KR20190031682A - Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics - Google Patents

Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics Download PDF

Info

Publication number
KR20190031682A
KR20190031682A KR1020170119413A KR20170119413A KR20190031682A KR 20190031682 A KR20190031682 A KR 20190031682A KR 1020170119413 A KR1020170119413 A KR 1020170119413A KR 20170119413 A KR20170119413 A KR 20170119413A KR 20190031682 A KR20190031682 A KR 20190031682A
Authority
KR
South Korea
Prior art keywords
seq
cosmetic composition
skin
mir
present
Prior art date
Application number
KR1020170119413A
Other languages
Korean (ko)
Other versions
KR102033949B1 (en
Inventor
이지영
김태양
주환빈
이춘몽
이건국
Original Assignee
주식회사 코리아나화장품
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 코리아나화장품 filed Critical 주식회사 코리아나화장품
Priority to KR1020170119413A priority Critical patent/KR102033949B1/en
Publication of KR20190031682A publication Critical patent/KR20190031682A/en
Application granted granted Critical
Publication of KR102033949B1 publication Critical patent/KR102033949B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60Sugars; Derivatives thereof
    • A61K8/606Nucleosides; Nucleotides; Nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Cosmetics (AREA)

Abstract

The present invention provides a cosmetic composition for ameliorating atopic dermatitis comprising a miRNA containing a nucleotide sequence of sequence number one and having sequence homology of 85% or more with a nucleotide sequence of sequence number two or a mimic thereof as an active ingredient. The composition of the present invention can be used in treating atopic dermatitis by regulating the expression of inflammatory cytokines, and thus by regulating skin inflammation, moisturizing and barrier functions.

Description

miRNA-630 및 이의 모방체를 함유하는 아토피 피부 개선용 화장료 조성물{COSMETIC COMPOSITION FOR IMPROVING ATOPIC DERMATITIS CONTAINING MICRO RNA-630 AND ITS MIMICS}TECHNICAL FIELD [0001] The present invention relates to a cosmetic composition for improving atopic skin containing miRNA-630 and a mimetic thereof. < Desc / Clms Page number 1 >

본 발명은 마이크로 RNA인 miRNA-630 및 이의 모방체를 함유하는 화장료 조성물에 관한 것으로, 구체적으로 miRNA-630 및 이의 모방체를 함유하는 아토피 피부 개선용 화장료 조성물에 관한 것이다.The present invention relates to a cosmetic composition containing microRNA miRNA-630 and a mimetic thereof, and more particularly to a cosmetic composition for improving atopic skin containing miRNA-630 and a mimetic thereof.

일반적으로, 피부는 외부환경과 항상 접하고 있는 기관으로서, 수분손실을 막는 보호장벽으로서의 역할을 수행한다. 표피의 각질층 역시 피부에 가장 외측에 존재하면서 피부 밖으로 수분과 전해질이 소실되는 것을 억제함으로써, 피부의 건조를 막아 피부가 정상적인 대사과정을 수행할 수 있도록 환경을 제공한다. 또한, 외부의 물리적 손상과 화학물질로부터 인체를 보호하거나 세균, 바이러스 등이 피부로 침입하는 것을 막아주는 중요한 역할을 한다.In general, the skin is an organ that is always in contact with the external environment, and acts as a protective barrier to prevent moisture loss. The horny layer of the epidermis also exists in the outermost part of the skin and inhibits the loss of moisture and electrolytes outside the skin, thereby preventing the skin from drying and providing an environment in which the skin can perform a normal metabolic process. It also plays an important role in protecting the body from external physical damage, chemical substances, and preventing invasion of bacteria, viruses, etc. into the skin.

이러한 피부에 환경적, 유전적인 문제로 인하여 기능이 저하되어 생기는 질환이 아토피 피부염이다. 아토피성 피부염은 피부 장벽기능장애와 알르레기원과 미생물과 같은 환경 인자 사이의 복잡한 상호작용과 관련된 유일한 질병이다(Incovaria et al., Clin. Exp. Immunol., 153: 27-29, 2003). 멜라닌세포(melanocyte)와 각질세포(keratinocyte)를 포함하는 모든 피부세포는 활성산소종(reactive oxygen species, ROS)와 활성질소종(reactive nitrogen species, RNS)을 생산한다(Pelle et al., J. Invest. Dermatol., 124: 793-797, 2005;Kornina and Pastore, Front. Biosci. 1: 123-141, 2005). 덧붙여, 피부세포로부터 생성된 ROS는 또한 지질 분자 또는 리폭시게나제(lipoxigenase)와 시클로옥시게나제(cyclooxygenase)와 같은 산화환원-민감성 지질대사 효소와 반응함으로써 지질 라디칼(lipid radical), 과산화물(peroxide), 하이드로과산화물(hydroperoxide)와 같은 활성지질종(reactive lipid species) 또는 알데히드를 생산할 수 있다. 만성 염증질환인 아토피성 피부염은 그러한 산화 환원균형을 붕괴시켜서 ROS, RNS의 과잉생산과 지질 과산화물의 높은 수준을 야기하는데, 이는 결국 질병상태를 악화시키고 Th2-편향된 면역반응 쪽으로 치우치게 한다(Briganti and Picardo, J. Eur. Acad. Dermatol., 17: 663-669, 2003; Wu et al., Clin. Exp. Immunol., 135: 194-199, 2004).Atopic dermatitis is a disease caused by environmental and genetic problems in these skin. Atopic dermatitis is the only disease associated with complex interactions between skin barrier dysfunction and environmental factors such as allergens and microorganisms (Incovaria et al., Clin. Exp. Immunol., 153: 27-29, 2003). All skin cells, including melanocytes and keratinocytes, produce reactive oxygen species (ROS) and reactive nitrogen species (RNS) (Pelle et al., J. Mol. Invest. Dermatol., 124: 793-797, 2005; Kornina and Pastore, Front. Biosci., 1: 123-141, 2005). In addition, ROS produced from skin cells also react with lipid radicals, peroxides, and lipid radicals by reaction with lipid molecules or redox-sensitive lipid metabolism enzymes such as lipoxigenase and cyclooxygenase. , Reactive lipid species such as hydroperoxide, or aldehydes. Atopic dermatitis, a chronic inflammatory disease, disrupts such redox balance leading to overproduction of ROS and RNS and high levels of lipid peroxides, which eventually worsens the disease state and biases towards the Th2-biased immune response (Briganti and Picardo , J. Eur. Acad. Dermatol., 17: 663-669, 2003; Wu et al., Clin. Exp. Immunol., 135: 194-199, 2004).

피부에 나타나는 염증 반응은 붉어짐, 따끔거림, 화끈거림, 팽윤, 조직의 변화와 같은 5가지 현상으로 나타나는데, 이는 해로운 주위 환경, 즉 세균과 같은 외부 물질의 침입과 기계적 손상으로부터 생체를 보호하려는 생리적인 반응이다. 염증과 관계되는 대표적인 피부 트러블의 형태로는 아토피와 여드름 등이 있다. 특히, 아토피에 대해서 설한다면, 아토피는 심한 가려움증이 특징인데 피부에 자극을 가하면 가려움증이 더욱 심해지고, 자꾸 더 긁다보면 상처가 나게된다. 이로 인해 세균감염(황색포도상구균, 연쇄상구균 등)이 일어나게 되어 염증이 발생한다. 아토피의 문제 중에 중요한 인자의 하나는 이때 일어나는 2차 감염 및 초항원 독소이다. 아토피 환자의 80~90%는 피부에 황색포도상구균(Staphylococcus aureus)과 연쇄상구균(Stereptococcus pyogenes)의 감염이 있는데, 이때 anti- Staphylococcus, IgE가 만들어지며, 이는 T-cell 반응을 자극하는 초항원 독소에 의해 유발된다. 보다 구체적으로, 이러한 황색포도상구균의 초항원 독소는 랑게르한스 세포내 항원제시세포를 통하여 T 임파구를 선택적으로 자극하여 인터루틴-1과 TNF-alpha를 생산하게 하고, 이들에 의해 자극된 T-cell에서 여러 가지 세포내 사이토카인이라는 독소를 분비하여 염증을 일으키게 된다. 즉, 초항원 독소는 인터루틴-4와 인터루틴-5의 분비를 촉진하여 IFN-gamma의 분비는 저해하고, CLA의 수를 증가시켜 결국 IgE의 생성을 촉진시킨다. 이러한 IgE에 의하여 호염구에서 히스타민이라는 물질이 분비되어 아토피 피부염이 악화된다.The inflammatory reactions that appear on the skin appear as redness, tingling, burning, swelling, and changes in tissue, which are physiological and physiologic factors that protect the body from harmful environmental conditions such as intrusion of external substances such as bacteria and mechanical damage Reaction. Typical skin troubles associated with inflammation include atopy and acne. Especially, if you talk about atopy, atopy is characterized by severe itching. When you stimulate the skin, the itching becomes worse, and when you scratch more, it gets hurt. This causes bacterial infections (Staphylococcus aureus, Streptococcus, etc.) and inflammation occurs. One of the important factors in the problem of atopy is the secondary infections and superantigen toxins that occur at this time. Staphylococcus aureus and Stereptococcus pyogenes infect skin with at least 80-90% of atopic patients, which produce anti- Staphylococcus , IgE, which is responsible for the T-cell response-stimulating superantigen Lt; / RTI > More specifically, the superantigen toxin of Staphylococcus aureus selectively stimulates T lymphocytes through antigen presenting cells in Langerhans cells to produce interleukin-1 and TNF-alpha, and stimulates T-cells It secretes various toxins called intracellular cytokines and causes inflammation. In other words, the superantigen toxin promotes the secretion of interleukin-4 and interleukin-5, thereby inhibiting the secretion of IFN-gamma and increasing the number of CLA, thereby promoting the production of IgE. Such IgE causes secretion of histamine from the basophil, and atopic dermatitis is exacerbated.

일반적으로 아토피 피부염 환자는 정상인에 비하여 세균, 바이러스, 곰팡이에 의한 피부 감염이 잘 발생하는 것으로 알려져 있다. 특히 아토피 환자의 90%가 피부에 황색 포도상구균(Staphylococcus aureus)이 집적되어 번식하고 있으며, 많은 연구 결과들을 통해서 아토피 환자의 상피세포에 황색 포도상구균의 감염되어 있음이 알려져 있다. 그러나 이런 아토피 환자에게 상피세포에 포도상 구균의 감염 및 번식하는 기전은 명확하지 않다. 아토피성 질환 부모의 소아에서 아토피성 피부염의 빈도가 높아 유전적인 소인이 있는 것으로 추정되고, 아토피성 피부염을 가지고 있는 모체로부터 수유기간이 증가할수록 아토피성 피부염의 발생 빈도도 증가하는 것으로 알려지고 있다In general, it is known that atopic dermatitis patients are more susceptible to bacterial, viral, and fungal skin infections than normal people. In particular, 90% of atopic patients are multiplying and accumulating Staphylococcus aureus in their skin, and many studies have shown that the staphylococcal infections of atopic patients are infected with Staphylococcus aureus. However, the pathogenesis of staphylococcal infection and proliferation of epithelial cells in these atopic patients is unclear. It is known that the genetic predisposition is high due to the high incidence of atopic dermatitis in parents of children with atopic diseases. It is known that the incidence of atopic dermatitis increases with the feeding period from the mother with atopic dermatitis

이들 포도상구균에 의한 피부 감염증은 주로 각질층 내의 세라마이드(Ceramides)의 함량을 감소시킴으로써 발생한다. 아토피는 각질층의 수분유지기능이 떨어짐에 따라 피부가 건조되어 각질이 다량 일어나며, 피부장벽 기능이 저하됨에 따라 자극유발물질이 각질층 내로 침입하여 자극을 유발시켜 정상피부에서는 침입하기 어려운 항원 단백질이 침입하며, 피부 알러지 등이 용이하게 발생하여 심한 소양증을 나타낸다. 따라서, 아토피 환자의 90% 이상이 포도상구균에 감염되어 있으며, 이것은 환자가 가려움을 참지 못하여 긁어서 생기기도 하지만 세균의 외독소가 우리 몸의 면역체계를 자극하여 알레르기를 일으키는 화학물질을 나오게 하여 아토피를 악화시킨다.These staphylococcal skin infections are mainly caused by reducing the content of ceramides in the stratum corneum. Atopic dermatitis is caused by dryness of the skin due to the loss of the water retention function of the stratum corneum, resulting in a large amount of keratin. As the skin barrier function is lowered, the stimulating substance enters the stratum corneum and induces stimulation. , Skin allergies and the like are easily occurred, resulting in severe pruritus. Therefore, more than 90% of atopic patients are infected with Staphylococcus aureus, which is caused by scraping because the patient can not tolerate the itching, but the bacterial exotoxin stimulates the body's immune system, causing chemicals that cause allergy, .

이러한 문제를 해결하기 위하여, 현재 일반적으로 사용되고 있는 아토피 피부를 치료하는 방법으로는 보습제 사용, 타르제제 사용, 바르거나 먹는 스테로이드제제 사용, 자외선 치료, 클린다마이신, 디클록사시린(dicloxacilline)과 같은 항생제, 항소양제, 과망간산칼륨(potassium permanganate), 세트리마이드(cetrimide), 클로르헥시딘(chlorhexidine), 클로옥시레놀(chloroxylenol), 디브로모프로파미딘(dibromopropamidine), 폴리녹시린(polynoxylin), 포비돈 아이오다인(povidone iodine), 트리클로산(triclosan)과 같은 항균제, 면역 관련 치료제, 식품, 향기, 한방 등의 방법을 사용하고 있다.In order to solve this problem, currently available methods of treating atopic skin include, but are not limited to, the use of moisturizing agents, the use of tar preparations, the use of a proper or steroid preparation, ultraviolet light treatment, antibiotics such as clindamycin, dicloxacilline, Antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antioxidants, antimicrobial agents, antimicrobial agents, antibiotics such as povidone iodine and triclosan, immunotherapeutic agents, food, fragrance and herbal medicine.

그러나, 타르제제는 알코올 성분이 있어 냄새가 좋지 않고 건조한 피부를 자극하는 단점이 있고, 스테로이드 제제는 발진, 피부색 변화, 고혈압, 백내장 등의 부작용이 심각하며, 자외선 치료는 햇볕의 화상, 가려움증 유발, 색소 침착과 장기간 치료 시에는 피부의 조기 노화와 암의 위험이 높고, 항생제는 주로 내복약으로 사용하는 단점이 있다.However, Tar formulation has a disadvantage of irritating dry skin because it has an alcohol component. Steroid preparations have severe side effects such as rash, change of skin color, hypertension and cataract, and ultraviolet rays are a cause of sunburn, itching, During pigmentation and prolonged treatment, the risk of skin premature aging and cancer is high, and antibiotics are mainly used as an oral medicine.

Micro RNA는 인트론 부위에 위치하며 크기는 17~25의 뉴클레오타이드로서 매우 작은 유전물질로서 세포의 유전자 발현을 선택적으로 조절하여, 세포의 성장, 분화, 노화, 활성 등에 관여하는 역할을 한다. 인간에게는 1000개의 마이크로 RNA가 존재할 것으로 추정되며, 각각의 마이크로 RNA에 대한 세포 내 기전 규명은 활발히 진행중이다.MicroRNA is located in the intron region and is 17 to 25 nucleotides. It is a very small genetic material that selectively regulates cell gene expression and plays a role in cell growth, differentiation, aging, and activity. It is estimated that there are 1000 microRNAs in humans, and intracellular mechanism for each microRNA is actively under investigation.

현재까지 밝혀진 miRNA는 주로 암과 같은 질병이나 발달과정과 관련된 것들이다. 예를 들어 miR-17과 miR-92는 전사인자인 E2F1의 발현을 직접적으로 조절하여 세포의 증식을 촉진하며 유방암, 폐암, 결장암, 위암, 췌장암에서 과발현되어 있다고 보고되었다. 또한, miR-29a는 미토콘드리아 외막에 존재하여 세포 사멸을 억제시키는 Mcl-1 유전자의 발현을 직접적으로 제어하여 세포사멸(Apoptosis)을 유발하고 miR-21은 종양억제유전자인 PTEN의 발현을 직접적으로 조절하여 세포 사멸을 저해하고 정상세포를 종양세포로 형질 전환시키며 다양한 암종에서 과발현되어 있다고 보고되었다. To date, miRNAs have been associated with diseases such as cancer and developmental processes. For example, miR-17 and miR-92 have been reported to directly regulate the expression of E2F1, a transcription factor, to promote cell proliferation and overexpress in breast, lung, colon, stomach, and pancreatic cancer. In addition, miR-29a is located in the mitochondrial outer membrane and directly controls the expression of Mcl-1 gene, which inhibits apoptosis, to induce apoptosis. MiR-21 directly regulates the expression of PTEN, And it is reported that it is overexpressed in various carcinomas, inhibiting apoptosis and transforming normal cells into tumor cells.

반면 피부에서의 miRNA의 역할에 대한 연구는 초기단계이며 현재까지 밝혀진 miRNA 중 대표적인 예로, 2011년 miR-125b가 각질형성세포 내 FGFR2의 유전자 발현을 직접적으로 조절하여 건선(psoriasis)를 조절할 수 있다고 보고되었다. 그 외에도 miR-152 및 mir-630은 세포외기질(extra-cellular matrix)을 조절하여 피부진피세포의 노화를 조절하고, miR-434-5p가 피부세포의 미백에 관여한다는 보고 등이 있다. 이처럼 피부에서도 피부노화현상과 관련하여 miRNA가 중요한 역할을 수행할 것으로 보이며 향후 피부노화에서의 miRNA의 역할은 학술적 또는 산업적으로 큰 가치를 지닐 것으로 판단된다.On the other hand, studies on the role of miRNAs in the skin are at an early stage. As a representative example of miRNAs, miR-125b can control psoriasis by directly controlling gene expression of FGFR2 in keratinocytes in 2011 . In addition, there are reports that miR-152 and mir-630 control the aging of skin dermal cells by regulating extracellular matrix and that miR-434-5p is involved in skin cell whitening. Thus, miRNA plays an important role in the skin aging phenomenon, and the role of miRNA in skin aging in future will be of great academic or industrial value.

한국등록특허 제10-1776000호는 miR-181a 및 이의 모방체를 포함하는 화장료 조성물에 관한 것이다.Korean Patent No. 10-1776000 relates to a cosmetic composition comprising miR-181a and a mimetic thereof.

이에, 본 발명자는 염증성 사이토카인 발현 억제 효과, NF-κB 활성 억제효과, 보습효과, 피부 장벽기능 개선 효과를 지니는 신규 물질을 찾는 연구를 수행한 결과 miR-630 또는 이의 모방체(mimic)가 그 효능이 매우 우수하다는 것을 발견하게 되었다.Accordingly, the present inventors have conducted a search for a novel substance having an inflammatory cytokine expression inhibitory effect, an NF-κB activity inhibitory effect, a moisturizing effect, and an effect of improving skin barrier function. As a result, miR-630 or its mimic And found that the efficacy is very good.

본 발명의 목적은 miR-630 또는 이의 모방체(mimic)를 함유하여 아토피 피부개선용 화장료 조성물을 제공하는데 있다.It is an object of the present invention to provide a cosmetic composition for improving atopic skin containing miR-630 or a mimic thereof.

본 발명은 서열번호 1의 염기서열을 포함하고, 서열번호 2의 염기서열과 85% 이상의 서열 상동성을 갖는 마이크로 RNA 또는 이의 모방체를 유효성분으로 포함하는 아토피 피부 개선용 화장료 조성물에 관한 것이다.The present invention relates to a cosmetic composition for improving atopic skin comprising a nucleotide sequence of SEQ ID NO: 1 and comprising, as an active ingredient, a microRNA having a sequence homology of 85% or more with the nucleotide sequence of SEQ ID NO: 2 or a mimetic thereof.

바람직하게는, 상기 화장료 조성물은 NF-κB의 활성을 조절한다. Preferably, the cosmetic composition controls the activity of NF-kB.

또한 바람직하게는, 상기 화장료 조성물은 염증성 사이토카인의 발현 억제효과를 갖는다. Also preferably, the cosmetic composition has an effect of suppressing the expression of an inflammatory cytokine.

또한 바람직하게는, 상기 화장료 조성물은 보습 효과를 갖는다. Also preferably, the cosmetic composition has a moisturizing effect.

또한 바람직하게는, 상기 화장료 조성물은 피부장벽기능 개선 효과를 갖는다.Also preferably, the cosmetic composition has an effect of improving the skin barrier function.

본 발명에 miR-630 및 이의 모방체를 유효성분으로 포함하는 조성물은 NF-κB 활성 억제효과(실험예 1), 염증성 사이토카인의 발현 억제 효과(실험예 2), 보습 효과(실험예3), 피부장벽기능 개선 효과(실험예 4)를 갖는다.The present invention relates to a composition comprising miR-630 and its mimetics as an active ingredient, which is effective for inhibiting NF-κB activity (Experimental Example 1), inhibiting the expression of inflammatory cytokines (Experimental Example 2), moisturizing effect (Experimental Example 3) , And skin barrier function improving effect (Experimental Example 4).

도 1은 서열번호 2 내지 14에 따른 IkB 단백질량의 발현 정도를 나타내는 그래프이다.1 is a graph showing the expression levels of IkB protein according to SEQ ID NOS: 2 to 14;

본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 하기의 정의를 가지며 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미에 부합된다. 또한 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 본 발명에 도입된다. 용어 약이라는 것은 참조 양, 수준, 값, 수, 빈도, 퍼센트, 치수, 크기, 양, 중량 또는 길이에 대해 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 또는 1% 정도로 변하는 양, 수준, 값, 수, 빈도, 퍼센트, 치수, 크기, 양, 중량 또는 길이를 의미한다.Unless defined otherwise, all technical terms used in the present invention have the following definitions and are consistent with the meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Also, preferred methods or samples are described in this specification, but similar or equivalent ones are also included in the scope of the present invention. The contents of all publications referred to herein are incorporated herein by reference. The term " drug " is used herein to refer to a reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, Level, value, number, frequency, percentage, dimension, size, quantity, weight or length of a sample,

본 명세서를 통해, 문맥에서 달리 필요하지 않으면, 포함하다 및 포함하는 이란 말은 제시된 단계 또는 구성요소, 또는 단계 또는 구성요소들의 군을 포함하나, 임의의 다른 단계 또는 구성요소, 또는 단계 또는 구성요소들의 군이 배제되지는 않음을 내포하는 것으로 이해하여야 한다. Throughout this specification, the words " comprising " and " comprising ", unless the context clearly requires otherwise, include the steps or components, or groups of steps or elements, And that they are not excluded.

본 발명에서 사용되는 용어 "씨드 서열(seed sequence)"는 마이크로 RNA 염기서열 내에 타겟 mRNA에 완벽하게 일치하여 붙는 염기서열을 뜻하며 타겟 단백질, 유전자 발현 등에 관여하는 서열을 의미한다.As used herein, the term " seed sequence " refers to a nucleotide sequence that perfectly matches a target mRNA in a microRNA base sequence, and refers to a target protein, a sequence involved in gene expression, and the like.

본 발명에서 사용되는 용어 "서열 상동성"은 기준이 되는 서열의 뉴클레오타이드와 구성이 일치하는 정도를 퍼센트로 나타낸 것을 의미한다.As used herein, the term " sequence homology " refers to the degree to which the nucleotide sequence conforms to the reference sequence in percent.

본 발명은 피부각질형성세포의 분화 및 피부 보습 조절용 조성물로서, 서열번호 1의 염기서열을 포함하고 총 15 내지 22개의 올리고뉴클레오타이드, 바람직하게는 22개의 올리고뉴클레오타이드로 이루어진 마이크로 RNA 또는 이의 모방체(mimic)를 유효성분으로 포함하는 아토피 피부 개선용 화장료 조성물에 관한 것이다.The present invention relates to a composition for controlling the differentiation and skin moisturization of dermal keratinocytes, which comprises a microRNA consisting of a total of 15 to 22 oligonucleotides, preferably 22 oligonucleotides containing the nucleotide sequence of SEQ ID NO: 1 or a mimic thereof ) As an active ingredient to a cosmetic composition for improving atopic skin.

5' - GUAUUC - 3' (서열번호 1) 5 '- GUAUUC-3' (SEQ ID NO: 1)

또한, 본 발명은 서열번호 2의 염기서열을 포함하는 아토피 피부 개선용 화장료 조성물에 관한 것이다. 서열번호 2의 염기서열은 서열번호 1의 올리고뉴클레오타이드를 포함하며 miR-630와 동일한 서열을 갖는 올리고뉴클레오타이드이다.The present invention also relates to a cosmetic composition for improving atopic skin comprising the nucleotide sequence of SEQ ID NO: 2. The nucleotide sequence of SEQ ID NO: 2 is an oligonucleotide comprising the oligonucleotide of SEQ ID NO: 1 and having the same sequence as miR-630.

5' - AGUAUUCUGUACCAGGGAAGGU - 3' (서열번호 2)5 '- AGUAUUCUGUACCAGGGAAGGU-3' (SEQ ID NO: 2)

본 발명은 서열번호 1의 염기서열을 포함하면서 서열번호 2의 염기서열과 85% 이상의 서열 상동성을 갖는 올리고뉴클레오타이드를 포함하는 아토피 피부 개선용 화장료 조성물에 관한 것이다. 바람직하게는 본 발명은 서열번호 2의 염기서열과 90% 이상, 보다 바람직하게는 95% 이상의 서열 상동성을 갖는 올리고뉴클레오타이드를 포함할 수 있다. 상기 범위보다 낮은 서열 상동성을 갖는 경우에는 다른 염기서열과의 결합이 약하거나 제한되어서 원하는 효과를 얻을 수 없다.The present invention relates to a cosmetic composition for improving atopic skin comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 and having a sequence homology of 85% or more with the nucleotide sequence of SEQ ID NO: 2. Preferably, the present invention can include an oligonucleotide having 90% or more, more preferably 95% or more of the sequence homology with the nucleotide sequence of SEQ ID NO: 2. In the case of having a sequence homology lower than the above range, a desired effect can not be obtained because the binding with other base sequences is weak or limited.

또한, 본 발명에서 본 발명에서 85% 이상의 서열 상동성을 갖는다는 것은 씨드 서열(서열번호 1)을 포함하면서 기준 서열(서열번호 2)의 올리고뉴클레오타이드를 기준으로 3개의 뉴클레오타이드가 변형된 것을 의미하고, 90% 이상의 서열 상동성을 갖는다는 것은 2개의 뉴클레오타이드가 변형된 것을 의미하고, 95% 이상의 서열 상동성을 갖는다는 것은 1개의 뉴클레오타이드가 변형된 것을 의미한다. 기준 서열의 올리고뉴클레오타이드의 길이는 15 내지 22개로 변형될 수 있으나, 본 발명에서는 하나의 뉴클레오타이드가 변형되는 경우 5% 서열 상동성이 감소되는 것으로 볼 것이다.In the present invention, the nucleotide sequence having 85% or more homology in the present invention means that 3 nucleotides are modified based on the oligonucleotide of the reference sequence (SEQ ID NO: 2) including the seed sequence (SEQ ID NO: 1) , 90% or more sequence homology means that two nucleotides are modified, and having 95% or more sequence homology means that one nucleotide has been modified. The length of the oligonucleotide of the reference sequence may be varied from 15 to 22, but in the present invention, the 5% sequence homology will be reduced when one nucleotide is modified.

아토피나 건선과 같은 난치성 피부질환의 중요 요인 중 하나가 염증에 의한 피부질환이며, 이들의 공통점은 염증악화에 의해 병변이 증가된다는 점인데, 공통적으로 발견되는 염증 원인이 NF-κB 과활성화로 인한 증상 악화이다. 따라서, 본 발명에 따른 올리고뉴클레오타이드를 포함하는 조성물은 상기 NF-κB의 활성을 조절하여 염증성 사이토카인의 발현을 억제시킬 수 있다. 염증성 사이토카인의 발현이 감소하면 염증반응을 감소시킴으로써 아토피피부 개선용 조성물로서 이용될 수 있다.One of the major causes of intractable skin diseases such as atopy and psoriasis is skin disease caused by inflammation. The common feature is that the lesions are increased by aggravation of inflammation. Common causes of inflammation are NF-κB and activation The symptoms are worse. Accordingly, the composition comprising the oligonucleotide according to the present invention can suppress the expression of inflammatory cytokines by modulating the activity of the NF-κB. Reduced expression of inflammatory cytokines can be used as a composition for improving atopic skin by reducing the inflammatory response.

본 발명에서 miR-630는 인간 또는 마우스로부터 유래된 것일 수 있으며, 이에 한정되지 않는다.In the present invention, miR-630 may be derived from human or mouse, but is not limited thereto.

본 발명의 서열번호 1의 염기서열을 갖는 miRNA를 이용하여 miR-630 및 이의 모방체(mimic)로 miR-630과 동일/유사한 서열을 갖는 올리고뉴클레오타이드 분자를 제작할 수 있다. 또한, hsa-miR-630의 모방체(mimic)는 상기 hsa-miR-630 염기서열과 유사한 서열로서, NF-κB의 활성을 억제하고 염증성 사이토카인 유전자의 발현을 조절하는 기능을 수행하는 것들을 포함할 수 있다. The miRNA having the nucleotide sequence of SEQ ID NO: 1 of the present invention can be used to prepare oligonucleotide molecules having the same / similar sequence as miR-630 and its mimic as miR-630. In addition, the mimic of hsa-miR-630 is a sequence similar to the hsa-miR-630 nucleotide sequence and includes those that inhibit the activity of NF-kB and regulate the expression of an inflammatory cytokine gene can do.

또한, 본 발명의 상기 올리고뉴클레오타이드는 변형된 뉴클레오타이드 분자로 이루어질 수도 있다. 예컨대, 2'-O-알킬(예: 메틸, 에틸), 2'-O-알릴, 2'-O-알릴과 같은 2'-치환된 라이보스를 포함하는 뉴클레오타이드 분자를 부분적으로 또는 전체적으로 포함할 수 있다. 또한, 치환된 염기를 갖는 뉴클레오타이드 분자를 부분적으로 또는 전체적으로 포함할 수도 있다.The oligonucleotide of the present invention may also be composed of modified nucleotide molecules. Partially or wholly comprise a nucleotide molecule comprising a 2'-substituted ribose such as, for example, 2'-O-alkyl (e.g. methyl, ethyl), 2'-O-allyl, 2'- . In addition, the nucleotide molecule having a substituted base may be partially or entirely contained.

본 발명은 본 발명에 따른 마이크로 RNA 또는 이의 모방체를 유효성분으로 포함하여 NF-κB 활성 억제효과, 염증성 사이토카인 발현 억제효과, 보습효과 및 피부장벽기능 개선효과를 갖는 화장료 조성물을 제공할 수 있다.The present invention can provide a cosmetic composition having an effect of inhibiting NF-κB activity, inhibiting the expression of inflammatory cytokine, moisturizing effect, and skin barrier function, comprising the microRNA or the mimetic thereof according to the present invention as an active ingredient .

본 발명에 따르면, 상기 본 발명에 따른 마이크로 RNA 또는 이의 모방체는 조성물의 전체 중량에 대해서 0.00001 ~ 30.0 중량% 함유되며, 더욱 바람직하게는, 상기 올리고뉴클레오타이드를 화장료 조성물의 전체 중량에 대해서 0.001 ~ 10 중량% 함유되는 것을 특징으로 한다. 상기 올리고뉴클레오타이드의 함량이 0.00001 중량% 미만인 경우에는 피부 개선 효과가 나타나지 않으며, 30.0 중량%를 초과하는 경우에는 함유량 증가에 대한 피부 개선 효과 증대 정도가 미미하며, 제형상의 안전 및 안정성에 문제가 있으며 경제적이지도 못하다. According to the present invention, the microRNA or the mimetic thereof according to the present invention is contained in an amount of 0.00001-30.0 wt% based on the total weight of the composition, more preferably 0.001-10.0 wt% of the oligonucleotide, By weight. When the content of the oligonucleotide is less than 0.00001% by weight, the effect of improving the skin is not exhibited. When the content of the oligonucleotide is more than 30.0% by weight, the degree of increase of the skin improving effect with respect to the increase of the content is insignificant, It is not economical.

따라서, 상기 올리고뉴클레오타이드를 포함하는 아토피피부 개선용 화장료 조성물은 염증성 사이토카인 발현 억제 효과, NF-κB 활성 억제효과, 보습효과, 피부 장벽기능 개선 효과를 갖는 것을 특징으로 한다.Accordingly, the cosmetic composition for improving atopic skin comprising the oligonucleotide is characterized by having an inflammatory cytokine expression inhibiting effect, an NF-κB activity inhibiting effect, a moisturizing effect, and a skin barrier function improving effect.

본 발명에 화장료 조성물은 리보핵산 분해효소의 활성을 저해시키는 성분을 추가로 포함할 수 있다. 예를 들어, 대한민국 등록특허 제10-1675916호 및 대한민국 특허출원 제10-2016-0055465호에 기재된 바와 같이 천녀목란 추출물 및 정향 추출물을 포함할 수 있다. 다만 이에 한정되지 않으며 리보핵산 분해효소의 활성을 저해시킬 수 있는 모든 성분을 포함할 수 있다.The cosmetic composition of the present invention may further comprise a component that inhibits the activity of the ribonucleic acid decomposing enzyme. For example, it may contain Magnolia sieboldii extract and Clove extract as described in Korean Patent No. 10-1675916 and Korean Patent Application No. 10-2016-0055465. But is not limited thereto and may include all components capable of inhibiting the activity of ribonucleolytic enzymes.

본 발명의 화장료 조성물에 포함되는 성분은 유효 성분으로서 상기 유효 성분 이외에 화장료 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예컨대 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다. 본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션, 팩, 마사지크림 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The ingredients contained in the cosmetic composition of the present invention may contain, as an active ingredient, the ingredients commonly used in cosmetic compositions in addition to the above-mentioned effective ingredients, and may contain conventional ingredients such as antioxidants, stabilizers, solubilizers, vitamins, Supplements, and carriers. The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powdered foundation, emulsion foundation, wax foundation, pack, massage cream and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.

본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로 서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연등이 이용될 수 있다. 본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜 또는 소르비탄의 지방산 에스테르가 있다. 본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다. 본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다. 본 발명의 제형이 계면활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide . When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters. In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used. When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether. When the formulation of the present invention is a surfactant-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide ether Alkylamido betaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester.

본 발명의 화장료 조성물이 비누, 계면활성제 함유 클렌징 제형 또는 계면활성제 비함유 클렌징 제형일 경우, 피부에 도포한 후 닦아내거나 떼거나 물로 씻어낼 수도 있다. 구체적인 예로서, 상기 비누는 액상비누, 가루비누, 고형비누 및 오일비누이며, 상기 계면활성제 함유 클렌징 제형은 클렌징 폼, 클렌징 워터, 클렌징 수건 및 클렌징 팩이며, 상기 계면활성제 비함유 클렌징 제형은 클렌징크림, 클렌징 로션, 클렌징 워터 및 클렌징 겔이며, 이에 한정되는 것은 아니다. When the cosmetic composition of the present invention is a soap, a surfactant-containing cleansing formulation or a surfactant-free cleansing formulation, it may be applied to the skin and then wiped off, washed or rinsed with water. The surfactant-containing cleansing formulation may be a cleansing foam, a cleansing water, a cleansing towel and a cleansing pack. The surfactant-free cleansing formulation may be a cleansing cream, , Cleansing lotion, cleansing water and cleansing gel, but is not limited thereto.

이하, 실험예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실험예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실험예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through experimental examples. It will be apparent to those skilled in the art that these experimental examples are merely intended to explain the present invention more specifically and that the scope of the present invention is not limited by these examples according to the gist of the present invention .

실시예의Example 제조:  Produce: miRmiR -630 및 이의 -630 and its object 모방체의Imitative 제조 Produce

miRNA-630 및 이의 모방체의 농도가 100nM가 되도록 리포좀(liposome)을 이용하여 인간 피부 섬유아세포에 트렌스펙션하였다. 트렌스펙션은 TransITsiQUEST 트렌스펙션 reagent(Mirus, PanVera, Madison, WI)를 이용하여 제조사의 사용법에 따라 수행하였다. miR-630과 동일한 염기서열의 올리고뉴클레오타이드(oligonucleotide)는 서열번호 2이고, miR-630에서 씨드서열 외의 염기서열에서 1개의 염기가 다른 올리고뉴클레오타이드는 서열번호 3, 4, 5 및 6이고, miR-630에서 씨드서열 외의 염기서열에서 2개의 염기가 다른 올리고뉴클레오타이드는 서열번호 7, 8, 9 및 10이고, miR-630에서 씨드서열 외의 염기서열에서 3개의 염기가 다른 올리고뉴클레오타이드는 서열번호 11, 12, 13 및 14이다. 이들을 세포 내로 주입하여 miR-630의 과발현을 유도할 수 있다. 대조군으로는 현재까지 알려진 어떤 miRNA와도 중복되지 않는 올리고뉴클레오타이드(- control)를 트렌스펙션시킨 샘플을 이용하였다. 실험에 사용된 miR-630 및 이의 모방체의 염기서열은 표 1과 같다.The liposomes were used to transfect human skin fibroblasts so that the concentration of miRNA-630 and its mimic was 100 nM. Transfection was performed using the TransITsiQUEST transfection reagent (Mirus, PanVera, Madison, Wis.) According to the manufacturer's instructions. The oligonucleotide having the same base sequence as miR-630 is SEQ ID NO: 2, the oligonucleotides having one base in the nucleotide sequence other than the seed sequence in miR-630 are SEQ ID NOS: 3, 4, 5 and 6, 630, oligonucleotides having two bases other than the seed sequence are SEQ ID NOS: 7, 8, 9, and 10, and oligonucleotides having three bases other than the seed sequence in miR-630 are SEQ ID NOS: 11 and 12 , 13 and 14, respectively. They can be injected into cells to induce overexpression of miR-630. As a control group, a sample in which an oligonucleotide (- control) which is not overlapped with any known miRNA was transfected was used. The nucleotide sequences of miR-630 and its mimic used in the experiment are shown in Table 1.

시료명Name of sample 염기서열  Base sequence 서열번호 2SEQ ID NO: 2 5'- AGUAUUCUGUACCAGGGAAGGU - 3'5'-A GUAUUC UGUACCAGGGAAGGU-3 ' 서열번호 3SEQ ID NO: 3 5'- AGUAUUCUGUACGAGGGAAGGU - 3'5'- A GUAUUC UGUAC G AGGGAAGGU-3 ' 서열번호 4SEQ ID NO: 4 5'- AGUAUUCUGUACCAGGAAAGGU - 3' 5'- A GUAUUC UGUACCAGG A AAGGU - 3 ' 서열번호 5SEQ ID NO: 5 5'- AGUAUUCUGUACCAGGGAAUGU - 3' 5'- A GUAUUC UGUACCAGGGAA U GU - 3 ' 서열번호 6SEQ ID NO: 6 5'- AGUAUUCUGUACCAUGGAAGGU - 3' 5'- A GUAUUC UGUACCA U GGAAGGU - 3 ' 서열번호 7SEQ ID NO: 7 5'- AGUAUUCUGUACCGGGCAAGGU - 3'5'-A GUAUUC UGUACC G GG C AAGGU - 3 ' 서열번호 8SEQ ID NO: 8 5'- AGUAUUCUGUACCAGGGACCGU - 3'5'-A GUAUUC UGUACCAGGGA CC GU-3 ' 서열번호 9SEQ ID NO: 9 5'- AGUAUUCUGUACCAAGGAAGCU - 3' 5'- A GUAUUC UGUACCA A GGAAG C U - 3 ' 서열번호 10SEQ ID NO: 10 5'- AGUAUUCUGUACCAGGCUAGGU - 3'5'- A GUAUUC UGUACCAGG CU AGGU - 3 ' 서열번호 11SEQ ID NO: 11 5'- AGUAUUCUGUGGAAGGGAAGGU - 3'5'- A GUAUUC UGU GGA AGGGAAGGU - 3 ' 서열번호 12SEQ ID NO: 12 5'- AGUAUUCUGAACCAGCGAAGCU - 3' 5'- A GUAUUC UG A ACCAG C GAAG C U - 3 ' 서열번호 13SEQ ID NO: 13 5'- AGUAUUCUGUACCACGGAACGG - 3'5'- A GUAUUC UGUACCA C GGAA C G G - 3 ' 서열번호 14SEQ ID NO: 14 5'- AGUAUUCUGUACGAGGGCGGGU - 3'5'- A GUAUUC UGUAC G AGGG CG GGU-3 '

실험예Experimental Example 1:  One: miRmiR -630 및 이의 -630 and its object 모방체의Imitative NFNF -- κBκB 활성 조절효과 Activity modulating effect

miR-630 및 이의 모방체가 염증반응에 중요한 전사인자인 NF-κB의 활성에 미치는 영향을 확인하기 위하여, 하기와 같은 실험을 수행하였다. NF-κB는 세포질에서 IkB라는 단백질과 결합한 상태로 존재할 때는 IkB에 의해 활성이 저해되지만, 특정 신호가 전달되어 IkB가 인산화되어 분해되면서 IkB로부터 떨어져 핵으로 이동하게 되고 염증반응과 관련된 유전자의 발현을 조절한다.In order to confirm the effect of miR-630 and its mimic on the activity of NF-κB, an important transcription factor for inflammatory reactions, the following experiment was conducted. When NF-κB binds to a protein called IkB in the cytoplasm, it is inhibited by IkB. However, when IkB is phosphorylated and degraded by a specific signal, it moves away from IkB to the nucleus and the expression of the gene related to the inflammation reaction .

miR-630 및 이의 모방체가 NF-κB의 활성을 조절하는지 확인하기 위해 서열번호 2 내지 14를 트랜스펙션시킨 각질형성세포(HaCaT)에 20ng/ml의 TNF-α를 처리하여 염증반응을 유발시켰다. 구체적으로, TNF-α를 처리한 서열번호 2 내지 14를 트랜스펙션한 세포를 1% NP-40 및 complete proteinase inhibitor(Roche)를 포함하는 PBS(phosphate-buffer saline)로 처리하여 세포 용해액을 수득한 뒤 동일한 양(20 μg)의 SDS-PAGE를 수행하여 단백질을 분리시킨 다음, 니트로셀룰로오스 멤브레인에 옮겼다. 이후 상기 트랜스퍼한 멤브레인을 5% 스킴밀크로 30분간 블로킹한 후, 항-Ikb(abcam. USA) 및 항-β-actin 항체(모노클로날항체, abcam, USA) 1차 항체와 함께 배양한 후 항-토끼 HRP(horseradish peroxidase)-융합 2차 항체(abcam, USA)와 함께 배양하였다. 그 후 각 멤브레인에 화학발광 솔루션(chemiluminescence solution, Thermo Fisher cientific., USA)을 처리한 뒤, 단백질 발현을 확인하였다. 단백질의 발현정도는 β-actin으로 정규화(normalization)하고 Image J 프로그램을 이용하여 정량하였다. 그 결과를 도 1에 나타냈다.To determine whether miR-630 and its mimetics regulate the activity of NF-κB, keratinocytes (HaCaT) transfected with SEQ ID NOs: 2 to 14 were treated with 20 ng / ml of TNF-α to induce an inflammatory response . Specifically, the cells transfected with TNF-α and SEQ ID NOS: 2 to 14 were treated with phosphate-buffered saline (PBS) containing 1% NP-40 and complete proteinase inhibitor (Roche) The same amount (20 μg) of SDS-PAGE was carried out to separate the proteins and transferred to nitrocellulose membranes. Then, the transferred membrane was blocked with 5% skim milk for 30 minutes and then incubated with anti-Ikb (abcam. USA) and anti-β-actin antibody (monoclonal antibody, abcam, USA) And incubated with anti-rabbit HRP (horseradish peroxidase) -fused secondary antibody (abcam, USA). Then, each membrane was treated with a chemiluminescence solution (Thermo Fisher cientific., USA), and protein expression was confirmed. The degree of protein expression was normalized with β-actin and quantitated using the Image J program. The results are shown in Fig.

도 1에서 알 수 있는 바와 같이, 본 발명에 따른 서열번호 2 내지 14를 트랜스펙션한 각질형성세포에서 TNF-α에 의해 감소된 IkB 단백질량을 현저히 증가시킴을 알 수 있었으며, 이를 통해 서열번호 2 내지 14가 NF-κB의 활성을 감소시켰음을 확인할 수 있다.As can be seen from FIG. 1, it was found that the amount of IkB protein reduced by TNF-α was significantly increased in keratinocytes transfected with SEQ ID NOS: 2 to 14 according to the present invention, 2 to 14 decreased the activity of NF-kB.

실험예Experimental Example 2:  2: miRmiR -630 및 이의 -630 and its object 모방체의Imitative 자외선 조사에 의한 염증성 사이토카인 발현 억제효과 Inhibitory Effect on Inflammatory Cytokine Expression by UV Irradiation

실험예 2는 제조예 2 내지 14의 miR-630 및 이의 모방체의 자외선 조사에 의해 발현되는 염증성 사이토카인 발현 억제 효과를 평가하기 위한 것으로서, 24-웰 시험 플레이트에 5x104 개씩 넣고 24시간 동안 부착시킨 각질형성세포(HaCaT)세포에 서열번호 2 내지 14를 트랜스펙션시킨 뒤 각 웰을 PBS로 1회 세척하고 각 웰에 500 ㎕의 PBS를 넣었다. 이 각질형성세포에 자외선B(UVB) 램프(Model: F15TB, UV B 15W, Sankyo Dennki사 Japan)을 이용하여 자외선 10 mJ/cm2를 조사한 후 배양 상층액을 150 ㎕을 취하여 IL-1 α을 정량함으로써 서열번호 2 내지 14의 염증성 사이토카인 발현 억제 효과를 판단하였다. IL-1 α의 양은 효소 면역 분석법(Enzyme-linked immunosorbent assay)을 이용하여 정량화하였으며, 염증성 사이토카인(IL-1 α)의 발현 억제율(%)은 하기 수학식 1에 따라 계산하였다.Experimental Example 2 was conducted to evaluate the inhibitory effect of miR-630 and its mimetics of the preparation examples 2 to 14 on the expression of inflammatory cytokines expressed by ultraviolet irradiation, wherein 5x10 4 cells were put into a 24-well test plate, (HaCaT) cells were transfected with SEQ ID NOS: 2 to 14, each well was washed once with PBS, and 500 占 퐇 of PBS was added to each well. This keratinocyte was irradiated with 10 mJ / cm 2 of ultraviolet light using an ultraviolet B (UVB) lamp (Model: F15TB, UV B 15W, Sankyo Dennki Japan) and 150 μl of the culture supernatant was added to obtain IL- The inhibitory effects of inflammatory cytokines of SEQ ID NOS: 2 to 14 were determined by quantification. The amount of IL-1 alpha was quantitated using an enzyme-linked immunosorbent assay, and the inhibition rate (%) of inflammatory cytokine (IL-1 alpha) was calculated according to the following equation.

Figure pat00001
Figure pat00001

Bo : 자외선 조사하지 않고 시료 처리하지 않은 웰의 IL-1 α 생성량Bo: IL-1? Production in wells without UV irradiation

Bt : 자외선 조사하고 시료 처리하지 않은 웰의 IL-1 α 생성량 Bt: IL-1? Production in wells irradiated with ultraviolet light and not treated with sample

St : 자외선 조사하고 시료 처리한 웰의 IL-1 α 생성량 St: IL-1? Production in well irradiated and treated with UV

시료명 Name of sample 염증성 사이토 카인 발현 억제율 (%)Inhibitory rate of inflammatory cytokine expression (%) 서열번호2SEQ ID NO: 2 72.74 ± 1.5672.74 ± 1.56 서열번호3SEQ ID NO: 3 70.18 ± 2.1170.18 ± 2.11 서열번호4SEQ ID NO: 4 69.84 ± 1.8969.84 + 1.89 서열번호5SEQ ID NO: 5 70.21 ± 0.8670.21 + - 0.86 서열번호6SEQ ID NO: 6 69.44 ± 1.0169.44 + - 1.01 서열번호7SEQ ID NO: 7 66.84 ± 1.1866.84 + - 1.18 서열번호8SEQ ID NO: 8 67.22 ± 1.2167.22 ± 1.21 서열번호9SEQ ID NO: 9 67.10 ± 0.7267.10 + - 0.72 서열번호10SEQ ID NO: 10 67.52 ± 0.8367.52 + 0.83 서열번호11SEQ ID NO: 11 66.70 ± 0.7266.70 + - 0.72 서열번호12SEQ ID NO: 12 65.10 ± 0.9365.10 + - 0.93 서열번호13SEQ ID NO: 13 66.52 ± 0.8466.52 + - 0.84 서열번호14SEQ ID NO: 14 65.17 ± 1.1265.17 ± 1.12 인도메타신 100ppmIndomethacin 100 ppm 61.23 ± 0.8161.23 + - 0.81 무처치No treatment 8.24 ± 0.358.24 0.35

표 2에 따르면, 서열번호 2 내지 14를 트랜스펙션한 세포는 자외선에 의한 염증성 사이토카인인 IL-1 α의 생성을 억제하는 것을 알 수 있었다. 본 발명에 따른 서열번호 2 내지 14는 염증성사이토카인 발현 억제물질인 인도메타신보다도 우수한 염증성 사이토카인 발현 억제율을 보임을 알 수 있었다. 따라서 본 발명의 서열번호 2 내지 14는 자외선 조사에 의한 염증 발생을 효과적으로 방어함을 알 수 있다.According to Table 2, it was found that the cells transfected with SEQ ID NOS: 2 to 14 inhibited the production of IL-1 alpha, an inflammatory cytokine caused by ultraviolet light. The inventors of the present invention found that the inhibition rate of inflammatory cytokine expression is superior to that of indomethacin, which is an inhibitor of inflammatory cytokine expression. Thus, it can be seen that SEQ ID NOS: 2 to 14 of the present invention effectively prevent inflammation caused by ultraviolet irradiation.

제형예 1 내지 7. miR-630 및 miR-630의 모방체를 함유하는 화장료 조성물의 제조Formulation Examples 1 to 7. Preparation of Cosmetic Composition Containing Mimics of miR-630 and miR-630

miRNA-630 및 이의 모방체인 서열번호 2 내지 4, 7, 8, 11 및 12를 포함하는 화장료(제형예 1 내지 7)를 제조하였으며, 효능의 비교를 위해 miRNA-630 및 이의 모방체 대신에 보습제로서 글리세린 및 1,3-부틸렌글리콜을 포함하는 화장료 조성물(비교제형예 1), miR-630 및 이의 모방체나 보습제를 모두 포함하지 않는 화장료 조성물(비교제형예 2)을 하기 표 3과 같이 제조하였다.(Formulations 1 to 7) comprising miRNA-630 and its mimics SEQ ID NOS: 2 to 4, 7, 8, 11 and 12 were prepared and compared to the miRNA-630 and its mimics for comparison of effectiveness, (Comparative Formulation Example 1) containing glycerin and 1,3-butylene glycol, miR-630 and a cosmetic composition (Comparative Formulation Example 2) containing neither imipramine nor a moisturizer were prepared as shown in Table 3 below Respectively.

구분division 성분ingredient 제형예1Formulation Example 1 제형예2Formulation Example 2 제형예3Formulation Example 3 제형예4Formulation Example 4 제형예 5Formulation Example 5 제형예 6Formulation Example 6 제형예 7Formulation Example 7 비교제형예1Comparative Formulation Example 1 비교제형예2Comparative Formulation Example 2 AA 서열번호2SEQ ID NO: 2 0.010.01 -- -- -- -- -- -- -- -- 서열번호3SEQ ID NO: 3 -- 0.010.01 -- -- -- -- -- -- -- 서열번호4SEQ ID NO: 4 -- -- 0.010.01 -- -- -- -- -- -- 서열번호7SEQ ID NO: 7 -- -- -- 0.010.01 -- -- -- -- 서열번호8SEQ ID NO: 8 -- -- -- -- 0.010.01 -- -- -- -- 서열번호11SEQ ID NO: 11 -- -- -- -- -- 0.010.01 -- -- -- 서열번호12SEQ ID NO: 12 -- -- -- -- -- -- 0.010.01 -- -- 1,3-부틸렌글리콜1,3-butylene glycol -- -- -- -- -- -- -- 55 -- 글리세린glycerin -- -- -- -- -- -- -- 55 -- 정향추출물Clove extract 1One 1One 1One 1One 1One 1One 1One 1One 1One 천녀목란추출물Magnolia extract 1One 1One 1One 1One 1One 1One 1One 1One 1One EDTA-2NaEDTA-2Na 0.020.02 0.020.02 0.020.02 0.020.02 0.020.02 0.020.02 0.020.02 0.020.02 0.020.02 정제수Purified water to 100to 100 to 100to 100 to 100to 100 to 100to 100 to 100to 100 to 100to 100 to 100to 100 to 100to 100 to 100to 100 BB 피이지-60하이드로 제네이티드캐스터오일PIGGY-60 Hydrogenated Castor Oil 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 폴리에틸렌 글라이콜400Polyethylene glycol 400 33 33 33 33 33 33 33 33 33 마이크로크리스탈린Microcrystalline 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 솔비탄스테아레이트Sorbitan stearate 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 0.50.5 토코페릴아세테이트Tocopheryl acetate 0.20.2 0.20.2 0.20.2 0.20.2 0.20.2 0.20.2 0.20.2 0.20.2 0.20.2 사이클로메치콘Cyclomethicone 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 0.30.3 BHTBHT 0.050.05 0.050.05 0.050.05 0.050.05 0.050.05 0.050.05 0.050.05 0.050.05 0.050.05 CC 향,방부제Incense, preservative 적량Suitable amount 적량Suitable amount 적량Suitable amount 적량Suitable amount 적량Suitable amount 적량Suitable amount 적량Suitable amount 적량Suitable amount 적량Suitable amount

실험예 3: miR-630 및 이의 모방체의 보습효과Experimental Example 3: Moisturizing effect of miR-630 and its mimetic

상기 제형예의 화장료 조성물에 대한 임상 보습효과를 다음과 같이 측정하였다. 설문 조사를 통하여 피부가 건조하다고 느끼는 건강한 남녀 135명을 무작위로 15명씩 9개 그룹(A 내지 I)으로 나눈 후, A, B, C, D, E, F 및 G 그룹에는 제형예 1 내지 7의 화장료 조성물을, H 그룹에는 비교제형예 1의 화장료 조성물을, I 그룹에는 비교제형예 2의 화장료 조성물을 각각 1일 2회씩 4주간 안면에 도포하게 하였다. 보습효과는 실사용 시험 시작 후 매 2주간, 그리고 종료 후의 개선 효과를 Corneomater CM820 (Corage + Khazaka, Germany)를 이용하여 평가하였다. 그 결과는 하기의 표 4에 나타내었다.The clinical moisturizing effect of the cosmetic composition of the above formulation example was measured as follows. A, B, C, D, E, F, and G groups were divided into nine groups (A to I) of 135 healthy volunteers who feel skin dry through a questionnaire, The cosmetic composition of Comparative Formulation Example 1 was applied to the H group, and the cosmetic composition of Comparative Formulation Example 2 was applied to the face group for 2 weeks twice a day for 4 weeks. The moisturizing effect was evaluated by Corneomater CM820 (Corage + Khazaka, Germany) after every two weeks and after the start of the test. The results are shown in Table 4 below.

구분division 사용 전Before use 사용 2주 후After 2 weeks of use 사용 4주 후After 4 weeks of use 제형예 1Formulation Example 1 30.1530.15 45.4845.48 55.8955.89 제형예 2Formulation Example 2 29.1529.15 44.1544.15 53.5253.52 제형예 3Formulation Example 3 28.9828.98 44.1944.19 53.2953.29 제형예 4Formulation Example 4 30.8130.81 43.9843.98 54.0154.01 제형예 5Formulation Example 5 30.1130.11 42.1542.15 51.4551.45 제형예 6Formulation Example 6 30.4330.43 42.1742.17 52.3252.32 제형예 7Formulation Example 7 31.2131.21 41.8841.88 52.1952.19 비교제형예 1Comparative Formulation Example 1 30.330.3 42.142.1 50.950.9 비교제형예 2Comparative Formulation Example 2 28.528.5 29.429.4 28.928.9

상기 표 4에 나타낸 바와 같이, 일반 다른 보습제를 함유한 비교제형예 1과 비교하여도, 본 발명의 miR-630 및 이의 모방체를 함유한 제형예 1 내지 7의 보습효과가 우수함을 확인할 수 있었다.As shown in Table 4, it was confirmed that the moisturizing effect of miR-630 of the present invention and Formulations 1 to 7 containing the mimetic thereof was excellent, as compared with Comparative Formulation Example 1 containing other humectants .

실험예Experimental Example 4 :  4 : miRmiR -630 및 이의 -630 and its object 모방체의Imitative 피부장벽기능Skin barrier function 개선효과 Improvement effect

상기 제형예 1 내지 7 및 비교제형예 1 및 2의 피부장벽기능 개선 효과를 평가하였다. 20세 이상 성인 남녀 90 명을 무작위로 10 명씩 9개 그룹(1 내지 9그룹)으로 나눈 후, 전박에 1.0% SLS 수용액 20 μl를 finn-chamber 적용하여 16시간 첩포함으로써 피부장벽기능을 일시적으로 손상시켰다. 그 후 1 내지 7 그룹에는 제형예 1 내지 7의 화장료 조성물을, 8 그룹에는 miR-630 및 이의 모방체 대산에 보습제로서 글리세린 및 1,3-부틸렌글리콜을 포함하는 화장료 조성물(비교제형예 1), 9 그룹에는 추출물 및 보습제를 포함하지 않는 화장료 조성물(비교제형예 2)을 각각 1일 2회씩 1주간 도포하게 하였다. 피부장벽기능 개선효과는 SLS 첩포전, 첩포후, 제형도포 후 7일간 매일 경피수분손실량(Transepidermal Water Loss; TEWL)을 측정하였으며 결과를 표 5에 나타내었다.The skin barrier function improving effects of Formulation Examples 1 to 7 and Comparative Formulation Examples 1 and 2 were evaluated. Ninety male adults over 20 years of age were randomly divided into 9 groups (groups 1 to 9) by 10 individuals. Twenty microliters of 1.0% SLS aqueous solution was applied to the whole buns for 16 hours, Damaged. Thereafter, the cosmetic composition of Formulation Examples 1 to 7 was added to Groups 1 to 7, the cosmetic composition containing glycerin and 1,3-butylene glycol as moisturizing agents in miR-630 and its mimic acid in Group 8 (Comparative Formulation Example 1 ), And a cosmetic composition (Comparative Formulation Example 2) containing no extract or moisturizing agent was applied to group 9 twice a day for one week. The effect of improving the skin barrier function was measured by Transepidermal Water Loss (TEWL) for 7 days after SLS application, coaptation, and application of the formulation. The results are shown in Table 5.

  시험전Before the test SLS 첩포후SLS Collaboration Day1Day1 Day2Day2 Day3Day3 Day4Day4 Day5Day5 Day6Day6 Day7Day7 제형예 1Formulation Example 1 6.76.7 21.721.7 17.317.3 9.29.2 7.07.0 6.56.5 6.36.3 6.06.0 6.26.2 제형예 2Formulation Example 2 6.46.4 21.521.5 18.718.7 9.79.7 7.67.6 6.86.8 6.76.7 6.46.4 6.56.5 제형예 3Formulation Example 3 6.76.7 21.821.8 18.818.8 9.89.8 7.57.5 6.86.8 6.76.7 6.66.6 6.76.7 제형예 4Formulation Example 4 6.66.6 22.022.0 18.318.3 10.110.1 7.67.6 6.76.7 6.66.6 6.66.6 6.56.5 제형예 5Formulation Example 5 6.76.7 21.221.2 19.419.4 11.311.3 8.18.1 6.86.8 6.46.4 6.76.7 6.86.8 제형예 6Formulation Example 6 6.76.7 21.921.9 19.319.3 11.811.8 8.08.0 6.66.6 6.66.6 6.76.7 6.76.7 제형예 7Formulation Example 7 6.66.6 21.621.6 18.818.8 10.910.9 7.87.8 6.86.8 6.56.5 6.86.8 6.76.7 비교제형예 1Comparative Formulation Example 1 6.46.4 21.421.4 17.517.5 13.313.3 8.28.2 6.86.8 6.56.5 6.56.5 6.66.6 비교제형예 2Comparative Formulation Example 2 6.36.3 22.222.2 20.420.4 19.519.5 18.718.7 17.817.8 15.715.7 13.613.6 10.710.7

상기 표 5에서 알 수 있듯이, 제형예 1 내지 7을 도포한 부위가 비교제형예 1 및 2에 비해 더 빠르게 장벽기능을 회복시키는 것을 확인할 수 있었다.As can be seen from Table 5, it was confirmed that the portions coated with Formulation Examples 1 to 7 recovered the barrier function more rapidly than Comparative Formulation Examples 1 and 2.

<110> COREANA COSMETICS CO., LTD. <120> COSMETIC COMPOSITION FOR IMPROVING ATOPIC DERMATITIS CONTAINING MICRO RNA-630 AND ITS MIMICS <130> DP-2017-0184 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 6 <212> RNA <213> Artificial Sequence <220> <223> miRNA-630 seed sequence <400> 1 guauuc 6 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-630 <400> 2 aguauucugu accagggaag gu 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 3 aguauucugu acgagggaag gu 22 <210> 4 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 4 aguauucugu accaggaaag gu 22 <210> 5 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 5 aguauucugu accagggaau gu 22 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 6 aguauucugu accauggaag gu 22 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 7 aguauucugu accgggcaag gu 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 8 aguauucugu accagggacc gu 22 <210> 9 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 9 aguauucugu accaaggaag cu 22 <210> 10 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 10 aguauucugu accaggcuag gu 22 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 11 aguauucugu ggaagggaag gu 22 <210> 12 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 12 aguauucuga accagcgaag cu 22 <210> 13 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 13 aguauucugu accacggaac gg 22 <210> 14 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 14 aguauucugu acgagggcgg gu 22 <110> COREANA COSMETICS CO., LTD. <120> COSMETIC COMPOSITION FOR IMPROVING ATOPIC DERMATITIS CONTAINING          MICRO RNA-630 AND ITS MIMICS <130> DP-2017-0184 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 6 <212> RNA <213> Artificial Sequence <220> <223> miRNA-630 seed sequence <400> 1 guauuc 6 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-630 <400> 2 aguauucugu accagggaag gu 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 3 aguauucugu acgagggaag gu 22 <210> 4 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 4 aguauucugu accaggaaag gu 22 <210> 5 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 5 aguauucugu accagggaau gu 22 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 6 aguauucugu accauggaag gu 22 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 7 aguauucugu accgggcaag gu 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 8 aguauucugu accagggacc gu 22 <210> 9 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 9 aguauucugu accaaggaag cu 22 <210> 10 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 10 aguauucugu accaggcuag gu 22 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 11 aguauucugu ggaagggaag gu 22 <210> 12 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 12 aguauucuga accagcgaag cu 22 <210> 13 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 13 aguauucugu accacggaac gg 22 <210> 14 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 14 aguauucugu acgagggcgg gu 22

Claims (5)

서열번호 1의 염기서열을 포함하고, 서열번호 2의 염기서열과 85% 이상의 서열 상동성을 갖는 마이크로 RNA 또는 이의 모방체를 유효성분으로 포함하는, 아토피 피부 개선용 화장료 조성물.1. A cosmetic composition for improving atopic skin, comprising the microarray having a nucleotide sequence of SEQ ID NO: 1 and having a nucleotide sequence homology of 85% or more with the nucleotide sequence of SEQ ID NO: 2, or a mimetic thereof. 제1항에 있어서,
상기 화장료 조성물은 NF-κB의 활성 억제효과를 갖는, 아토피 피부 개선용 화장료 조성물.
The method according to claim 1,
Wherein the cosmetic composition has an effect of inhibiting the activity of NF-κB.
제1항에 있어서,
상기 화장료 조성물은 염증성 사이토카인 발현 억제 효과를 갖는, 아토피 피부 개선용 화장료 조성물.
The method according to claim 1,
Wherein the cosmetic composition has an inflammatory cytokine expression inhibiting effect.
제1항에 있어서,
상기 화장료 조성물은 보습증진 효과를 갖는, 아토피 피부 개선용 화장료 조성물.
The method according to claim 1,
The cosmetic composition has a moisturizing effect.
제1항에 있어서,
상기 화장료 조성물은 피부장벽기능 개선 효과를 갖는, 아토피 피부 개선용 화장료 조성물.
The method according to claim 1,
The cosmetic composition has an effect of improving skin barrier function.
KR1020170119413A 2017-09-18 2017-09-18 Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics KR102033949B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020170119413A KR102033949B1 (en) 2017-09-18 2017-09-18 Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020170119413A KR102033949B1 (en) 2017-09-18 2017-09-18 Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics

Publications (2)

Publication Number Publication Date
KR20190031682A true KR20190031682A (en) 2019-03-27
KR102033949B1 KR102033949B1 (en) 2019-10-21

Family

ID=65907539

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170119413A KR102033949B1 (en) 2017-09-18 2017-09-18 Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics

Country Status (1)

Country Link
KR (1) KR102033949B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220027341A (en) 2020-08-26 2022-03-08 (주)아모레퍼시픽 Composition for enhancing skin barrier function comprising plant-derived oligonucleotides

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Michat Rozalski 외, MiRNA in atopic dermatitis, Advanced in Dermatology and allergology, vol. 3, pp. 157-161, 2016.6. *
Paul Lawrence 외, Advances in the Application and Impact of MicroRNAs as Therapies for Skin Disease, BioDrugs, Vol. 31, pp. 423-438, 2017.9.5. *
R. Rupaimoole 외, Hypoxia-upregulated microRNA-630 targets Dicer, leading to increased tumor progression, Oncogene vol. 35, pp.4312-4320, 2016.8.18. *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220027341A (en) 2020-08-26 2022-03-08 (주)아모레퍼시픽 Composition for enhancing skin barrier function comprising plant-derived oligonucleotides

Also Published As

Publication number Publication date
KR102033949B1 (en) 2019-10-21

Similar Documents

Publication Publication Date Title
EP3288531B1 (en) Method of improving skin health and compositions therefor
EA031758B1 (en) Niacinamide for inducing generation of antimicrobial peptides
EP2742942B1 (en) Niacinamide for inducing generation of antimicrobial peptides
US20140134636A1 (en) Composition for controlling chromogenesis including microrna
KR101201524B1 (en) Composition for improvement of health of scalp and hair comprising dibenzo-p-dioxin derivatives
KR102033949B1 (en) Cosmetic composition for improving atopic dermatitis containing micro rna-630 and its mimics
KR101753874B1 (en) A cosmetic composition comprising a decapeptide as an active ingredient
KR20190048202A (en) Methods for preparing nanoliposome encapsulating of N-Acetyl glucosamine and Sodium chondroitin sulfate and cosmetic composition containing the same
EP2722075A1 (en) Armeria Maritima plant extracts for use in the treatment or prevention of conditions arising from an impaired skin barrier function
JP2017523177A (en) Skin whitening composition containing chemokine
CN118043341A (en) Peptides with anti-aging activity and uses thereof
KR20160008862A (en) Composition for skin irritant alleviation, skin barrier enhancement and anti-inflammatory with the ethyl acetate extract of Rose davurica
KR102034436B1 (en) Composition For Treating And Preventing Atopic Dermatitis Comprising Ternstroemia kwangtungensis Merr. Extracts
JP6843537B2 (en) Anti-skin aging agent and topical cosmetics containing it
KR20150105550A (en) Cosmetic composition comprising mucus extract from spawn
JP5155543B2 (en) Endothelin-1 production inhibitor, hexosaminidase release inhibitor, anti-inflammatory / whitening skin preparation, endothelin-1 production inhibition method, and hexosaminidase release inhibition method
Warren et al. Attenuation of surfactant-induced interleukin 1α expression by zinc pyrithione
KR101776000B1 (en) COSMETIC COMPOSITION CONTAINING MICRO RNA-181a AND ITS MIMICS
US9566262B2 (en) Itch suppression by fucoxanthin
CN110547975B (en) Cosmetic material composition containing epipinoresinol
KR102158464B1 (en) Skin external composition containing benzamide compound
CN116251100B (en) Application of TPEN in preparation of anti-skin aging or anti-dermatitis composition product
KR102634821B1 (en) Composition for reinforcing skin barrier
EP3796897B1 (en) Compounds for preventing and treating skin or mucosal affections having an inflammatory component
KR102645432B1 (en) Composition for differentiation of skin cells and method for screening for materials for promoting differentiation of skin cells

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant