-485-3p

Target genes, specific sequence antagomir, 2'-O-methylated and phosphorothioate modified antisense oligonucleotides associated with Alzheimer's and brain diseases were synthesized against mMu-miR-485-3p overexpressed in the Alzheimer's mouse model.

Example 3: 5xFAD  In the hippocampus and cerebral cortex of the mouse miR -485-3p expression analysis (RT-qPCR)

(1) Research method

5xFAD transgenic mouse is an animal model of Alzheimer disease that overexpresses mutant forms of APP and PSEN1 and accumulates intraneuronal Aβ42 at 6 weeks.

Based on the results of Example 1, RT-qPCR was performed to confirm the expression of miR-485-3p in demented animal models. 10-month-old 5xFAD transgenic mice and Wild type (WT) mice were deeply anesthetized and sacrificed by monocots. The brain was immediately removed and the hippocampus and cerebral cortex were incised in the residual brain structure. Total miRNA was isolated from the hippocampus using the PAXgene Tissue miRNA Kit (Qiagen, USA) according to the manufacturer's instructions. cDNA was synthesized using miScript II RT Kit (Qiagen, USA) and qPCR was performed using the miu_miR-485-3p miScript Primer Assay and miScript SYBR Green PCR Kit. miRNA levels were quantified by normalizing according to snoRNA202 (mouse control).

(2) Results of research

FIG. 3 (A) shows the expression of miR-485-3p in hippocampus and cortex. As a result, RT-PCR was performed to identify the expression pattern of miR-485-3p in the hippocampus and cerebral cortex of 5xFAD. As a result, expression of miR-485-3p was increased in the hippocampus of 5xFAD versus WT. Thus, with the results of the study of Example 1, the expression of miR-485-3p appears to be elevated in Alzheimer ' s dementia. Therefore, we tried to identify the neuronal target mRNA or protein that miR-485-3p might affect.

Example 4: 5xFAD  In the hippocampus and cerebral cortex of the mouse ELAVL2  include Related protein  And amyloid beta 42 protein expression

(1) Research method

According to the results of Example 3, ELVL2-related protein and amyloid beta 42 protein expression were examined in the hippocampus and cerebral cortex of 5xFAD. Anesthetized mice (9 months) were sacrificed with monocots and brain was immediately removed. USA), cFOS antibody (cell signaling, USA), APP antibody (cell signaling, USA), amyloid beta antibody (cell signaling, USA) ) Was used for western blotting. Immunoreactive proteins were visualized as chemiluminescence reagents (GE health care, UK) and quantitated and quantified using a chemical image analyzer (Fusion SL). To quantify the amyloid beta 42 protein in the hippocampus and cerebral cortex, quantification was carried out using mouse / rat amyloid beta (1-42) ELISA kit (IBL).

(2) Results of research

1) ELAVL2 expression in hippocampus and cerebral cortex

Figures 3 (B) and 3 (C) show the results of ELAVL2 expression and related protein expression in the hippocampus and cerebral cortex of 5xFAD. ELAVL2 is an ELAV-like RNA-binding protein that is known to modulate neuronal functions such as neuronal excitation or synaptic transmission directly associated with cognitive and behavioral functions. ELAVL2 is a neural-specific RNA-binding protein that recognizes the GAAA motif of RNA and is responsible for post-transcriptional gene regulation. The target is the transcription factor cFOS, which affects the expression level of the protein. It is also known that cFOS affects the expression of APP protein, known as the amyloid beta precursor, in brain cells. It was confirmed that the increase pattern of miR-485-3p significantly influenced the amount of APP expression in a series of procedures.

2) Comparison of Aβ42 expression in cerebral cortex and hippocampus

FIG. 4 shows the results of comparative analysis of Aβ42 in 5xFAD, comparing the expression of Aβ42 in the cerebral cortex and hippocampus of 5xFAD. In 5xFAD, it was confirmed that A? 42 in both cerebral cortex (Fig. 4 (A)) and hippocampus (Fig. 4 (B) These results suggest that controlling miR-485-3p may be a way to reduce amyloid beta, a known cause of Alzheimer's disease.

Example 5: Measurement of the concentration of amyloid beta (A?) 42 isolated from saliva

(1) Research method

Because the amyloid beta is measured in saliva close to the brain, the accuracy is better than that of blood, and a small amount of amyloid beta can be quantitated to early diagnosis. You can also get a higher accuracy (over 99%) by double checking with ancillary means (blood, miRNA).

Using a sequence specifically binding to amyloid beta 42 and a self-binding sequence within the nucleic acid, a multi-nucleotide nucleic acid having a structural characteristic in which a quencher decreases while binding to amyloid beta 42 and fluorescence is expressed is synthesized. Since the size of the multi-nucleic acid is smaller than that of the antibody, it has excellent specificity and selectivity and can be sampled and mass-analyzed within 1 hour, so that it is possible to provide a diagnostic method with high diagnostic ease. Amyloid beta 42 in saliva was quantified using a platform technique (magnetoimmunoassay system) capable of collecting trace amounts of biomarkers into monolayers (Figure 5). It is possible to reproduce the collection of certain nanoparticles on a certain area. The aggregation of saliva-derived amyloid beta and magnetic particle complex is within 300 μm in diameter, and the number of magnetic particles in the aggregate is ~ 1.0 × 10 ⁴ (FIG. 6 (a)). Region-of-interest (ROI) of the photomultiplier tube (PMT) analysis was 100 × 100 μm ² , and the average value of each sample was calculated by measuring three fluorescent materials by PMT (FIG.

100 patients from normal group, 100 patients from mild cognitive impairment to severe dementia were recruited. The ages ranged from early 30s to late 80s. Patients with other diseases that may affect dementia were excluded.

(2) Results of research

We measured very small amounts of amyloid beta in saliva and reproduced amyloid beta that did not appear by ELISA. In comparison with ELISA on the market for research, it was not detected in 30 normal people.

The magnetoimmunoassay system according to this embodiment is capable of simply detecting saliva amyloid beta peptide at a concentration somewhat higher than the commercial ELISA system of ~ 20 pg / ml. According to the protocol of the ELISA system used for reference, the lowest measurable concentration of the standard amyloid beta peptide is 7.4 pg / ml, since the curve-fit for the measurement does not satisfy the correct linearity for a very low concentration range It can be a bit ambiguous.

The results of saliva-derived amyloid beta 42 for each dementia patient were able to distinguish between normal, mild cognitive impairment (MCI), and severe. That is, amyloid beta concentrations of normal (0 to 500 pg / ml), mild cognitive impairment (500 pg to 1 ng / ml) and severe (1 ng / ml to) were confirmed (Fig. 7). In addition, amyloid beta was quantified in more than 100 dementia patients and classified as mild cognitive impairment and moderate dementia (more than 90% of clinician diagnosis).

Example 6 Production of Hippocampal Primary Cell Line and In Vitro Transfection

(1) Research method

Primary cells were extracted from the hippocampus and cortical tissue extracted from the 5xFAD embryo. (Seibenhener, M. & Woonten M. W, Isolation and Culture of Hippocampal Neurons from Prenatal Mice, Jove, 2012). In Vitro Transfection Primary cells were transfected with 50 nM of miR-485-3p duplex (or scrambled miRNA duplex; Bioneer, Daejon, South Korea) and 50 nM of Antagomir (AM) 485-3p using Lipofectamine 2000. Cell homogenates from 48 hours after transfection were prepared and western blotted using ELAVL2 antibody (abcam, UK). The immune response protein was visualized as a chemiluminescence reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). Amyloid beta 42 protein was measured using mouse / rat amyloid beta (1-42) assay kit (IBL) with reference to manufacturer's instructions.

(2) Results of research

Expression of ELAVL2 by AM485-3p transfection in hippocampal primary cells was compared (FIG. 9). ELAVL2 was expressed in the hippocampus primary cell of 5xFAD and ELAVL2 expression was increased in the cell transfected with AM485-3p compared to control. This implies that miR-485-3p inhibits the expression of ElAVL2 and this was demonstrated in cells treated with AM. Development of drugs or compositions such as miR-485-3p inhibitors that elevate ELAVL2 may be a key strategy in the prevention / treatment of Alzheimer's disease as ELAVL2 is involved in neuronal excitation and is an important factor affecting cognitive function.

Example  7: AM485-3p Intranasal  Treated From 5xFAD Include ELAVL2  Comparative analysis of quantities of related proteins and amyloid beta-42 protein

(1) Research method

Inhibition of miR-485-3p was induced by nasal administration of the sequence-specific entagomer or scramble-sequence enthymomas. Intranasal administration of entagomie was performed by targeting the brain without anesthetizing the mice. (Leah R.T., et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74): 4440). Place the pipette in front of one of the nasal passages with an intranasal grip and place the abdomen upwards on the mouse after completing the adaptation step in the paper. 6 μl is inhaled with a pipette and 2 times inhalation (1 drop = 3 μl). After 15-second postural maintenance, the nasal cavity is equally sucked into the right nasal cavity. After 2 minutes, repeat the same procedure and inhale a total of 24 μl (AM485 (2'-O-Methylated) -5'-gagaggagagccguguaugacu-3 '; 24 μl of 0.1% v / v diethyl pyrocarbonate- 5 nmol in distilled water; Bioni, Korea). Control mice were dosed with equal volume of Vehicle. After 12 weeks (once a week dose) at the time of nasal administration (7 months), the anesthetized mice were sacrificed by monocots and the brains were immediately removed. A homogeneous cargo of the brain region (hippocampus and cortex) was prepared and tested for ELAVL2 antibody (abcam, USA), cFOS antibody (cell signaling, USA), APP antibody (cell signaling, USA), amyloid beta antibody USA) was used for western blotting. The immune response protein was visualized as a chemiluminescence reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). Amyloid beta 42 protein was measured using mouse / rat amyloid beta (1-42) assay kit (IBL) with reference to manufacturer's instructions.

(2) Results of research

ELVL2-containing-related proteins and amyloid beta-42 proteins were quantitatively analyzed in 5xFAD treated with AM485-3p (FIG. 10). Since the treatment of AM485-3p in mouse primary cell line induced ELAVL2 change in Example 6, we tried to confirm the role of AM485-3p in vivo by nasal treatment of AM485-3p with 5xFAD. Expression of ELAVL2 was increased in the AM485-3p group compared to the control group. With the recovery of ELAVL2, the expression of cFOS, a transcription factor involved in expression in APP, normalized and this reduced the expression of APP, leading to a decrease in amyloid beta 42 protein (Fig. 10 (A) and (B)). This suggests that the development of drugs or compositions such as miR-485-3p inhibitors is a key strategy for the prevention / treatment of Alzheimer's disease. In addition, since it has been confirmed that the treatment of AM485-3p in animal models affects the inhibition of the production of A? 42 (FIG. 10 (C)), the relevant inhibitor or drug treatment seems to be able to alleviate the pathological symptoms of Alzheimer's dementia.

Example 8: 5xFAD  The mice were injected with AM485- 3p  Intranasal From 5xFAD  Cognitive function comparison

(1) Research method

Y-maze and passive avoidance test were conducted to confirm the improvement of cognitive function of 5xFAD with AM485-3p.

1) Y-maze test

The Y-lab experiment consists of a Y-shaped labyrinthine labyrinth made of black acrylic plates (10 cm by 41 cm, 25 cm by 25 cm), and each labyrinth is arranged at an angle of 120 ° to each other have. After setting each labyrinth as A, B, and C areas, carefully place the experimental animals in one area and allow them to move freely for 8 minutes. Measure the number and order of entry into each labyrinth to determine the spontaneous alteration (%) Respectively. One point (actual change, ie ABC, BCA, CAB, etc.) was accepted when entering three different areas sequentially. If not entered consecutively, the score was not accepted. Therefore,% spontaneous alteration was calculated by the following equation.

% spontaneous alteration = total alterations / (total number of entries - 2) x 100

2) Passive avoidance test

The passive avoidance test, widely used for learning and memory measurements, is a method of measuring the working memory ability of rodents. The passive avoidance test system is a shuttle box divided into two chambers. One light bulb is installed in one room to create a bright environment that the experimenter dislikes. In the other room, . After two hours of stress exertion, the passive avoidance response was tested (training test). At the bottom of the dark room, an aluminum rod is laid out at regular intervals, which can cause an electric shock to the animal's sole. Experimental animals tend to enter a dark room, where they are placed in a bright room and given an electric shock (5 V, 0.5 mA, 10 sec) when they enter a dark room, allowing the animal to remember it. Immediately afterwards, the latency time to the dark room was measured to 90 seconds (retention test 1, 2, 3) without electrical shock after 24 hours.

(2) Results of research

Cognitive function was compared in 5xFAD treated with AM485-3p (Fig. 11). As a result of the behavioral test, both the spontaneous alteration (Fig. 11 (A)) and the retention time (latency time, Fig. 11 (B)) were decreased in 5xFAD versus WT. Since the main symptoms of Alzheimer's dementia are represented by behavioral and memory impairments, behavioral disturbances of 5xFAD are seen to be due to excessive accumulation and pathology of amyloid beta. However, in the group treated with AM485-3p, the change activity and retention time increased significantly compared to 5xFAD. This means that treatment with AM485-3p can ameliorate the major symptoms of Alzheimer's disease by eliminating pathological symptoms such as behavioral and memory impairment that miR-485-3p promotes the production of amyloid beta 42 protein. Thus, the preparation of a drug or composition that modulates miR-485-3p suggests that it may be a new strategy to improve behavioral disturbance and cognitive function, the main symptom of Alzheimer's dementia.

Example 9: Statistical analysis

Student's-t test was used to compare the two groups and to compare three or more groups using the Krushall-Wallis analysis of variance. When the P-value obtained from the Krushall-Wallis test was < 0.05, post-hoc testing of the intergroup comparisons was performed using the Mann-Whitney U test. Two-tailed P-values of less than 0.05 were considered statistically significant.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> BIORCHESTRA Ltd. <120> Method for Diagnosing Alzheimer's disease Using microRNA-485-3p <130> P17-B152 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 1 gucauacacg cucumber cu 22 <210> 2 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 2 acuuggagag aggcuggccg ugaugaauuc gauucaucaa agcgagucau acacggcucu 60 ccucucuuuu agu 73 <210> 3 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 3 guguaugac 9 <210> 4 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 4 uguaugac 8 <210> 5 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 5 guguauga 8 <210> 6 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 6 uguauga 7 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 7 agagaggaga gccguguaug ac 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mMu-miR-485-3p <400> 8 agucauacac ggcucuccuc uc 22

Claims (12)

And measuring the expression level of miR-485-3p from the collected sample.
The method of claim 1, wherein the sample is blood.
The method according to claim 1, wherein the amount of expression of miR-485-3p is determined by rea-time PCR, quantitative PCR primer extension analysis, nucleic acid chip analysis, sequence analysis, gel chromatographic analysis by aptamer- &Lt; / RTI &gt; is measured by the method selected.
The method according to claim 1, wherein the expression level of miR-485-3p is 5 times or more as compared with the normal group, thereby diagnosing that the miR-485-3p has Alzheimer's disease or brain disease.
The method according to claim 1, wherein the expression level of miR-485-3p is 9 times or more as compared with that of the normal group, thereby diagnosing Alzheimer's disease or brain disease.
The method according to claim 1, wherein the brain disease is any one selected from the group consisting of autistic spectrum disorder, mental retardation, amyotrophic lateral sclerosis, seizure, stroke, Parkinson's disease and spinal cord injury.
The method of claim 1, further comprising measuring the concentration of amyloid beta 42 (A? 42) from the sample taken.
8. The method according to claim 7, wherein the sample is saliva or blood.
8. The method of claim 7, wherein the concentration of amyloid beta 42 is less than 500 pg / ml and less than 1 ng / ml; mild cognitive impairment (MCI); And 1 &lt; RTI ID = 0.0 &gt; ng / ml. &Lt; / RTI &gt;
a primer capable of amplifying miR-485-3p or a probe capable of hybridizing with miR-485-3p; and a composition for diagnosing Alzheimer's disease or brain disease.
The composition for diagnosing Alzheimer's disease or brain disease according to claim 10, further comprising an antibody or nucleic acid aptamer specifically binding to amyloid beta 42.
A kit for diagnosing Alzheimer's disease or brain disease comprising the composition of claim 10 or 11.

Images