KR101900384B1 - Aglycosylated Antibody Fc Region Exhibiting Enhanced Binding Specificity to an Fcγ Receptor - Google Patents

Abstract

The present invention relates to a polypeptide comprising an Fc domain in which part of the amino acid sequence of the human antibody Fc domain is replaced with another amino acid sequence, or to an immobilized antibody comprising the same. The Fc domain of the present invention is optimized for substitution of some amino acid sequences of a wild-type Fc domain with another amino acid sequence, thereby being excellent in the selective binding ability to FcγRIIIa among Fc receptors and being useful for the treatment of cancer. .

Description

Aglycosylated Antibody Fc Region Exhibits Enhanced Binding Specificity to an Fc < RTI ID = 0.0 > Receptor < / RTI >

The present invention relates to an immobilized antibody Fc region with improved binding specificity for an Fc [gamma] receptor and to a method for its preparation.

Studies on the structure and function of proteins have been actively conducted according to the development of biotechnology such as genetic recombination and cell culture all over the world. This not only enhances understanding of life phenomena, The role plays a role in the improvement of quality of life by providing effective disease diagnosis and treatment. Particularly, in 1975, a hybridoma technology was developed (Kohler and Milstein, Nature , 256: 495-497, 1988) which produces monoclonal antibodies by fusing B cells and Myeoloma cells, 1975), there has been active research and development on immunotherapy using therapeutic antibodies in clinical fields such as cancer, autoimmune diseases, inflammation, cardiovascular diseases, and infections.

Therapeutic antibodies are considered to be one of the most effective cancer treatment methods because they exhibit very high specificity to the target, low bio-toxicity and low side effects, as well as excellent blood half-lives of about 3 weeks, compared with conventional low-molecular drugs. In fact, major pharmaceutical companies and laboratories around the world are spurring research and development on therapeutic antibodies that specifically bind to cancer cells, including cancer-causing factors and effectively eliminate them. Roche is a leading company in the development of therapeutic antibody medicines including Roche, Amgen, Johnson & Johnson, Abbott and BMS. Especially Roche has developed Herceptin, Avastin, Rituxan ) Is a representative product. With these three therapeutic antibodies, it generates a huge profit of around US $ 19.5 billion in the global market in 2012, and is leading the global antibody drug market. Johnson & Johnson, who developed Remicade, is also growing rapidly in the global antibody market due to increased sales, and pharmaceutical companies such as Abbott and BMS are also known to have a number of therapeutic antibodies at the developmental stage. As a result, biopharmaceuticals, including therapeutic antibodies specific to disease targets and low side effects, are rapidly replacing the global pharmaceutical market, where low-molecular drugs have taken the initiative.

One of the most important mechanisms of the therapeutic antibody is to collect the immune cells and transfer them to the target antigen. The Fc domain of the antibody plays a crucial role in the immune cell recruitment and antibody-dependent cell-mediated cytotoxicity (ADCC). In particular, the ADCC function of the antibody depends on the interaction with the Fc receptor (FcR) present on the surface of many cells. Human Fc receptors are classified into five categories, and the type of immune cells to be recruited depends on which Fc receptor the antibody binds to. Thus, attempts to modify antibodies to recruit specific cells can be of great importance in the therapeutic field.

However, to date, most attempts have been to modify the Fc domain using IgG molecules expressed by mammals. The mammalian antibody is glycosylated, and the hydrocarbon chain modified on the glycated antibody Fc region stabilizes the structure of the protein, allowing the antibody to bind to the Fc receptor. In contrast, aglycosylated antibodies produced by bacteria can not bind to Fc receptors because they do not have a chain of hydrocarbons bound to the Fc region and therefore can not exhibit ADCC function. Therefore, if an amelogenous antibody capable of binding to the Fc receptor is developed, it is possible to produce using bacteria, which is not an existing animal cell, and thus it is possible to reduce the production cost.

In addition, antibodies to mammalian cells that have modified the Fc region increase binding capacity for specific Fc receptors, but also retain the binding capacity to other Fc receptors, thus retaining the undesirable immune response. There are five major types of Fc [gamma] R in humans. Four of these receptors induce an immune activation or inflammatory response, and Fc [gamma] RIIb induces immunosuppression or anti-inflammatory responses, with most naturally occurring antibodies or recombinant glycated antibodies binding to both activated and inhibitory Fc receptors. The ADCC-inducing ability of the antibody depends on the ratio of the ability to bind to the activated Fc [gamma] R and the ability to bind the inhibitory Fc [gamma] RIIb (Boruchov et al, J Clin Invest , 115 (10): 2914-23, 2005) . However, due to the fact that Fc [gamma] RIIb has a homology of 96% with the activated Fc [gamma] R, efforts to increase the A / I ratio by introducing a genetic mutation into the glycated antibody have not achieved great results.

In addition, among the various immune cells involved in the cancer cell death mechanism using the therapeutic IgG antibody currently in clinical use, natural killer cells (NK cells) are known to have the most potent cytotoxic killer effect, Unlike cells (eg, monocytes, macrophages, dendritic cells), NK cells express FcγRIIIa on the surface, and FcγRI and FcγRIIa, FcγRIIb, and FcγRIIIb are not expressed. Therefore, it is essential to improve the affinity with FcγRIIIa expressed on the surface of NK cells by optimizing the Fc region of the IgG antibody in order to maximize the mechanism of action of cancer cells to differentiate from existing therapeutic antibodies.

It should be understood that the foregoing description of the background art is merely for the purpose of promoting an understanding of the background of the present invention and is not to be construed as adhering to the prior art already known to those skilled in the art.

The inventors of the present invention have made efforts to develop an immobilized antibody having improved binding ability with FcγRIIIa expressed on the surface of NK cells without the problem of heterogeneity of existing glycated antibodies. As a result, it was confirmed that the binding ability to FcγRIIIa in the Fc receptor was greatly enhanced by substituting some amino acid sequences of the wild-type Fc domain with other amino acid sequences, thereby enhancing the cancer cell killing effect of NK cells, thereby completing the present invention .

Accordingly, it is an object of the present invention to provide a polypeptide comprising an Fc domain in which a part of the amino acid sequence of the human antibody Fc domain is replaced with another amino acid sequence.

It is another object of the present invention to provide an immobilized antibody comprising the polypeptide.

It is still another object of the present invention to provide a nucleic acid molecule encoding the polypeptide.

It is still another object of the present invention to provide a vector comprising the nucleic acid molecule.

It is still another object of the present invention to provide a host cell comprising the vector.

It is another object of the present invention to provide a composition comprising the polypeptide or the nucleic acid molecule.

It is still another object of the present invention to provide a method for producing the polypeptide or the non-glycosylated antibody.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a polypeptide comprising an Fc domain in which a part of the amino acid sequence of the human antibody Fc domain is replaced with another amino acid sequence.

The inventors of the present invention have made efforts to develop an immobilized antibody having improved binding ability with FcγRIIIa expressed on the surface of NK cells without the problem of heterogeneity of existing glycated antibodies. As a result, it was confirmed that the binding ability to FcγRIIIa selectively increased in the Fc receptor by substituting some amino acid sequences of the wild type Fc domain with other amino acid sequences, thereby enhancing the cancer cell killing effect of NK cells.

An antibody is a protein that specifically binds to a specific antigen, and the natural antibody is a heterodimeric glycoprotein of about 150,000 daltons, usually composed of two identical light chains (L) and two identical heavy chains (H).

Human antibodies used in the present invention have five main classes of IgA, IgD, IgE, IgG and IgM, preferably IgG. Papain degradation of the antibody forms two Fab fragments and one Fc fragment, and in the human IgG molecule, the Fc region is generated by papain digestion of the N-terminus of Cys 226 (Deisenhofer, Biochemistry 20: 2361-2370, 1981) .

The antibody Fc domain may be the Fc domain of an IgA, IgM, IgE, IgD, or IgG antibody, or a variant thereof. In one embodiment, the domain is the Fc domain of an IgG antibody (e.g., the Fc domain of an IgG1, IgG2a, IgG2b, IgG3, or IgG4 antibody). In one embodiment, the Fc domain may be an IgGl Fc domain (e. G., The Fc domain of an anti-HER2 antibody, more specifically the Fc domain of trastuzumab). In the polypeptide comprising the Fc domain of the present invention, the entire polypeptide may not be glycosylated or only a part of the polypeptide (for example, Fc domain) may not be glycosylated. In addition, one or more regions derived from an antibody in addition to the Fc domain may be included in the polypeptide. In addition, the polypeptide may comprise an antigen-binding domain from an antibody, and the plurality of polypeptides may form an antibody or antibody-type protein.

As used herein, the amino acid residue number of the antibody Fc domain follows the Kabat EU numbering system commonly used in the art (Kabat et al., In "Proteins of Immunological Interest" 5th Ed., US Department of Health and Human Services, NIH Publication No. 91-3242, 1991).

According to a preferred embodiment of the invention, the substituted Fc domain of the invention comprises the following nine amino acid substitutions according to the Kabat EU numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L .

In one embodiment of the invention, the unmodified Fc domain is mutated to bind to one or more of Fc [gamma] RIa, Fc [gamma] RIIa, Fc [gamma] RIIb, Fc [gamma] RIIc, Fc [gamma] RIIa, Fc [gamma] RIIb or Fc [ Wherein the mutated non-fused Fc domain has a binding affinity for any one or more of the Fc receptors within 10%, within 20%, within 30%, within 40%, within 50%, within 60% More than 2 times, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more than 70%, 80%, 90% or 100% 9 times, 10 times or 20 times or more.

According to a preferred embodiment of the present invention, the Fc domain of the polypeptide of the present invention has improved binding ability to FcγRIIIa as compared to the Fc domain which is not substituted with the above nine amino acids.

According to an embodiment of the present invention, the Fc domain (Fc1004, U.S. Patent No. 8,952,132) substituted only with S298G, T299A, N390D, E382V and M428L does not bind FcγRIIIa as in the wild type Fc domain but does not bind T299A, K326I, A327Y and The Fc domain substituted only with L328G (A / IYG, US Patent No. 8,815,237) is also significantly weaker in binding capacity to Fc [gamma] RIIIa than the wild type Fc domain. It was confirmed that the binding ability of the Fc domain containing the 9 amino acid substitutions of the present invention to Fc [gamma] RIIIa was greatly improved as compared with the wild type Fc domain or Fc1004 or A / IYG (Examples 3 and 4).

According to another aspect of the invention, the present invention provides an aglycosylated antibody comprising said polypeptide.

The term " antibody " as used herein refers to polyclonal antibodies, monoclonal antibodies, human antibodies, and humanized antibodies and fragments thereof.

All currently available therapeutic antibodies are produced from animal cell cultures. When producing antibodies, a variety of carbohydrate mutants are modified into antibody proteins, and the resulting glycan heterogeneity results in variations in the efficacy and stability of the antibody And it requires a lot of cost for purification, analysis and QC (quality control) in the process of manufacturing the antibody.

Compared to the glycated antibody, which requires an expensive animal cell culture system, the aglycosylated antibody is capable of mass production in bacteria and has excellent excellence in terms of speed and cost. However, the N-linked glycans produced in the Asn297 amino acid of the glycated antibody play a crucial role in the structure and function of the antibody. Unlike the glycosylated antibody Fc produced in animal cells, And thus has a closed structure or a flexible structure. Thus, an immobilized antibody can not bind FcγRIIIa, which plays a crucial role in NK cell recruitment and activation, and exhibits a cancer cell death mechanism I can not.

According to a preferred embodiment of the present invention, the present invention relates to the use of an antibody against the glycated heterogeneity problem through optimization of the ungultered antibody Fc region (V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L replaced by nine amino acids) In addition, it can be produced in bacteria at low cost and at the same time, it can maximize the mechanism of cancer cell death by the enhanced binding force with FcγRIIIa expressed on the surface of NK cells.

According to another aspect of the present invention, there is provided a nucleic acid molecule encoding the polypeptide, a vector comprising the nucleic acid molecule, or a host cell comprising the vector.

According to another aspect of the present invention, the present invention provides a method for producing a polypeptide comprising a human antibody Fc domain comprising the steps of:

a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the polypeptide of claim 1; And

b) recovering the polypeptide expressed by said host cell.

According to another aspect of the present invention, the present invention provides a method for producing an immobilized antibody comprising the steps of:

a) culturing a host cell expressing an immortalized antibody comprising the polypeptide of claim 1; And

b) purifying the antibody expressed from said host cell.

The nucleic acid molecules of the present invention may be isolated or recombinant, and include DNA and RNA in single and double stranded form as well as corresponding complementary sequences. &Quot; Isolated nucleic acid " is a nucleic acid isolated from a peripheral genetic sequence present in the genome of an isolated nucleic acid, in the case of a nucleic acid isolated from a naturally occurring source. In the case of a nucleic acid that is enzymatically or chemically synthesized from a template, such as a PCR product, a cDNA molecule, or an oligonucleotide, the nucleic acid generated from such a procedure can be understood as an isolated nucleic acid molecule. The isolated nucleic acid molecule represents a nucleic acid molecule as a separate fragment or as a component of a larger nucleic acid construct. A nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence. For example, the DNA of a full-length or secretory leader is operably linked to the DNA of the polypeptide when expressed as a preprotein in the form before secretion of the polypeptide, and the promoter or enhancer comprises a polypeptide sequence Or the ribosome binding site is operably linked to a coding sequence when it is placed to facilitate translation. Generally, " operably linked " means that the DNA sequences to be ligated are located adjacent to each other, and in the case of a secretory leader, it means that the DNA sequences are adjacent to each other in the same reading frame. However, the enhancer need not be located contiguously. Linking is accomplished by ligation at convenient restriction sites. If such sites are not present, synthetic oligonucleotide adapters or linkers are used according to conventional methods.

As used herein, the term " vector " means a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating a nucleic acid sequence. The nucleic acid sequence may be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids, and viruses (e.g., bacteriophage). Those skilled in the art can establish a vector by standard recombinant techniques (Maniatis, et al, Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al, In:.. Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994).

As used herein, the term " expression vector " means a vector comprising a nucleic acid sequence encoding at least a portion of the gene product to be transcribed. In some cases, the RNA molecules are then translated into proteins, polypeptides, or peptides. The expression vector may contain various regulatory sequences. Vectors and expression vectors may also include nucleic acid sequences that provide another function, as well as regulatory sequences that regulate transcription and translation.

As used herein, the term " host cell " refers to any transgenic organism that includes eukaryotes and prokaryotes and is capable of replicating the vector or expressing the gene encoded by the vector. The host cell may be transfected or transformed by the vector, which means that the exogenous nucleic acid molecule is transferred or introduced into the host cell.

According to a preferred embodiment of the present invention, the host cell of the present invention is a bacterial cell, more preferably a gram-negative bacterial cell. The cells are suitable for the practice of the present invention in that they have a periplasmic region between the inner membrane and the outer membrane. Examples of preferred host cells of the present invention include E. coli , Pseudomonas aeruginosa , Vibrio cholera , Salmonella typhimurium , Shigella flexneri , Haemophilus influenza , Bordotella pertussi , Erwinia amylovora , Rhizobium sp . But are not limited thereto.

In the preparation method of the present invention, the purification of the antibody may include filtration, HPLC, anion exchange or cation exchange, high performance liquid chromatography (HPLC), affinity chromatography, or a combination thereof, preferably Protein An affinity chromatography using A can be used.

According to another aspect of the present invention, the present invention provides a method of screening a polypeptide comprising an Fc domain that binds to Fc [gamma] RIIIa comprising the steps of:

comprising the steps of: a) applying a random point mutation to the Fc domain comprising the nine amino acid substitutions (V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L) Building a library; And

b) selecting a polypeptide comprising an Fc domain that binds to FcγRIIIa in said library.

The substituted Fc domain of the present invention may comprise additional amino acid substitutions, in addition to the nine amino acid substitutions.

According to one embodiment of the present invention, an Fc library was constructed using bacterial cells (preferably Escherichia coli), from which mutants showing high affinity with FcγRIIIa were selected (Examples 5 and 6).

The additional amino acid substitution of the Fc domain is not particularly limited and is preferably selected from the group consisting of amino acids 226, 243, 246, 250, 253, 307, 347, 350, 400 and 421 according to Kabat EU numbering system More preferably at least one additional amino acid substitution selected from the group consisting of C226R, F243L, K246E, T250I, I253N, T307S, C347R, T350A, S400T and N421S.

The screening method of the present invention can use fluorescence labeled cell separation (FACS) screening or other automated flow cell analysis techniques. Devices for conducting flow cytometry analyzers are well known to those skilled in the art. Examples of such devices include FACSAria, FACS Star Plus, FACScan and FACSort instruments (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, Colo. XDP (Beckman Coulter, Indianapolis, Ind.). Flow cytometry techniques generally involve the separation of cells or other particles in a liquid sample. Typically, the purpose of a flow cytometer is to analyze the discrete particles for one or more of their properties (e.g., the presence of a labeled ligand or other molecule). Particles are passed one by one by the sensor and are classified based on size, refraction, light scattering, opacity, roughness, shape, fluorescence and the like.

According to another aspect of the present invention, there is provided a composition comprising a polypeptide comprising an Fc domain comprising said amino acid substitution or a nucleic acid molecule encoding said polypeptide.

According to a preferred embodiment of the present invention, the composition of the present invention is a pharmaceutical composition for preventing or treating cancer.

The pharmaceutical composition of the present invention comprises (a) a nucleic acid molecule encoding the polypeptide, the non-germinated antibody or the polypeptide; And (b) a pharmaceutically acceptable carrier.

According to another aspect of the present invention, there is provided a method of preventing or treating cancer, comprising administering the pharmaceutical composition.

The types of cancer to be prevented or treated according to the present invention are not limited and include leukemias and acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic lymphocytic leukemia, Lymphomas such as chronic myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphomas and multiple myeloma, brain tumors, neuroblastoma, Childhood solid tumors such as retinoblastoma, Wilms Tumor, bone tumors and soft-tissue sarcomas, lung cancer, breast cancer, cancer cancers, prostate cancer, urinary cancers, uterine cancers, oral cancers, pancreatic cancer, melanoma and other skin cancers. cancer, stomach cancer, ovarian cancer, brain tumors, liver cancer, laryngeal cancer, thyroid cancer, esophageal cancer and testicular cancer. ), ≪ / RTI > and the like.

The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and can be administered, for example, by intravenous injection, local injection, and intraperitoneal injection.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

The pharmaceutical composition of the present invention may be used alone, but may be used in combination with other conventional chemotherapy or radiotherapy, and cancer therapy can be more effectively performed when such concurrent therapy is carried out. Chemotherapeutic agents that can be used with the compositions of the present invention include, but are not limited to, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, But are not limited to, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin, , Bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluoro 5-fluorouracil, vincristin, vinblastin and methotrexate, and the like. Radiation therapies that can be used with the compositions of the present invention include X-ray irradiation and gamma-ray irradiation.

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides a polypeptide comprising an Fc domain in which a part of the amino acid sequence of the human antibody Fc domain is replaced with another amino acid sequence, or an immobilized antibody comprising the polypeptide.

(Ii) In addition, the present invention provides a method for producing the polypeptide or the non-glycosylated antibody.

(Iii) The Fc domain of the present invention is optimized by substituting some amino acid sequences of a wild-type Fc domain with another amino acid sequence, thereby being excellent in the selective binding ability to FcγRIIIa among the Fc receptors and being useful for the treatment of cancer. Antibody. ≪ / RTI >

Figure 1 shows tablets (left, SDS-PAGE) photographs of Tetrameric FcγRIIIa and ELISA (right) test results for activity confirmation.
Figure 2 shows ELISA results for confirmation of activity after tetrameric FcγRIIIa fluorescent labeling using Alexa 488 Flour.
Figure 3 shows a graph comparing the binding strength of A / IYG and Fc1004 to Fc [gamma] RIIIa.
Figure 4 shows a graph comparing the binding strength of A / IYG and Fc1004-IYG to Fc [gamma] RIIIa.
Figure 5 shows a schematic diagram of the construction of an untreated antibody Fc library based on Fc1004-IYG.
FIG. 6 is a graph comparing binding capacities of FcγRIIIa high affinity Fc variants extracted through library screening using a flow cytometer.
FIG. 7 shows photographs obtained by SDS-PAGE of soluble expression and purification of excavated mutants and a control (wild type, A / IYG).
Figure 8 shows the affinity analysis results for various Fc [gamma] Rs of mutants through ELISA.
Figure 9 is a graph showing SPR analysis of variants (a) binding assay for FcγRIIIa (V158), and b) binding assay for FcγRIIIa (F158).
FIG. 10 shows the results of confirming the degree of HER2 expression of MCF-7 and SKBR-3.
11 shows ADCC tendency analysis according to the ratio of Effector cell: Target cell.
FIG. 12 shows the results of analysis of the cancer cell killing effect of each mutant using human PBMC, SKBR-3, and MCF-7.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example  One: Unwarranted  The antibody was incubated with full-length IgG  Bacteria in the form Display on the inside  for Fc Mutant Cloning (A / IYG , Fc1004 - IYG )

In order to display the full-length IgG of A / IYG (US Patent No. 8,815,237) mutant and Fc1004-IYG, each Fc variant was constructed with a heavy chain plasmid. The primers MJ # 36, MJ # 43 / MJ # 42, and MJ # 37 were prepared by dividing into two fragments so that T299A substitution was performed on the pMOPac12-PelB-VH-CH1- Were amplified with Vent polymerase (New England Biolab). Two fragments are primer MJ # 36, MJ # 37 by using a PCR assembly process, and Sfi I (New England Biolab) cut , T4 DNA ligase (invitrogen) proceed with the ligation and then using the process pMopac12-PelB-VH-CH1- CH2-CH3 (T299A) -FLAG plasmid. (PMopac12-PelB-VH-CH1-CH2-CH3 (A / IYG)) was substituted with the primer MJ # 36, MJ # 39 / MJ # 38, and MJ # 37 using this plasmid as a template. -FLAG manufactured). The 326IYG point mutation was introduced into pMopac12-PelB-VH-CH1-CH2-CH3 (Fc1004) -FLAG using the same primers MJ # 36, MJ # 39 / MJ # 38 and MJ # 37 to obtain pMopac12- CH1-CH2-CH3 (Fc1004-IYG) -FLAG.

The primers used in the experiments primer # The nucleotide sequence (5 '- > 3') MJ # 36 (SEQ ID NO: 17 sequence) CGCAGCGAGGCCCAGCCGGCCATGGCGGAGGTTCAATTAGTGGAATCTG MJ # 43 (SEQ ID NO: 18) GGACGCTGACCACACGGTACGCGCTGTTGTACTGCTCCTCCCG MJ # 42 (SEQ ID NO: 19) CGGGAGGAGCAGTACAACAGCGCGTACCGTGTGGTCAGCGTCC MJ # 37 (Sequence Listing 20 sequence) CGCAATTCGGCCCCCGAGGCCCCTTTACCCGGGGACAGGGAG MJ # 39 (SEQ ID NO: 21) GGTTTTCTCGATGGGGGCTGGGCCATAAATGTTGGAGACCTTGCATTTGTACTCCTTG MJ # 38 (SEQ ID NO: 22) CAAGGAGTACAAATGCAAGGTCTCCAACATTTATGGCCCAGCCCCCATCGAGAAAACC MJ # 45 (SEQ ID NO: 23) CGACAAGAAAGTTGAGCCCAAATCTTGT MJ # 46 (SEQ ID NO: 24) CGCAATTCCGGCCCCCGAGGCCCC MJ # 44 (Sequence Listing No. 25) ACAAGATTTGGGCTCAACTTTCTTGTCG MJ # 2 (SEQ ID NO: 26) CTGCCCATGTTGACGATTG MJ # 49 (SEQ ID NO: 27) CGCAGCGAGCGCGCACTCCATGGCGGAGGTTCAATTAGTGGAATCTG MJ # 50 (SEQ ID NO: 28) CCCTAAAATCTAGACCTTTACCCGGGGACAGGGAG

Example  2: Tetrameric Of FcγRIIIa  Manufacturing Alexa488 fluor  Used fluorescent label

The plasmid pMAZ-FcγRIIIa (V158) -FLAG-Streptavidin-His was temporarily expressed on HEK 293F cells at a size of 300 ml and subjected to affinity chromatography using 1 ml of Ni-NTA agarose (Qiagen) slurry. The cultured suspension was centrifuged at 7000 rpm for 10 minutes to remove cells, and the supernatant was equilibrated with 25 × PBS and filtered with a 0.2 μm filter (Merck Millipore) using a bottle top filter. The slurry of Ni-NTA equilibrated with PBS was added and stirred at 4 캜 for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific). pass-through solution was added to the resin one more time to bind, followed by 50 ml of 1x PBS, 25 ml of 10 mM imidazole buffer, 25 ml of 20 mM imidazole buffer, and 200 占 퐇 of 250 mM imidazole buffer A cleaning process was performed. After elution with 2.5 ml of 250 mM imidazole buffer, the buffer was replaced with PBS through Amicon Ultra4 (Merck Millipore), and the purified protein was identified through SDS-PAGE through concentration process (Fig. 1). The purified protein was assayed by ELISA for binding to Rituxan (Roche), and then 1 ㎎ of the purified protein was fluorescently labeled using Alexa Fluor 488 Protein Labeling Kit (Thermo Fisher Scientific). Activity after fluorescence labeling was analyzed by ELISA (Fig. 2). This resulted in the successful production of high purity active tetrameric FcγRIIIa and confirmed that the protein activity was maintained even after labeling with Alexa 488 fluorescent material.

Example  3: Wild type Fc1004  And A / IYG's On FcγRIIIa  Bond strength comparison

The clones to be analyzed were pMOPac12-PelB-VH-CH1-CH2-CH3 (wild type) -FLAG, pMopac12-PelB-VH-CH1-CH2-CH3 (Fc1004) -FLAG, pMopac12-PelB-VH -CH1-CH2-CH3 (A / IYG) so -FLAG type E. coli Jude 1 cells (F '[Tn 10 (Tet r) proAB + lacI q Δ (lacZ) M15] mcrA Δ (mrr - hsdRMS - mcrBC) 80d lac ZΔM15 Δ lacX74 deoR recA1 araD139 ? ( intermediate leu ) 7697 galU galKrpsLendA1nupG) (Kawarasaki et al, 2003 ) for the transformation with pBAD30-Km-PelB-VL- Ck-NlpA-VL-Ck-His-cMyc Plasmid the heavy and light chains to be expressed in each periplasmic space area (periplasmic region) . Five ml of glucose (Sigma-Aldrich) medium containing 2% glucose was added to Terrific broth (TB, BD) for 16 hours at 37 ° C, and then 5.5 ml of TB was dispensed into a 100 ml flask. After the cooling process, until OD ₆₀₀ = 25 ℃ and incubated 20 minutes, and 0.6 eseo 250 rpm was overexpressed during the 0.2% arabinose, 1 mM IPTG was added to 25 ℃, 250 rpm, 20 hours. After over-expression cells were harvested with a uniform amount by 14000 rpm, 1 bungan by centrifugation through the OD ₆₀₀ normalize. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 minute. Resuspension was performed with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was discarded and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 ㎎ / ㎖ lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and then rotated at 37 ° C for 15 minutes to remove the peptidoglycan layer. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. 300 μl of the supernatant was resuspended in 700 μl of PBS and fluorescently labeled tetrameric FcγRIIIa-Alexa 488 flour probe. The fluorescence probe was labeled with spheroplast by rotation at room temperature. After labeling, the plate was washed once with 1 ml of PBS and analyzed using Guava (Merck Millipore) equipment (Fig. 3). As a result, it was confirmed that wild type Fc and A / IYG and Fc1004 showed a mean value of 30-42, respectively, and did not bind FcγRIIIa well.

Example  4: A / IYG and Fc1004 - IYG's On FcγRIIIa  Bond strength comparison

PelB-VH-CHl-CH2-CH3 (Fc1004-IYG) -FLAG was introduced into E. coli Jude 1 cells by pBAD30-Km-PelB-VL Ck-NlpA-VL-Ck-His-cMyc plasmid so that the heavy and light chains can be expressed in the periplasmic region, respectively. TB was cultured in 5 ml of glucose medium containing 2% of glucose at 37 ° C for 16 hours, and TB 5.5 ml was inoculated in a 100 ml flask at a ratio of 1: 100. After the cooling process, until OD ₆₀₀ = 25 ℃ and incubated 20 minutes, and 0.6 eseo 250 rpm was overexpressed during the 0.2% arabinose, 1 mM IPTG was added to 25 ℃, 250 rpm, 20 hours. After over-expression cells were harvested with by 14000 rpm, 1 bungan centrifugation by the same amount through the OD ₆₀₀ normalize. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 minute. Resuspension was performed with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was discarded and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 ㎎ / ㎖ lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and then rotated at 37 ° C for 15 minutes to remove the peptidoglycan layer. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. 300 μl of the supernatant was resuspended in 700 μl of PBS and fluorescently labeled tetrameric FcγRIIIa-Alexa 488 flour probe. The fluorescence probe was labeled with spheroplast by rotation at room temperature. After labeling, the plate was washed once with 1 ml of PBS and analyzed using Guava (Merck Millipore) equipment (Fig. 4). The fluorescence intensity of Fc1004-IYG was 199.85, which was 8.4-fold higher than that of wild-type (23.92), indicating that A / IYG (41.24), which is known to exhibit the highest affinity to FcγRIIIa among the known mutated Fc variants, , The binding force of Fc1004-IYG was greatly improved as compared with that of the case of Fc1004-IYG.

Example  5: Fc1004 - IYG  Based Unwarranted  Construction of antibody library

The error prone PCR and the assemble PCR were performed using pMopac12-PelB-VH-CH1-CH2-CH3 (Fc1004-IYG) -FLAG as a template in order to prepare the Fc1004-IYG-based immobilized antibody Fc library. The error prone PCR method using Taq polymerase (Invitrogen) was used for random point mutation in the Fc (CH2-CH3) region. Primers MJ # 45 and MJ # A point mutation was introduced into the nucleotide. In addition, the front part of the Fc was designed to be overlapped with the Fab and assembled in the form of a heavy chain. Therefore, the Fab (VH-CH1) portion was subjected to conventional PCR using primers MJ # 36, MJ # 44 and Vent polymerase and then assembled using primers MJ # 36 and MJ # 46 to assemble Fab fragment and Fc fragment PCR was performed to produce full heavy chain type PCR product. Then, Sfi I restriction enzyme digestion and ligation were performed to transform into Jude 1 to prepare an immobilized antibody Fc library in the form of a heavy chain (library size: 1.14 × 10 ⁹ , experimental error rate: 0.457%). A library in which full-length IgG is displayed in the inner membrane of Escherichia coli is obtained by securing the gene in this library and re-transforming it into Jude 1 cells transformed with pBAD30-Km-PelB-VL-Ck-NlpA-VL-Ck- (Fig. 5).

Example  6: With built libraries Flow cell  The analyzer is screened and analyzed using MG42, MG48, MG59, MG87, etc. Mutant  Selection( On FcγRIIIa  Confirmation of bond strength)

The constructed library was incubated at 37 ° C for 4 hours with 1 vial (1 ㎖) in 25 ml of TB + 2% glucose medium in a 250 ml flask, and then 110 ㎖ of TB was dispensed into a 2.5 ℓ flask at a ratio of 1: 100. After the cooling process, until OD ₆₀₀ = 25 ℃ and incubated 20 minutes, and 0.6 eseo 250 rpm was overexpressed during the 0.2% arabinose, 1 mM IPTG was added to 25 ℃, 250 rpm, 20 hours. After overexpression, the OD ₆₀₀ value was measured and the cells were harvested by centrifugation at 14000 rpm for 1 minute at the normalized amount. The spheroplast preparation was performed as described above, followed by labeling with tetrameric FcγRIIIaAlexa 488 flour and washing with 1 ml of PBS once. Finally, a sample resuspensioned with 1 ml of PBS was diluted in 20 ml of PBS, and only the cells receiving the upper 3% signal were isolated using S3 Cell sorter (BioRad). Separated cells were subjected to further sorting and screening. Filtered out cells produce MJ # 36, MJ # 2 amplified genes by PCR using the primers and Taq polymerase (Biosesang) and to amplify the gene of the cell selected through the Sfi I restriction enzyme treatment ligation, transformation process sublibrary Respectively. After repeating this process for a total of 5 rounds, mutants with high affinity with Fc [gamma] RIIa were selected by analyzing each of 90 individual clones (Fig. 6a and 6b, Table 2, mutation positions were determined by Kabat EU numbering system according to the EU index number as in " Proteins of Immunological Interest ", 5th Ed., US Department of Health and Human Services, NIH Publication No. 91-3242, 1991).

Point mutations of major variants Fc variant Point mutation A / IYG (SEQ ID NO: 5) T299A, K326I, A327Y, L328G Fc1004 (SEQ ID No. 3) S298G, T299A, E382V, N390D, M428L Fc1004-IYG (SEQ ID No. 7) S298G, T299A, K326I, A327Y, L328G, E382V, N390D, M428L MG42 (SEQ ID NO: 9) (Fc1004-IYG) + 264E, 350A, 421S MG48 (SEQ ID NO: 11) (Fc1004-IYG) + 264E, 350A MG59 (SEQ ID NO: 13) (Fc1004-IYG) + 264E MG87 (Sequence Listing 15 sequence) (Fc1004-IYG) + 264E, 421S

(MG61: (Fc1004-IYG) + T307S, MG86: (Fc1004-IYG) + C226R + F243L + K246E MG54: (Fc1004-IYG) mutants showing high affinity with FcγRIIIa than A / IYG, + T250I + I253N and MG14 (Fc1004-IYG) + C347R) (Fig. 6C).

Example  7: Excavated Mutant  For expression in animal cells Cloning  And expression purification

The wild-type and A / IYG, which contain MG59, MG87 and MG48 among the mutants excised, were labeled with the Vent polymerase and primers MJ # 49, IgG (A / IYG), and pMAZ-IgH (MG59) were digested with restriction enzymes and ligated with BssH II and Xba I (New England Biolab) ), pMAZ-IgH (MG87), and pMAZ-IgH (MG48). For expression in IgG form, HEK 293F cells were co-transfected with pMAZ-IgL plasmid and transiently expressed at 300 ml scale. The cultured medium was removed by centrifugation at 7000 rpm for 10 minutes, and the supernatant was taken and equilibrated using 25x PBS. and filtered with a 0.2 탆 filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Protein A agarose (Genscript) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific). After pass-through solution was taken, it was flowed once more to bind resin and washed with 1x PBS at 10 CV (Column Volume) or more. After elution with 3 ml of 100 mM glycine HCl (pH 2.7), it was immediately neutralized with 1 ml of 1 M Tris (pH 8.0). After replacing the buffer with PBS through Amicon Ultra4 (Merck Millipore), the purified protein was identified through SDS-PAGE (BioRad) through concentration process (FIG. 7). It was confirmed that IgG type protein (150 kDa) was purified to high purity on SDS-PAGE.

Example  8: Mutant On FcRs  ELISA analysis for confirming binding strength

0.05 M Na ₂ CO ₃ 50 μl of IgG Fc mutant diluted to 4 μg / ml at pH 9.6 was immobilized in a flat bottom polystyrene high-bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 μl of 5% BSA ) At room temperature for 2 hours. After washing 4 times with 180 μl of 0.05% PBST, serially diluted FcRs with blocking solution was added to each well of 50 μl, and reacted at room temperature for 1 hour. After washing, 50 μl of anti-HisHRP conjugate (Sigma-Aldrich) and anti-GST-HRP conjugate (GE Healthcare) were reacted at room temperature for 1 hour and washed. 50 μl of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added to each well. After development, 50 μl of 2 MH ₂ SO ₄ was added to terminate the reaction and analyzed using an Epoch Microplate Spectrophotometer (BioTek) ). All experiments were performed in duplicate and ELISA confirmed the binding ability of each FcRs [FcγRI, FcγRIIa (H), FcγRIIa (R), FcγRIIb, and FcRn.

Example  9: SPR  through FcγRIIIa and trastuzumab Mutant  K _D measure value

Binding capacity of trastuzumab mutants was measured using BIAcore T200 (GE Healthcare). (Aglyco-T), A / IYG, wild-type glycated antibody (produced through HEK 293F cell culture), Herceptin (clinical drug produced from CHO cells, MG48 and MG59) And then immobilized on a CM5 chip and immobilized on dimeric FcγRIIIa-V158-GST, FcγRIIa-F158-GST using HBS-EP buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 surfactant) The regeneration of CM5 chip was carried out sequentially with 50 mM glycine pH 3.9, 50 mM glycine pH 9.5, and 3 M NaCl. The equilibrium dissociation constants (K _D ) was calculated using the 2: 1 bivalent analyte model of BIAevaluation 3.2 software (GE Healthcare) (Table 3).

The SPR K _D value K _D (M) Fold increase
(V / F) FcγRIIIa (158V) Fc [gamma] RIIIa (158F) Aglyco-T N.D. N.D. 0 A / IYG 1.110 X 10 ^-6 1.737 X 10 ^-5 One Glyco-T (HEK) 1.200 X 10 ^-7 5.782 X 10 ^-6 9.25 / 3.00 Herceptin (CHO) 8.418 X 10 ^-8 5.142 X 10 ^-6 13.19 / 3.38 MG48 6.793 X 10 ^-8 6.763 X 10 ^-7 16.34 / 25.68 MG59 1.070 X 10 ^-7 1.049 X 10 ^-6 10.37 / 16.56

As a result, it was confirmed that the binding capacity of MG48 and MG59 isolated from this study increased by at least 16 times for FcγRIIIa-V158 and up to 25 times for FcγRIIa-F158 compared to A / IYG.

Example  10: Target cell SKBR - 3 and MCF -7 HER2  Expression level confirmation experiment

Cells cultured in 100 mm dish (80% confluency) were washed once with DPBS, treated with 1.5 μl of Accutase (Merck Millipore), and incubated for 2-3 minutes at 37 ° C in a CO ₂ incubator. After confirming that the cells were separated from the bottom of the dish, 6 ml of the cell culture medium was added. 10 ml pipette was used to collect all the solution containing the cells. After centrifugation at 1200 rpm for 3 minutes, the solution in the 15 ml tube was removed and 5 ml of DPBS was added to the 15 ml tube. And then centrifuged at 1200 rpm for 3 minutes. Remove the DPBS in the tube, add 3 ml of washing buffer (PBS + 1% BSA) to the 15 ml tube, mix well with the cells, centrifuge for 3 minutes at 1200 rpm and remove the washing buffer in the tube. After repeating the above washing procedure twice, the final 1 ml of washing buffer was added and mixed well with the cells. FACS tubes (Falcon) were prepared by non-staining for each cell, labeled with isotype control (normal human IgG-Alexa488) and trastuzumab-alexa488. Cells were counted and dispensed at 1 × 10 ⁵ cells / 300 μl per tube. The cells were blocked by centrifugation at 4 ° C for 15 minutes, and the supernatant was removed. 100 μl of washing buffer was dispensed into the FACS tube and mixed well with the cells. 1 ㎍ of isotype control and trastuzumab-alexa488 were added except non-staining. After shading with aluminum foil, the antibody reaction is carried out at 4 ° C for 30 minutes. After completion of the reaction, the cells are removed by centrifugation and the supernatant is removed. Washing buffer was added in an amount of 1 ml each time, and the washing procedure was repeated three times. 300 μl of running buffer (PBS) was added to each tube, mixed well with the cells, and analyzed by FACS. As a result, it was confirmed that SKBR-3 showed much higher HER2 expression than MCF-7 (FIG. 10). Therefore, SKBC-3, which has higher expression of HER2 than MCF-7, has been found to be a more suitable target cell for evaluation of ADCC activity of antibody samples targeting HER2.

Example  11: ADCC  for Effector  cell ( PBMC ): Target cell ( SKBR -3, MCF - 7) of  Preliminary experiment for rate determination

Target cells SKBR-3 and MCF-7 were cultured. Target cells were seeded in 96-well V-bottom plates (Corning) at 1 × 10 ⁴ cells / 50 μl / well and trastuzumab PBMC (CTL, Table 4) were treated with DNase I at room temperature for 30 minutes at 37 ° C in a water bath at 37 ° C. Cells were counted, and an appropriate number of PBMCs were added to each well.

PBMC Donor Information Sample ID # Ethnicity Age Gender ABO / PH 20091026 Caucasian 24 Male A / POS 20100412 Hispanic 30 Male A / POS HHU20120530 African / American 35 Male AB / POS HHU20130318 Asian 38 Male A / POS HHU20150924 Asian / Filipino 40 Male A / POS

Effector cell: Target cell ratio was 1.5625: 1, 3.125: 1, 6.25: 1, 12.5: 1, 25: 1, centrifuged at 100xg for 1 minute and then incubated at 37 ℃ in CO ₂ incubator for 4 hours Lt; / RTI > After 4 hours, the plate was centrifuged at 300 × g for 3 minutes, and 50 μl of the supernatant was transferred to a SpectraPlate-96-well plate (PerkinElmer) and 50 μl of CytoTox 96 ^® Reagent (Promega) Incubation was carried out at room temperature for several minutes. 50 μl of stop solution was added to terminate the reaction and the absorbance was measured at 490 nm. The procedure was repeated three times in duplicate and the mean value was taken. As a result, SKC-3 (1 × 10 ⁴ cells / well), which is highly expressed in HER2, was used as a target cell. In the ADCC assay using PBMC as an effector cell, effector cell number-dependent cytotoxicity was increased. -7 also showed an increase in cytotoxicity depending on the number of effector cells, but the rate of increase was lower than that of SKBR-3, which has a high expression of HER2 (FIG. 11). The cytotoxicity of SKBR-3 with high HER2 expression was higher than that of MCF-7 with low HER2 expression and cytotoxicity was HER2-specific. Considering the difference in FcγRIIIa F / V variant distribution of PBMC used as effector cells, The effector cell: target cell ratio for ADCC activity evaluation was confirmed to be at least 25: 1 (Table 5).

Effector: ADCC degree according to target cell ratio Effector: Target % Cytotoxicity SKBR-3 MCF-7 1.5625: 1 1.65 0.23 3.125: 1 2.00 0.98 6.25: 1 13.54 1.01 12.5: 1 17.47 7.00 25: 1 40.21 10.38

Example  12: Human PBMC  Used Herceptin  variants ADCC  Active comparative evaluation

SKBR-3 and MCF-7 were cultured and seeded in a 96-well plate (V-bottom) at 1 × 10 ⁴ cells / 50 μl per well. The test material was then seeded at 0, 0.032, 0.16, 0.8, 4, Mu] g / ml in each well. The PBMCs were pooled in 5 individual PBMCs, subjected to quick thawing in a 37 ° C water bath, and treated with DNase I at room temperature for 30 minutes. The cells were counted, and 2.5 x 10 ⁵ cells / 50 μl of PBMC was added per well. The plate was centrifuged at 100 × g for 1 minute and incubated in a 37 ° C. CO ₂ incubator for 4 hours. After 4 hours, the plate was taken out and centrifuged at 300 × g for 3 minutes. 50 μl of the supernatant was transferred to SpectraPlate-96-well plate and 50 μl of CytoTox 96 ^® Reagent was added to each well. . After stopping the reaction by adding 50 μl of stop solution, the absorbance was measured at 490 nm. The mean value was expressed as% Cytotoxicity after three independent repetitions of this procedure in duplicate. The cell-specific cytotoxicity of the test substance was confirmed by the fact that% Cytotoxicity was high as 4-31% in SKBR-3, a high-expression cell line, and 2-15% in MCF-7, a HER2 low-expression cell line. It was confirmed that the cancer cell killing effect was significantly improved as compared with the non-immunized antibody and the human IgG antibody (FIG. 12).

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Kookmin University Industry Academy Cooperation Foundation <120> Aglycosylated Antibody Fc Region Exhibiting Enhanced Binding          Specificity to an Fc gamma Receptor <130> HPC-7061 <160> 28 <170> KoPatentin 3.0 <210> 1 <211> 227 <212> PRT <213> Homo sapiens <400> 1 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 2 <211> 681 <212> DNA <213> Homo sapiens <400> 2 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240 cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300 tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggagagca atgggcagcc ggagaacaac tacaagacca cacctcccgt gctggactcc 540 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 3 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (Fc1004) <400> 3 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 4 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (Fc1004) <400> 4 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cggcgcgtac 240 cgtgtggtca gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa 300 tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc taaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggtgagca atgggcagcc ggagaacgac tacaagacca cacctcccgt gctggactcc 540 gacggctctt tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gttacatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 5 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (A / IYG) <400> 5 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 6 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (A / IYG) <400> 6 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcgcgtac 240 cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300 tgcaaggtct ccaacattta tggcccagcc cccatcgaga aaaccatctc caaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggagagca atgggcagcc ggagaacaac tacaagacca cacctcccgt gctggactcc 540 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 7 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (Fc1004-IYG) <400> 7 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 8 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (Fc1004-IYG) <400> 8 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cggcgcgtac 240 cgtgtggtca gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa 300 tgcaaggtct ccaacattta tggcccagcc cccatcgaga aaaccatctc taaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggtgagca atgggcagcc ggagaacgac tacaagacca cacctcccgt gctggactcc 540 gacggctctt tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gttacatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 9 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG42) <400> 9 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Ala Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Ser Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 10 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG42) <400> 10 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ctccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg aggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cggcgcgtac 240 cgtgtggtca gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa 300 tgcaaggtct ccaacattta tggcccagcc cccatcgaga aaaccatctc taaagccaaa 360 gggcagcccc gagaccaca ggtgtacgcc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggtgagta atgggcagcc ggagaacgac tacaagacca cacctcccgt gctggactcc 540 gacggctctt tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 agcgtcttct catgctccgt gttacatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 11 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG48) <400> 11 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Ala Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 12 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG48) <400> 12 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ctccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg aggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cggcgcgtac 240 cgtgtggtca gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa 300 tgcaaggtct ccaacattta tggcccagcc cccatcgaga aaaccatctc taaagccaaa 360 gggcagcccc gagaccaca ggtgtacgcc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggtgagca atgggcagcc ggagaacgac tacaagacca cacctcccgt gctggactcc 540 gacggctctt tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gttacatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 13 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG59) <400> 13 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 14 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG59) <400> 14 gacaaaactc acacatgccc accatgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg aggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cggcgcgtac 240 cgtgtggtca gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa 300 tgcaaggtct ccaacattta tggcccagcc cccatcgaga aaaccatctc taaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggtgagca atgggcagcc ggagaacgac tacaagacca cacctcccgt gctggactcc 540 gacggctctt tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gttacatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 15 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG87) <400> 15 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly   1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met              20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Glu Asp Val Ser His          35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val      50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Gly Ala Tyr  65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly                  85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Ile Tyr Gly Pro Ala Pro Ile             100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val         115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser     130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asp Tyr Lys Thr Thr Pro Pro                 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val             180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Ser Val Phe Ser Cys Ser Val Leu         195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser     210 215 220 Pro Gly Lys 225 <210> 16 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Antibody Fc Sequence (MG87) <400> 16 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ctccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg aggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cggcgcgtac 240 cgtgtggtca gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa 300 tgcaaggtct ccaacattta tggcccagcc cccatcgaga aaaccatctc taaagccaaa 360 gggcagcccc gagaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggtgagta atgggcagcc ggagaacgac tacaagacca cacctcccgt gctggactcc 540 gacggctctt tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 agcgtcttct catgctccgt gttacatgag gctctgcaca accactacac gcagaagagc 660 ctctccctgt ccccgggtaa a 681 <210> 17 <211> 49 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 36) <400> 17 cgcagcgagg cccagccggc catggcggag gttcaattag tggaatctg 49 <210> 18 <211> 43 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 43) <400> 18 ggacgctgac cacacggtac gcgctgttgt actgctcctc ccg 43 <210> 19 <211> 43 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 42) <400> 19 cgggaggagc agtacaacag cgcgtaccgt gtggtcagcg tcc 43 <210> 20 <211> 42 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 37) <400> 20 cgcaattcgg cccccgaggc ccctttaccc ggggacaggg ag 42 <210> 21 <211> 58 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 39) <400> 21 ggttttctcg atgggggctg ggccataaat gttggagacc ttgcatttgt actccttg 58 <210> 22 <211> 58 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 38) <400> 22 caaggagtac aaatgcaagg tctccaacat ttatggccca gcccccatcg agaaaacc 58 <210> 23 <211> 28 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 45) <400> 23 cgacaagaaa gttgagccca aatcttgt 28 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 46) <400> 24 cgcaattccg gcccccgagg cccc 24 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 44) <400> 25 acaagatttg ggctcaactt tcttgtcg 28 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 2) <400> 26 ctgcccatgt tgacgattg 19 <210> 27 <211> 47 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 49) <400> 27 cgcagcgagc gcgcactcca tggcggaggt tcaattagtg gaatctg 47 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> Synthetic primer (MJ # 50) <400> 28 ccctaaaatc tagaccttta cccggggaca gggag 35

Claims (12)

A polypeptide comprising a human antibody Fc domain, wherein said Fc domain comprises the following nine amino acid substitutions according to the Kabat EU numbering system: V264E, S298G, T299A, K326I , A327Y, L328G, E382V, N390D and M428L.
The method of claim 1, wherein said amino acid substitution comprises one or more additional amino acid substitutions selected from the group consisting of amino acids 226, 243, 246, 250, 253, 307, 350, 347, 400 and 421 according to Kabat EU numbering system &Lt; / RTI &gt;
The polypeptide according to claim 1, wherein the Fc domain comprising the amino acid substitution has improved binding to Fc [gamma] RIIIa as compared to the Fc domain that is not substituted.
An immobilized antibody comprising the polypeptide of claim 1.
A nucleic acid molecule encoding the polypeptide of claim 1.
A vector comprising the nucleic acid molecule of claim 5.
A host cell comprising the vector of claim 6.
8. The host cell according to claim 7, wherein the host cell is a bacterial cell.
5. A method for the prevention of cancer, which comprises the polypeptide of claim 1, the immunizing antibody of claim 4, or the nucleic acid molecule of claim 5, wherein the polypeptide, the non-attenuated antibody or nucleic acid molecule comprises an antigen- Or a pharmaceutical composition for therapeutic use.
A method for producing a polypeptide comprising a human antibody Fc domain comprising the steps of:
a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the polypeptide of claim 1; And
b) recovering the polypeptide expressed by said host cell.
A method for preparing an immobilized antibody comprising the steps of:
a) culturing a host cell expressing an immortalized antibody comprising the polypeptide of claim 1; And
b) purifying the antibody expressed from said host cell.
A screening method of a polypeptide comprising an Fc domain binding to Fc [gamma] RIIIa comprising the steps of:
a polypeptide comprising an Fc domain that additionally has a random point mutation in addition to the Fc domain comprising nine amino acid substitutions of V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L according to the Kabat EU numbering system Building a library of &lt; RTI ID = 0.0 &gt; And
b) selecting a polypeptide comprising an Fc domain that binds to FcγRIIIa in said library.

Images