KR102022248B1 - Method for enhancing saponin of Kalopanax septemlobus cell - Google Patents

Abstract

The present invention relates to a method for enhancing saponin production of lacquer cells, and more particularly, to a method for enhancing saponin production of lacquer cells and a saponin cell composition having a higher saponin productivity than conventional lacquer cells prepared using the same.
Saponin production enhancement method of the Rhizome cells of the present invention can enhance saponin production of Rhizoblast cells by inducing and culturing non-embryonic callus of Rhizophyllum which is difficult to grow large. The tree cell composition of the present invention is excellent in usefulness as a raw material component of drugs, functional foods and cosmetics having saponin as an active ingredient with enhanced saponin.

Description

Method for enhancing saponin production in yeast cells {Method for enhancing saponin of Kalopanax septemlobus cell}

The present invention relates to a method for enhancing saponin production of lacquer cells, and more particularly, to a method for enhancing saponin production of lacquer cells and a saponin cell composition having a higher saponin productivity than conventional lacquer cells prepared using the same.

Kalopanax septemlobus is a medicinal plant that is called thawing in Chinese medicine and its bark is called thawing blood. It is a deciduous broad-leaved arborescent tree of 20-25m, belonging to Araliaceae .

The main pharmacological components of Yin tree are saponins such as kalopanaxsaponin A and Kalpanax saponin B. In particular, Yin tree saponins have a similar action to ginseng saponins, and Yin tree has been used as a substitute for ginseng.

The pharmacological activity of Yin-Tak is known as antitussive, anti-inflammatory, tonic action, hypoglycemic action, and the development of technology to utilize Yin-Tum and its composition as a medicine, functional food, and cosmetics has been attempted. -0588448).

Mine can be grown by seed propagation, but double dormancy seeds have germination characteristics for 2 years, so germination rate is very low at around 8% on average. There has been developed a method for producing seedlings in large quantities (registered patent 10-0365491, registered patent 10-0767050).

However, no technology has been developed to enhance the production of saponin, a pharmacological component of Yin.

It is an object of the present invention to provide a method for enhancing saponin production of yeast cells.

It is still another object of the present invention to provide a saponin cell composition having improved saponin productivity compared to conventional saponin cells, prepared by the saponin production-promoting method of the sapling cells.

Still another object of the present invention is to provide a composition for external application of skin comprising the above-mentioned tree cell composition or extract thereof.

In order to achieve the object of the present invention, the present invention

Iii) sterilizing and seeding seeds of the tree;

Ii) inducing a non-embryogenic callus from said seed; And

Iii) selecting and culturing the non-embryonic callus,

The non-embryogenic callus induction provides a method for enhancing saponin production of yeast cells cultured in a medium containing 4 to 5 μM or more of auxin plant growth hormone.

In the present invention, 'callus' refers to the cell mass in which the explants on the culture of the plant are cultured on the medium and cultured under the appropriate culture conditions to form a cell structure having a certain structure.

In the present invention, 'non-embryogenic callus' refers to a callus in which the callus does not have an embryogenic capacity.

Step i): Preparing Seed Seeds

Sterilize seed of wood and provide it.

Seeds may use mature or immature seeds. Callus derived from mature embryos of mature seeds has the advantage that non-embryogenic callus induction is well performed. Therefore, only mature seeds can be selected and used for induction of non-embryogenic callus. When immature seeds are used, induction into embryogenic callus is simultaneously performed in addition to non-embryonic development, but has an advantage of rapid growth rate.

Seed sterilization can be performed by soaking in 70% ethanol for 30 seconds to 1 minute, sterilizing the surface with 2% sodium hypochlorite (NaOCl) solution for 20-30 minutes, and then rinsing with sterile distilled water 3 to 5 times. have.

Seeding of seeds may be carried out by removing the epidermis under a microscope or magnifying glass, or by any other conventional method.

Step ii) non- Embryonic development Callus  Judo

A non-embryogenic callus is derived from the seeded seed from step i).

Media that can be used to induce non-embryogenic callus include WPM (woody plant medium), MS (Murashige & Skoog), B5 (Gamborg's B5), Durzan, SH (Schenk & Hildebrandt), White, DKW (Driver- Kuniyuk-Walnut (Gunis-Walnut), GD (Gresshoff & Doy), LP (Quoirin & Lepiovre) medium and the like, preferably WPM (woody plant medium) medium is used.

It is preferable that the medium for induction of non-embryogenic callus contains 4-5 μM of auxin plant growth hormone. When the callus induction medium contains less than 4 μM of auxin plant growth hormone, callus induction efficiency may be decreased, or the frequency of induction of embryogenic callus may be increased due to insufficient stress on the cell development switch. Inclusion of more than 5 μM may cause the seed seed to die before the callus is induced. Most preferably, Auxin plant growth hormone is contained in 4.4 μM.

'Oxin-type plant growth hormone' that can be used in the present invention includes 2,4-dichlorophenoxyacetic acid (2-4-Dichlorophenoxyacetic acid; 2,4-D) and the like.

As in the examples below, the inverted planter seeds were treated with 4-5 μM 2,4-dichlorophenoxyacetic acid (2,4-D) with WPM containing 3% sucrose, 0.3% gelrite ( woody plant medium) can be dentured to induce callus. At this time it can be incubated for 3-6 weeks in a dark culture room of 24 ~ 26 ℃ can induce the non-embryonic callus.

Step iii): non-embryonic callus culture

By selecting and culturing the non-embryonic callus, a large amount of nematode cells with enhanced saponin productivity are obtained.

The selection of non-embryonic callus can be easily performed by morphological characteristics (FIG. 1). The non-embryogenic callus is white and translucent (FIG. 1A), whereas the embryogenic callus is tan (FIG. 1B) and can be easily distinguished with the naked eye.

Non-embryonic callus can also be distinguished by cell structure characteristics. The cells of non-embryogenic callus are large, vacuole, have small nuclei and have an elongated structure (FIGS. 2A, 2B), whereas embryogenic callus is organized with prominent nuclei and dense cytoplasm. The structure is shown (Fig. 2c, Fig. 2d).

Non-embryogenic callus culture is taken in culture medium by taking only non-embryogenic callus selected in the above manner and incubated for 3-6 weeks in dark culture room at pH 5.0-6.0 and 24-26 ° C. When cultured under the above culture conditions, the expression level of saponin biosynthesis-related enzymes of the lacquer cells of the present invention can be significantly enhanced, and as a result, saponin production can be promoted.

In the present invention, the culture medium of the non-embryogenic callus is WPM (woody plant medium), MS (Murashige & Skoog), B5 (Gamborg's B5), Durzan, SH (Schenk & Hildebrandt), White, DKW (Driver- Kuniyuk-Walnut, GD (Gresshoff & Doy), LP (Quoirin & Lepiovre) medium, and the like. Preferably, WPM medium is used.

In the present invention, auxin plant growth hormone contained in callus induction medium is destroyed in non-embryogenic callus culture, so that it is hardly included in the final cell.

According to still another object of the present invention, there is provided a saponin productivity-promoting saponin cell composition prepared by the saponin production-promoting method of the sapling cells.

The tree cell composition according to the present invention can be used as a raw material of drugs, functional foods and cosmetics containing the active ingredient saponin.

According to another object of the present invention, there is provided a topical composition for skin comprising the above cell composition or extract thereof.

In the present invention, the extract may be extracted by using the organic solvent cell composition. As the organic solvent that can be used for the extraction may be used acetone, ethyl acetate, diethyl ether, glycerin, ethylene glycol, propylene glycol, butylene glycol, benzene, chloroform, hexane and alcohol having 1 to 4 carbon atoms. These can be used individually or in mixture of 2 or more types.

Saponin contained in the external preparation composition for skin may be excellent in the treatment, improvement, prevention and alleviation of skin inflammation, antioxidant effect, whitening and skin tone improvement.

Saponin production enhancement method of the Rhizome cells of the present invention can enhance saponin production of Rhizoblast cells by inducing and culturing non-embryonic callus of Rhizophyllum which is difficult to grow large.

The cell composition of the present invention is excellent in usefulness as a raw material of pharmaceuticals, functional foods and cosmetics with the active ingredient of saponin as the saponin is enhanced, and the external composition for skin according to the present invention is enhanced with the saponin of the tree to treat skin inflammation. It can have the effect of improving, preventing and relieving, antioxidant effect, whitening and skin tone.

1 is a photograph showing the shape of the non-embryonic callus (FIG. 1A) of the Yin-induced wood according to the present invention.
Figure 2 is a photograph taken by optical microscopy and TEM of the non-embryonic cell tissue and ultrastructure of the U. erysipelas induced in accordance with the present invention (Fig.
Figure 3 is a graph showing the gene ontology (GO) classification and the percentage of each category of the unigeneous embryogenic callus (NEC) of the present invention and the negative embryogenic callus (EC) of the comparative example according to the present invention.
Figure 4 shows the cluster heat map of the gene ontology (GO) enrichment analysis of the negative tree embryogenic callus (NEC) according to the invention and the negative tree embryogenic callus (EC) of the comparative example.
Figure 5 is a graph comparing the expression of the unigene of the five major enzymes related to saponin biosynthesis of the lactome non-embryonic callus (NEC) according to the present invention and the lactose embryogenic callus (EC) of the comparative example (SE-squalene epoxidase CYP450s-cytochrome P450; GTs-UDP-glycosyl transferase).

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to specific examples in order to help understanding of the present invention. However, the following examples are only illustrated to more clearly understand the present invention, and the scope of the present invention is not limited by the following examples.

Example

Example 1 Enhancement of Saponin Production of Cells

<Industrial Seed Preparation and Non-Evening Callus Induction>

Immature seeds were harvested from the flowering buds of the flowering period. Soaked in 70% ethanol for 1 minute, surface sterilized with 2% sodium hypochlorite (NaOCl) for 20 minutes, then rinsed five times with sterile distilled water. Seeds were planted by removing the epidermis under a microscope or magnifying glass.

Milled seedlings were 10 × containing callus induction medium, a woody plant medium (WPM) medium containing 3% sucrose, 0.3% zeolite and 4.4 μM 2,4-dichlorophenoxyacetic acid (2,4-D). The non-embryogenic callus was induced by incubating for 3 weeks in a dark culture chamber while wound on a 2 cm plastic Petri dish. Induced callus was mostly non-embryogenic callus showing a white and translucent form (FIG. 1A), and some of the embryogenic callus showing a yellowish brown form (FIG. 1B) were also induced.

<Gum non-embryonic callus culture>

Non-embryogenic callus showing white and translucent morphology was screened and collected on a WPM (woody plant medium) culture medium and incubated in dark culture room at pH 5.0 ~ 6.0 and 24 ~ 26 ℃ for 3 ~ 6 weeks, resulting in saponin productivity. Enhancement yeast cells were prepared in bulk.

Example  2: tree rain- Embryonic development Callus  Tissue observation

As a comparative example, the malt embryogenic callus according to the present invention is compared with histological observation by optical microscopy and TEM, and the results are shown in FIG. 2.

Specifically, 2.5% glutar aldehyde and 1.6% paraformaldehyde buffered with the non-embryonic callus according to the present invention and as the comparative example, the x-ray embryogenic callus with 0.05M phosphate buffer (pH 6.8) for 24 hours at room temperature, respectively. Samples immobilized in a fixed solution containing were dehydrated in alcohol series and then embedded in Technovit 7100 (Kulzer, Germany) according to Yeung (1999). A continuous 3 μm sections were then made on an Autocut rotary microtome (RM 2165, Leica, Wetzlar GmbH, Germany) with a disposable tungsten knife, and each section was stained with toluidine blue O for 15 minutes. Each section was then examined using a Leica DMR optical microscope and recorded with a digital camera (Leica DC 300F) and Leica Application Suite software (FIG. 2A: non-embryonic callus tissue, FIG. 2C: embryogenic callus tissue).

For ultrastructural analysis, callus surface cells were used because inner cell development was relatively slow but cells of the outer layer of callus with high metabolic activity could easily form embryos. Preliminary fixation of the surface cells of the Rhizome embryogenic callus according to the present invention and 2% glutaraldehyde solution adjusted to pH 7.2 with 0.05 M sodium cacodylate buffer, respectively, as a comparative example And fixed in 1% OsO ₄ in the same buffer, dehydrated and sequentially embedded in resin and EPON 812. The ultrafine sections obtained with MT-X ultramicrotome (RMC, Tucson, AZ, USA) were then stained with uranyl acetate followed by lead citrate. Image observation and recording was performed using a LIBRA 120 transmission electron microscope (Carl Zeiss, Germany) and the results are shown in FIG. 2B (non-embryogenic callus) and FIG. 2D (embryonic callus).

As shown in FIG. 1, Nerve non-embryonic callus (NEC) was white, well broken and translucent, whereas embryonic callus (EC) was tan, soft and compact.

As shown in FIG. 2, in terms of cellular structure, the cells of the Rhizome non-embryonic callus (NEC) were large, highly vacuole and elongated with small nuclei (FIG. 2). a, c), embryogenic callus (EC) showed a more organized structure with a small, isometric cell mass, with a pronounced nucleus and a dense cytoplasm (FIG. 2 b and d).

Example 3: Pyro Sequencing and De novo Assembly Analysis

A transcript comparison analysis was performed using the 454 pyro sequencing technique of yeast embryogenic callus as a comparative example.

RNA Extraction, cDNA Library Construction, and 454 Pyro Sequencing

The total RNA of each cell of the Rhizome embryogenic callus as a comparative example was extracted using the cetyltrimethylammonium bromide (CTAB) method, followed by RNeasy column (Qiagen Ltd., Crawley, UK). Clean up. Total RNA quality was determined using NanoDrop spectrophotometer (Thermo, Wilmington, USA) and RNA samples with a ratio of 260: 280 between 1.9 and 2.1 were selected for analysis.

Dynabeads mRNA Purification Kit and Magnetic Particle Concentrator (MPC) (Invitrogen, Carlsbad, USA) were used to construct respective cDNA libraries for leukogenic embryogenic callus and leukogenic embryogenic callus cells as a comparative example as follows:

Double stranded cDNAs were synthesized from 200 ng of mRNA using a cDNA synthesis system kit and 400 μm “random” Roche primers (Roche, Mannheim, Germany). The sock end of the double stranded cDNA was repaired using the Rapid Library (RL) preliminary kit (Invitrogen, Carlsbad, USA). Adapter ligation was performed at 25 ° C. for 10 minutes by reaction of 1 μl MID adapter and 1 μl RL ligase. Small fragments were removed using AMPure XP Beads and a sizing solution (Beckman Coulter, CA, USA). Library quantitation was performed using a TBS 380 Fluorometer for disposable cuvettes. The quality of the cDNA library was evaluated by determining the average fragment size using a High Sensitivity Chip from Agilent2100 Bioanalyzer ™ (Agilent Technologies, CA, USA).

<Sequence trimming, de novo transcriptome assembly>

The two cDNA templates synthesized above were amplified by emulsion PCR (emPCR) and cDNA pyrosequencing on the 454 GS-FLX Titanium platform was performed as follows:

The sequences for assembly were prepared using the user PerlScript, SeqClean (http://compbio.dfci.harvard.edu) and RepeatMasker (http://www.repeatmasker.org) programs. We applied a rigorous filtering process because sequencing errors can create invalid assemblies. That is, low quality reads were removed from cutoff values with a Phred quality score of 15 or less, followed by library adapter sequences, poly A / T stretch and low complexity regions. Finally we filtered out short readings (less than 50 bases in length). The pretreated sequences were assembled using MIRA (version 3.2.1) and the like.

Pyro sequencing of this cDNA produced 269,692 raw reads from Infertile Calligenic Callus (NEC) and 281,714 raw reads from Embryonic Callus (in EC) (Table 1).

Embryonic development Non-embryogenesis Sequencing Total number of raw reads 281,714 269,692 Total length of sequencing reads 91,158,586 86,620,004 Average read length (bp) 323.6 321.2 Maximum read length (bp) 927 942 Trimming Total number of raw reads 204,164 168,065 Total length of sequencing reads 66,133,221 54,494,257 Average read length (bp) 323.9 324.2 Maximum read length (bp) 740 751 De novo Assembly All assembled unigenes 80,280 63,128 Number of contig (by MIRA) 25,841 20,521 Number of reads assembled 149,725 125,459 The sequence depth 5.8 6.1 Average length of contigs (bp) 749.1 745.0 N50 of contigs (bp) 827 817 Number of contig with> 500 bp 19,077 15,203 Number of singletons 54,440 42,607 Average length of singletons (bp) 248.1 245.5 Annotation NCBI-NR 45,832 35,194 UniProt 47,714 38,890 COG 42,919 37,557 All annotated unigenes 48,974 39,900

<Annotation>

Unijin assembled above was annotated using the BLASTX algorithm with a threshold of E-value 1e-5 compared to the sequences for three databases, such as COG, UniProtKB, and NCBI-NR, resulting in a non-negative non- 39,900 embryogenic callus and 48,974 embryogenic callus were identified (Table 1).

Gene Ontology (GO) Classification

GO-based functional classification uses the Blast2GO program according to molecular function, biological process, and cellular component ontology, allowing each assembled Unigene to be assigned to three main GO categories and 35 subcategories, and the results are shown in FIG. Indicated.

From Table 1 and FIG. 3, it can be confirmed that the transcripts (genes) are differentially expressed in the Rhizome non-embryonic callus cells and the Rhizome embryogenic callus cells as a comparative example. In particular, biological processes were most prominent.

Example 4 Identification and Characterization of Differential Expressed Genes (DEGs)

The differentially expressed genes (DEGs) were identified as follows and analyzed by enrichment.

Unijins clustered by their access number and also quantified the sum of readings corresponding to each unijin. The number of reads was normalized according to the difference in library size and gene length. Identification of differentially expressed genes (DEGs) was performed by 1) taking the difference in gene expression between the NEC and EC libraries and 2) taking the significance level of the difference. Concentration analysis of GO term enriched in differentially expressed genes was determined by Benjamini-Hochberg modified hypergeometric assay for multiple testing. All DEGs were mapped to GO entries based on annotations, converted to adjusted p-values of the concentrated GO items using a method developed by NooKaew et al. The results are shown in Table 2 and FIG. 4.

Category Unijin number GO-ID GO-term EC NEC Biological process GO: 0008152 Metabolic process 19,735 16,510 GO: 0050896 Response to stimulus 8,684 7,448 GO: 0009987 Cellular process 15,456 12,094 GO: 0032502 Developmental process 5,619 4,092 GO: 0065007 Biological regulation 7,511 5,860 GO: 0000003 Reproduction 3,396 2,414 GO: 0032501 Multicellular organismal process 5,437 3,959 GO: 0071840 Cellular component organization or biogenesis 5,078 3,712 GO: 0051179 Localization 4,897 4,266 GO: 0023052 Signaling 2,734 2,303 GO: 0040007 Growth 1,245 1,028 GO: 0008283 Cell proliferation 353 219 GO: 0016265 Death 391 405 GO: 0051704 Multi-organism process 314 220 GO: 0016032 Viral reproduction 63 46 Molecular function GO: 0005488 Binding 18,270 15,035 GO: 0003824 Catalytic activity 17,195 14,934 GO: 0005215 Transporter activity 2,092 1,782 GO: 0005198 Structural molecule activity 1,019 782 GO: 0001071 Nucleic acid binding transcription factor activity 704 544 GO: 0030234 Enzyme regulator activity 384 333 GO: 0009055 Electron carrier activity 379 445 GO: 0060089 Molecular transducer activity 424 346 GO: 0004872 Receptor activity 148 146 GO: 0016209 Antioxidant activity 161 195 GO: 0045735 Nutrient reservoir activity 28 12 GO: 0045182 Translation regulator activity 14 18 GO: 0031386 Protein tag 0 3 Cellular components GO: 0005623 Cell 25,756 20,926 GO: 0043226 Organelle 19,330 15,483 GO: 0016020 Membrane 6,664 5,710 GO: 0032991 Macromolecular complex 6,161 4,868 GO: 0005576 Extracellular region 1,333 1,311 GO: 0031974 Membrane-enclosed lumen 2,641 1,895 GO: 0031012 Extracellular matrix 6 3

As shown in Table 2 and FIG. 3, digital expression profiling analysis identified 13,766 DEGs, of which 4,895 and 5,820 genes were specifically expressed in EC and NEC, respectively. The remaining 3,051 DEGs were expressed in common but there was a more than twofold difference in expression levels between the two libraries (p <0.001). As a result of gene enrichment analysis using 13,766 DEGs, 35 GO items showed a significant difference between EC and NEC (p <0.001) (FIG. 4).

In particular, genes involved in the secondary metabolic process (GO: 0019748) can be confirmed that the specific or overexpressed in NEC (Fig. 4).

To confirm in more detail, 10 transcripts expressed much in NEC compared to EC were assayed and shown in Table 3.

Contig ID Annotation ID No of reads Description EC NEC EPT001TT0427C001067 ACN96317 3 949 Class 1 chitinase EPT001TT0427C011401 AAC62510 One 219 Metallothionein-1-like EPT001TT0427C011059 AEY75220 One 195 Cytochrome P450 EPT001TT0427C013752 YP_005090323 2 126 Putative p-coumarate 3-hydroxylase EPT001TT0427C001895 ACD45060 One 123 Beta-1,3-glucanase EPT001TT0427C001116 XP_002517441 One 113 ATP binding protein EPT001TT0427C000406 XP_002264896 2 109 Root phototropism protein 2 EPT001TT0427C013102 JN604544 One 106 Cytochrome P450 EPT001TT0427C000759 XM_002264642 One 99 Beta-glucosidase 46-like EPT001TT0427C002999 ACL31667 One 76 4-coumarate coenzyme A ligase

As shown in Table 3, in NEC, several genes involved in secondary metabolic processes, such as two cytochrome P450s, putative p-coumarate 3-hydroxylase and 4-coumarate coenzyme A ligase, and oxidative stress-related genes are identified. It can be seen that the expression is significantly higher than the EC.

Example 4: Confirmation of Gene Expression by RT-qPCR

Biosynthetic pathways of cypress saponins are as follows:

The first step in the synthesis of saponin saponins is catalyzed by Squalene epoxidase and the subsequent step is subsequent oxidation of the triterpene backbone by cytochrome P450 (CYP) enzyme and UDP-glycosyl transferase (GT) And glycosylation, respectively. CYP is a large and diverse superfamily of monooxygenases that catalyze the oxidation of organic materials in a wide range of biosynthetic pathways. CYP plays a key role in the functionalization of triterpene scaffolds (the aglycone portions of saponins called saponins).

Therefore, the expression levels of the five transcripts corresponding to the squalene epoxidase, cytochrome P450 (CYP) enzyme, and UDP-glycosyl transferase (GT), which are involved in the biosynthetic pathway of Japanese saponin, were compared in NEC and EC.

<RNA isolation and real time PCR analysis>

Total RNA was extracted using TRI reagents (Molecular Research Center, USA), and real-time quantitative PCR (RT-qPCR) primers were designed as shown in Table 4 by the Primer3 program (http://fokker.wi.mit.edu). Was used.

Contig ID Description Forward Reverse EPT001TT0427C001363 Squalene epoxidase2 (SE2) mRNA TTTTTTCATAATGGCCGTTTCAT TTTCCATTTTTGGCCTTGTATTG EPT001TT0427C001289 UDP-glucosyltransferase, putative, mRNA TTTTGGCTAGCCTTTGTTCACTT TTTGGAAGGCGGTCAATATTTCT EPT001TT0427C000589 Cytochrome P450 mRNA, complete cds ATTGTTGATTGAGGTGGTGGAAG ATACTCATCCCCGTGACATACTC EPT001TT0427C001063 Cytochrome P450 mRNA AAAACTCCCCAAAGAATGTAGGG AAAGTTCAAAAGTCTCCGCGTTA EPT001TT0427C007998 Cytochrome P450 mRNA ATAGATAGATGCACTGCGAGGAT ATTAGTCTTGCTCCGATTCATTG

Gene expression levels were determined by the 2-ΔΔCt method. The first strand cDNA was synthesized with PrimeScript RT Reagent Kit (Takara, Japan) and RT-qPCR was performed using the SYBR Green PCR Master Mix (BioRad laboratories, USA) according to the manufacturer's instructions. RT-qPCR was performed using a DNA Engine Opticon ^™ Continuous Fluorescence Detection System (MJ Research Inc., Walthan, Mass.).

Each PCR mixture was made to contain 1 μl of cDNA, 10 μl of 2 × SYBR Green PCR master mix, 1 μl of each PCR primer (10 μM) and 7 μl of nuclease-free water in 20 μl of the final PCR reaction mix. Cycling conditions for amplification were 40 cycles of 30 minutes at 95 ℃, 30 seconds at 40 ℃, 30 seconds at 60 ℃, 30 seconds at 72 ℃, the results are shown in Figures 5a to 5c.

As shown in Figures 5a to 5c, Squalene epoxidase is more than 10 times the expression in NEC, two of the three cytochrome P450 (CYP) is confirmed only in NEC, the other one In addition, the expression was significantly enhanced, UDP-glycosyl transferase (GT) also confirmed that more than three times the enhanced expression in the NEC. As a result, it can be seen that the productivity of saponin is significantly enhanced in NEC cells.

<110> National Institute of Forest Science <120> Method for enhancing saponin of Kalopanax septemlobus cell <130> P-10183 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Squalene epoxidase2 (SE2) mRNA forward primer <400> 1 ttttttcata atggccgttt cat 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Squalene epoxidase2 (SE2) mRNA reverse primer <400> 2 tttccatttt tggccttgta ttg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> UDP-glucosyltransferase mRNA forward primer <400> 3 ttttggctag cctttgttca ctt 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> UDP-glucosyltransferase mRNA reverse primer <400> 4 tttggaaggc ggtcaatatt tct 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> Cytochrome P450 mRNA 1 forward primer <400> 5 attgttgatt gaggtggtgg aag 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> Cytochrome P450 mRNA 1 reverse primer <400> 6 atactcatcc ccgtgacata ctc 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> Cytochrome P450 mRNA 2 forward primer <400> 7 aaaactcccc aaagaatgta ggg 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> Cytochrome P450 mRNA 2 reverse primer <400> 8 aaagttcaaa agtctccgcg tta 23 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> Cytochrome P450 mRNA 3 forward primer <400> 9 atagatagat gcactgcgag gat 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> Cytochrome P450 mRNA 3 reverse primer <400> 10 attagtcttg ctccgattca ttg 23

Claims (8)

In a method for enhancing the expression of saponin production-related enzymes in the cell,
Iii) sterilizing and seeding seeds of the tree;
Ii) inducing callus by culturing the seed sown in a medium containing 4-5 μM of auxin plant growth hormone; And
Iii) selecting a non-embryogenic callus and placing it on the culture medium to incubate for 3 to 6 weeks in a dark culture room at pH 5.0 to 6.0 and 24 to 26 ℃,
The saponin production related enzymes are squalene epoxidase, cytochrome P450, and UDP-glycosyl transferase.
The method of claim 1, wherein the auxin plant growth hormone is 2,4-dichlorophenoxyacetic acid.
The method of claim 1, wherein the non-embryogenic callus induction is woody plant medium (WPM) medium containing 4.4 μM 2,4-dichlorophenoxyacetic acid (2,4-D), 3% sucrose, 0.3% gelite. A method for enhancing the expression of saponin production-related enzymes of a lactose cell, which is made in tooth.
According to claim 1 by the method according to claim 1 to increase the expression of saponin production-related enzymes in the cell
The saponin production-related enzymes are squalene epoxidase, cytochrome P450, and UDP-glycosyl transferase will be.
delete Food comprising the cell composition of claim 4 or an extract thereof.
Cosmetics comprising the wooden cell composition according to claim 4 or an extract thereof. delete

Images