KR20190044347A - Multimeric Protein Display System using Cell Membrane Fluidity - Google Patents

Abstract

The present invention relates to a display system of multimer target protein using fluidity of cell membranes. The display system of the present invention has much higher convenience (such as simple medium production, reduction of incubation time for screening, use of a single promoter, etc.) compared with a conventional full-length lgG display system or Fc display system using PelB. In addition, the display system of the present invention has the %CV value is smaller than the conventional full-length lgG display technique, and the fluorescence signal value between a negative clone and a positive clone is large, thereby being more efficient for screening using a target protein display.

Description

TECHNICAL FIELD [0001] The present invention relates to a multimeric protein display system using cell membrane fluidity,

The present invention relates to a display system for multi-chain objective proteins using flow properties of cell membranes.

Protein display systems have physically linked genotypes and phenotypes. Bacterial display systems, bacteriophage display systems, and yeast display systems have been developed and are now widely used for high-speed search for improving the functionality of pharmaceutical / industrial proteins (Directed Evolution Library Creation: Methods and Protocols 2003 Arnold, Frances H., Georgiou, George, Directed Enzyme Evolution: Screening and Selection Methods 2003 Arnold, Frances H., Georgiou, George)

Therapeutic antibodies are considered to be one of the most effective cancer treatment methods because they exhibit very high specificity to the target, low bio-toxicity and low side effects, as well as excellent blood half-lives of about 3 weeks, compared with conventional low-molecular drugs.

Therapeutic antibodies are composed of Fab (Fragment antigen binding), which recognizes the target antigen, and Fc (fragment crystallizable), which collects immune cells and removes the target. Since the effector function on Fc is mediated by the binding of FcγRs (FcγRI, FcγRII, FcγRIII), many global pharmaceutical companies are exploring Fc variants with increased binding capacity to FcγRs to increase the efficacy of antibody drugs .

Roche is a leading company in the development of therapeutic antibody medicines including Roche, Amgen, Johnson & Johnson, Abbott and BMS. Especially Roche has developed Herceptin, Avastin, Rituxan ) Is a representative product. With these three therapeutic antibodies, it generates a huge profit of around US $ 19.5 billion in the global market in 2012, and is leading the global antibody drug market. Johnson & Johnson, who developed Remicade, is also growing rapidly in the global antibody market due to increased sales, and pharmaceutical companies such as Abbott and BMS are also known to have a number of therapeutic antibodies at the developmental stage. As a result, biopharmaceuticals, including therapeutic antibodies specific to disease targets and low side effects, are rapidly replacing the global pharmaceutical market, where low-molecular drugs have taken the initiative.

Therefore, a system for efficiently searching for Fc variants is very important for the development of next-generation therapeutic antibodies.

Conventional antibody Fc variant detection systems using bacteria include full-length IgG display and Fc display using PelB. All of them are displayed on the inner membrane of the bacteria and then spheroplasted to peel off the outer membrane Analysis system.

The full-length IgG display system is a system in which bacteria are co-transformed with plasmids coding for heavy and light chains, and heavy and light chains expressed in the periplasmic region around the plasma membrane are assembled (Jung et al., 2013 ACS Chem Biol). Since this method requires two plasmids encoding the heavy chain and the light chain respectively, two promoters (Lac promoter and PBAD promoter) must be considered at the same time during the culture and overexpression, and the culture conditions and time (20 hours) The longer the screening process, the greater the rate of negative clone that grows fast. In addition, since the display level is not constant, the deviation (CV: coefficient of variation) is high when the flow cytometer is actually analyzed.

Another system, Fc display using PelB leader peptide, is a system in which trap is increased due to viscosity of trehalose due to Fc protein secreted to the cytoplasmic space region by sec pathway (Jung et al., 2010 Proc Natl Acad Sci USA). This method is inconvenient to separately prepare a medium to which 0.5 M of trehalose is added at a high concentration without using a general medium, and the amount of the Fc fragment to be washed by the washing step in the spheroplasting process It is very difficult to control the display level of the trapped Fc protein. Indicating that they are not suitable in terms of uniformity and reproducibility essential for a series of screening processes.

Therefore, unlike the display systems described above, there is an urgent need for development of an efficient display system, since the culture time and conditions are simple, the degree of display is uniform, and the CV value is relatively small.

It should be understood that the foregoing description of the background art is merely for the purpose of promoting an understanding of the background of the present invention and is not to be construed as adhering to the prior art already known to those skilled in the art.

The present inventors have sought to develop a display system with increased convenience and efficiency over a full-length IgG display system, which is a conventional display system, or an Fc display system using PelB. As a result, when a monomer of a target protein to which an anchor polypeptide is fused is produced and displayed, the display system can be manufactured simply and conveniently by forming a multiplexed body by self-assembly due to the fluidity of the cell membrane. And that the degree of display is uniform.

Accordingly, an object of the present invention is to provide a method for producing a multi-chain objective protein display system using the fluidity of a cell membrane.

It is another object of the present invention to provide a target protein display system comprising a monomer of a target protein to which an anchor polypeptide is fused.

Still another object of the present invention is to provide a composition for a target protein display comprising a monomer of a target protein to which an anchor polypeptide is fused, a nucleic acid molecule that encodes a monomer of a target protein to which the anchor polypeptide is fused or a vector comprising the nucleic acid molecule .

It is another object of the present invention to provide a method for screening Fc variants having improved affinity for Fc [gamma] R by using the flowability of cell membranes.

It is another object of the present invention to provide a screening method of scFV having binding ability to an antigen using the flowability of a cell membrane.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method of producing a multimeric target protein display system comprising the steps of:

(a) a vector comprising (i) a nucleotide sequence encoding a monomer and anchor polypeptide of the target protein to be displayed and (ii) a vector comprising a promoter operatively linked to the coding nucleotide sequence Constructing a second image;

(b) transforming the microorganism with the vector;

(c) culturing the transformed microorganism to express a monomer of the target protein fused with the anchor polypeptide, wherein the anchor polypeptide is anchored to the inner membrane of the microorganism, and the monomer of the target protein is the protoplasm of the microorganism Displayed in a periplasmic region; And

(d) the monomer of the objective protein to which the anchor polypeptide is fused is self-assemble by membrane fluidity to form a multimer.

The present inventors have sought to develop a display system with increased convenience and efficiency over a full-length IgG display system, which is a conventional display system, or an Fc display system using PelB. As a result, when a monomer of a target protein to which an anchor polypeptide is fused is produced and displayed, the display system can be manufactured simply and conveniently by forming a multiplexed body by self-assembly due to the fluidity of the cell membrane. And the degree of display is uniform.

The manufacturing method of the present invention will be described below in each step.

(a) Construction of vector:

First, a nucleotide sequence encoding a monomer and anchor polypeptide of the target protein to be displayed and (ii) a vector comprising a promoter operatively linked to the coding nucleotide sequence is constructed )do.

The term " target protein " is used herein to mean any protein or peptide as an object to be displayed on the display system. (VH or / and VL), a single-chain variable fragment (scFV), an Fc (humanized antibody) or a fragment thereof, an antibody or a portion thereof, Binding protein or a binding domain thereof, a peptide, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin protein, a cytokine, a transcription regulator, a blood coagulation factor, a plant bio- But are not limited to, CSF (Macrophagecolony stimulating factor), hemoglobin, G-protein, CD28, interleukin, interferon-γ, TGF-β (Transforming growth factor-β)

According to a preferred embodiment of the present invention, a target protein of the present invention is an antibody, an antibody antigen binding region (VH or / and VL), an scFv, a Fab, an Fc protein, a G- protein, a hemoglobin, Interferon-gamma, TGF-beta, or a fragment thereof.

Antibodies are proteins that specifically bind to specific antigens. There are five major classes of natural antibodies: IgA, IgD, IgE, IgG and IgM, usually two identical light chains (L) and two identical heavy chains (H) , Which is a heterodimeric glycoprotein of about 150,000 daltons.

As used herein, the term antibody refers to polyclonal antibodies, monoclonal antibodies, human antibodies, and humanized antibodies and fragments thereof.

Papain degradation of the antibody forms two Fab fragments and one Fc fragment, and in the human IgG molecule, the Fc region is generated by papain digestion of the N-terminus of Cys 226 (Deisenhofer, Biochemistry 20: 2361-2370, 1981) .

The antibody Fc domain may be the Fc domain of an IgA, IgM, IgE, IgD, or IgG antibody, or a variant thereof.

According to a preferred embodiment of the present invention, the target protein of the present invention is in a multimer form including a dimer.

The target protein of the present invention is expressed in a periplasmic region in the form of a monomer, floated by the fluidity of the cell membrane, and self-assemble with other monomers to form a multimer.

According to a preferred embodiment of the present invention, the monomer of the target protein of the present invention is one or more monomers selected from the group consisting of heavy chain variable region (VH), light chain variable region (VL) and fragments thereof.

According to a preferred embodiment of the present invention, the monomer of the target protein of the present invention is an Fc protein monomer or a fragment thereof.

As used herein, the term " anchor polypeptide " refers to an anchor polypeptide that binds to the N-terminal or C-terminal of a monomer of the target protein and is expressed and anchored in the cell membrane of the microorganism and the monomer of the target protein is expressed in the periplasmic space (NlpA leader peptide), MalF (Jung et al., 2007 Biotechnol Bioeng), and Pf3 coat protein (hereinafter referred to as " (Kleiner et al., 2008 FEBS Lett), M13 procoat protein (Czwizinski and W Wickner, 1982 EMBO J), ProW Nt / TM1 / 3K (Linda Froderberg et al., 2003 Molecular Microbiology), KdpD protein (Sandra J. Facey, Andreas Kuhn 2004 Biochim Biophys Acta).

The anchor polypeptide may be linked to the monomer of the target protein by a linker.

A nucleotide sequence encoding a monomer and an anchor polypeptide of the target protein to be displayed is constructed as a vector together with a promoter operatively linked to the coding nucleotide sequence.

As used herein, the term " operably linked " means a functional linkage between a promoter that is a nucleic acid expression control sequence and another nucleic acid sequence, whereby the promoter regulates transcription of the other nucleic acid sequence.

As used herein, the nucleotide or nucleic acid molecule may be isolated or recombinant, and includes DNA and RNA in single and double stranded form as well as corresponding complementary sequences. The isolated nucleic acid is a nucleic acid isolated from a peripheral genetic sequence present in the genome of the isolated nucleic acid, in the case of a nucleic acid isolated from a naturally occurring source. In the case of a nucleic acid that is enzymatically or chemically synthesized from a template, such as a PCR product, a cDNA molecule, or an oligonucleotide, the nucleic acid generated from such a procedure can be understood as an isolated nucleic acid molecule. The isolated nucleic acid molecule represents a nucleic acid molecule as a separate fragment or as a component of a larger nucleic acid construct. A nucleic acid is operably linked when it is placed in a functional relationship with another nucleic acid sequence. For example, the DNA of a full-length or secretory leader is operably linked to the DNA of the polypeptide when expressed as a preprotein in the form before secretion of the polypeptide, and the promoter or enhancer comprises a polypeptide sequence Or the ribosome binding site is operably linked to a coding sequence when it is placed to facilitate translation. Generally, operably linked means that the DNA sequences to be linked are located adjacent to each other, and in the case of the secretory leader, it means that the DNA sequences are adjacent to each other in the same reading frame. However, the enhancer need not be located contiguously. Linking is accomplished by ligation at convenient restriction sites. If such sites are not present, synthetic oligonucleotide adapters or linkers are used according to conventional methods.

As used herein, the term vector refers to a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence. The nucleic acid sequence may be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids, and viruses (e.g., bacteriophage). Those skilled in the art can establish a vector by standard recombinant techniques (Maniatis, et al, Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al, In:.. Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994).

As used herein, the term expression vector refers to a vector comprising a nucleic acid sequence encoding at least a portion of the gene product to be transcribed. In some cases, the RNA molecules are then translated into proteins, polypeptides, or peptides. The expression vector may contain various regulatory sequences. Vectors and expression vectors may also include nucleic acid sequences that provide another function, as well as regulatory sequences that regulate transcription and translation.

(b) Transformation of microorganisms:

Next, microorganisms are transformed using the constructed vector.

The microorganism can be transfected or transformed by the vector, which means that the exogenous nucleic acid molecule is transferred or introduced into the host cell.

According to a preferred embodiment of the present invention, the microorganism of the present invention is a bacterial cell. The cells are suitable for the practice of the present invention in that they have a periplasmic region between the inner membrane and the outer membrane. Examples of preferred bacterial cells of the present invention include E. coli , Pseudomonas aeruginosa , Vibrio cholera , Salmonella typhimurium , Shigella flexneri , Haemophilus influenza , Bordotella pertussi , Erwinia amylovora , Rhizobium sp . But are not limited thereto.

(c) Anchor The polypeptide  Fused Of the target protein  Monomer expression:

Next, the step of expressing the monomer of the target protein fused with the anchor polypeptide is anchored to the inner membrane of the microorganism, and the monomer of the target protein is displayed in the periplasmic region of the microorganism .

(d) self-assemble Multiplex ( multimer ) formation:

Finally, the monomer of the target protein to which the anchor polypeptide is fused floats the cell membrane due to the membrane fluidity of the cell membrane, and the monomers self-assemble as a pair to form a multimer, .

As used herein, the term " multimer " includes a dimer, wherein the dimer may be a homodimer with the same monomers attached, or a heterodimer with different monomers combined.

According to one embodiment of the present invention, the display system of the present invention is self-assembled by expressing and self-assembling Fc monomers to form homodimers (Examples 1 to 3), or by expressing the heavy and light chains of the antibody, respectively It was confirmed that heterodimers (Examples 4 to 5) can be formed.

According to another aspect of the present invention, there is provided a target protein display system produced by the above method.

Hereinafter, in order to avoid excessive duplication of contents in the present specification, description of portions overlapping with the above description will be omitted.

The objective protein display system manufactured according to the present invention is superior to conventional full-legged IgG display systems or PelB-based Fc display systems in convenience (simplicity of medium production, reduction of incubation time for screening, (%) CV value is smaller than that of the conventional full-field IgG display technique and the fluorescence intensity value (Mean fluorescence intensity, MFI) between the negative clone and the positive clone is larger than that of the conventional full IgG display technique.

According to still another aspect of the present invention, there is provided a method for producing an anchor polypeptide, comprising the steps of: (a) preparing an anchor polypeptide comprising a monomer of a target protein to which an anchor polypeptide is fused, a nucleic acid molecule encoding a monomer of a target protein to which the anchor polypeptide is fused, Thereby providing a composition for a target protein display.

According to a preferred embodiment of the present invention, the monomer of the objective protein to which the anchor polypeptide of the present invention is fused comprises a sequence selected from the group consisting of SEQ ID NO: 35 to SEQ ID NO: 39.

According to a preferred embodiment of the present invention, the nucleic acid molecule of the present invention comprises a sequence selected from the group consisting of SEQ ID NOS: 30 to 34.

According to another aspect of the present invention, the present invention provides a method of screening Fc variants with improved affinity for Fc [gamma] R comprising the steps of:

(a) a vector comprising (i) a nucleotide sequence encoding a monomer and anchor polypeptide of the Fc variant to be displayed and (ii) a vector comprising a promoter operably linked to the coding nucleotide sequence Constructing a second image;

(b) transforming the microorganism with the vector;

(c) culturing the transformed microorganism to express a monomer of an Fc variant fused with the anchor polypeptide, wherein the anchor polypeptide is anchored to the inner membrane of the microorganism, and the monomer of the Fc variant is a protoplast of the microorganism Displayed in a periplasmic region;

(d) the monomer of the Fc variant to which the anchor polypeptide is fused is self-assembled by membrane fluidity to form a dimer; And

(e) treating the microorganism displaying the dimer of the Fc variant with Fc [gamma] R, and comparing the binding force against Fc [gamma] R with the case of wild type Fc.

According to a preferred embodiment of the invention, said Fc variant comprises one or more amino acid substitutions selected from the group consisting of the following amino acid substitutions according to the Kabat numbering system: L235V, G236A, S239D, F243L , V264E, S267E, R292P, Q295R, S298G, T299A, Y300L, K326I, A327Y, L328F, L328G, L328W, A330L, P331A, I332E, I332Y, T350A, D357G, E382V, N390D, T394A, P396L, F405S, M428I and M428L .

The amino acid residue number of the antibody Fc domain herein refers to the Kabat numbering system conventionally used in the art (Kabat et al., In Proteins of Immunological Interest 5th Ed., US Department of Health and Human Services , NIH Publication No. 91-3242, 1991).

According to another aspect of the present invention, the present invention provides a method for screening an antigen binding region (VH and / or VL) having a binding force to an antigen comprising the steps of:

(a) a vector comprising (i) a nucleotide sequence encoding an heavy chain or light chain variable region of an antibody to be displayed and an anchor polypeptide, and (ii) a vector comprising a promoter operatively linked to the coding nucleotide sequence Constructing a second image;

(b) transforming the microorganism with the vector;

(c) culturing the transformed microorganism to express a heavy or light chain variable region of the antibody fused with the anchor polypeptide, wherein the anchor polypeptide is anchored to the inner membrane of the microorganism and the heavy or light chain variable Wherein the site is displayed in a periplasmic region of the microorganism;

(d) The heavy or light chain variable region of the antibody fused with the anchor polypeptide is self-assemble with the light or heavy chain variable region of the antibody by membrane fluidity of the antibody to form a multimer ; And

(e) treating the antigen with the microorganism for which the complex is displayed.

The nucleotide sequence encoding the heavy chain variable region of the antibody and the nucleotide sequence encoding the light chain variable region can be constructed in the same vector or constructed in different vectors, preferably constructed in the same vector and expressed by a single promoter .

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides a multi-chain target protein display system using the fluidity of cell membranes.

(Ii) The display system of the present invention has much higher convenience (manufacture of a simple medium, reduction of incubation time for screening, use of a single promoter, etc.) as compared with the conventional full-field IgG display system or Fc display system using PelB, , The% CV value is smaller than that of the full-length IgG display technique, and the difference between the vocal clone and the positive clone fluorescence signal value is larger, which is more effective for screening using the target protein display.

Figure 1 shows the Fc that is self-assemble by the flowability of gIII protein and cell membrane to form a dimer.
Figure 2 shows Fc with NlpA leader peptides and dimers fused by self-assemble by the flowability of cell membranes.
FIG. 3 shows the comparison of FcγRIIIa binding and signal difference between the dimeric Fc display using the gIII domain and the NlpA leader peptide and cell membrane fluidity and the conventional full-length IgG display technique.
FIG. 4 shows the results of assemble with bevacizumab VH / VL by antigen binding in A cell lining.
5 shows a schematic diagram of the library constructed and an antibody Fc domain display schematic diagram using gIII.
FIG. 6 is a bar graph comparing the fluorescence intensities of the wild-type Herceptin Fc with the FcγRIIIa affinity (6A) of each round of library after 5 rounds of screening (6B).
Figure 7 shows variants with high affinity for Fc [gamma] RIIIa (A: No. 25 (HW 25), B: No. 86 (HW 86)
Fig. 25 (HW 25) and No. 86 (HW 86) with the Fc sequence of wild-type Herceptin (A) and the nucleotide sequence of HW 25 and HW 86 (B).
9 shows the result of analysis of the affinity for Fc [gamma] RIIIa after the 355th glycine of HW 25 was converted to aspartic acid and the 405th serine to phenylalanine (No.25-G357D shows only 357 amino acids No.25-S405F is the only wild-type amino acid in the mutation of HW 25, and No. 25-G357D / S405F is the mutant of HW 25. Only 357 and 405 amino acids are wild type).
Fig. 10 shows experimental results of T394A mutagenesis found in HW86.
Figure 11 shows the results of the ADCC efficacy test of HW86.
12 shows a cleavage map of pMopac12-NlpA-Fc-FLAG.
Fig. 13 shows a cleavage map of pAK200-Fc-gIII.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example  One: gIII  Domain and cell membrane fluidity dimeric Fc  Vector construction for display (wild type WT Fc , MG48)

Plasmids were prepared to self-assemble the monomeric form of the Fc protein with the gIII protein into dimers by the flowability of the cell membrane (Fig. 1). Vent polymerase (New England Biolab) and primer MJ # 183, each amplifying the wild-type WT Fc and MG48 gene using a MJ # 184 Sfi I (New England Biolab) in a restriction enzyme-treated to create an insert Sfi I restriction enzyme treatment pAK200 vector. Then Escherichia coli Jude1 ((F '[Tn 10 (Tet r) proAB + lacI q Δ (lacZ) M15] mcrA Δ (mrr - hsdRMS - mcrBC) 80d lac ZΔM15 Δ lacX74 deoR recA1 araD139 ( araleu ) 7697 galUgalKrpsLendA1nupG ) (Kawarasaki et al, 2003) to obtain a single clone, and the sequence analysis confirmed that WT Fc and MG48 were successfully inserted into pAK200.

The primers used in the experiments primer # The nucleotide sequence (5 → 3) MJ # 1 (SEQ ID No. 1) CCAGGCTTTACACTTTATGC MJ # 183 (SEQ ID No. 2) CGAACTGGCCCAGCCGGCCATGGCGGACAAAACTCACACATG MJ # 184 (SEQ ID NO: 3) AGTTCGGGCCCCCGAGGCCCCTTTACCCGGGGACAGGGAG MJ # 228 (Sequence Listing 4) CGCAGCGAGGCCCAGCCGGCCATGGCGGACATCCAGATGACTCAATCACCCAGTTCAC MJ # 229 (Sequence Listing 5) CTTAACGCGGCCCCCGAGGCCCCGGTCCGCTTAATCTCCACTTTGGTTCC MJ # 232 (SEQ ID NO: 6) CGCAGCGAGGCCCAGCCGGCCATGGCGGAAGTCCAGCTGGTGGAGTCCG MJ # 233 (SEQ ID NO: 7) CTTAACGCGGCCCCCGAGGCCCCACTGCTTACTGTAACAAGAGTGCCCTG MJ # 236 (SEQ ID NO: 8) CCCTAAAATCTAGACTATTAGGCGCGCCCTTTGTCATC

Example  2: NlpA  leader peptide and cell membrane fluidity dimeric Fc  Vector construction for display (wild type WT Fc , MG48)

A plasmid was prepared to allow the NlpA leader peptide to self-assemble into the dimer by the flowability of the membrane-type Fc protein fused to the monomer (FIG. 2). Vent polymerase (New England Biolab) and primer MJ # 183, each amplifying the wild-type WT Fc and MG48 gene using a MJ # 184 Sfi I (New England Biolab) in a restriction enzyme-treated to create an insert Sfi I restriction enzyme treatment pMopac12 And then ligation was performed with -NlpA-FLAG vector. After that, a single clone was obtained by transformation into Escherichia coli Jude1, and it was confirmed by sequencing that WT Fc and MG48 were successfully inserted into the corresponding vector.

Example  3: Vector construction for antibody fragment display using cell membrane fluidity

The VH and VL portions of Bevacizumab were amplified with a vent polymerase (New England Biolab) using primers MJ # 232 and MJ # 233, MJ # 228 and MJ # 229, respectively. A gene amplification was conducted for each of the ligation pMopac12-NlpA-FLAG vector and pMopac12-NlpA-His-cMyc vector prepared with the same restriction enzymes and then treated with restriction enzyme Sfi I (New England Biolab). This plasmid was transformed into Jude1 and the pMOPac12-NlpA-VH (bevacizumab) -FLAG and pMopac12-NlpA-VL (bevacizumab) -His-cMyc were confirmed by confirming the base sequence of single colony. Then, VH and VL were produced in bicistronic form to express in one vector. The previously prepared pMopac12-NlpA-VH (bevacizumab) -FLAG was used as a template and amplified with primers MJ # 1 and MJ # 236. This DNA fragment was restriction enzyme treated with XbaI (New England Biolab) and then ligated into the same restriction enzyme-treated pMopac12-NlpA-VL (bevacizumab) -His-cMyc vector. Sequence analysis revealed that a bicistronic plasmid of pMopac12-NlpA-VH (bevacizumab) -FLAG-NlpA-VL (bevacizumab) -His-cMyc was produced.

Example  4. Full-length IgG  Culture of Escherichia coli for display

VL-CK-NlpA-VL (Cys-PelB-VL-CK-NlpA-VL) was introduced into Jude1 cell by pBAD30-Km-PelB-VH-CHl-CH2-CH3 (WT) -FLAG, pMopac12- -Ck-His-cMyc plasmid to prepare heavy chain and light chain to be expressed in the intercellular region, respectively. 5 ml of glucose containing 2% of glucose was cultured at 37 ° C for 16 hours, and 5.5 ml of TB was inoculated into a 100 ml flask at a ratio of 1: 100. After the cooling process, until OD ₆₀₀ = 25 ℃ and incubated 20 minutes, and 0.6 eseo 250 rpm was overexpressed during the 0.2% arabinose, 1 mM IPTG was added to 25 ℃, 250 rpm, 20 hours. After overexpression, the cells were recovered by centrifugation at 14000 rpm for 1 min by the same amount through OD ₆₀₀ normalize.

Example  5. Cell membrane fluidity and NlpA  or gIII  Used dimeric Fc  Culture of Escherichia coli for display

The plasmid pAK200-Fc (WT / MG48) -gIII and pMopac12-NlpA-Fc (WT / MG48) -FLAG plasmid were transformed into Jude1 bacterial cells and cultured in 5 ml of TB medium supplemented with 2% After 16 hours of culture, the cells were inoculated in 5 ml of TB medium at a ratio of 1: 100 and cultured until OD ₆₀₀ = 0.6. Immediately after cooling at 25 ° C and 250 rpm for 20 minutes, 1 mM IPTG was added and overexpressed at 25 ° C and 250 rpm for 5 hours. After overexpression, the OD ₆₀₀ value was measured and the cells were recovered by centrifugation at 14000 rpm for 1 minute.

Example  6. Escherichia coli culture for antibody fragment display based on cell membrane fluidity

The pMOPac12-NlpA-VH (bevacizumab) -FLAG-NlpA-VL (bevacizumab) -His-cMyc plasmid was transformed into Jude1 bacterial cells and cultured in 5 ml of TB + 2% glucose medium at 37 ° C for 16 hours The cells were then inoculated 1: 100 in 5 ml of TB medium and cultured to an OD _{600 of} 0.6. Immediately after cooling at 25 ° C and 250 rpm for 20 minutes, 1 mM IPTG was added and overexpressed at 25 ° C and 250 rpm for 5 hours. After overexpression, the OD ₆₀₀ value was measured and the cells were recovered by centrifugation at 14000 rpm for 1 minute.

Example  7. protein Mutant  For navigation and analysis Extracellular membrane Peptidoglycan  Floor Removal

The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 mg / ml lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and the peptidoglycan layer was removed by rotation at 37 ° C for 15 minutes.

Example  8. Flow cell  Analyzers based on cell membrane fluidity Fc Mutant  Display system verification

In order to compare the dimeric Fc display system based on the cell membrane fluidity developed in the present invention with the conventional full-length IgG display system, the binding capacity with FcγRIIIa was compared and analyzed. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. After taking 300 μl, 700 μl of PBS and 5 nM of tetrameric FcγRIIIa-Alexa488 probe were added together and the fluorescent probe was labeled on spheroplast by rotation at room temperature. After labeling, the plate was washed once with 1 ml of PBS and analyzed using Guava (Merck Millipore) equipment (FIG. 3). Based on the scientific fact that FcγRIIIa binding is impossible in the form of monomeric Fc, it has been confirmed that the Fc protein of the monomer fused to NlpA and gIII is displayed as a dimer type Fc through the cell membrane fluidity, It was confirmed that the% CV value was lower than that of the IgG display technique and the difference of the mean fluorescence intensity (MFI) between the negative clone and the positive clone was large. Therefore, the target protein including the Fc mutant had high homogeneity, We have shown that the binding assay of protein and ligand and the search of protein variant library can be effective using an effective flow cytometer.

Example  9: Flow cell  Verification of cell membrane fluidity based antibody fragment display system using analyzer

This experiment was carried out to confirm whether multimers other than Fc can self-assemble with this system using the fluidity of the membrane. In this experiment, mammalian IgG antibodies, including humans, which are used for the treatment and diagnosis of diseases except for camelids and sharks, which are capable of antigen binding with a single domain antibody (VHH), should be assemble with VH and VL for antigen binding. It is based on the scientific fact that if VL is not assimilated, it does not have the ability to bind antigen. Escherichia coli displaying antibody binding sites (VH, VL) with the extracellular membrane and peptidoglycan layer removed was centrifuged, supernatant was removed, and resuspension was performed with 1 ml of PBS. Then, 300 μl of the supernatant was removed and 700 μl of PBS 75 nM of VEGF-Alexa488 probe was added and labeled at spheroplast by rotation at room temperature. After labeling, the cells were washed once with 1 ml of PBS and analyzed using a Guava (Merck Millipore) instrument (Fig. 4). As a result, when VH or VL alone was displayed, fluorescence intensity similar to that of empty cell Jude1 was shown, indicating that it did not bind with VEGF, which is an antigen. In addition, when VH and VL are expressed together, it is confirmed that VH and VL are assimilated due to the fluidity of the bacterial intracellular membrane, thereby successfully binding to the antigen. In addition to Fc protein, various proteins forming multimers were displayed and confirmed to be able to self-assemble.

Example  10: To Fc [gamma] RIIIa  Bond strength improvement Mutant  Build libraries for excavation

Studies on Fc variants that enhance binding to Fc [gamma] R are being conducted in various organs, and various functional Fc variants have been discovered in previous studies. The aim of this study was to find the most optimal combination of Fc variants through the combination of various Fc variants. For this purpose, a library was designed and constructed to display the Fc of the non - glycosylated antibody in E. coli, which is simple and easy to manipulate. Since the binding sites of antibody Fc to various FcγRs are concentrated in regions close to the CH1-CH2 junction domain, mutants that have enhanced binding affinity to other FcγRs such as FcγRII, FcγRIIa, and FcγRIIb, but not FcγRIIIa, also have an effect on binding to FcγRIIIa There is a possibility to give. Therefore, we have searched mutants that have improved affinity for all FcγRs, not limited to FcγRIIIa. In addition to the mutated Fc variants discovered by previous studies in this laboratory, Antibody Fc variants were also selected as candidates (Table 2). As a result, 8 kinds of mutated antibodies and 4 kinds of glycated antibodies were screened, and mutants having 30 mutations at 29 mutation sites were identified. In the case of 30 mutants at 29 mutation positions, Of the total number of cells. For this, a gene encoding a Fc variant with a random combination was constructed using a primer having a degenerate codon (Table 3). Since the CH1-CH2 junction of Fc plays an important role in the binding of FcγR, , It was required to display the antibody Fc through the C-terminal rather than the N-terminal. Therefore, the pAK200 plasmid using the gene III signaling protein derived from the bacteriophage was used as a vector to enable C-terminal display of the E. coli cell gap region through cell membrane fluidity, and a large Fc mutant library into which various Fc variants were introduced was constructed 5).

Types of variants selected for library construction Mutant Mutation location Xencor2a G236A Xencor3a S239D / A330L / I332E Xencor2b S267E / L328F Macrogenics L235V / F243L / R292P / Y300L / P396L Fc 11 E382V Fc 5 E382V / M428I Fc 5-2a S298G / T299A / E382V / M428I Fc 1004 S298G / T299A / E382V / N390D / M428L Fc 701 Q295R / L328W / P331A / I332Y / E382V / M428L A / IYG T299A / K326I / A327Y / L328G Fc 1004 / IYG S298G / T299A / K326I / A327Y / L328G / E382V / N390D / M428L MG 48 V264E / S298G / T299A / K326I / A327Y / L328G / T350A / E382V / N390D / M428L

(Mutation positions are determined according to the EU index number as in the Kabat EU numbering system (Kabat et al., In Proteins of Immunological Interest 5th ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242, 1991)

The primers used in the experiments primer # The nucleotide sequence (5 → 3) 1Fw (SEQ ID NO: 9) GACAAAACTCACACATGCC CACCGTGCCCAGCACCTGAA 2Rv (SEQ ID NO: 10) GAGGGTGTCCTTGGGTTTTGGG GGAARGAGGAAGACTGACGGTCCCCCTAMGAG TTCAGGTGCTGGGCACGGTG 2Rv S239D (SEQ ID NO: 11) GAGGGTGTCCTTGGGTTTTGGG GGAARGAGGAAGACATCCGGTCCCCCTAMGAG TTCAGGTGCTGGGCACGGTG 3Fw (SEQ ID NO: 12) CCCAAAACCCAAGGACACCCTC ATGATCTCCCGGA CCCCTGAGGTCACATGCGTG 4Rv (SEQ ID NO: 13) CAGTTGAACTTGACCTCAGGGTCTTC GTGGCTCACGTCTWCCAC CACGCATGTGACCTCAGGGG 4Rv S267E (SEQ ID NO: 14) CAGTTGAACTTGACCTCAGGGTCTTC GTGTTCCACGTCTWCCAC CACGCATGTGACCTCAGGGG 5Fw (Sequence Listing 15 sequence) GAAGACCCTGAGGTCAAGTTCAACTG GTACGTGGACGGCGTG GAGGTGCATAATGCCAAGACAAAGCCG 6Rv (SEQ ID NO: 16 sequence) GGTGAGGACGCTGACCACACG GTACGCGCYGTTGTATYGCTCCTCTSG CGGCTTTGTCTTGGCATTATGCACCTC 6Rv Y300V (SEQ ID NO: 17 sequence) GGTGAGGACGCTGACCACACG CACCGCGCYGTTGTATYGCTCCTCTSG CGGCTTTGTCTTGGCATTATGCACCTC 7Fw (SEQ ID NO: 18) CGTGTGGTCAGCGTCCTCACC GTCCTGCACCAGGACTGGCTGAAT GGCAAGGAGTACAAGTGCAAGGTC 8Rv (SEQ ID NO: 19 sequence) CTGCCCTTTGGCTTTGGAGATGGTTTT CTCGATTGSTRMTGGMVHGKMTWTGTTGGA GACCTTGCACTTGTACTCCTTGCC 8Rv I332Y (Sequence Listing 20 sequence) CTGCCCTTTGGCTTTGGAGATGGTTTT CTCATATGSTRMTGGMVHGKMTWTGTTGGA GACCTTGCACTTGTACTCCTTGCC 8Rv I332E (SEQ ID NO: 21 sequence) CTGCCCTTTGGCTTTGGAGATGGTTTT CTCTTCTGSTRMTGGMVHGKMTWTGTTGGA GACCTTGCACTTGTACTCCTTGCC 9 Fw (SEQ ID NO: 22) AAAACCATCTCCAAAGCCAAAGGGCAG CCCCGAGAACCACAGGTGTACRCA CTGCCCCCATCCCGGGATG 10Rv (SEQ ID NO: 23) Gt; 11 Fw (SEQ ID NO: 24) CTGGTCAAAGGCTTCTATCCCAGC GACATCGCCGTGGAGTGGGWA AGCAATGGGCAGCCGGAGAAC 12Rv (SEQ ID NO: 25 sequence) GAGGAAGAAGGAGCCGTCGGAG TCCAGCACGGGAGGTGTGGTCTTGTAGTY GTTCTCCGGCTGCCCATTGCT 12Rv P396L (Sequence Listing 26 sequence) GAGGAAGAAGGAGCCGTCGGAG TCCAGCACCAGAGGTGTGGTCTTGTAGTY GTTCTCCGGCTGCCCATTGCT 13Fw (SEQ ID NO: 27) CTCCGACGGCTCCTTCTTCCTC TACAGCAAGCTCACCGTGGACAAGAGCAG GTGGCAGCAGGGGAACGTCTTC 14Rv (SEQ ID NO: 28) TTTACCCGGGGACAGGGAGAGG CTCTTCTGCGTGTAGTGGTTGTGCAGAGCCTCATGSAKCACGGAGCATGA GAAGACGTTCCCCTGCTGCCAC Pro-amplification Rv (SEQ ID NO: 29 sequence) CTCTAG GGCCCCCGAGGCCCC GTGGCAGCAGGGGAACGTCTTC

Example  11: Screening of built libraries

The constructed library was cultured in 25 ml of TB medium (Becton, Dickinson and Company, New Jersey, USA) + 2% glucose (Sigma Aldrich, Missouri, USA) , The cells were inoculated at 1: 100 in terrific broth and cultured at 37 ° C until OD600 reached 0.5. After the incubation, induction was carried out for 5 hours at 25 ° C using 1 mM IPTG (Biosesang (Sungnam, South Korea)), and the cell solution was recovered at 8 / OD600 after induction. The recovered cells were washed with 1 ml of Tris-HCl (pH 8.0), centrifuged at 14000 rpm for 1 minute, and the same operation was performed once more. The recovered cells were then resuspensioned with 1 ml of STE (0.5 M Sucrose-10 mM Tris-10 mM EDTA (pH 8.0)) and stirred at 37 ° C for 30 minutes. After stirring, the cells were centrifuged at 14,000 rpm for 1 minute and solubilized with solution A (0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8). After centrifugation at 14,000 rpm for 1 minute, the pellet was resuspended in solution A containing 1 mg / ml lysozyme (Sigma Aldrich, Missouri, USA) and stirred at 37 ° C for 15 minutes. The agitated cells were centrifuged at 14000 rpm for 1 minute and then dissolved with 1 ml of PBS. The mixture was mixed with PBS containing fluorescently labeled FcγRIIIa at a ratio of 7:15 to make 1 ml, and the mixture was stirred at room temperature for 1 hour. The fluorescently labeled spheroplasts were centrifuged at 14,000 rpm for 1 minute, washed with PBS, and centrifuged again at 14,000 rpm for 1 minute.

Sprague-lavaged endothelial cells with FcγRIIIa were diluted in 1 × PBS at a ratio of 1:15 and screened using a flow cell analyzer (S3 cell sorter, BioRad). Since the high fluorescence intensity of spiroflavast, which is indicated by fluorescence-labeled FcγRIIIa, means that it has a mutant with high affinity for FcγRIIIa, the top 3% of the fluorescence intensity is collected through screening . Screening of the recovered spooflast was performed by flow cytometry again to remove negative clones that were recovered in the screening process and to increase the proportion of mutants having high affinity for FcγRIIIa. The obtained spiroplast was amplified and recovered by PCR using positive mutant DNA, and cloned into a display vector to construct a library. After this screening, the library construction process was repeated five times in total, and as the screening progressed, the library was amplified with mutants having higher affinity for FcγRIIIa by gradually decreasing the concentration of the fluorescent label FcγRIIIa used.

Example  12: Library evaluation and individual after screening Mutant  analysis

After 5 repetitive screenings, the libraries constructed in all the screening steps and the starting library were cultured in 25 ml of TB + 2% glucose medium in 250 ml plats at 37 ° C for 4 hours, : 100 and the cultivation was continued at 37 ° C until OD600 reached 0.5. After the incubation, induction was carried out for 5 hours at 25 ° C using 1 mM IPTG. After induction, 8 ml / OD600 cells were recovered. In addition, 5 ml of TB + 2% glucose medium was inoculated into the untreated wild-type Fc test tube used as the comparative group, pre-cultured overnight at 37 ° C, and then cultured in 5 ml of TB medium Cell recovery was performed. All collected libraries and comparative groups were subjected to the same method as described above, and their fluorescence intensities were compared (Guava, Millipore). As a result, only mutants having high affinity for FcγR were selected The library exhibited higher FcγRIIIa affinity than the wild type amorphous Fc, and as screening progressed, it was confirmed that the ratio of mutants having high affinity to FcγRIIIa in the library was amplified (FIG. 6).

 After confirming that the screening using the library was completed successfully, the individual mutants were selected from the libraries constructed after the last round screening to measure the binding capacity of the mutants to FcγRIIIa. The test tube was inoculated with 5 ml of TB + 2% glucose medium and incubated overnight at 37 ° C. The cells were inoculated at a ratio of 1: 100 in 5 ml of TB medium and cultured at 37 ° C until OD600 reached 0.5. Induction was carried out at 25 ° C for 5 hours using 1 mM IPTG. After the induction was completed, E. coli was harvested by an amount of 8 ml / OD600, and the spore-rotast of the individual mutants was prepared through the above-described sparrowlasting process. Then, the intensity of the fluorescence was measured by a flow cytometer Respectively. As a result, mutants showing particularly high affinity to Fc [gamma] RIIIa among 100 individual mutants were selected and identified (Table 4, Figures 7 and 8)

Name and variation location of the excavated variants Mutant Mutation location HW 25 V264E / S298G / T299A / Y300L / K326I / A327Y / L328G / D357G / E382V / N390D / F405S HW 86 V264E / S298G / T299A / K326I / A327Y / L328G / T350A / E382V / N390D / T394A / M428L

(Mutation positions are determined according to the EU index number as in the Kabat EU numbering system (Kabat et al., In Proteins of Immunological Interest 5th ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242, 1991)

Example  13: Excavated Mutants  Additional experiments using

HW 25 and HW 86 discovered unintended mutations introduced during the PCR process to amplify DNA during the screening process, rather than the locations of mutations envisioned for building libraries. To confirm the effect of these mutations on the affinity to FcγRIIIa, PCR was carried out using Quik change kit (Agilent) to return each mutation to the wild-type Fc sequence. The cloned mutants were analyzed by flow cytometry To compare the affinity for Fc [gamma] RIIIa. In the case of HW 25, returning D357G and F405S back to 357D and 405F, both of the mutations were found to contribute to the enhancement of affinity to FcγRIIIa (FIG. 9).

In the case of T394A, this T394A mutation was introduced into Fc 1004 / IYG, a mutant possessed by the present inventors. After the cloning was completed, the affinity for Fc [gamma] RIIIa was analyzed through a flow cytometer and it was confirmed that the affinity for Fc [gamma] RIIIa was increased by introducing the T394A mutation (FIG. 10).

Example  14: in animal cells IgG  Expression and purification

Experiments were carried out to express and purify the mutant and the control group as proteins for further experiments. The display proceeds in the form of antibody Fc. To analyze the effect, the expression should be purified in the form of antibody. Therefore, a DNA coding for the antibody heavy chain is obtained by linking with DNA encoding VH-CH1 of trastzumab, HII / Xba I < / RTI > PMAZ-IgH (No. 25), pMAZ-IgH (No), and pMAZ-IgH (trp) were obtained by treating with restriction enzyme Bss HII / Xba I and then ligation, .25-DG), and pMAZ-IgH (No. 86). The pMAZ plasmid encoding the light chain of trastzumab was transformed into HEK293F to express the antibody.

Then, the cells were centrifuged at 3000 × g for 20 minutes, and the supernatant was collected. The supernatant was collected, diluted with 25 × PBS to 1 × PBS, and filtered with a 0.22 uM filter. The protein solution was equilibrated with 1 × PBS in the supernatant. The column was filled with resin and 1 × PBS was flowed 50 times the resin volume. Then, the antibody bound to 100 mM glycine (pH 3.0) was taken and immediately neutralized with neutral pH by adding 1 M Tris (pH 8.0). The purified antibody was centrifuged through a 3 kDa column tube at 7,500 x g for 25 minutes and then filled with 1 x PBS. After centrifugation at 7,500 x g for 25 minutes, 1 x PBS was repeated to repeat the procedure. The ratio of 1 x PBS was set to 99% or more.

Example  15: In E. coli IgG  Expression and purification

Full-length trastzumab was expressed and purified in E. coli for use as an additional control. First, a plasmid was constructed using the PelB signaling protein while encoding the heavy and light chains of trastzumab. This plasmid was introduced into MG1655 Escherichia coli as a plasmid encoding DsbC-chaperon, and was transformed into R / 2 medium (KH ₂ PO ₄ 6.75 g / l, (NH ₄ ) ₂ HPO ₄ 2.0 g / l, citric acid monohydrate 0.93 g / _{l, MgSO 4 .7H 2 O 0.7} g / l, TMS 5.0 ml / l, 2% glucose) in the after subculturing, after creating the R / 2 medium in a 2 L jar fermantor 1: 100 dilution in a ratio of And the cultivation was continued. Then, the culture was performed so that the OD600 was 70, and the induction was performed using 1 mM IPTG. Escherichia coli was resuspended in 1.2 L of 100 mM Tris, 10 mM of EDTA (pH 7.4), lysozyme was added in an amount of 4 mg / wet cell g and incubated at 30 ° C for 16 hours and the E. coli was disrupted by incubation. The disrupted Escherichia coli was centrifuged at 14,000 x g for 30 minutes, and the supernatant was recovered and purified by the method described above.

Example  16: ADCC  Analysis of the cancer cell death effect

SKBC-3, a target cell for measuring ADCC, was cultured in McCoy's medium + 10% FBS + 1 x anti-anti at 37 ° C and 5% CO ₂ and then assay buffer (RPMI + 10% heat inactivated FBS + 30 ng / ml recombinant human IL-2) and inoculated in a 96-well plate (V-bottom) at 1 × 10 ⁴ cells / 50 μl / well per well. Serial dilutions of IgG expressed in animal cells in 1/5 of the highest concentration of 20 μg / ml to 0 μg / ml in the assay buffer were prepared at a total of 8 concentrations, and 10 μl of each of the SKBR-3 cells After the addition, the cells were cultured at 37 ° C and 5% CO ₂ for 1 hour. The PBMC were then rapidly dissolved in a 37 ° C water bath for 2-3 minutes, transferred to a 50 ml tube, treated with 10 ml of anti-aggregation buffer (1 ml of CTL Anti-aggregate Wash ^™ 20xSolution + Was mixed well, and the supernatant was carefully removed by centrifugation at 300 g for 10 minutes, 10 ml of an anti-clotting buffer was added, and the cells were suspended. After centrifugation at 300 × g for 10 minutes, the supernatant was carefully removed, and 1 ml of assay buffer was added to suspend the cells. The PBMCs were diluted in assay buffer at a concentration of 2.5 × 10 ⁶ cells / mL, added with 50 μl / well of each well of the target cells and the plate, and incubated at 37 ° C in a 5% CO ₂ incubator Lt; / RTI > After 4 hours, centrifugation was carried out at 300 × g for 5 minutes. 50 μl of the supernatant was transferred to SpectraPlate 96-well plate, and 50 μl of CytoTox 96 Reagent was added to each well. μl reaction termination solution (provided by the CytoTox 96 Non-Radioactive Cytotoxicity assay kit) was added to the reaction solution, and the absorbance at 490 nm was measured with VersaMax and the result was collected. As a result, it was observed that HW 86 increased the ADCC effect by a factor of about 2 compared with the wild-type trastzumab (FIG. 11).

<110> Kookmin University Industry Academy Cooperation Foundation <120> Multimeric Protein Display System using Cell Membrane Fluidity <130> HP7488 <160> 46 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MJ # 1 <400> 1 ccaggcttta cactttatgc 20 <210> 2 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> MJ # 183 <400> 2 cgaactggcc cagccggcca tggcggacaa aactcacaca tg 42 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MJ # 184 <400> 3 agttcgggcc cccgaggccc ctttacccgg ggacagggag 40 <210> 4 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> MJ # 228 <400> 4 cgcagcgagg cccagccggc catggcggac atccagatga ctcaatcacc cagttcac 58 <210> 5 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> MJ # 229 <400> 5 cttaacgcgg cccccgaggc cccggtccgc ttaatctcca ctttggttcc 50 <210> 6 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> MJ # 232 <400> 6 cgcagcgagg cccagccggc catggcggaa gtccagctgg tggagtccg 49 <210> 7 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> MJ # 233 <400> 7 cttaacgcgg cccccgaggc cccactgctt actgtaacaa gagtgccctg 50 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> MJ # 236 <400> 8 ccctaaaatc tagactatta ggcgcgccct ttgtcatc 38 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> 1Fw <400> 9 gacaaaactc acacatgccc accgtgccca gcacctgaa 39 <210> 10 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> 2Rv <400> 10 gagggtgtcc ttgggttttg ggggaargag gaagactgac ggtcccccta mgagttcagg 60 tgctgggcac ggtg 74 <210> 11 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> 2Rv S239D <400> 11 gagggtgtcc ttgggttttg ggggaargag gaagacatcc ggtcccccta mgagttcagg 60 tgctgggcac ggtg 74 <210> 12 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> 3Fw <400> 12 cccaaaaccc aaggacaccc tcatgatctc ccggacccct gaggtcacat gcgtg 55 <210> 13 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> 4Rv <400> 13 cagttgaact tgacctcagg gtcttcgtgg ctcacgtctw ccaccacgca tgtgacctca 60 gggg 64 <210> 14 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> 4Rv S267E <400> 14 cagttgaact tgacctcagg gtcttcgtgt tccacgtctw ccaccacgca tgtgacctca 60 gggg 64 <210> 15 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> 5Fw <400> 15 gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 60 acaaagccg 69 <210> 16 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> 6Rv <400> 16 ggtgaggacg ctgaccacac ggtacgcgcy gttgtatygc tcctctsgcg gctttgtctt 60 ggcattatgc acctc 75 <210> 17 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> 6Rv Y300V <400> 17 ggtgaggacg ctgaccacac gcaccgcgcy gttgtatygc tcctctsgcg gctttgtctt 60 ggcattatgc acctc 75 <210> 18 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> 7Fw <400> 18 cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 60 tgcaaggtc 69 <210> 19 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> 8Rv <400> 19 ctgccctttg gctttggaga tggttttctc gattgstrmt ggmvhgkmtw tgttggagac 60 cttgcacttg tactccttgc c 81 <210> 20 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> 8Rv I332Y <400> 20 ctgccctttg gctttggaga tggttttctc atatgstrmt ggmvhgkmtw tgttggagac 60 cttgcacttg tactccttgc c 81 <210> 21 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> 8Rv I332E <400> 21 ctgccctttg gctttggaga tggttttctc ttctgstrmt ggmvhgkmtw tgttggagac 60 cttgcacttg tactccttgc c 81 <210> 22 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> 9Fw <400> 22 aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtacrc actgccccca 60 tcccgggatg 70 <210> 23 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> 10Rv <400> 23 gctgggatag aagcctttga ccaggcaggt caggctgacc tggttcttgg tcagctcatc 60 ccgggatggg ggcag 75 <210> 24 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> 11Fw <400> 24 ctggtcaaag gcttctatcc cagcgacatc gccgtggagt gggwaagcaa tgggcagccg 60 gagaac 66 <210> 25 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> 12Rv <400> 25 gaggaagaag gagccgtcgg agtccagcac gggaggtgtg gtcttgtagt ygttctccgg 60 ctgcccattg ct 72 <210> 26 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> 12Rv P396L <400> 26 gaggaagaag gagccgtcgg agtccagcac cagaggtgtg gtcttgtagt ygttctccgg 60 ctgcccattg ct 72 <210> 27 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> 13Fw <400> 27 ctccgacggc tccttcttcc tctacagcaa gctcaccgtg gacaagagca ggtggcagca 60 ggggaacgtc ttc 73 <210> 28 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> 14Rv <400> 28 tttacccggg gacagggaga ggctcttctg cgtgtagtgg ttgtgcagag cctcatgsak 60 cacggagcat gagaagacgt tcccctgctg ccac 94 <210> 29 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Pro-amplificationRv <400> 29 ctctagggcc cccgaggccc cgtggcagca ggggaacgtc ttc 43 <210> 30 <211> 1167 <212> DNA <213> Artificial Sequence <220> <223> WT Fc-gIII <400> 30 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240 cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300 tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggagagca atgggcagcc ggagaacaac tacaagacca cacctcccgt gctggactcc 540 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa aggggcctcg ggggccgaag gcggcggttc tggttccggt 720 gattttgatt atgaaaagat ggcaaacgct aataaggggg ctatgaccga aaatgccgat 780 gaaaacgcgc tacagtctga cgctaaaggc aaacttgatt ctgtcgctac tgattacggt 840 gctgctatcg atggtttcat tggtgacgtt tccggccttg ctaatggtaa tggtgctact 900 ggtgattttg ctggctctaa ttcccaaatg gctcaagtcg gtgacggtga taattcacct 960 ttaatgaata atttccgtca atatttacct tccctccctc aatcggttga atgtcgccct 1020 tttgtcttta gcgctggtaa accatatgaa ttttctattg attgtgacaa aataaactta 1080 ttccgtggtg tctttgcgtt tcttttatat gttgccacct ttatgtatgt attttctacg 1140 tttgctaaca tactgcgtaa taaggag 1167 <210> 31 <211> 1167 <212> DNA <213> Artificial Sequence <220> <223> MG48-gIII <400> 31 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg aggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240 cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300 tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360 gggcagcccc gagaccaca ggtgtacgcc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggagagca atgggcagcc ggagaacaac tacaagacca cacctcccgt gctggactcc 540 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa aggggcctcg ggggccgaag gcggcggttc tggttccggt 720 gattttgatt atgaaaagat ggcaaacgct aataaggggg ctatgaccga aaatgccgat 780 gaaaacgcgc tacagtctga cgctaaaggc aaacttgatt ctgtcgctac tgattacggt 840 gctgctatcg atggtttcat tggtgacgtt tccggccttg ctaatggtaa tggtgctact 900 ggtgattttg ctggctctaa ttcccaaatg gctcaagtcg gtgacggtga taattcacct 960 ttaatgaata atttccgtca atatttacct tccctccctc aatcggttga atgtcgccct 1020 tttgtcttta gcgctggtaa accatatgaa ttttctattg attgtgacaa aataaactta 1080 ttccgtggtg tctttgcgtt tcttttatat gttgccacct ttatgtatgt attttctacg 1140 tttgctaaca tactgcgtaa taaggag 1167 <210> 32 <211> 789 <212> DNA <213> Artificial Sequence <220> <223> NlpA-WT Fc <400> 32 atgaaactga caacacatca tctacggaca ggggccgcat tattgctggc cggaattctg 60 ctggcaggtt gcgaccagag tagcagcgag gcccagccgg ccatggcgga caaaactcac 120 acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 180 ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 240 gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 300 cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 360 gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 420 aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 480 gaaccacagg tgtacaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 540 ctgacctgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 600 gggcagccgg agaacaacta caagaccaca cctcccgtgc tggactccga cggctccttc 660 ttcctctaca gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca 720 tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtcc 780 ccgggtaaa 789 <210> 33 <211> 789 <212> DNA <213> Artificial Sequence <220> <223> NlpA-MG48 <400> 33 atgaaactga caacacatca tctacggaca ggggccgcat tattgctggc cggaattctg 60 ctggcaggtt gcgaccagag tagcagcgag gcccagccgg ccatggcgga caaaactcac 120 acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 180 ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggag 240 gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 300 cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 360 gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 420 aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 480 gaaccacagg tgtacgccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 540 ctgacctgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 600 gggcagccgg agaacaacta caagaccaca cctcccgtgc tggactccga cggctccttc 660 ttcctctaca gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca 720 tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtcc 780 ccgggtaaa 789 <210> 34 <211> 1101 <212> DNA <213> Artificial Sequence <220> NLpA-VH (bevacizumab) -FLAG-NlpA-VL (bevacizumab) -His-cMyc <400> 34 atgaaactga caacacatca tctacggaca ggggccgcat tattgctggc cggaattctg 60 ctggcaggtt gcgaccagag tagcagcgag gcccagccgg ccatggcgga agtccagctg 120 gtggagtccg gtggcggcct cgtgcagcct ggggggtcat tgcgcctatc atgcgcagcc 180 tccggatata cttttacaaa ctacggaatg aactgggtgc ggcaagcccc cggaaaaggc 240 ctggagtggg tgggttggat caatacctat accggtgaac caacatatgc tgctgacttc 300 aagaggagat ttaccttctc cctggacact agtaagtcta cagcttatct gcagatgaat 360 agcctgcgag ccgaggatac cgcagtttat tactgtgcta aatatcctca ctattatgga 420 tcttctcact ggtattttga tgtgtggggc cagggcactc ttgttacagt aagcagtggg 480 gcctcggggg ccgaattcgc ggccgctgca ccagattata aagatgacga tgacaaaggg 540 cgcgcctaat agtctagaga aggagatata catatgaaac tgacaacaca tcatctacgg 600 acaggggccg cattattgct ggccggaatt ctgctggcag gttgcgacca gagtagcagc 660 gaggcccagc cggccatggc ggacatccag atgactcaat cacccagttc actgtctgcg 720 tctgttgggg atcgggtgac cattacgtgc tccgcctctc aagacattag taactatctc 780 aactggtatc aacagaaacc aggcaaagcc cctaaggtgt tgatatactt cacctccagc 840 ctgcacagcg gtgttccgtc acgcttttct ggcagtggct ccgggacgga cttcacactc 900 acaatctcga gcctgcaacc cgaggacttc gcaacctact attgccagca gtactccacc 960 gtcccctgga cctttggcca gggaaccaaa gtggagatta agcggaccgg ggcctcgggg 1020 gccgaattcg cggccgcagt cgaccatcat catcaccatc acggggccgc agaacaaaaa 1080 ctcatctcag aagaggatct g 1101 <210> 35 <211> 389 <212> PRT <213> Artificial Sequence <220> <223> WT Fc-gIII <400> 35 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys Gly Ala Ser Gly Ala Glu Gly Gly Gly Gly Ser Gly Ser Gly 225 230 235 240 Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr                 245 250 255 Glu Asn Ala Asp Glu Asn Ala Leu Gln Ser Asp Ala Lys Gly Lys Leu             260 265 270 Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly         275 280 285 Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala     290 295 300 Gly Ser Asn Ser Gln Met Ala Gln Val Gly Asp Gly Asp Asn Ser Pro 305 310 315 320 Leu Met Asn Asn Phe Arg Gln Tyr Leu Pro Ser Leu Pro Gln Ser Val                 325 330 335 Glu Cys Arg Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser             340 345 350 Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu         355 360 365 Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile     370 375 380 Leu Arg Asn Lys Glu 385 <210> 36 <211> 389 <212> PRT <213> Artificial Sequence <220> <223> MG48-gIII <400> 36 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Ala Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys Gly Ala Ser Gly Ala Glu Gly Gly Gly Gly Ser Gly Ser Gly 225 230 235 240 Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr                 245 250 255 Glu Asn Ala Asp Glu Asn Ala Leu Gln Ser Asp Ala Lys Gly Lys Leu             260 265 270 Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly         275 280 285 Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala     290 295 300 Gly Ser Asn Ser Gln Met Ala Gln Val Gly Asp Gly Asp Asn Ser Pro 305 310 315 320 Leu Met Asn Asn Phe Arg Gln Tyr Leu Pro Ser Leu Pro Gln Ser Val                 325 330 335 Glu Cys Arg Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser             340 345 350 Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu         355 360 365 Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile     370 375 380 Leu Arg Asn Lys Glu 385 <210> 37 <211> 263 <212> PRT <213> Artificial Sequence <220> <223> NlpA-WT Fc <400> 37 Met Lys Leu Thr Thr His Leu Arg Thr Gly Ala Ala Leu Leu   1 5 10 15 Ala Gly Ile Leu Leu Ala Gly Cys Asp Gln Ser Ser Ser Glu Ala Gln              20 25 30 Pro Ala Met Ala Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro          35 40 45 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys      50 55 60 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val  65 70 75 80 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp                  85 90 95 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr             100 105 110 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp         115 120 125 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu     130 135 140 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 145 150 155 160 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys                 165 170 175 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp             180 185 190 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys         195 200 205 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser     210 215 220 Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 225 230 235 240 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser                 245 250 255 Leu Ser Leu Ser Pro Gly Lys             260 <210> 38 <211> 263 <212> PRT <213> Artificial Sequence <220> <223> NlpA-MG48 <400> 38 Met Lys Leu Thr Thr His Leu Arg Thr Gly Ala Ala Leu Leu   1 5 10 15 Ala Gly Ile Leu Leu Ala Gly Cys Asp Gln Ser Ser Ser Glu Ala Gln              20 25 30 Pro Ala Met Ala Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro          35 40 45 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys      50 55 60 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu  65 70 75 80 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp                  85 90 95 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr             100 105 110 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp         115 120 125 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu     130 135 140 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 145 150 155 160 Glu Pro Gln Val Tyr Ala Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys                 165 170 175 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp             180 185 190 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys         195 200 205 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser     210 215 220 Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 225 230 235 240 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser                 245 250 255 Leu Ser Leu Ser Pro Gly Lys             260 <210> 39 <211> 367 <212> PRT <213> Artificial Sequence <220> NlpA-VH (bevacizumab) -NlpA-VL (bevacizumab) <400> 39 Met Lys Leu Thr Thr His Leu Arg Thr Gly Ala Ala Leu Leu   1 5 10 15 Ala Gly Ile Leu Leu Ala Gly Cys Asp Gln Ser Ser Ser Glu Ala Gln              20 25 30 Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val          35 40 45 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr      50 55 60 Phe Thr Asn Tyr Gly Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly  65 70 75 80 Leu Glu Trp Val Gly Trp Ile Asn Thr Tyr Thr Gly Glu Pro Thr Tyr                  85 90 95 Ala Ala Asp Phe Lys Arg Arg Phe Thr Phe Ser Leu Asp Thr Ser Lys             100 105 110 Ser Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala         115 120 125 Val Tyr Tyr Cys Ala Lys Tyr Pro His Tyr Tyr Gly Ser Ser His Trp     130 135 140 Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly 145 150 155 160 Ala Ser Gly Ala Glu Phe Ala Ala Ala Ala Pro Asp Tyr Lys Asp Asp                 165 170 175 Asp Asp Lys Gly Arg Ala *** *** Ser Arg Glu Gly Asp Ile His Met             180 185 190 Lys Leu Thr Thr His Leu Ala Leu Leu Ala         195 200 205 Gly Ile Leu Leu Ala Gly Cys Asp Gln Ser Ser Ser Glu Ala Gln Pro     210 215 220 Ala Met Ala Asp Ile Gln Met Thr Gln Ser Ser Ser Ser Leu Ser Ala 225 230 235 240 Ser Val Gly Asp Arg Val Thr Ile Thr Cys Ser Ala Ser Gln Asp Ile                 245 250 255 Ser Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys             260 265 270 Val Leu Ile Tyr Phe Thr Ser Ser Leu His Ser Gly Val Ser Ser Arg         275 280 285 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser     290 295 300 Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Thr 305 310 315 320 Val Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr                 325 330 335 Gly Ala Ser Gly Ala Glu Phe Ala Ala Ala Val Asp His His His             340 345 350 His His Gly Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu         355 360 365 <210> 40 <211> 227 <212> PRT <213> Homo sapiens <400> 40 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 41 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> HW25 <400> 41 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Leu  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Gly Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 42 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> HW25-G357D <400> 42 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Leu  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 43 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> HW25-S405F <400> 43 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Leu  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Gly Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 44 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> HW25-G357D, S405F <400> 44 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Leu  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 45 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> HW86 <400> 45 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Ala Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Ala Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 46 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Fc1004 / IYG-T394A <400> 46 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Ala Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225

Claims (15)

A method for producing a multimeric target protein display system comprising the steps of:
(a) a vector comprising (i) a nucleotide sequence encoding a monomer and anchor polypeptide of the target protein to be displayed and (ii) a vector comprising a promoter operatively linked to the coding nucleotide sequence Constructing a second image;
(b) transforming the microorganism with the vector;
(c) culturing the transformed microorganism to express a monomer of the target protein fused with the anchor polypeptide, wherein the anchor polypeptide is anchored to the inner membrane of the microorganism, and the monomer of the target protein is the protoplasm of the microorganism Displayed in a periplasmic region; And
(d) the monomer of the objective protein to which the anchor polypeptide is fused is self-assemble by membrane fluidity to form a multimer.
The method according to claim 1, wherein the target protein is in a multimer form including a dimer.
3. The method of claim 2, wherein the target protein is selected from the group consisting of an antibody, an antibody antigen binding region (VH or VL), an scFv, a Fab, an Fc protein, a G protein, a hemoglobin, M- CSF, CD28, an interleukin, Or a fragment thereof.
The method according to claim 1, wherein the monomer of the target protein is an Fc protein monomer or a fragment thereof.
The method according to claim 1, wherein the monomer of the target protein is one or more monomers selected from the group consisting of heavy chain variable region (VH), light chain variable region (VL) and fragments thereof.
2. The method of claim 1, wherein the anchor polypeptide is selected from the group consisting of gIII protein, NlpA leader peptide, MalF, Pf3 coat protein, M13 pro coat protein, ProW Nt / TM1 / 3K and KdpD protein.
The method according to claim 1, wherein the microorganism is a bacterial cell.
A monomer of a target protein to which the anchor polypeptide is fused is prepared by the method of claim 1, and the monomer protein of the self protein is fused to the self protein by the membrane fluidity of the microbial cell membrane, Wherein the microorganism is self-assemble to form a multimer and is displayed in a periplasmic region of the microorganism.
9. A composition for a target protein display comprising a monomer of a target protein to which an anchor polypeptide of claim 8 is fused, a nucleic acid molecule that encodes a monomer of a target protein fused with said anchor polypeptide, or a vector comprising said nucleic acid molecule.
10. The composition of claim 9, wherein the monomer of the target protein to which the anchor polypeptide is fused comprises a sequence selected from the group consisting of SEQ ID NOS: 35 to 39.
10. The composition of claim 9, wherein the nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOS: 30 to 34.
A method of screening Fc variants with enhanced affinity for Fc [gamma] R comprising the steps of:
(a) a vector comprising (i) a nucleotide sequence encoding a monomer and anchor polypeptide of the Fc variant to be displayed and (ii) a vector comprising a promoter operably linked to the coding nucleotide sequence Constructing a second image;
(b) transforming the microorganism with the vector;
(c) culturing the transformed microorganism to express a monomer of an Fc variant fused with the anchor polypeptide, wherein the anchor polypeptide is anchored to the inner membrane of the microorganism, and the monomer of the Fc variant is a protoplast of the microorganism Displayed in a periplasmic region;
(d) the monomer of the Fc variant to which the anchor polypeptide is fused is self-assembled by membrane fluidity to form a dimer; And
(e) treating the microorganism displaying the dimer of the Fc variant with Fc [gamma] R, and comparing the binding force against Fc [gamma] R with the case of wild type Fc.
13. The method of claim 12, wherein said Fc variant comprises one or more amino acid substitutions selected from the group consisting of the following amino acid substitutions according to Kabat numbering system: L235V, G236A, S239D, F243L, V264E, S267E, R292P, Q295R, S298G, T299A, Y300L, K326I, A327Y, L328F, L328G, L328W, A330L, P331A, I332E, I332Y, T350A, D357G, E382V, N390D, T394A, P396L, F405S, M428I and M428L.
A method for screening an antigen binding region (VH or VL) having a binding force for an antigen comprising the steps of:
(a) a vector comprising (i) a nucleotide sequence encoding an heavy chain or light chain variable region of an antibody to be displayed and an anchor polypeptide, and (ii) a vector comprising a promoter operatively linked to the coding nucleotide sequence Constructing a second image;
(b) transforming the microorganism with the vector;
(c) culturing the transformed microorganism to express a heavy or light chain variable region of the antibody fused with the anchor polypeptide, wherein the anchor polypeptide is anchored to the inner membrane of the microorganism and the heavy or light chain variable Wherein the site is displayed in a periplasmic region of the microorganism;
(d) The heavy or light chain variable region of the antibody fused with the anchor polypeptide is self-assemble with the light or heavy chain variable region of the antibody by membrane fluidity of the antibody to form a multimer ; And
(e) treating the antigen with the microorganism for which the complex is displayed.
15. The screening method according to claim 14, wherein the nucleotide sequence encoding the heavy chain variable region of the antibody and the nucleotide sequence encoding the light chain variable region are constructed in the same vector or constructed in different vectors.

Images