KR20190016216A - manufacturing method of nanoemulsion composition containing quercein and nanoemulsion composition containing quercein prepared using the method - Google Patents

Abstract

The present invention relates to a nanoemulsion composition containing quercetin. The nanoemulsion composition maximizes the stability of quercetin component and the absorption rate in the body by making quercetin into a nanoemulsion by using an emulsifier and hydrophilic biopolymers, and also has an effect of improving the stability in the body by reducing an intestinal stimulus effect.

Description

TECHNICAL FIELD The present invention relates to a nanoemulsion composition containing quercetin and a quercetin-containing nanoemulsion composition containing quercetin,

The present invention relates to a nanoemulsion composition containing quercetin, and more particularly, to a nanoemulsion composition containing quercetin, which has preventive and therapeutic effects against hyperlipemia among nanoemulsions and nanoparticles, Nanoparticles, nanoparticles, and methods of manufacturing the nanoparticles.

Quercetin (3,3 ', 4', 5,7-pentahydroxyflavone) is one of the major flavonoids and is the most representative of nearly 4,000 flavonoids. Quercetin is abundant in foods such as red wine, onions, green tea, apples, berry, and cabbage, and is known to be abundant in ginkgo leaf, St. John's Wort, and American Elder. Quercetin is used as a vasoconstrictor in many countries and is used as a material for many multivitamins and herbal medicines. The formula (1) is as follows.

As described above, although quercetin has a high value as a diverse physiologically active functional food material, its solubility in water is 0.17-7.7 占 퐂 / ml, its solubility in artificial gastric juice is 5.5 占 퐂 / ml, And has a solubility of 28.9 占 퐂 / ml, which is a very low solubility. Thus, there is a problem that there is a great limitation in bioavailability through utilization of food materials and oral ingestion (Non-Patent Document 1).

In order to solve the problems (low solubility, dispersibility and bioavailability) of the quercetin, various methods such as microemulsion (Non-Patent Document 1), solid lipid nanoparticles, encapsulation using cyclodextrin and liposome encapsulation have been developed.

Among these methods, there has been known a technique of dispersing oil-soluble quercetin in food oil and converting it into an emulsified state of an underwater type (O / W) or a water-in-oil type (W / O) The flocculation problem in which the particles form lumps when the emulsion method is used and the problem of maintaining the mixture in a separate state and the creaming of the particles depending on the relative density of the two systems, ), As well as physical changes such as coalescence of the particles. In addition to the above problems, there is a problem that an emulsifier that can be used is very limited. Specifically, emulsifiers that are allowed for foods are very limited, and some emulsifiers that are allowed only allow very low concentrations. Furthermore, among acceptable emulsifiers, soybean oil (long-chain fatty acid glycerides) has a problem of being less soluble than short-chain or medium-chain fatty acid glycerides and thus having low bioavailability.

Non-Patent Document 1. Gao Y., Wang Y., Ma Y., Yu A., Cai F., Shao W., Zhai G. Formulation optimization and in situ absorption in rat intestinal tract of quercetin-loaded microemulsion. Colloid Surf. B. 2009; 71: 306-314. doi: 10.1016 / j.colsurfb.2009.03.005.

The present invention has been made to solve the above-mentioned problems, and it is an object of the present invention to provide a method for producing a homogeneous nano emulsion composition having an average particle size of 190 to 250 nm.

It is another object of the present invention to provide a method for producing a polymer having excellent long-term storage stability, physico-chemical stability under various pH conditions, dispersion degree and solubility To provide an improved nanoemulsion composition.

In order to achieve the above-mentioned object, the present invention provides a method for producing an aqueous emulsion, comprising: 1) preparing quercetin, a medium-chain fatty acid ester and a sorbitan fatty acid ester to prepare a first solution in which a first emulsion is formed; 2) dissolving lecithin and hydrophilic polymer in purified water to prepare a second solution; 3) mixing the first solution with a second solution; And 3) adding a pH adjusting agent to the resultant mixture of step 3) to adjust the pH to 6.5 to 9.0. The present invention also provides a method for preparing the nanoemulsion composition.

The pH adjusting agent may be a buffer or sodium hydroxide or other pH adjusting agent or a combination thereof.

1 to 5% by weight of a heavy chain fatty acid ester, 1 to 5% by weight of a sorbitan fatty acid ester, 0.1 to 1% by weight of lecithin, 3 to 6% by weight of Hydrophilic biopolymer and 80-90% by weight of purified water.

Wherein the heavy chain fatty acid ester is caprylic / capric glyceride (captex 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic biopolymer is sodium alginate.

The step 1) is performed at 50-70 ° C for 0.5-4 hours.

In order to accomplish the above-mentioned other objects, the present invention provides a process for producing a nano-emulsion, comprising the steps of: 0.1-1 wt.% Of quercetin, 1-5 wt.% Of a heavy chain fatty acid ester, Lactic acid, 0.1 to 1 wt.% Lecithin, 3-6 wt.% Hydrophilic biopolymer and 80-90 wt.% Purified water.

Wherein the heavy chain fatty acid ester is caprylic / capric glyceride (captex 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic biopolymer is sodium alginate.

The average particle size of the nano emulsion formed in the nano emulsion composition is 150-250 nm.

The nanoemulsion formed in the nanoemulsion composition is characterized in that the surface thereof is negatively charged.

And the surface potential range of the nanoemulsion formed in the nanoemulsion composition is -45 to -55 mV.

And the pH of the nanoemulsion composition is 6.5 to 9.0.

The nanoemulsion formed in the nanoemulsion composition is characterized in that the retentivity of quercetin is 50-91% as calculated through the following formula (1).

In order to accomplish still another object, the present invention provides a pharmaceutical composition for preventing or treating hyperlipidemia comprising the nanoemulsion composition as an active ingredient.

The nanoemulsion composition is characterized in that it has an effect of reducing weight, decreasing adipocytes, and decreasing total cholesterol in the body.

Wherein the hyperlipidemia is any one selected from the group consisting of hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, atherosclerosis, and pancreatitis.

The composition is characterized in that it is for oral administration.

In order to accomplish still another object, the present invention provides a food composition for improving or preventing hyperlipidemia, which comprises the nanoemulsion composition as an active ingredient of the nanoemulsion composition.

According to the present invention, the quercetin is made into a nano-emulsion by using an emulsifier and a hydrophilic biopolymer, thereby maximizing the stability of the quercetin component and the absorption rate in the body, and reducing the intestinal stimulating effect, thereby improving the body stability.

In addition, the nanoemulsion or nanoparticle of the present invention is excellent in solubility in water and can be stored for a long period of time, and can be manufactured in powder form, so that it can be used in various other foods.

Figure 1 is a graph showing the retention of the nanoemulsion prepared from Example 1 at various pH conditions (pH 6.5-9.0).
2 is a TEM photograph of a quercetin-containing nanoemulsion prepared in Example 1 at various pH conditions.
3 is a photograph of a state after storing the quercetin-containing nanoemulsion of Example 1 at room temperature (21 ° C) and 37 ° C for 3 months.
FIG. 4 is a graph showing the results of an animal model of hyperlipidemia (0.05%, 0.1% quercetin) and a quercetin-containing nanoemulsion (Example 1) (A), serum AST (b) and serum ALT (c). Values are expressed as mean ± standard error (n = 6).
5 shows the results of an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia (0.05%, 0.1% nanoquercetin) administered with the quercetin-containing nanoemulsion of Example 1 for 6 weeks, (A), total cholesterol (b), HDL-cholesterol (c), LDL-cholesterol (d) and arteriosclerosis index (e).
FIG. 6 is a graph showing an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia (0.05%, 0.1% (A), triglyceride (b), and total cholesterol (c) in the liver. The values are expressed as mean ± standard error (n = 6). * Indicates statistical significance for the control group (** P <0.01, *** P <0.001), and # indicates statistical significance for quercetin directly administered group (#P <0.05, ## P < 0.01).
FIG. 7 is a graph showing an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia (0.05%, 0.1% (A), FAS (b), SREBP-2 (c), HMG-CoA (d), ABCA1 (e) and ApoA-1 . The values are expressed as mean ± standard error (n = 6). * Indicates statistical significance for the control group (* P <0.05, ** P <0.01, *** P <0.001), and # indicates statistical significance for the quercetin group (#P <0.05, P &lt; 0.01, ### P &lt; 0.001).
FIG. 8 is a graph showing an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia administered with quercetin-containing nanoemulsion of Example 1 (0.05% Lt; RTI ID = 0.0 &gt; miR-122 &lt; / RTI &gt; In the figure, the values are expressed as mean ± standard error (n = 6). * Indicates statistical significance for the control group (* P <0.05, ** P <0.01).

Hereinafter, the present invention will be described in detail.

An aspect of the present invention relates to a manufacturing method comprising the steps of:

1) preparing quercetin, a heavy chain fatty acid ester and a sorbitan fatty acid ester to prepare a first solution in which a first emulsion is formed;

2) dissolving lecithin and hydrophilic polymer in purified water to prepare a second solution;

3) mixing the first solution with a second solution; And

3) adding a pH adjusting agent to the resultant mixture of step 3) to adjust the pH to 6.5 to 9.0.

The nanoemulsion composition comprising the first solution and the second solution may comprise 0.1-1 wt% quercetin, 1-5 wt% medium chain fatty acid ester, 1-5 wt% sorbitan fatty acid ester, 0.1 -1 weight% lecithin, 3-6 weight% hydrophilic biopolymer and 80-90 weight% purified water, which will be described in more detail in the nanoemulsion composition described later. Therefore, the repeated contents described in the following nano emulsion composition will be omitted.

The step 1) is preferably carried out at 50-70 ° C. for 0.5-4 hours. If the reaction is carried out at a temperature lower than 50 ° C., a sufficient bond is not formed between the components of the nano emulsion, There arises a problem that it becomes prolonged. When the temperature exceeds 70 ° C, quercetin activity may be lowered, or the average particle size of the nanoemulsion may become excessively large, which may cause discomfort during oral administration.

If the pH is less than 6.5 or the pH is more than 9.0, the dispersity becomes 0.4 or more and the average particle size becomes 300 nm or more. , And the surface potential difference may also increase to -10 to -20 or more.

According to another aspect of the present invention, there is provided a nanoemulsion composition prepared by the above process, comprising 0.1-1 wt% quercetin, 1-5 wt% heavy chain fatty acid ester, 1-5 wt% sorbitan fatty acid Ester, 0.1-1 wt% lecithin, 3-6 wt% hydrophilic biopolymer, and 80-90 wt% purified water.

More preferably about 0.2-0.5 wt% quercetin, 1-3 wt% heavy chain fatty acid ester, 1-3 wt% sorbitan fatty acid ester, 0.1-1 wt% lecithin, 3-6 wt% % Hydrophilic biopolymer and 85-90% by weight purified water. The nanoemulsion composition should contain the nanoemulsion composition prepared according to the order and conditions of the preparation method. When used, the stability of the quercetin component and the absorption rate The present invention relates to a method for the production of a food or beverage, which comprises the steps of: (a) .

If any of the above components deviates from the above range, the above-mentioned effect can not be attained, and further, problems such as aggregation, coagulation or suspension occur, and when the pH condition changes, quercetin There is a problem of leakage. This can be confirmed by the following experimental example.

Accordingly, the nanoemulsion composition of the present invention is characterized in that it is produced by the invention of the present invention, and the average particle size, degree of dispersion and surface Was significantly improved. Therefore, the nanoemulsion composition prepared by the production method of the present invention is superior to the quercetin-containing nanoemulsion prepared by the conventional preparation method by 1.5 to 2 times or more by the oral administration.

In general, the nano emulsion is an underwater type emulsion. The nano emulsion having a particle size of 100 to 200 nm is less affected by gravity than the micro emulsion having a particle size of 1 m or more. Therefore, But there are few creaming phenomena and sedimentation phenomena affecting the stability of the conventional microemulsion. However, the coalescence due to the interaction between the particles and the particles or the ovalbust caused by the difference in solubility due to the diversification of the particle size There is a problem that destabilization is manifested by Ostwald ripening. In addition, the emulsifiers used in the preparation of nanoemulsions generally have limited use, and even if used, their solubility is low and their availability in the body is poor. In order to solve such problems, the present invention provides a liposome having excellent physico-chemical stability, long-term storage stability, and effective physiological activity by controlling the content ratio of quercetin and a medium chain fatty acid ester, sorbitan fatty acid ester, lecithin, Characterized in that a nanoemulsion having excellent retention of the components and significantly improving the body-use property is produced.

In addition, the nanoemulsion composition of the above-described structure has a problem (a stimulation effect in the intestines) of the hydrophilic biopolymer, and the in-vivo stability is remarkably improved.

The nano-emulsion composition can be used in the form of a nano-emulsion in which the stability is further increased by solvent precipitation or vacuum lyophilization and is easily applied to other foods in powder form.

Unlike simple emulsion and colloidal functional ingredient carriers, the nano-emulsification technology offers advantages such as thermodynamic stability, simple manufacturing method, transparent liquid and low viscosity using a high concentration of lipophilic components and oils and food surfactants It is a method that can produce nano emulsion.

The nano emulsion formed in the nano emulsion composition has various advantages over the emulsion or the micro emulsion. The particle size is in the range of 5 to 300 nm, preferably 150 to 250 nm, so that it is thermodynamically stable And shows a transparent solution state due to small light dispersion. According to the present invention, the nano-emulsion prepared through the completion of a number of repetitive experiments is consistently self-assembled with the hydrophilic or lipophilic portion of the emulsifier, and is shared with the surfactant to obtain a more stable 150-250 nm average particle size Lt; / RTI &gt; In addition, the gravitational acceleration and Brownian motion of the nanoemulsion according to the present invention are remarkably reduced, so that creaming or sedimentation does not occur during the storage period and aggregation does not occur, so that separation does not occur in the separated state. In addition, since the particles themselves are not deformed, the occurrence of the adhesion is suppressed and surface cohesion can be prevented.

The nanoemulsion according to the present invention can be confirmed that the dispersion degree, the particle size, the surface potential difference and the stability, which affect the availability and solubility of the nanoemulsion in the case of deviating from the content condition or changing the material, are greatly reduced. In addition, the stability of the active material and the effect of increasing the bioavailability may also be reduced. The nano emulsion is most preferably prepared through the production method of the present invention as described above.

Emulsifiers are used in the production of nano emulsions. Soy emulsifiers (lecithin), medium chain fatty acid esters, sorbitan fatty acid esters, polyglycerin fatty acid esters, and calcium stearyl lactate . In the food sector, the use of emulsifiers is often only possible at low concentrations. For example, in the case of propylene glycol, not more than 1 g per kg of food can not be used. Considering this point, it is preferable to use sorbitan fatty acid esters, medium chain fatty acid esters and lecithin as emulsifiers in the present invention. The sorbitan fatty acid ester is a nonionic surfactant having different properties and uses depending on the type and number of fatty acids bonded to the sorbitan and degree of esterification. The commercially available fatty acid is sorbitan monoester. The fatty acids bound to sorbitan include lauric acid (Tween 20), palmitic acid (Tween 40), stearic acid (Tween 60) and oleic acid (Tween 80). In the present invention, Tween 80 having an HLB value of 10 to 20, a viscosity of 400 to 620 cps and an average molecular weight of 1300 to 1320 is preferable as an emulsifier.

The exact name of the Tween 80 is polysorbate 80 or polyoxyethylene sorbitan monooleate, CAS NO. 9005-65-6, and can be represented by the following formula (2).

(2)

Tweens 20 or Tween 40 or Tween 60 are more suitable for the preparation of water-in-oil (W / O) emulsions in the chemical structure and are not suitable for the production of water-in-oil (O / W) emulsions in the present invention, ) And the emulsion is easily separated, and when used in the production of nano emulsion, problems such as aggregation, aggregation, formation of emulsion of 500 nm or more occur.

Lecithin, which is obtained from edible oil seeds such as soybean, sunflower seed, and seed oil, is characterized by having an amphiphilic structure containing a phospholipid composed of two fatty acids and a phosphorus valence ester bond in the glycerol side chain The negatively charged phosphate group is used as a good emulsifier which contributes to the stabilization of the emulsion particle by providing a static interaction with repulsive force. However, when lecithin is prepared as a main component, problems such as coagulation, suspension, precipitation, and the like in the formation of the nano emulsion are caused, and dispersion and surface charge are lowered.

The heavy chain fatty acid ester means a substance in which three molecules of saturated or unsaturated C ₂ -C ₂₀ fatty acids and one molecule of glycerol are linked by an ester bond. For example, triacetin, tripropionin, tributyrin, trivalerin, tricaproin, tricaprylin (e.g., triacetin, Such as tricaprin, triheptanoin, trinonanoin, triundecanoin, trilaurin, tristridecane, tetracycline, and the like, But are not limited to, tritridecanoin, trimyristin, tripentadecanoin, tripalmitin, glyceryl triheptadecanoate, triolein and caprylic / Caprylic / Capric Triglyceride (Cas no. 65381-09-1, 73398-6'1-5) (Captex®355) may be used, but preferably caprylic / capric triglyceride . In addition to caprylic / capric glyceride, glyceryl caprylate / caprate (capmul MCM®), PEG-6 caprylic / capric glyceride (caprol) microexpress) was used, it was confirmed that the average particle size of the quercetin-containing emulsion became excessively large at the microemulsion level or the polydispersity index had a value of 0.4 or more.

One of the great advantages of the nano emulsion is that it increases the stability of the quercetin component that has the effect of preventing or treating hyperlipidemia and increases the absorption efficiency of the body, as well as the activity of quercetin in vivo through oral administration to the human body, In a state of being maintained. It is preferable that the hydrophilic biopolymer to ultimately control the particle size of the nanoemulsion is water-soluble. By using a water-soluble biopolymer, quercetin can be safely delivered to the body through oral administration by the organic binding relationship with the above components But can increase the absorption in the body and can be easily prepared orally. The water-soluble biopolymer which can be used in the present invention may be chitosan, alginic acid, cellulose, carrageenan, gelatin, gum arabic, pectin and guar gum, preferably sodium chitosan. If chitosan and casein sodium, which are not sodium alginate, are used, there is a problem that the surface charge is significantly lowered or the particle size is increased.

The surface of the nanoemulsion formed in the nanoemulsion composition is negatively charged. In other words, since the nanoemulsions having a negative charge all have a negative charge, the agglomeration phenomenon between the nanoemulsions is remarkably reduced and the dispersibility is improved.

The preferred surface potential range of the nanoemulsion according to the present invention may be -70 to -45 mV. Above -45 mV, cohesion is minimized by the electrostatic repulsion and the efficiency of quesetin transfer to the cell membrane with positive charge can be increased. If the surface potential is outside the range of -70 to -45 mV, not only the above-mentioned effect can not be achieved but also the physico-chemical stability such as collapse of the particles depending on the pH condition is remarkably lowered.

The pH of the nanoemulsion composition is in the range of 6.5 to 9.0. The pH range in which the stability of the general nanoemulsion is secured is limited to the neutral range of 6.0 to 7.5, while the nanoemulsion according to the present invention has a pH ranging from pH 6.5 it has an advantage that a stable form can be maintained for a long period even under the condition of pH 9.0. In the present invention, storage stability was confirmed for 3 months, and it was confirmed that there was almost no change in particle size, dispersion degree, and potential difference. Therefore, it can be seen that storage can be easily performed up to 6 months. Therefore, the nanoemulsion according to the present invention has an advantage that it can be stored from 1 day to 12 months, preferably from 1 day to 6 months, at pH 6.5 to 9.0 at 20 to 40 ° C.

In addition, the nanoemulsion formed in the nanoemulsion composition according to the present invention has an advantage that retention of quercetin is 50-91%, which is calculated through the following formula 1, and 1.5-2 times more retention than that of the conventional nanoemulsion.

[Formula 1]

Quercetin retention (%) =

In the present invention, water-insoluble flavonoid quercetin is dissolved in a medium-chain fatty acid ester and a sorbitan fatty acid ester to form a nemo-emulsion by coemulsification with a mixture of biopolymer and lecithin. In the present invention, the nanoemulsion can be prepared by adjusting the pH to a range of pH 4.5 to 9.0, preferably pH 6.5 to 9.0. When the pH of the nanoemulsion is adjusted to 4.5 to 6.0, nanoemulsion particles are not formed.

The nano-emulsion of the present invention can be recovered by a solvent precipitation method such as ethanol or acetone, or dried by a vacuum lyophilization method to be made into nanoparticles. The nanoparticles of powder form have a higher stability than the nano emulsion, And it is advantageous that it is easier to apply to various drugs or foods. In addition, the nano emulsion or nanoparticle of the present invention has an excellent solubility and can dissolve well in water.

Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating cardiovascular diseases or fatty liver comprising the nanoemulsion composition as an active ingredient.

The present invention relates to a drug delivery formulation capable of delivering quesetin in vivo, and is a pharmaceutical composition for oral administration suitable for oral administration.

The nanoemulsion composition according to the present invention suppresses the expression of genes related to the decrease in lipid levels in serum and liver, the decrease in expression of genes related to fatty acid and cholesterol synthesis in liver, the increase in expression of genes related to HDL-cholesterol production and the lipid accumulation in liver It was confirmed to have all. Therefore, the pharmaceutical composition according to the present invention can be effectively used for preventing or treating hyperlipidemia.

The cardiovascular diseases of the present invention include myocardial infarction, angina pectoris, hypertension, heart failure, cardiomyopathy, primary pulmonary hypertension, cardiovascular disease, But are not limited to, those selected from the group consisting of cardiac arrest, congestive heart failure, ischemic heart failure, arteriosclerosis, arrhythmia, coronary artery disease, stroke, ischemic heart disease (myocardial ischemia), hyperlipidemia, hypotension and peripheral vascular disease It may, but not necessarily, be hyperlipidemia. The term " hyperlipidemia " as used herein refers to an abnormally high level of lipid such as cholesterol, triglyceride and LDL-cholesterol in the blood.

Fatty liver is a fatty liver, which is a disorder of liver fat metabolism and accumulation of fat in hepatocytes. Specifically, the fatty liver disease defined herein may be any one or more selected from the group consisting of an alcoholic fatty liver, a nonalcoholic fatty liver, a nutritive fatty liver, a starvation fatty liver, an obese liver fat, and a diabetic fatty liver, and preferably includes a nonalcoholic fatty liver do.

In the present invention, the term " treatment " may mean any action that improves or alters the symptoms of breast cancer by administration of the pharmaceutical composition.

The nanoemulsion composition is excellent in solubility and greatly improved bioavailability, so that it is preferably applied for oral administration. In particular, the nanoemulsion composition of the present invention is stably solubilized by forming an emulsion by mixing proper amounts of quercetin, a medium chain fatty acid ester, a sorbitan fatty acid ester, lecithin and a hydrophilic biopolymer, and exhibits remarkably increased solubility In addition, it has very stable solubility in intestines.

The composition of the present invention may contain a pharmaceutically acceptable additive, and may be formulated into a conventional oral solid preparation such as tablets, capsules and the like together with such additives. For example, a mixture of the nanoemulsion and a pharmaceutically acceptable additive may be filled into capsules and formulated into capsules. Such pharmaceutically acceptable additives include, for example, diluents such as lactose, starch and microcrystalline cellulose; Magnesium stearate, talc, such as talc, and the like, but the present invention is not limited thereto. The pharmaceutically acceptable additives may range from 20 to 70% by weight, based on the total weight of the composition, but are not limited thereto.

The composition of the present invention is administered in a pharmaceutically effective amount.

The term " pharmaceutically effective amount " as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will vary depending on the species and severity, age, sex, The type of drug, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

According to a preferred embodiment of a suitable dosage of the pharmaceutical composition of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-10 g / kg.

There is provided a food composition for preventing or improving a cardiovascular disease or fatty liver using the nanoemulsion composition according to the present invention as an active ingredient.

The food composition has a cardiovascular or fatty liver prophylactic or ameliorating effect. Specifically, the cardiovascular disease is a disease occurring in the heart and major arteries. The cardiovascular diseases of the present invention are myocardial infarction, angina pectoris, hypertension, heart failure, cardiomyopathy, But are not limited to, those selected from the group consisting of cardiac arrest, congestive heart failure, ischemic heart failure, arteriosclerosis, arrhythmia, coronary artery disease, stroke, ischemic heart disease (myocardial ischemia), hyperlipidemia, hypotension and peripheral vascular disease It may, but not necessarily, be hyperlipidemia. The term " hyperlipidemia " as used herein refers to an abnormally high level of lipid such as cholesterol, triglyceride and LDL-cholesterol in the blood.

Fatty liver is a fatty liver, which is a disorder of liver fat metabolism and accumulation of fat in hepatocytes. Specifically, the fatty liver disease defined herein may be any one or more selected from the group consisting of an alcoholic fatty liver, a nonalcoholic fatty liver, a nutritive fatty liver, a starvation fatty liver, an obese liver fat, and a diabetic fatty liver, and preferably includes a nonalcoholic fatty liver do.

The food composition according to the present invention can be formulated in the same manner as the above-mentioned pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, confectioneries, diet bars, dairy products, meat, chocolates, pizza, ram noodles, other noodles, gums, ice cream, Have a back

The food composition of the present invention may contain not only the above-mentioned nanoemulsion composition as an active ingredient but also components that are ordinarily added in food production, for example, a protein, a carbohydrate, a fat, a nutrient, a seasoning agent and a flavoring agent do. Examples of the above-mentioned carbohydrates are monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavorings such as tau martin and stevia extract (e.g., rebaudioside A and glycyrrhizin) and synthetic flavorings (saccharine, aspartame, etc.) can be used as flavorings. For example, when the food composition of the present invention is prepared from a drink and a beverage, the present invention may further include citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, and various plant extracts in addition to the nanoemulsion composition have.

The present invention provides a health functional food comprising a composition for food for preventing or ameliorating muscular weakness related to muscle weakness comprising the nanoemulsion composition as an active ingredient. The health functional food is a food prepared by adding the above nano emulsion composition to food materials such as beverage, tea, spice, gum and confectionery, or encapsulated, powdered or suspended, and has a health-specific effect when consumed However, unlike general medicine, there is an advantage that there is no side effect that can occur when a long-term use of the medicine is performed using the food as a raw material. The health functional food of the present invention thus obtained is very useful because it can be ingested routinely. The amount of the nanoemulsion composition to be added to such a health functional food may vary depending on the type of the health functional food to be targeted and can not be uniformly specified. However, it may be added within a range that does not deteriorate the original taste of the food, And usually ranges from 0.01 to 50% by weight, preferably from 0.1 to 20% by weight. In the case of health functional foods in the form of pills, granules, tablets or capsules, they may be added usually in the range of 0.1 to 100% by weight, preferably 0.5 to 80% by weight. In one embodiment, the health functional food of the present invention may be in the form of a pill, tablet, capsule or beverage.

Hereinafter, the present invention will be described in detail with reference to examples. However, the present invention is not limited to the examples.

Examples 1 to 3. Preparation of nano emulsion

(Captex® 355, capmul MCM®, caprol micro express) (Abitec Coporation, Janeville, Wis., USA) and quercetin (Acros Organics Company, Fisher Scientific, Pittsburgh, PA, USA) : 10, and the mixture was stirred at 150 rpm for 3 minutes. 3 g of Tween 80 was added to the mixture, and the mixture was stirred at 12,000 rpm in a homogenizer (Ultra-Turrax T-25, Janhke & Kunkel GmbH and Co KG, Staufen, Germany) The mixture was reacted for 1-3 hours (1-3 hours in this experiment) while maintaining the temperature at 65 ° C to prepare a first solution in which the first emulsion was formed. A solution of 5% sodium alginate (Sigma-Aldrich Chemical Company, St. Louis, MI, USA) containing lecithin (IFC Solutions, Linden, NJ, USA) was added 15 times and mixed in a homogenizer at 10,000 rpm for 4 minutes. To the distilled water was added 0.5% of the mixed solution so that the pH was adjusted to 4.5 to 9.0, and the mixture was stirred at room temperature for 3 hours at 40 rpm Not stirred, and was prepared in a nano-emulsion composition was stabilized for 24 hours. The composition was obtained by filtration and dried to nano-emulsion using a 0.45 ㎛ filter.

The nanoemulsion prepared using Captex 355 as an emulsifier was Example 1, the nanoemulsion prepared using capmul MCM® was used as Example 2, and the nanoemulsion prepared using caprol microexpression was set as Example 3.

Experimental Example 1. Selection of Emulsifier.

Quercetin is used in a variety of oils (including soybean oil, lemone oil, cinnamon oil, clove bud oil, orange oil, peppermint oil, thyhu oil, lime oil, tangerine oil, grapefruit oil, eugenol, caprol micro express, captex®355, Tween 80, Tween 60, Tween 40, and Tween 20), and the solubility and transparency of each other were compared with each other Respectively.

As a result, Tween 80, caprol micro express, soy lecithin, captex®355, and polyethylene glycol-400, which are transparent and have good solubility with each other while maintaining a liquid state at room temperature, were selected.

Other oils besides the oil have problems in that they are poor in solubility, the mixture becomes opaque or becomes solid at room temperature.

Experimental Example 2. Transparency and solubility of quercetin-containing primary emulsion

Quercetin and various emulsifiers were mixed as shown in Table 1, and then subjected to vortexing. The mixture was heated at 65 ° C for 20 minutes and homogenized for 4 minutes to prepare a quercetin-containing nanoemulsion by self-assembly Respectively. The solubility and transparency of the prepared nano-emulsion were visually observed and are shown in Table 1 below.

sample Tween 80 pedigree lecithin CaptEx®355 capmul MCM® caprol micro express PEG 400 Sodium alginate Quercetin
(0.47 mg / g) Solubility / Transparency One 3 g 3 g 300 mg ○ / ○ 2 3 g 3 g 300 mg ○ / ○ 3 3 g 3 g 300 mg ○ / ○ 4 3 g 3 g 300 mg ○ / ○ 5 3 g 3 g 300 mg ○ / ○ 6 3 g 3 g 300 mg × / ○ 7 3 g 3 g 300 mg × / ○ 8 3 g 3 g 300 mg × / ○ 9 3 g 3 g 300 mg △ / ○ 10 3 g 3 g 300 mg △ / ○ 11 3 g 3 g 3 g 450 mg △ / ○ 12 3 g 3 g 3 g 450 mg × / ○ 13 3 g 3 g 3 g 450 mg × / ○ 14 3 g 3 g 3 g 450 mg × / ○

○: Excellent solubility or solution is transparent

?: Excellent solubility but not homogeneously mixed and separated

X: not dissolved, separated, or not partially dissolved

As shown in Table 1, when three or more emulsifiers were mixed and used, it was confirmed that there was a problem that the prepared nano emulsion significantly deteriorated in solubility. Also, it can be confirmed that the nanoemulsion prepared on the basis of the lecithin not mixed with Tween 80 is also low in solubility or separated even without excellent homogeneity even when solubility is excellent.

As a result, it is understood that the preparation of a nano emulsion by adding various emulsifiers or hydrophilic biopolymers including Tween 80 essentially improves solubility and transparency.

Experimental Example 3. Solubility of the primary emulsion according to the addition ratio of Tween 80

300 mg of quercetin is mixed with 3 g of captex 355. After vortexing for 20 minutes, Tween 80 (1 g, 2 g, 2.5 g, and 3 g) was mixed with each other to prepare a nanoemulsion. The mixture was mixed at 70 ° C for 1 hour and then the solubility was measured.

As a result, it was confirmed that the nano emulsion prepared by mixing 3 g of Tween 80 was completely dissolved, whereas the nano emulsion prepared by mixing 1 to 2.5 g of Tween 80 did not dissolve due to low solubility. From these results, it can be seen that it is preferable to mix Tween 80 at 3 g or more.

EXPERIMENTAL EXAMPLE 4 Comparison of Formability of Nano Emulsion Prepared by Using Sodium Caseinate and Sodium Alginate

Quercetin and various emulsifiers were mixed according to the ratios in Table 2 below and mixed for 4 minutes at 12,000 rpm. The mixture was reacted for 1 hour while maintaining the temperature at 65 캜 to prepare a primary emulsion. 5% sodium caseinate (sodium caseinate) or 5% sodium alginate (sodium alginate) was added to the primary emulsion and the mixture was homogenized at 10,000 rpm for 4 minutes. The mixture was added to distilled water so that the amount of the mixed solution was 0.5%, and the mixture was stirred overnight to prepare a nanoemulsion. Among the above-prepared nanoemulsions, when casein sodium was used, most of the nanoemulsions were coagulated, coagulated, or suspended.

Among the above samples, samples in which homogeneous, stable and well-dissolved nanoemulsion was formed were 15, 22, 27-29, 34-36.

sample The primary emulsion (first solution) The second solution Tween 80 CaptEx®355 capmul MCM® caprol micro express PEG 400 Quercetin
(0.47 mg / g) 5% sodium caseinate 5% sodium alginate 15 3 g 3 g 300 mg 1 g 16 3 g 3 g 300 mg 1 g 17 3 g 3 g 300 mg 1 g 18 3 g 3 g 300 mg 1 g 19 3 g 300 mg 1 g 20 3 g 150 mg 0.5 g 21 3 g 150 mg 0.5 g 22 3 g 3 g 300 mg 94.5 g 23 3 g 3 g 300 mg 94.5 g 24 3 g 3 g 300 mg 94.5 g 25 3 g 3 g 300 mg 94.5 g 26 3 g 300 mg 94.5 g 27 3 g 3 g 300 mg 1 g 28 3 g 3 g 300 mg 1 g 29 3 g 3 g 300 mg 1 g 30 3 g 3 g 300 mg 1 g 31 3 g 300 mg 1 g 32 3 g 150 mg 0.5 g 33 3 g 150 mg 0.5 g 34 3 g 3 g 300 mg 94.5 g 35 3 g 3 g 300 mg 94.5 g 36 3 g 3 g 300 mg 94.5 g 37 3 g 3 g 300 mg 94.5 g 38 3 g 300 mg 94.5 g

As shown in Table 2, 0.5 g of the nanoemulsion prepared from the above-mentioned samples was dispersed in 100 ml of purified water, and then the particle size, polydispersity index, potential difference and visual observation of each dispersed nanoemulsion Are shown in Table 3. &lt; tb &gt; &lt; TABLE &gt;

The particle size and potential difference were measured to measure the stability of the nano emulsion. Particle size and potential difference measurements were performed at 21 [deg.] C using a light-scattering particle size analyzer (Zetasizer Nano ZS, Malvern Instruments Ltd., Worcestershire, UK).

sample PS (average particle size) PDI (polydispersity index) ZP (potential difference) sample PS (average particle size) PDI (polydispersity index) ZP (potential difference) 15 162.9 ± 0.52 0.44 + 0.04 -18.6 + 0.49 22 125.0 + - 0.37 0.40 + 0.02 -22.6 ± 1.17 27 239.7 ± 19.5 0.35 + 0.04 -37.1 + 1.15 34 196.7 ± 2.13 0.30 0.01 -50.4 ± 0.52 28 1811.7 + - 629.0 0.90 + 0.14 - 35 729.9 ± 18.10 0.612 + 0.06 - 29 481.4 ± 19.5 0.46 ± 0.23 - 36 244.3 ± 0.54 0.69 ± 0.00 -

PS (particle size), particle size (nm); PDI (polydispersity index), polydispersity index; ZP (potential difference), zeta potential (mV)

As shown in Table 3, it was confirmed that there was a difference in average particle size, polydispersity index and potential difference depending on the amount of sodium alginate. Samples 22 and 34-36 showed better overall physico-chemical properties than Samples 15 and 27-29. Since the nano emulsion significantly affects the absorption rate and utilization of the nano emulsion according to these physicochemical properties, the numerical improvement of the degree described above is significant.

In the case of Samples 15 and 22, the potential difference was less than -25 mV, and the polydispersity index was also 0.4 or more, indicating that the dispersibility was low, and slight aggregation was observed when visually confirmed. Therefore, it was confirmed that an unstable emulsion was formed when sodium caseinate was used instead of sodium alginate as a hydrophilic biopolymer.

Furthermore, when capmul MCM®, caprol micro express, PEG 400 is used instead of a mixture of Tween 80 and captex®355 as the emulsifier, the average particle size of the quercetin-containing emulsion becomes excessively high to the microemulsion level, The index was also found to have a value of 0.4 or greater.

When PEG 400 was used, it was confirmed that separation or precipitation occurred after formation of nanoemulsion.

Experimental Example 5. Comparison of Particle Size, Dispersion and Potential Difference of Quercetin-Containing Nano Emulsion According to pH.

Table 4 shows the particle size, dispersity and potential difference of the quercetin-containing nanoemulsion prepared in Examples 1 to 3 according to each pH.

pH Example 1 Example 2 Example 3 Room temperature (21 ° C) Room temperature (21 ° C) Room temperature (21 ° C) PS PDI ZP PS PDI ZP PS PDI ZP 6.5 227.9 ± 1.2 0.292 + - 0.2 -46.5 ± 0.1 1548 ± 11.2 0.943 + 0.1 - 501.2 ± 8.8 0.584 + - 0.4 - 7.0 199.6 ± 0.6 0.239 + 0.03 -49.2 ± 0.3 2670 ± 23.02 1.0 ± 0.1 - 2214 ± 11.3 1.0 ± 0.08 - 7.5 198.6 ± 1.4 0.23 ± 0.8 -47.7 ± 0.4 936.7 ± 9.6 0.685 ± 0.06 - 244.6 ± 0.5 0.689 ± 0.01 - 8.0 196.3 ± 0.7 0.253 + - 0.2 -51.0 ± 1.0 724.4 ± 28.8 0.137 0.7 - 251.7 ± 0.5 0.719 ± 0.7 - 8.5 197.0 ± 0.8 0.245 + 0.07 -52.6 ± 0.4 450.9 ± 1.5 0.692 + - 0.4 - 194.0 ± 4.5 1.0 ± 0.2 - 9.0 198.0 ± 0.7 0.259 + 0.04 -53.8 ± 0.1 936.1 + - 10.3 0.669 + 0.03 - 258.0 + 1.7 0.732 0.01 -

As shown in Table 4, the quercetin-containing nanoemulsion of Example 1 had an average particle size of 150 to 250 nm under various pH conditions (6.5 to 9.0), and an excellent dispersion degree of less than 0.3 and an excellent dispersion degree of -45 to -70 mV Indicating a potential difference. When the quercetin-containing nanoemulsion of Preparation Example 1 is prepared under the condition of pH lower than 6.5, there is a problem that a precipitate is formed. Therefore, the pH is preferably 6.5 to 9.0 at the time of production.

Also, when capmul MCM®, caprol micro express, rather than a mixture of Tween 80 and captex®355 as an emulsifier, is used, the average particle size of the quercetin-containing emulsion becomes excessively large to the microemulsion level, In addition, the polydispersity index was also found to have a value of 0.4 or greater. That is, it is preferable to use Tween 80 and captex 355 in the preparation of the primary emulsion, and then the addition of a 5% sodium alginate solution containing the% content of lecithin is preferable for solubility, transparency, Which is preferable in terms of particle size. When any one of them is out of the condition, the particle size, the degree of dispersion and the potential difference do not satisfy the above criteria, and they precipitate, flocculate or flocculate, and when used as a food or a drug, the water absorption rate and pharmacological effect of quercetin A problem arises.

Experimental Example 5: Evaluation of formation of nanoemulsion when sodium caseinate and lecithin mixed solution was used as the second solution

When lecithin was added to sodium caseinate, the emulsion was formed in a state of dispersion with an average particle size of 300 nm or more and a dispersion degree of 0.65 to 0.7, which was very unstable, and the potential difference also increased to -4 to -8 mV . That is, it can be seen that when a mixture of sodium caseinate and lecithin is used as the second solution, it is not helpful at all to form a nanoemulsion.

Experimental Example 6. Measurement of retention capacity of quercetin-containing nanoemulsion

In order to measure the quercetin retention of quercetin-containing nanoemulsion, the nanoemulsion prepared in Example 1 at various pH conditions (pH 6.5-9.0) was centrifuged at 4,000 rpm for 10 minutes for 2 minutes, The supernatant was filtered off with a 0.45 ㎛ filter membrane to obtain a precipitate, which was then dissolved in methanol and the content of quercetin contained therein was analyzed by HPLC. At this time, the quercetin retention (%) of the quercetin-containing nanoemulsion was calculated by the following equation.

[Formula 1]

Quercetin retention (%) =

Figure 1 is a graph showing the retention of the nanoemulsion prepared from Example 1 at various pH conditions (pH 6.5-9.0).

As shown in FIG. 1, the quercetin retention of quercetin-containing nanoemulsion prepared in the range of pH 6.5-9.0 was in the range of 50-91%, and when the pH was adjusted in the range of 8.0-9.0, retention was 90% .

Experimental Example 7. Measurement of transmission electron microscope (TEM) of quercetin-containing nanoemulsion

Transmission electron microscopy of the quercetin-containing nanoemulsion was carried out by fixing 7 μl of the quercetin-containing nanoemulsion to the carbon-coated copper grid for negative staining, washing once with ultrapure water, immediately adding 7 μl of 2% uranyl acetate, Washed with ultrapure water and dried in air. The prepared specimen was photographed at an accelerated electron beam of 200 kV to obtain a transmission electron microscope photograph, and the results are shown in Fig. The particle morphology of the quercetin-containing nanoemulsion was observed in a circular form and the size ranged from 197 to 328 nm (FIG. 2).

Experimental example 8. Measurement of storage stability of quercetin-containing nanoemulsion

The storage stability of the quercetin-containing nanoemulsion of Example 1 was measured by a method such as particle size, polydispersity index, potential difference and visual observation while being stored at room temperature (21 DEG C) and 37 DEG C thermostat for 3 months, And the state of the quercetin-containing nanoemulsion after storage at room temperature (21 ° C) for 3 months and at 37 ° C is shown in FIG. The particle size of quercetin-containing nanoemulsion at room temperature (21 ° C) was slightly increased to 201-224 nm during storage for 3 months immediately after preparation, In one case, stable results were obtained in the range of 191-197 nm. When the pH was adjusted to 7.5, it was 190-197 nm. When the pH was adjusted to 8.0, it was 194-198 nm. When the pH was adjusted to 8.5, it was 188-199 nm. When the pH was adjusted to 9.0, the range was 185-198 nm And maintained a stable state. On the other hand, when stored at 37 ℃, stable nanoemulsion was formed at 180-197 nm over pH control range of 6.5-9.0.

During storage of quercetin-containing nanoemulsion, the polydispersity index is in the range of 0.2-0.29 regardless of the pH control range for 3 months after storage at room temperature and storage for 3 months. . The potential difference value was in the range of -44 to -70 mV in the pH 6.5-9.0 range at the room temperature and 37 ° C storage condition and immediately after the preparation for 3 months storage period, and the nanoemulsion formation layer was stably maintained.

pH Immediately after manufacture 1 month 2 months 3 months Room temperature (21 ° C) Room temperature (21 ° C) 37 ℃ Room temperature (21 ° C) 37 ℃ Room temperature (21 ° C) 37 ℃ PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP 6.5 201 0.30 -47.2 203 0.31 -44.3 180 0.22 -48.5 204 0.25 -51.5 187 0.20 -63.2 224 0.31 -53.3 191 0.19 -61.7 7.0 197 0.24 -50.4 197 0.23 -42.9 184 0.20 -49.0 199 0.22 -58.2 188 0.20 -62.7 205 0.23 -58.1 191 0.20 -60.1 7.5 197 0.28 -48.1 198 0.22 -47.0 185 0.21 -50.2 194 0.20 -57.5 190 0.21 -62.0 212 0.29 -65.6 193 0.19 -63.2 8.0 194 0.25 -51.0 197 0.30 -44.6 197 0.21 -41.0 198 0.24 -55.8 198 0.18 -45.9 198 0.24 -58.2 197 0.25 -45.8 8.5 199 0.25 -53.3 197 0.24 -57.4 188 0.20 -49.8 196 0.21 -67.4 192 0.20 -62.0 198 0.40 -63.5 194 0.22 -60.8 9.0 197 0.26 -55.8 198 0.22 -53.2 185 0.21 -52.2 200 0.24 -66.2 193 0.20 -61.7 198 0.22 -69.1 195 0.20 -62.7

PS (particle size), particle size (nm); PDI (polydispersity index), polydispersity index; ZP (potential difference), zeta potential (mV)

Experimental Example 9. Evaluation of efficacy on animal models of hyperlipidemia

1) Breeding and diet of experimental animals

 Male C57BL / 6J mice (Doo Yeol Biotech, Seoul, Korea) at 4 weeks of age were preliminarily raised for 1 week in an animal breeding room (22 ± 1 ℃, relative humidity 55 ± 5%, 12 hours light / dark cycle) The experimental diets were divided into five groups, total cholesterol diet control group, quercetin group (0.05%, 0.1%) and quercetin - containing nanoemulsion group (0.05%, 0.1% Respectively.

The control group received only high cholesterol diet and the quercetin group (0.05%, 0.1%) supplied high cholesterol diet containing 0.05% or 0.1% quercetin (a single compound not a nanoemulsion). The quercetin-containing nanoemulsion group (0.05%, 0.1%) also supplied a high cholesterol diet containing 0.05% or 0.1% quercetin-containing nanoemulsion (Example 1). The cholesterol-induced cholesterol-induced hyperlipidemia model was prepared by feeding an experimental diet based on AIN-76 dietary composition (Table 6). Experimental diets and water were freely consumed during the entire breeding period, and body weight and dietary intake of the experimental animals were measured twice a week. All animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of Ewha Womans University (approval number 16-047).

In Table 6, experimental samples were quercetin (a single compound not a nanoemulsion) in the quercetin group (0.05%, 0.1%) and quercetin-containing nanoemulsion in the quercetin-containing nanoemulsion group (0.05%, 0.1% do. That is, since the quercetin-containing nanoemulsion group was administered on the basis of the weight of the nanoemulsion, the amount of quercetin supplied to the animal model of hyperlipidemia was substantially smaller than that of the quercitin group. Despite this, experimental results to be described later confirmed that a significantly improved pharmacological effect was obtained in the group administered with quercetin-containing nanoemulsion. When considering the amount of quercetin practically administered, the quercetin group (quercetin group) It can be seen that the batherine-containing nanoemulsion exhibits a difference of more than 2-fold even though it contains less than 20-fold quercetin.

Constituent Control group  Quercetin Quercetin-containing nanoemulsion (Example 1) 0.05% 0.1% 0.05% 0.1% Corn starch 150.0 150.0 150.0 150.0 150.0 Casein 200.0 200.0 200.0 200.0 200.0 Sucrose 485.0 484.5 484.0 484.0 484.0 Corn oil 50.0 50.0 50.0 50.0 50.0 Cellulose 50.0 50.0 50.0 50.0 50.0 Mineral mix ^{2 )} 35.0 35.0 35.0 35.0 35.0 Vitamin mix ^{3 )} 10.0 10.0 10.0 10.0 10.0 DL-Methionine (DL-Methionine) 3.0 3.0 3.0 3.0 3.0 Choline bitartrate 2.0 2.0 2.0 2.0 2.0 Experimental sample 0.0 0.5 1.0 0.5 1.0 Cholesterol 10.0 10.0 10.0 10.0 10.0 Cholic acid 5.0 5.0 5.0 5.0 5.0 Gross weight 1000 1000 1000 1000 1000  Total calories (kcal) 3579.7 3579.3 3577.9 3576.1 3572.5  Carbohydrates (% as kcal) 67.1 67.1 67.1 67.1 67.0  Protein (% as kcal) 20.3 20.3 20.3 20.4 20.4  Fat (% as kcal) 12.6 12.6 12.6 12.6 12.6

^{1) It} is based on the AIN-76 formula.

²⁾ AIN-76 Mineral mix (mg / kg diet)

³⁾ AIN-76 Vitamin mix (mg / kg diet)

2) Collection and processing of samples

All five groups of hyperlipidemic animal models prepared in the process 1) were fasted for more than 12 hours and then anesthetized. Blood was collected from the heart and centrifuged at 2,800 rpm at 4 ° C for 20 minutes. Serum was separated and stored at -20 ° C until analysis. The laparotomy liver was washed with cold saline, weighed, frozen in liquid nitrogen and stored in a deep freezer at -70 ° C.

3) Measurement of serum lipid and biochemical indicators

Serum triglyceride, total cholesterol. HDL-cholesterol. AST (aspartate aminotransferae) and ALT (alanine aminotransferase) were measured using a commercial kit (Asan Pharmaceutical, Seoul, Korea). The concentration of LDL-cholesterol was determined using Friedewald's formula (Friedewald WT, Levey RI, Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972; 18: 499-502) The atherogenic index (AI) was calculated from the following formula by Inkeles et al. (Inkeles S, Eisenberg D. Hyperlipidemia and coronary atherosclerosis. Medicine (Baltimore) 1981; 60: 110-123.).

 LDL-cholesterol = total cholesterol-HDL-cholesterol- [triglyceride / 5]

 Atherogenic index = (total cholesterol-HDL-cholesterol) / HDL-cholesterol

4) Liver lipid measurement

Liver lipid extraction was performed according to the method of Bligh and Dyer (Bligh EG, Dyer WJ, A rapid method of total lipid extraction and purification, Can J Biochem Physiol 1959; 37: 911-917). The liver tissue was homogenized by adding 1.5 ml of saline, and then 7.5 ml of a (v / v) chloroform / methanol solution was added and left at room temperature for 30 minutes. Chloroform (2.5 ml) was added and centrifuged at 3,000 rpm for 20 min. 10 g of sodium sulfate (anhydrous) was added to the bottom layer. The filtrate was collected by filtration on filter paper (No. 6, UK) Respectively. The concentrations of triglyceride and total cholesterol were measured using a commercial kit (Asan Pharmaceutical) using an enzyme colorimetric assay.

5) Quantification of mRNA by real-time quantitative PCR

 Total RNA in the liver was extracted using Trizol (Invitrogen, Carlsbad, USA). M-MLV Reverse Transcriptase (Bioneer Co., Daejeon, Korea) was used for cDNA synthesis from total RNA for mRNA quantification. The synthesized cDNA was amplified using AccuPower® 2X GreenStar ™ qPCR Master Mix (Bioneer Co.). The primer sequences used for quantification of specific mRNAs are shown in Table 7. Fluorescence measurements for quantitative analysis were performed every PCR cycle using Rotor-Gene RG-3000A (Corbett Research, Sydney, Australia), and relative quantitation of gene expression was performed using the delta-delta Ct method (Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method Method.

gene GeneBank No. Primer base sequence (5-3) ABCA1 NM_013454 F: ACGCTGTACCTGCCCTATGT R: GCTCCTCGAAAAGGGCGAAA ACC AY451393 F: CAAGTGCTCAAGTTTGGCGC R: CAAGAACCACCCCGAAGCTC ApoA-1 NM_009692 F: TATGGCAGCAAGATGAACCC R: CCAGGAGATTCAGGTTCAGC β-actin NM_007393 F: GGACCTGACAGACTACCTCA R: GTTGCCAATAGTGATGACCT FAS AF127033 F: CTGGCATTCGTGATGGAGTC R: TGTTTCCCCTGAGCCATGTA HMG-CoA M62766 F: GCACCATGCCATCGATAGAG R: GACAGCTCACCAGCCATCAC SREBP-2 NM_033218 F: ACTGAAGTAGAGCGGGTCCC R: AAGTAGTGCCGCTGACGTTG

6) Statistical analysis

All experimental results were analyzed using SPSS 21.0 (IBM Corporation, Armonk, NY, USA). One-way analysis of variance was used to show mean and standard error. Significance was tested at P <0.05 according to Tukey's multiple range test.

7) Conclusion

This study compared the lipid - lowering effects of quercetin directly and quercetin - containing nanoemulsion using high cholesterol diet induced hyperlipidemia mice as animal models. When quercetin is administered in the form of a nanoemulsion, the serum and liver lipid levels are reduced more effectively than when quercetin is directly ingested, and not only the expression of genes involved in fatty acid and cholesterol synthesis in the liver is reduced, but also the production of HDL-cholesterol And increased gene expression.

Specifically, the increase in insect numbers, the dietary intake, and the dietary efficiency of the quercetin-treated group and the nanoemulsion-treated group were compared with each other, and the results are shown in Table 8 (the experimental diet was conducted for 6 weeks). As shown in Table 8, there was no significant difference in initial weight, final weight, weight gain, dietary intake and diet efficiency between all groups. These results show that direct administration of 0.05% and 0.1% quercetin and administration of 0.05% and 0.1% quercetin-containing nanoemulsion do not affect body weight, dietary intake and diet efficiency.

Control group Quercetin Quercetin-containing nanoemulsion 0.05% 0.1% 0.05% 0.1% Initial weight (g) 21.34 ± 0.29 21.34 ± 0.29 21.37 ± 0.26 21.34 ± 0.26 21.33 + - 0.21 Final weight (g) 25.15 + 0.15 24.71 ± 0.16 24.41 + - 0.34 24.25 + - 0.39 24.12 + - 0.48 Weight gain (g / day) 0.09 ± 0.01 0.08 ± 0.01 0.07 ± 0.01 0.07 ± 0.01 0.07 ± 0.01 Dietary intake (g / day) 4.74 ± 0.08 4.62 + 0.11 4.64 0.10 4.75 + 0.06 4.64 ± 0.12 Dietary efficiency ¹⁾ (g gain / kcal consumed) 0.019 ±
0.002 0.017 ±
0.002 0.016 ±
0.002 0.015 ±
0.002 0.015 ±
0.002

In the above table, values are expressed as mean ± standard error (n = 6).

¹⁾ Efficacy = weight gain (g) / dietary intake (g)

We also investigated liver weight, serum AST and ALT activity of each group of animal models in order to evaluate the dietary safety of quercetin-treated group and quercetin-containing nanoemulsion group. FIG. 4 is a graph showing the results of an animal model of hyperlipidemia (0.05%, 0.1% quercetin) and a quercetin-containing nanoemulsion (Example 1) (A), serum AST (b) and serum ALT (c). Values are expressed as mean ± standard error (n = 6).

As shown in FIG. 4, there was no significant difference between the liver weights of the respective groups (FIG. 4A), and serum levels of AST and ALT were not significantly different between all groups when liver damage occurred (Figures 4b, c). Therefore, it can be confirmed that both case of administration of quercetin containing 0.05% and 0.1% and administration of quercetin-containing nanoemulsion are not harmful to experimental animals.

 5 shows the results of an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia (0.05%, 0.1% nanoquercetin) administered with the quercetin-containing nanoemulsion of Example 1 for 6 weeks, (A), total cholesterol (b), HDL-cholesterol (c), LDL-cholesterol (d) and arteriosclerosis index (e).

The values are expressed as mean ± standard error (n = 6). * Indicates statistical significance for the control group (* P <0.05, ** P <0.01, *** P <0.001), and # indicates statistical significance for the group directly administered quercetin (# P &lt; 0.05, # P &lt; 0.01).

As shown in Fig. 5, the serum triglyceride content was 27.9% and 34.8% lower in the hyperlipidemic animal model (0.05%, 0.1% nanoquercetin) administered with the quercetin-containing nanoemulsion of Example 1 for 6 weeks than the control group , And quercetin (0.05%, 0.1% quercetin) for 6 weeks. Total cholesterol was reduced by 12.1%, 10.7% and 18.2% in the 0.1% quercetin-treated group, 0.05% and 0.1% quercetin-containing nanoemulsion, respectively, compared with the control group, and 0.05% There was no significant change in the group treated with cetin directly.

HDL-cholesterol was increased by 13.5% and 20.7% in the group treated with 0.05% and 0.1% quercetin-containing nanoemulsion, respectively, compared with the control group. In the group treated with 0.1% quercetin-containing nanoemulsion, Compared to the control group (Fig. C). LDL-cholesterol was reduced by 19.4%, 19.6% and 33.5% in the group treated with 0.1% quercetin directly, 0.05% and 0.1% quercetin-containing nanoemulsion, respectively, compared to the control group, (Fig. 5D), compared to the group to which the same concentration of quercetin was directly administered in the emulsion-administered group (Fig. 5D). Atherogenic index also showed similar tendency. (29.0%) in the 0.1% quercetin-treated group (24.0%), the 0.05% quercetin-containing nanoemulsion group and the 0.1% quercetin-containing nanoemulsion group (45.0% Respectively. The group treated with 0.1% quercetin-containing nanoemulsion showed a significant decrease of 27.6% compared with the group treated with quercetin at the same concentration (FIG. 5E). Based on these results, it was confirmed that the group administered with quercetin-containing nanoemulsion decreased serum lipid levels more effectively than the group directly administered with quercetin.

FIG. 6 is a graph showing an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia (0.05%, 0.1% (A), triglyceride (b), and total cholesterol (c) in the liver. The values are expressed as mean ± standard error (n = 6). * Indicates statistical significance for the control group (** P <0.01, *** P <0.001), and # indicates statistical significance for quercetin directly administered group (#P <0.05, ## P &lt; 0.01).

As shown in FIG. 6, the total lipid content in the liver was 10.4%, 16.0% and 42.0% in the 0.1% quercetin-treated group, 0.05% and 0.1% quercetin-containing nanoemulsion group, . In the group treated with 0.1% quercetin-containing nanoemulsion, the amount of quercetin was significantly decreased by 35.2% compared to the group administered with the same amount of quercetin. The hepatic triglyceride content was decreased by 30.6% and 58.6%, 56.8% and 65.2%, respectively, in the 0.05% and 0.1% quercetin treated group and 0.05% and 0.1% quercetin containing nanoemulsion treated groups, respectively , And the group treated with 0.05% quercetin-containing nanoemulsion showed a significant decrease of 37.6% compared to the group treated with quercetin at the same concentration (FIG. 6b). The total cholesterol content in the liver was significantly higher in the group treated with 0.1% quercetin (20.0%), the group treated with 0.05% quercetin-containing nanoemulsion (17.7%) and the group treated with 0.1% quercetin (27.5%), and there was no significant change in the group treated with 0.05% quercetin (FIG. 6c). These results suggest that ingestion of quercetin-containing nanoemulsion may reduce liver lipid levels more effectively than quercetin intake.

FIG. 7 is a graph showing an animal model of hyperlipidemia (0.05%, 0.1% quercetin) administered with quercetin for 6 weeks, an animal model of hyperlipidemia (0.05%, 0.1% (A), FAS (b), SREBP-2 (c), HMG-CoA (d), ABCA1 (e) and ApoA-1 . The values are expressed as mean ± standard error (n = 6). * Indicates statistical significance for the control group (* P <0.05, ** P <0.01, *** P <0.001), and # indicates statistical significance for the quercetin group (#P <0.05, P &lt; 0.01, ### P &lt; 0.001).

As shown in FIG. 7, the effect of direct administration of quercetin and the administration of nanoemulsion form on the mechanism of reducing lipid accumulation in the liver was examined, and the effect of gene therapy on mRNA expression was examined. ACC (acetyl-CoA carboxylase) is an enzyme that catalyzes the production of malonyl-CoA. FAS (fatty acid synthase) plays a role in promoting the synthesis of fatty acids from precursors of acetyl-CoA and malonyl-CoA. Thus, increased ACC and FAS activity in the liver promotes fatty acid synthesis and abrogates the synthesis of triglycerides. SREBP-2 is a transcription factor that directly activates gene expression related to the synthesis and metabolism of cholesterol and increases the expression of HMG-CoA (3-hydroxy-3-methylglutaryl-coenzyme A) Promotes cholesterol biosynthesis. In addition, ABCA1 (ATP-binding cassette transporter A1) plays an important role in the formation of HDL-cholesterol by supplying cholesterol and phospholipids to apoA-1 (apolipoprotein A-1) as a cholesterol and phospholipid receptor present in the cell membrane.

7, mRNA expression levels of ACC were decreased by 28.2%, 25.2%, and 45.0% in the group administered with 0.1% quercetin directly, 0.05% and 0.1% quercetin-containing nanoemulsion, respectively, as compared with the control group And 20.8% and 23.4%, respectively, in the group administered with 0.05% and 0.1% quercetin-containing nanoemulsion compared to the group administered with quercetin (FIG. 7A). FAS mRNA expression levels were also reduced by 34.2% and 49.5%, 60.5%, and 83.8% in the 0.05% and 0.1% quercetin-treated group and 0.05% and 0.1% quercetin-containing nanoemulsion treated groups, respectively . The groups treated with 0.05% and 0.1% quercetin-containing nanoemulsion showed significant reductions of 40% and 67.9%, respectively, compared to the group treated with quercetin (FIG. 7b).

In addition, the mRNA expression level of SREBP-2 was decreased by 29.0%, 29.6% and 40.0% in the 0.1% quercetin-treated group, 0.05% and 0.1% quercetin-containing nanoemulsion group, respectively, compared with the control group, but 0.05 There was no significant change in the group treated with% quercetin (Figure 7c). The mRNA expression level of HMG-CoA was also decreased by 27.6%, 30.2% and 36.3% in the group treated with 0.1% quercetin directly, 0.05% and 0.1% quercetin-containing nanoemulsion, respectively, There was no significant change in the group administered directly with quercetin (Fig. 7d).

On the other hand, the level of mRNA expression of ABCA1 was increased 1.7, 1.6, and 1.9 times in the 0.1% quercetin-treated group, 0.05% and 0.1% quercetin-containing nanoemulsion group, The group administered with quercetin-containing nanoemulsion showed a significant increase of 1.25-fold compared to the group administered directly with the same concentration of quercetin (Fig. 7E)

The mRNA expression levels of ApoA-1 were also increased 1.7, 1.5 and 2.1 times in the 0.1% quercetin-treated group, 0.05% and 0.1% quercetin-containing nanoemulsion group, respectively, compared with the control group. (Fig. 7F). In the group administered with quercetin-containing nanoemulsion, there was a significant increase of 1.21-fold compared with the group administered with quercetin at the same concentration (Fig. 7F). These results suggest that ingestion of quercetin in the form of nanoemulsion rather than direct ingestion effectively reduces the expression of fatty acid and cholesterol synthesis-related genes in the liver and increases the expression of HDL-cholesterol production-related genes .

Claims (18)

1) preparing quercetin, a heavy chain fatty acid ester and a sorbitan fatty acid ester to prepare a first solution in which a first emulsion is formed;
2) dissolving lecithin and hydrophilic polymer in purified water to prepare a second solution;
3) mixing the first solution with a second solution; And
3) adding a pH adjusting agent to the resultant mixture of step 3) to adjust the pH to 6.5 to 9.0. The method according to claim 1,
The nanoemulsion composition may comprise 0.1-1 wt% quercetin, 1-5 wt% heavy chain fatty acid ester, 1-5 wt% sorbitan fatty acid ester, 0.1-1 wt% lecithin, 3-6 wt% % Hydrophilic biopolymer and 80-90 wt% purified water. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt; The method according to claim 1,
Wherein the heavy chain fatty acid ester is caprylic / capric glyceride (captex 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic biodegradable polymer is sodium alginate. &Lt; / RTI &gt; The method according to claim 1,
Wherein the step 1) is carried out at 50-70 ° C for 0.5-4 hours. The method according to claim 1,
Wherein the nanoemulsion prepared in the step 3) has an average particle size of 150-250 nm and a potential difference of -55 to -45 mV. A process for producing a polyurethane foam comprising the steps of:
0.1 to 1 wt% quercetin, 1-5 wt% heavy chain fatty acid ester, 1-5 wt% sorbitan fatty acid ester, 0.1-1 wt% lecithin, 3-6 wt% hydrophilic A biopolymer and 80-90% by weight of purified water. The method according to claim 6,
Wherein the heavy chain fatty acid ester is caprylic / capric glyceride (captex 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic biodegradable polymer is sodium alginate. . The method according to claim 6,
Wherein the average particle size of the nanoemulsion formed in the nanoemulsion composition is 150-250 nm. The method according to claim 6,
Wherein the nanoemulsion formed on the nanoemulsion composition has a negative charge on the surface thereof. The method according to claim 6,
Wherein the surface potential range of the nanoemulsion formed in the nanoemulsion composition is from -55 to -45 mV. The method according to claim 6,
Wherein the nanoemulsion composition has a pH of 6.5 to 9.0. The method according to claim 6,
Wherein the nanoemulsion composition has a polydispersion index (PDI) of 0.2-0.29. The method according to claim 6,
Wherein the nanoemulsion formed in the nanoemulsion composition has a quercetin retention of 50-91% calculated by the following formula 1. &lt; EMI ID = 1.0 &gt;
[Formula 1]
Quercetin retention (%) =

A pharmaceutical composition for preventing or treating cardiovascular diseases or fatty liver comprising the nanoemulsion composition prepared by the manufacturing method of claim 1 as an active ingredient. 15. The method of claim 14,
The nanoemulsion composition is characterized in that it has an effect of suppressing the expression of genes related to decrease in lipid levels in serum and liver, decrease in expression of genes related to fatty acid and cholesterol synthesis in liver, increase in expression of HDL-cholesterol-related genes and lipid accumulation in liver Wherein the pharmaceutical composition is for preventing or treating cardiovascular diseases or fatty liver. 15. The method of claim 14,
Wherein the hyperlipidemia is any one selected from the group consisting of hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, atherosclerosis, pancreatitis, and a pharmaceutical composition for preventing or treating cardiovascular diseases or fatty liver. 15. The method of claim 14,
A pharmaceutical composition for preventing or treating hyperlipidemia or cardiovascular disease or fatty liver, wherein said composition is for oral administration. A food composition for improving or preventing cardiovascular diseases or fatty liver comprising the nanoemulsion composition prepared by the production method of claim 1 as an active ingredient.

Images