KR20190043318A - Method for enhancing saponin of Kalopanax septemlobus cell - Google Patents

Abstract

The present invention relates to a method for promoting the production of saponin of Kalopanax septemlobus cells. More particularly, the present invention relates to a method for promoting the production of saponin of Kalopanax septemlobus cells, and a Kalopanax septemlobus cell composition having higher saponin productivity than a conventional Kalopanax septemlobus cell composition manufactured using the same. The method for promoting the production of saponin of Kalopanax septemlobus cells of the present invention can promote the production of saponin by inducing and culturing a non-embryogenic callus of Kalopanax septemlobus which has difficulties in mass proliferation. The Kalopanax septemlobus cell composition of the present invention is excellent in the availability as a raw material component for pharmaceuticals, functional foods, and cosmetics containing saponin as an active ingredient since the saponin of Kalopanax septemlobus is promoted.

Description

[0001] The present invention relates to a method for enhancing the production of saponin in a mammal,

More particularly, the present invention relates to a method for promoting the production of saponin of bamboo cells and a method for enhancing saponin production of bamboo cells.

Kalpanax septemlobus is a medicinal plant that is made from oriental herb and thawing, and its bark is called sea tangle. The labor 20~25m belonging to Araliaceae (Araliaceae) deciduous broad-leaved tall tree is a deciduous arborescent distributed scattered over the country and mountain.

The main pharmacological component of the chestnut tree is saponin such as kalopanaxsaponin A and chalopanax saponin B. Especially, saponin of chestnut has a similar action to saponin of ginseng, and the chestnut has been used as a substitute for ginseng.

The pharmacological activities of the phloem are known to be Jinhae, antiinflammation, tonic action, hypoglycemic action, etc., and development of a technique utilizing phamaceae and a composition derived therefrom as medicines, functional foods and cosmetics has been attempted -0588448).

It is possible to propagate by the breeding of the seedling, but it is a double dormancy seed and the germination rate is about 8% on average due to the germination characteristic of 2 years. In order to overcome this problem, A method of producing a large quantity of a climbing seedling has been developed (Patent No. 10-0365491, Patent No. 10-0767050).

However, no technique has been developed for promoting the production of saponin, a pharmacological component of the Japanese apricot.

It is an object of the present invention to provide a method for promoting the production of saponin in a bamboo cell.

It is still another object of the present invention to provide a feminine cell composition prepared by the method for promoting the production of saponin in the feminine cell, wherein the productivity of the feminine cell is improved compared to the conventional feminine cell.

It is still another object of the present invention to provide a composition for external application for skin comprising the above-described bamboo cell composition or an extract thereof.

In order to achieve the object of the present invention,

I) sterilizing the seeds of the barks;

Ii) inducing non-embryogenic callus from the harvested seed; And

Iii) selectively culturing non-embryogenic calli,

The non-embryogenic callus induction method provides a method for promoting the production of saponin in cultured bovine cells in a medium containing 4 to 5 μM or more of auxin plant growth hormone.

In the present invention, 'callus' refers to a cell mass that forms a uniformly shaped cell mass when the explant is sprouted on a medium and cultured under appropriate culture conditions during tissue culture of a plant.

In the present invention, the term 'non-embryogenic callus' means a callus in which the callus does not have embryogenic ability.

Step i): Preparation of females seed

The seeds of the chestnut are sterilized and supplied.

Seeds can use mature seeds or immature seeds. The callus derived from the mature embryo of mature seed has the advantage of inducing non-embryogenic callus well. Therefore, only mature seeds can be selected and used for induction of non-embryogenic calli. When immature seeds are used, induction to embryogenic callus is performed at the same time in addition to non - embryogenesis, but the growth rate is fast.

Sterilization of seeds can be carried out by soaking in 70% ethanol for 30 seconds to 1 minute, disinfection with 2% sodium hypochlorite (NaOCl) solution for 20-30 minutes and rinsing 3 to 5 times with sterile distilled water have.

Seedling can be carried out by removing the seed coat under a microscope or a magnifying glass or by any other conventional method.

Step ii) Embryogenesis Callus  Judo

Induce non-embryogenic calli from the seed obtained from step i).

The media that can be used for inducing non-embryogenic calli are woody plant medium, MS (Murashige & Skoog), B5 (Gamborg's B5), Durzan, SH (Schenk & Hildebrandt), White, DKW Kuniyuk-Walnut, GD (Gresshoff & Doy), LP (Quoirin & Lepiovre) medium, and preferably WPM (woody plant medium) medium.

The medium for inducing non-embryogenic calli preferably contains 4-5 μM auxin plant growth hormone. Incorporation of auxin plant growth hormone below 4 μM into the callus induction medium may result in lower callus induction efficiency or insufficiently strong stress to the developmental switch of cells, leading to a higher incidence of embryogenic callus induction If it is contained in excess of 5 [mu] M, there may arise a problem that the seed is broken before the callus is induced. Most preferably, auxin plant growth hormone is included at 4.4 [mu] M.

Examples of the 'auxin plant growth hormone' that can be used in the present invention include 2,4-dichlorophenoxyacetic acid (2,4-D) and the like.

As in the following examples, the determined females seeds were seeded with 4 to 5 μM 2,4-dichlorophenoxyacetic acid (2,4-D) together with 3% sucrose, 0.3% WPM containing gelrite woody plant medium) medium to induce callus. At this time, cultured in a dark incubation room at 24 ~ 26 ℃ for 3 ~ 6 weeks to induce non-embryogenic callus.

Step iii): Culture of non-embryogenic callus

By selecting and culturing non-embryogenic calli, a large amount of mammalian cells with enhanced saponin productivity are obtained.

Selection of non-embryogenic calli can be easily performed by morphological characteristics (Fig. 1). Non-embryogenic calli are white and translucent (FIG. 1A), whereas embryogenic calli are yellowish brown (FIG. 1B) and can be readily distinguished visually.

Non-embryogenic calli can also be distinguished by cellular structural properties. Cells of non-embryogenic callus are large, have many vacuoles, have elongated structures with small nuclei (Figs. 2a and 2b), whereas embryogenic calli are composed of prominent nucleoli and dense cytoplasm (Fig. 2C, Fig. 2D).

Non-embryogenic callus cultures are cultured for 3 to 6 weeks in a dark incubation chamber at pH 5.0 to 6.0 and 24 to 26 째 C in a culture medium, taking only non-embryogenic calli selected in the above manner. When cultured under the above-mentioned culture conditions, the expression level of saponin biosynthesis-related enzymes of the present invention is significantly increased, resulting in promotion of saponin production.

In the present invention, the culture medium of non-embryogenic callus is selected from woody plant medium, MS (Murashige & Skoog), B5 (Gamborg's B5), Durzan, SH (Schenk & Hildebrandt), White, DKW Kuniyuk-Walnut, GD (Gresshoff & Doy), LP (Quoirin & Lepiovre) medium, and preferably WPM medium.

In the present invention, the auxin plant growth hormone contained in the callus inducing medium is destroyed when cultured in non-embryogenic callus, and is hardly contained in the final phylum cells.

According to another aspect of the present invention, there is provided a feminine cell composition produced by the method for promoting the production of saponin of the feminine cells, the feminine cell having an improved saponin productivity.

The composition of the present invention can be used as a raw material for medicines, functional foods and cosmetics containing saponin as an active ingredient.

According to another object of the present invention, there is provided an external preparation for skin comprising the above-described bamboo cell composition or an extract thereof.

In the present invention, the extract may be obtained by extracting the bark cell composition using an organic solvent. Examples of the organic solvent that can be used for the extraction include acetone, ethyl acetate, diethyl ether, glycerin, ethylene glycol, propylene glycol, butylene glycol, benzene, chloroform, hexane and alcohols having 1 to 4 carbon atoms. These may be used alone or in combination of two or more.

The saponin contained in the composition for external application for skin may be excellent in treating, improving, preventing and alleviating skin inflammation, antioxidant effect, whitening and improving skin tone.

The method of promoting the production of saponin of the present invention can promote the production of saponin in the skin of the bark by inducing and culturing the non-embryogenic calli of the bark which is difficult to mass-proliferate.

The composition of the present invention improves the saponin content of the skin, and thus has excellent utility as a raw material ingredient for medicines, functional foods and cosmetics containing saponin as an active ingredient. The composition for external application for skin according to the present invention is effective for treating skin inflammation , Improvement, prevention and alleviation effect, antioxidant effect, whitening, and improvement of skin tone.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a photograph showing the morphology of non-embryogenic calli (Fig.
FIG. 2 is a photomicrograph and TEM photographs of the cell structure and ultrastructure of non-embryogenic cells of the barks derived according to the present invention (FIGS. 2a and 2b; Nu-nucleus, V-vacuole).
FIG. 3 is a graph showing the gene ontology (GO) classification and the percentage of each category Uniin of the non-embryogenic callus (NEC) according to the present invention and the non-embryogenic callus (EC) of the comparative example.
Figure 4 shows a cluster heatmap of the gene ontology (GO) enrichment analysis of the non-embryogenic callus (NEC) according to the present invention and the non-embryogenic callus (EC) of the comparative example.
FIG. 5 is a graph comparing the expression of the five major enzymes related to saponin biosynthesis of the non-embryogenic callus (NEC) according to the present invention and the non-embryogenic callus (EC) of the comparative example (SE-squalene epoxidase CYP450s-cytochrome P450; GTs-UDP-glycosyltransferase).

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to specific embodiments in order to facilitate understanding of the present invention. However, the following examples are merely illustrative of the present invention in order to more clearly understand the present invention, and the scope of the present invention is not limited by the following examples.

Example

Example 1: Promoting the production of saponin in the femoral cell

≪ Preparation of females seed and non-embryogenic callus induction >

The immature seeds were harvested from the mulberry buds of the flowering stage. Dipped in 70% ethanol for 1 minute, surface sterilized with 2% sodium hypochlorite (NaOCl) for 20 minutes, and rinsed 5 times with sterile distilled water. Seeds were removed by removing seeds under a microscope or a magnifying glass.

The resulting females seeds were seeded in a 10 x (density) medium containing callus induction medium in WPM (woody plant medium) medium containing 3% sucrose, 0.3% gelite and 4.4 μM 2,4-dichlorophenoxyacetic acid Non-embryogenic calli were induced by culturing for 3 weeks while keeping 25 ± 1 ° C in a dark culture chamber in a 2 cm plastic petri dish. The induced callus was mostly non-embryogenic calli showing white and translucent form (FIG. 1A) and embryogenic callus (FIG. 1B) showing a yellowish brown form.

≪ Culture of calli of embryonic non-embryogenic >

White and translucent non-embryogenic calli were selected and cultured in WPM (woody plant medium) culture medium for 3 to 6 weeks at pH 5.0 ~ 6.0 and 24 ~ 26 ℃ for 3-6 weeks. Enhanced bovine cells were prepared in large quantities.

Example  2: Embryogenesis Callus  Tissue observation

As a comparative example of the callus of the non-embryogenic callus according to the present invention, the callus of the embryogenic callus was compared with the optical microscope and TEM, and the results are shown in FIG.

Specifically, the callus of the present invention was compared with the callus of the non-embryogenic callus of the present invention, and the callus of the callus of the callus was incubated at room temperature for 24 hours with 2.5% glutaraldehyde and 1.6% paraformaldehyde buffered with 0.05M phosphate buffer (pH 6.8) Were dehydrated in the alcohol system and then inbed onto Technovit 7100 (Kulzer, Germany) according to Yeung (1999). Subsequently, a continuous 3 μm slice was formed in an Autocut rotary microtome (RM 2165, Leica, Wetzlar GmbH, Germany) with a disposable tungsten knife, and each slice was stained with toluidine blue O for 15 minutes. Each section was then examined using a Leica DMR optical microscope and recorded with a digital camera (Leica DC 300F) and Leica Application Suite software (Fig. 2a: non-embryogenic callus tissue, Fig. 2c: embryogenic callus tissue).

For ultrastructural analysis, callus surface cells were used because the inner cell development was relatively late but the cells of the outer layer of callus with high metabolic activity could easily form embryos. As a comparative example of the non-embryogenic callus according to the present invention, the surface cells of the embryogenic embryogenic callus were pretreated with 2% glutaraldehyde solution adjusted to pH 7.2 with 0.05 M sodium cacodylate buffer , and it was fixed to 1% OsO ₄ in the same buffer solution and dehydrated, and the bed with the resin and EPON 812 sequentially. Ultrafine slices obtained with MT-X ultramicrotome (RMC, Tucson, AZ, USA) were then stained with uranyl acetate and then stained with lead citrate. Image observations and recordings were performed using a LIBRA 120 transmission electron microscope (Carl Zeiss, Germany) and the results are shown in Figure 2b (non-embryogenic callus) and Figure 2d (embryogenic callus).

As shown in Fig. 1, the horn non-embryogenic callus (NEC) was white, well broken and translucent while the embryogenic callus (EC) was yellowish brown, smooth and compact.

As shown in Fig. 2, in the cell structure, the cells of the non-embryogenic callus (NEC) were large, highly vacuolar, elongated with small nuclei (Fig. 2 a, c), Embryogenic callus (EC) showed a more organized structure with small, equiaxed cell masses with pronounced nuclei and dense cytoplasm (Fig. 2b and d).

Example 3: Pyrosequencing and de novo assembly analysis

A comparative analysis of transcripts using the 454 pyrosequencing technique of the callus of the callus was conducted as a comparative example to that of the non-embryogenic callus.

<RNA extraction, cDNA library construction and 454 pyrosequencing>

Total RNAs of cells of each non-horn embryogenic callus were compared with those of non-horn embryogenic calli using the cetyltrimethylammonium bromide (CTAB) method, and then analyzed by RNeasy column (Qiagen Ltd., Crawley, UK) Cleaned up. The total RNA quality was determined using a NanoDrop spectrophotometer (Thermo, Wilmington, USA) and RNA samples with a ratio of 260: 280 between 1.9 and 2.1 were selected for analysis.

Using the Dynabeads mRNA Purification Kit and the Magnetic Particle Concentrator (MPC) (Invitrogen, Carlsbad, USA), the following cDNA libraries were constructed for the non-embryogenic calli and the dermal embryogenic callus cells as comparative examples:

Double stranded cDNAs were synthesized from 200 ng fragment of mRNA using cDNA synthesis system kit and 400 mu m "random" Roche primer (Roche, Mannheim, Germany). Both ends of the double-stranded cDNA were recovered using the Rapid Library (RL) preliminary kit (Invitrogen, Carlsbad, USA). The adapter connection was carried out at 25 ° C for 10 minutes by the reaction of 1 μl MID adapter and 1 μl RL ligase. Small fragments were removed using AMPure XP Beads and sizing solution (Beckman Coulter, CA, USA). Library quantification was performed using a TBS 380 fluorometer for disposable cuvettes. The quality of the cDNA library was assessed by determining the average fragment size using a High Sensitivity Chip from Agilent 2100 Bioanalyzer ™ (Agilent Technologies, CA, USA).

&Lt; Sequencing trimming, dinovo transcriptome assembly >

The two cDNA templates synthesized above were amplified by emulsion PCR (emPCR) and cDNA pyrosequencing on a 454 GS-FLX Titanium platform was performed as follows:

I have prepared sequences for assemblies using PerlScript, SeqClean (http://compbio.dfci.harvard.edu) and RepeatMasker (http://www.repeatmasker.org) programs. We applied a rigorous filtering process because sequencing errors can create incorrect assemblies. That is, low quality reads were removed from the cut-off value with a Phred quality score of 15 or less and then removed the library adapter sequence, poly A / T stretch and low complexity areas. Finally, a short reading (length less than 50 bases) was filtered out. The pre-treated sequences were assembled using MIRA (version 3.2.1) or the like.

Pyrosequencing of this cDNA produced 269,692 raw reads and 281,714 primordial readings from embryogenic calli (EC) from non-embryogenic calli (NEC) (Table 1).

Embryogenesis Non-abortion Sequencing Total number of raw reads 281,714 269,692 Total length of sequencing reads 91,158,586 86,620,004 Average read length (bp) 323.6 321.2 Maximum read length (bp) 927 942 Trimming Total number of raw reads 204,164 168,065 Total length of sequencing reads 66,133,221 54,494,257 Average read length (bp) 323.9 324.2 Maximum read length (bp) 740 751 De Novo Assembly All assembled unigenes 80,280 63,128 Number of contig (by MIRA) 25,841 20,521 Number of reads assembled 149,725 125,459 The sequence depth 5.8 6.1 Average length of contigs (bp) 749.1 745.0 N50 of contigs (bp) 827 817 Number of contig with> 500bp 19,077 15,203 Number of singletons 54,440 42,607 Average length of singletons (bp) 248.1 245.5 Annotation NCBI-NR 45,832 35,194 UniProt 47,714 38,890 COG 42,919 37,557 All annotated unigenes 48,974 39,900

<Annotation>

Unigen assembled above was annotated using sequences of three databases, such as COG, UniProtKB and NCBI-NR, using the BLASTX algorithm with a threshold of E-value 1e-5, 39,900 of embryogenic calli and 48,974 of embryogenic calli were identified (Table 1).

<Gene Ontology (GO) classification>

Using the Blast2GO program according to molecular functions, biological processes and cellular component ontologies, GO-based functional classifications could be assigned to each of the three major GO categories and 35 subcategories, and the results are shown in FIG. 3 Respectively.

From Table 1 and FIG. 3, it can be confirmed that the callus cells of the callus cells of the genus Epidermis, as a comparative example, are differentially expressed in the transcripts (genes). In particular, biological processes were most prominent.

Example 4 Identification and Characterization of Differentially Expressed Gene (DEGs)

Differentially expressed genes (DEGs) were identified and enrichment was analyzed as follows.

Unijin was clustered by their access number and also quantified the sum of the corresponding readings for each Unijin. The number of readings was normalized according to the difference between the library size and the gene length. Identification of differentially expressed genes (DEGs) was performed by: 1) differences in gene expression between the NEC and EC libraries, and 2) a significant level of difference. Concentration analysis of the GO-term enriched in the differentially expressed genes was determined by a modified Benjamini-Hochberg hypergeometric assay for multiple tests. All DEGs were mapped to GO items based on annotations and converted to adjusted p-values of the enriched GO items using the method developed by NooKaew et al., And then completed the heat map using the R program's heat map function , And the results are shown in Table 2 and Fig.

Category Unijin Can GO-ID GO-term EC NEC Biological process GO: 0008152 Metabolic process 19,735 16,510 GO: 0050896 Response to stimulus 8,684 7,448 GO: 0009987 Cellular process 15,456 12,094 GO: 0032502 Developmental process 5,619 4,092 GO: 0065007 Biological regulation 7,511 5,860 GO: 0000003 Reproduction 3,396 2,414 GO: 0032501 Multicellular organismal process 5,437 3,959 GO: 0071840 Cellular component organization or biogenesis 5,078 3,712 GO: 0051179 Localization 4,897 4,266 GO: 0023052 Signaling 2,734 2,303 GO: 0040007 Growth 1,245 1,028 GO: 0008283 Cell proliferation 353 219 GO: 0016265 Death 391 405 GO: 0051704 Multi-organism process 314 220 GO: 0016032 Viral reproduction 63 46 Molecular function GO: 0005488 Binding 18,270 15,035 GO: 0003824 Catalytic activity 17,195 14,934 GO: 0005215 Transporter activity 2,092 1,782 GO: 0005198 Structural molecule activity 1,019 782 GO: 0001071 Nucleic acid binding transcription factor activity 704 544 GO: 0030234 Enzyme regulator activity 384 333 GO: 0009055 Electron carrier activity 379 445 GO: 0060089 Molecular transducer activity 424 346 GO: 0004872 Receptor activity 148 146 GO: 0016209 Antioxidant activity 161 195 GO: 0045735 Nutrient reservoir activity 28 12 GO: 0045182 Translation regulator activity 14 18 GO: 0031386 Protein tag 0 3 Cellular components GO: 0005623 Cell 25,756 20,926 GO: 0043226 Organelle 19,330 15,483 GO: 0016020 Membrane 6,664 5,710 GO: 0032991 Macromolecular complex 6,161 4,868 GO: 0005576 Extracellular region 1,333 1,311 GO: 0031974 Membrane-enclosed lumen 2,641 1,895 GO: 0031012 Extracellular matrix 6 3

As shown in Table 2 and FIG. 3, the digital expression profiling analysis confirmed 13,766 DEGs, of which 4,895 and 5,820 genes were specifically expressed in EC and NEC, respectively. The remaining 3,051 DEGs were expressed in common, but there was a difference of more than 2-fold between the two libraries (p <0.001). As a result of gene concentration analysis using 13,766 DEGs, 35 GO items showed a significant difference between EC and NEC (p <0.001) (Fig. 4).

In particular, the gene involved in the secondary metabolism (GO: 0019748) can be confirmed to be specific or overexpressed in NEC (FIG. 4).

In order to confirm more specifically, 10 transcripts that are highly expressed in NEC compared with EC were assayed and shown in Table 3.

Contig ID Annotation ID No of reads Description EC NEC EPT001TT0427C001067 ACN96317 3 949 Class 1 chitinase EPT001TT0427C011401 AAC62510 One 219 Metallothionein-1-like EPT001TT0427C011059 AEY75220 One 195 Cytochrome P450 EPT001TT0427C013752 YP_005090323 2 126 Putative p-coumarate 3-hydroxylase EPT001TT0427C001895 ACD45060 One 123 Beta-1,3-glucanase EPT001TT0427C001116 XP_002517441 One 113 ATP binding protein EPT001TT0427C000406 XP_002264896 2 109 Root phototropism protein 2 EPT001TT0427C013102 JN604544 One 106 Cytochrome P450 EPT001TT0427C000759 XM_002264642 One 99 Beta-glucosidase 46-like EPT001TT0427C002999 ACL31667 One 76 4-coumarate coenzyme A ligase

As shown in Table 3, in NEC, various genes involved in secondary metabolism such as two cytochrome P450s, presumed p-cumarate 3-hydroxylase and 4-coumarate coenzyme A ligase, oxidative stress-related genes EC. &Lt; / RTI &gt;

Example 4: Confirmation of gene expression by RT-qPCR

The biosynthetic pathway of the chinese saponins is as follows:

The first step in the synthesis of chinese saponins is catalyzed by squalene epoxidase and the subsequent step is the subsequent oxidation of the triterpene skeleton by cytochrome P450 (CYP) enzyme and UDP-glycosyltransferase (GT) And glycosylation, respectively. CYP is a large and diverse super family of monooxygenases that catalyze the oxidation of organic materials in a wide range of biosynthetic pathways. CYP plays a key role in the functionalization of the triterpene scaffold (the aglycone portion of saponin called sapogenin).

Therefore, the expression amounts of the five transcripts corresponding to the squalene epoxidase, cytochrome P450 (CYP) enzyme and UDP-glycosyltransferase (GT) involved in the biosynthesis pathway of the chrysanthemum saponin were compared and analyzed in NEC and EC.

<RNA isolation and real-time PCR analysis>

Total RNA was extracted using TRI reagent (Molecular Research Center, USA) and real-time quantitative PCR (RT-qPCR) primer was designed by Primer3 program (http: // fokker.wi.mit.edu) Respectively.

Contig ID Description Forward Reverse EPT001TT0427C001363 Squalene epoxidase 2 (SE2) mRNA TTTTTTCATAATGGCCGTTTCAT TTTCCATTTTTGGCCTTGTATTG EPT001TT0427C001289 UDP-glucosyltransferase, putative, mRNA TTTTGGCTAGCCTTTGTTCACTT TTTGGAAGGCGGTCAATATTTCT EPT001TT0427C000589 Cytochrome P450 mRNA, complete CDS ATTGTTGATTGAGGTGGTGGAAG ATACTCATCCCCGTGACATACTC EPT001TT0427C001063 Cytochrome P450 mRNA AAAACTCCCCAAAGAATGTAGGG AAAGTTCAAAAGTCTCCGCGTTA EPT001TT0427C007998 Cytochrome P450 mRNA ATAGATAGATGCACTGCGAGGAT ATTAGTCTTGCTCCGATTCATTG

Gene expression levels were determined by the 2- DELTA Ct method. The first strand cDNA was synthesized with PrimeScript RT Reagent Kit (Takara, Japan) and RT-qPCR was performed using SYBR Green PCR Master Mix (BioRad laboratories, USA) according to the manufacturer's instructions. RT-qPCR was performed using DNA Engine Opticon ^TM continuous fluorescence detection system (MJ Research Inc., Waltham, Mass.).

Each PCR mixture contained 1 μl of cDNA, 2 μl SYBR Green PCR Master Mix 10 μl, 1 μl of each PCR primer (10 μM) and 7 μl of nuclease-free water in 20 μl of the final PCR reaction mix. The cycling conditions for the amplification were 30 minutes at 95 ° C, 30 seconds at 40 ° C, 30 seconds at 60 ° C, and 30 seconds at 72 ° C. The results are shown in FIGS. 5a to 5c.

As shown in Figs. 5A to 5C, Squalene epoxidase was promoted in NEC 10 times or more, and two of cytochrome P450 (CYP) was confirmed to be expressed only in NEC, , And the expression of UDP-glycosyltransferase (GT) was also three times or more increased in NEC. As a result, the productivity of saponin was significantly increased in NEC cells.

<110> National Institute of Forest Science <120> Method for enhancing saponin of Kalopanax septemlobus cell <130> P-10183 <160> 10 <170> KoPatentin 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Squalene epoxidase 2 (SE2) mRNA forward primer <400> 1 ttttttcata atggccgttt cat 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Squalene epoxidase 2 (SE2) mRNA reverse primer <400> 2 tttccatttt tggccttgta ttg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> UDP-glucosyltransferase mRNA forward primer <400> 3 ttttggctag cctttgttca ctt 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> UDP-glucosyltransferase mRNA reverse primer <400> 4 tttggaaggc ggtcaatatt tct 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 mRNA 1 forward primer <400> 5 attgttgatt gaggtggtgg aag 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 mRNA 1 reverse primer <400> 6 atactcatcc ccgtgacata ctc 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 mRNA 2 forward primer <400> 7 aaaactcccc aaagaatgta ggg 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 mRNA 2 reverse primer <400> 8 aaagttcaaa agtctccgcg tta 23 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 mRNA 3 forward primer <400> 9 atagatagat gcactgcgag gat 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 mRNA 3 reverse primer <400> 10 attagtcttg ctccgattca ttg 23

Claims (8)

I) sterilizing the seeds of the barks;
Ii) inducing non-embryogenic callus from the harvested seed; And
Iii) selectively culturing non-embryogenic calli,
Wherein said non-embryogenic callus induction is by culturing in a medium containing 4 ~ 5 [mu] M auxin plant growth hormone.
The method according to claim 1, wherein the auxin plant growth hormone is 2,4-dichlorophenoxyacetic acid.
2. The method of claim 1, wherein the non-embryogenic callus induction is carried out in WPM (woody plant medium) medium containing 4.4 μM 2,4-dichlorophenoxyacetic acid (2,4-D), 3% sucrose, 0.3% And a method for promoting the production of saponin of a feminine cell.
A fern cell composition improved by saponin production by the method for promoting the production of saponin of a fern cell according to claim 1.
[Claim 5] The composition according to claim 4, wherein the mN cells have enhanced expression of squalene epoxidase, cytochrome P450, and UDP-glycosyltransferase.
The feminine cell composition according to claim 4, wherein saponin is used as a raw material for pharmaceuticals, functional foods and cosmetics containing saponin as an active ingredient.
A composition for external application for skin comprising the bark cell composition according to claim 4 or an extract thereof.
8. The composition for external application for skin according to claim 7, wherein the enhanced saponin has an effect of improving and alleviating skin inflammation, antioxidative action, whitening and improving skin tone.

Images