KR102393620B1 - manufacturing method of nanoemulsion composition containing quercein and nanoemulsion composition containing quercein prepared using the method - Google Patents

Abstract

The present invention relates to a nanoemulsion composition containing Quercein, which uses an emulsifier and a hydrophilic biopolymer to nanoemulsify Quercetin to maximize the stability and absorption rate of the Quercetin component, and to stimulate the intestinal tract. It has the effect of improving the stability of the body by reducing it.

Description

A method of manufacturing a nanoemulsion composition containing quercetin, and a nanoemulsion composition containing quercetin prepared through the same

The present invention relates to a nanoemulsion composition containing Quercein, and more particularly, Quercetin, which has a preventive and therapeutic effect on hyperlipidemia among flavonoid components, by nano-emulsifying and nano-particulating, thereby accommodating water It relates to a nanoemulsion composition, nanoparticles, and a method for manufacturing the same, in which the stability and body availability of the Quercetin component are increased through chemical conversion.

Quercetin (3,3',4',5,7-pentahydroxyflavone) is a kind of major flavonoid, and is the most representative substance among nearly 4,000 flavonoid components. Quercetin is abundant in foods such as red wine, onions, green tea, apples, berries, and Chinese cabbage, and it is known that it is also contained in large amounts in ginkgo leaves, St. John's wort, and American elder. In addition, Quercetin is used in many countries as a vasoprotectant, and is a substance used as a material for numerous multivitamins and herbal medicines, and the chemical formula (Formula 1) is as follows.

As described above, although Quercetin has a high value as a material for various physiologically active functional foods, the solubility in water is 0.17-7.7 μg/ml, the solubility in artificial gastric juice is 5.5 μg/ml, and the It has a remarkably low solubility of 28.9 ㎍ / ㎖ in solubility, so there is a problem that there is a big limitation in bioavailability through utilization as a food material and oral intake (Non-Patent Document 1).

In order to solve the problems (low solubility and dispersibility and bioavailability) of the quercetin, various methods such as micro-emulsion (non-patent document 1), solid lipid nanoparticles, inclusion using cyclodextrin and liposome encapsulation, etc. have been developed.

Among these methods, there is a known technique for dispersing fat-soluble quercetin in food oil and then converting it to an oil-in-water (O/W) or water-in-oil (W/O) emulsified state, but in the general food field. In the case of manufacturing particles using the emulsion method, the problem of flocculation, which causes particles to form agglomerates, and creaming, in which the mixture is kept in a separated state, and the particles are concentrated toward the surface or bottom depending on the relative density of the two systems ), as well as various problems in which particles have an unstable characteristic while accompanying physical changes such as coalescence. In addition to the above problems, there is a problem that the emulsifiers that can be used are very limited. Specifically, the emulsifiers allowed for food are very limited, and some of the allowed emulsifiers are only allowed in very low concentrations. Furthermore, among acceptable emulsifiers, soybean oil (long-chain fatty acid glycerides) is more difficult to dissolve than short-chain or medium-chain fatty acid glycerides, so even when used, the problem of low bioavailability still remains.

Non-Patent Literature 1. Gao Y., Wang Y., Ma Y., Yu A., Cai F., Shao W., Zhai G. Formulation optimization and in situ absorption in rat intestinal tract of quercetin-loaded microemulsion. Colloid Surf. B. 2009;71:306-314. doi: 10.1016/j.colsurfb.2009.03.005.

The present invention has been devised to solve the above problems, and an object of the present invention is to provide a method for preparing a homogeneous nanoemulsion composition having an average particle size of 190 to 250 nm.

The present invention has been devised to solve the above-mentioned problems, and another object of the present invention is to have excellent long-term storage, physical and chemical stability under various pH conditions, and good dispersion and solubility prepared through the above-mentioned manufacturing method. It is to provide an improved nanoemulsion composition.

In order to achieve the above object, the present invention comprises the steps of: 1) preparing a first solution in which a primary emulsion is formed by mixing Quercetin, a medium chain fatty acid ester and a sorbitan fatty acid ester; 2) preparing a second solution by dissolving lecithin and a hydrophilic polymer in purified water; 3) mixing the first solution with the second solution; and 3) adjusting the pH to 6.5 to 9.0 by adding a pH adjusting agent to the resultant mixture of step 3).

The pH adjusting agent may be a buffer or sodium hydroxide or other pH adjusting agent or a combination thereof.

Based on the total weight of the nanoemulsion composition, 0.1-1% by weight of Quercetin, 1-5% by weight medium chain fatty acid ester, 1-5% by weight of sorbitan fatty acid ester, 0.1-1% by weight of lecithin, 3-6% by weight It is characterized in that it contains a hydrophilic biopolymer and 80-90% by weight of purified water.

The medium chain fatty acid ester is caprylic/capric glyceride (captex® 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic biopolymer is sodium alginate.

Step 1) is characterized in that it is carried out at 50-70 ℃ for 0.5 to 4 hours.

In order to achieve the above-mentioned other object, the present invention is 0.1-1% by weight of Quercetin, 1-5% by weight medium chain fatty acid ester, 1-5% by weight of sorbate based on the total weight of the nanoemulsion prepared through the above preparation method It provides a nanoemulsion composition comprising a non-carbon fatty acid ester, 0.1-1% by weight of lecithin, 3-6% by weight of a hydrophilic biopolymer, and 80-90% by weight of purified water.

The medium chain fatty acid ester is caprylic/capric glyceride (captex® 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic biopolymer is sodium alginate.

The average particle size of the nanoemulsion formed in the nanoemulsion composition is characterized in that 150-250 nm.

The nanoemulsion formed on the nanoemulsion composition is characterized in that the surface has a negative charge.

The surface potential range of the nanoemulsion formed in the nanoemulsion composition is characterized in that -45 to -55 mV.

It is characterized in that the pH of the nanoemulsion composition is 6.5 to 9.0.

The nanoemulsion formed in the nanoemulsion composition is characterized in that the Quercetin retention calculated through Equation 1 below is 50-91%.

In order to achieve the above another object, the present invention provides a pharmaceutical composition for preventing or treating hyperlipidemia comprising the nanoemulsion composition prepared by the above preparation method as an active ingredient.

The nanoemulsion composition is characterized in that it has the effect of reducing body weight, reducing fat cells, and reducing the content of total cholesterol in the body.

The hyperlipidemia is characterized in that any one or more selected from the group consisting of hypercholesterolemia, complex hyperlipidemia, hypertriglyceridemia, atherosclerosis, and pancreatitis.

The composition is characterized in that it is for oral administration.

In order to achieve the another object described above, the present invention provides a food composition for improving or preventing hyperlipidemia comprising the nanoemulsion composition as an active ingredient prepared through the above preparation method.

According to the present invention, by using an emulsifier and a hydrophilic biopolymer of Quercetin to nano-emulsify, the stability and absorption rate of the Quercetin component are maximized, and the intestinal stimulatory effect is reduced, thereby improving the stability of the body.

In addition, the nanoemulsion or nanoparticles of the present invention have excellent solubility in water, and thus not only can be stored for a long period of time, but also can be prepared in powder form, so it has the advantage that it can be used in various ways as other foods.

1 is a graph showing the measurement of the holding power of the nanoemulsion prepared in Example 1 under various pH conditions (pH 6.5-9.0).
Figure 2 is a TEM photograph of the Quercetin-containing nanoemulsion of Example 1 prepared under various pH conditions.
3 is a photograph taken after storing the nanoemulsion containing Quercetin of Example 1 at room temperature (21° C.) and 37° C. for 3 months.
4 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) It is a graph showing the liver weight (a), serum AST (b) and serum ALT (c). Values are expressed as mean±standard error (n=6).
5 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) A graph showing serum triglycerides (a), total cholesterol (b), HDL-cholesterol (c), LDL-cholesterol (d), and arteriosclerosis index (e).
6 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) Total lipids (a), triglycerides (b), and total cholesterol (c) in the liver are shown. The figures are expressed as mean±standard error (n=6). * indicates statistical significance for the control group (**P<0.01, ***P <0.001), and # indicates statistical significance for the group directly administered with quercetin (#P<0.05, ## P<0.01).
7 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) The gene expression of lipid metabolism-related genes, ACC (a), FAS (b), SREBP-2 (c), HMG-CoA (d), ABCA1 (e), and ApoA-1 (f) in the liver of . The above values are expressed as mean±standard error (n=6). * indicates statistical significance for the control group (*P<0.05, **P<0.01, ***P<0.001), and # indicates statistical significance for the quercetin group (#P <0.05, ##P<0.01, ###P<0.001).
8 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with the nanoemulsion containing Quercetin of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) It is a graph showing the expression level of miR-122 in the liver. In the figure, values are expressed as mean±standard error (n=6). * Marks indicate statistical significance relative to the control group (*P<0.05, **P<0.01).

Hereinafter, the present invention will be described in detail.

One aspect of the present invention relates to a manufacturing method comprising the following steps.

1) preparing a first solution in which a primary emulsion is formed by mixing Quercetin, a medium chain fatty acid ester and a sorbitan fatty acid ester;

2) preparing a second solution by dissolving lecithin and a hydrophilic polymer in purified water;

3) mixing the first solution with the second solution; and

3) adjusting the pH to 6.5 to 9.0 by adding a pH adjusting agent to the resultant mixture of step 3).

The nanoemulsion composition in which the first solution and the second solution are mixed is 0.1-1% by weight of quercetin, 1-5% by weight of medium chain fatty acid ester, 1-5% by weight of sorbitan fatty acid ester, 0.1 based on the total weight of the composition It is preferable to include -1 wt% lecithin, 3-6 wt% hydrophilic biopolymer, and 80-90 wt% purified water, which will be described in more detail in the nanoemulsion composition to be described later. Therefore, repeated contents described in the following nanoemulsion composition will be omitted.

Step 1) is preferably carried out at 50-70 ° C. for 0.5 to 4 hours. If carried out at less than 50 ° C., sufficient bonding relationship is not formed between the components of the nanoemulsion, so the manufacturing time is reduced to 4 hours or more. A problem of lengthening occurs, and when it exceeds 70 ° C., the activity of Quercetin is reduced, or the average particle size of the nanoemulsion becomes excessively large, which may cause inconvenience during oral administration.

It is preferable to be prepared under the conditions adjusted to pH 6.5 to 9.0, and when the pH is less than 6.5 or exceeds pH 9.0, the dispersibility becomes 0.4 or more, and the size of the average particle also increases to 300 nm or more. , the surface potential difference may also increase to -10 to -20 or more.

Another aspect of the present invention is a nanoemulsion composition prepared by the above method, wherein 0.1-1% by weight of quercetin, 1-5% by weight of medium-chain fatty acid ester, and 1-5% by weight of sorbitan fatty acid based on the total weight of the composition It relates to a nanoemulsion composition comprising an ester, 0.1-1 wt% lecithin, 3-6 wt% hydrophilic biopolymer, and 80-90 wt% purified water.

More preferably, based on the total weight of the composition, 0.2-0.5% by weight of quercetin, 1-3% by weight of medium chain fatty acid ester, 1-3% by weight of sorbitan fatty acid ester, 0.1-1% by weight of lecithin, 3-6% by weight % of hydrophilic biopolymer and 85-90% by weight of purified water, and it is a nanoemulsion composition containing the nanoemulsion composition prepared according to the order and conditions of the manufacturing method. It has the effect of improving the stability of the body by reducing the irritant effect in the intestine, and has excellent solubility in water, so that it can be stored for a long time and can be used in various other foods because it can be manufactured in powder form. have an advantage

If any one of the above components is out of the range, the above-mentioned effect cannot be achieved, and further aggregation, coagulation or suspension problems occur, and when the pH conditions are changed, it is easily disintegrated and Quercetin is A leaking problem occurs. This can be confirmed through an experimental example to be described later.

Therefore, the nanoemulsion composition of the present invention is characterized in that it is prepared by the present invention, and the average particle size, dispersion and surface potential difference was significantly improved. Therefore, the nanoemulsion composition prepared by the preparation method of the present invention is superior in absorption rate through oral administration by 1.5 to 2 times or more compared to the nanoemulsion containing Quercetin prepared by the conventional preparation method.

In general, nanoemulsions are water-based emulsions, and nanoemulsions with a particle size of 100 to 200 nm are less affected by gravity than microemulsions with a particle size of 1 μm or larger. Creaming or sedimentation that affects the stability of general microemulsions does not appear much due to following There is a problem that instability appears by ripening (Ostwald ripening). In addition, emulsifiers generally used for the preparation of nanoemulsions have limitations in their use, and even if used, there is a problem that solubility is low and availability in the body is deteriorated. In order to solve this problem, in the present invention, by adjusting and mixing the content ratio of Quercetin, medium chain fatty acid ester, sorbitan fatty acid ester, lecithin, and hydrophilic raw polymer to an appropriate amount, physicochemical stability and long-term storage properties are excellent, and physiological activity is effective It is characterized in that it produces a nanoemulsion with excellent retention of ingredients and remarkably improved body availability.

In addition, the nanoemulsion composition having the above-described structure reduced the problems (intestinal stimulation effect) of the hydrophilic biopolymer, and thus the stability in vivo was significantly improved.

The nanoemulsion composition may be used in the form of a nanoemulsion that further increases stability by solvent precipitation or vacuum freeze-drying and is easily applied to other foods in the form of a powder.

Unlike simple emulsion and colloidal functional ingredient delivery systems, nanoemulsification technology uses high concentrations of fat-soluble ingredients and oil and food surfactants to provide advantages such as thermodynamic stability, simple manufacturing method, transparent liquid and low viscosity. It is a method that can prepare a nanoemulsion.

The nanoemulsion formed in the nanoemulsion composition has various advantages compared to emulsions or microemulsions, and the particle size is in the range of 5 to 300 nm, preferably 150 to 250 nm, so that it is thermodynamically stable compared to general emulsions. It shows a transparent solution state because the light dispersion is small. In addition, the nanoemulsion prepared through the content ratio completed through numerous repeated experiments according to the present invention is more stable by continuously self-associating with the hydrophilic or lipophilic part of the emulsifier and covalently covalentizing it with a surfactant, so that the average particle size of 150-250 nm is more stable. can keep In addition, in the nanoemulsion according to the present invention, gravitational acceleration and Brownian motion are remarkably reduced, so creaming or sedimentation does not occur during storage, and agglomeration does not occur, so separation does not occur in a powdery state. In addition, since the particles themselves do not deform, the occurrence of coalescence is suppressed and thus surface aggregation can be prevented.

In the nanoemulsion according to the present invention, it can be confirmed that when the content conditions are slightly different or the material is changed, the degree of dispersion, particle size, surface potential difference, and stability affecting the availability or solubility in the body are greatly reduced. In addition, there may be a problem in that the stability of the active material and the effect of increasing the availability in the body are also reduced. The nanoemulsion is most preferably prepared through the manufacturing method of the present invention as described above.

Emulsifiers are used in the production of nanoemulsions, but the types of emulsifiers that can be used in food are limited. . In the food field, the use of emulsifiers is often possible only at low concentrations. For example, in the case of propylene glycol, more than 1 g per 1 kg of food cannot be used. In consideration of this point, in the present invention, it is preferable to use sorbitan fatty acid esters, medium chain fatty acid esters and lecithin as emulsifiers. Sorbitan fatty acid esters are nonionic surfactants, and their properties and uses differ depending on the type and number of fatty acids bound to sorbitan and the degree of esterification. Commercially available sorbitan monoesters include lauric acid (Tween 20), palmitic acid (Tween 40), stearic acid (Tween 60) and oleic acid (Tween 80) that bind to sorbitan. In the present invention, in particular, Tween 80 having an HLB value of 10 to 20, a viscosity of 400-620 cps, and an average molecular weight of 1300-1320 is preferred as the emulsifier.

The exact name of the Tween 80 is polysorbate 80 or polyoxyethylene sorbitan monooleate, and CAS NO. 9005-65-6, and may be represented by the following formula (2).

[Formula 2]

Tween 20 or Tween 40 or Tween 60 is more suitable for preparing a water-in-oil (W/O) emulsion due to its chemical structure, so it is not suitable for preparing an oil-in-water (O/W) emulsion in the present invention. ) and the separation of the emulsion occurs easily, causing problems such as agglomeration, agglomeration, or formation of an emulsion of 500 nm or larger when used in the preparation of nanoemulsions.

In addition, lecithin, which can be obtained from edible oil seeds such as soybean, sunflower seed, and rapeseed oil, has an amphoteric structure containing a phospholipid composed of two fatty acids and phosphorus ester bonds in the glycerol side chain. The negatively charged phosphate group is used as an excellent emulsifier contributing to the stabilization of the emulsion particles by providing an electrostatic interaction with a repulsive force. However, when lecithin is prepared as a main component, problems such as aggregation, suspension, and precipitation, as well as problems such as aggregation, suspension, and precipitation, as well as problems of lowering of dispersibility and surface charge, are caused to form a nanoemulsion.

The medium-chain fatty acid ester refers to a substance in which three molecules of saturated or unsaturated C ₂ -C ₂₀ fatty acids and one molecule of glycerol are linked by an ester bond. For example, triacetin, tripropionin, tributyrin, trivalerin, tricaproin, tricaprylin [e.g. , Captex™ 8000 (Captex™ 8000), etc., tricaprin, triheptanoin, trinonanoin, triundecanoin, trilaurin, tritrideca Tritridecanoin, trimyristin, tripentadecanoin, tripalmitin, glyceryl triheptadecanoate, triolein and caprylic/caffeine Caprylic/Capric Triglyceride (Cas no. 65381-09-1, 73398-6`1-5) (Captex®355), etc. may be used, but preferably caprylic/capric glyceride can Because in addition to caprylic/capric glycerides, Glyceryl caprylate/caprate (capmul MCM®), PEG-6 Caprylic/Capric Glycerides (caprol) When micro express) is used, it was confirmed that the average particle size of the emulsion containing quercetin becomes excessively large to the level of the micro emulsion, or the problem of having a polydispersity index of 0.4 or more occurs.

One of the great advantages of the nanoemulsion is that it can increase the stability of the Quercetin component having a preventive or therapeutic effect on hyperlipidemia and increase the absorption efficiency in the body, as well as the activity of Quercetin in vivo through oral administration to the body organ targeted for delivery. that it can be delivered in a maintained state. The hydrophilic biopolymer for finally controlling the particle size of the nanoemulsion is preferably water-soluble. By using the water-soluble biopolymer, Quercetin can be safely delivered into the body through oral administration due to the organic binding relationship with the above components. However, it can increase absorption in the body and can be easily prepared for oral administration. The water-soluble biopolymer that can be used in the present invention may include chitosan, alginic acid, cellulose, carrageenan, gelatin, gum arabic, pectin and guar gum, but preferably sodium chitosan. If chitosan and sodium casein are used instead of sodium alginate, there is a problem in that the surface charge is significantly lowered or the size of the particles increases.

The surface of the nanoemulsion formed on the nanoemulsion composition has a negative charge. That is, since all of the nanoemulsions bearing negative charges have negative charges, the aggregation phenomenon between the nanoemulsions is significantly reduced and the dispersion degree is improved.

The preferred surface potential range of the nanoemulsion according to the present invention may be -70 to -45 mV. This is because, above -45 mV, aggregation is minimized due to electrostatic repulsion, and the efficiency of delivery of quercetin to the positively charged cell membrane can be increased. If it is outside the range of -70 to -45 mV surface potential, the above-described effect cannot be achieved, and there is a problem in that physicochemical stability is significantly lowered, such as particles are disintegrated depending on pH conditions.

It is characterized in that the pH of the nanoemulsion composition is 6.5 to 9.0, whereas a general nanoemulsion has a pH range that ensures stability is limited to a neutral range of 6.0 to 7.5, whereas the nanoemulsion according to the present invention is basic from pH 6.5 It has the advantage of being able to maintain a stable form for a long time even under pH9.0 conditions. In the present invention, storage for 3 months was confirmed, and it was confirmed that there was almost no change in particle size, dispersion degree and potential difference, so it can be seen that it can be easily stored for up to 6 months. Therefore, the nanoemulsion according to the present invention has the advantage that it can be stored at pH 6.5 to 9.0, 20 to 40 ° C., from 1 day to 12 months, preferably from 1 day to 6 months.

In addition, the nanoemulsion formed in the nanoemulsion composition according to the present invention has an advantage of having a retention power of 1.5 to 2 times or more compared to a conventional nanoemulsion, with a retention power of 50-91% calculated through Equation 1 below.

[Equation 1]

Quercetin retention (%) =

In the present invention, a nano-emulsion is prepared by dissolving quercetin, a flavonoid insoluble in water, with a medium-chain fatty acid ester and a sorbitan fatty acid ester, and coemulsifying it into a mixture of raw polymer and lecithin. In the present invention, the nanoemulsion can be prepared in a pH range of 4.5 to 9.0, preferably a nanoemulsion having a pH of 6.5 to 9.0 by adjusting the pH. When the pH of the nanoemulsion is adjusted to 4.5 to 6.0, nanoemulsion particles are not formed.

Nanoemulsion of the present invention can be recovered by solvent precipitation method such as ethanol or acetone or dried by vacuum freeze-drying method to prepare nanoparticles. This becomes possible and has the advantage that it is easier to apply to various drugs or foods. In addition, the nanoemulsion or nanoparticles of the present invention have very good solubility and thus have an advantage of being well dissolved when dispersed in water again.

Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating cardiovascular disease or fatty liver comprising the nanoemulsion composition as an active ingredient.

The present invention is a drug delivery formulation capable of delivering Quercetin in vivo, and is a pharmaceutical composition for oral administration suitable for oral administration.

The nanoemulsion composition according to the present invention has the effect of reducing serum and liver lipid levels, lowering the expression of fatty acid and cholesterol synthesis-related genes in the liver, increasing HDL-cholesterol production-related gene expression, and inhibiting the expression of genes related to lipid accumulation in the liver. All were confirmed to have Therefore, it can be effectively utilized for preventing or treating hyperlipidemia through the pharmaceutical composition according to the present invention.

The pharmaceutical composition has a preventive or therapeutic effect on cardiovascular disease or fatty liver, and specifically, the cardiovascular disease is a disease occurring in the heart and major arteries, and the cardiovascular disease of the present invention is myocardial infarction, angina, hypertension, heart failure, cardiomyopathy, primary Cardiac arrest, congestive heart disease, ischemic heart failure, arteriosclerosis, arrhythmias, coronary artery disease, stroke, ischemic heart disease (myocardial ischemia), hyperlipidemia, hypotension and peripheral vascular disease may be any one or more selected from the group consisting of, Although not, it may preferably be hyperlipidemia. In the above, "hyperlipidemia" refers to a state in which lipids such as cholesterol, triglycerides and LDL-cholesterol are abnormally high in the blood.

In addition, fatty liver refers to a state in which fat is accumulated in hepatocytes in an excessive amount due to a fatty metabolic disorder in the liver. Specifically, the fatty liver disease as defined herein may be at least one selected from the group consisting of alcoholic fatty liver, nonalcoholic fatty liver, nutrient fatty liver, starvation fatty liver, obese fatty liver and diabetic fatty liver, and preferably includes nonalcoholic fatty liver. do.

As used herein, the term "treatment" may refer to any action in which the symptoms of breast cancer are improved or beneficially changed by administration of the pharmaceutical composition.

The nanoemulsion composition has excellent solubility and greatly improved bioavailability, so that it is preferably applied for oral administration. In particular, the nanoemulsion composition of the present invention is stably solubilized by mixing an appropriate amount of quercetin, medium-chain fatty acid ester, sorbitan fatty acid ester, lecithin, and hydrophilic biopolymer to form an emulsion, and exhibits significantly increased solubility, In addition, it has very stable solubility in the intestine.

The composition of the present invention may include a pharmaceutically acceptable additive, and may be formulated into a conventional solid preparation for oral use, such as a tablet or capsule, together with these additives. For example, a mixture of the nanoemulsion and a pharmaceutically acceptable additive may be filled in a capsule to formulate a capsule. The pharmaceutically acceptable additives include, for example, diluents such as lactose, starch, microcrystalline cellulose; It may include a lubricant such as magnesium stearate and talc, but is not limited thereto. The pharmaceutically acceptable additive may be in the range of 20 to 70% by weight based on the total weight of the composition, but is not limited thereto.

The composition of the present invention is administered in a pharmaceutically effective amount.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the subject's type and severity, age, sex, and disease. It may be determined according to the type, drug activity, drug sensitivity, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, and can be easily determined by those skilled in the art.

According to a preferred embodiment of a suitable dosage of the pharmaceutical composition of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-10 g/kg.

Provided is a food composition for preventing or improving cardiovascular disease or fatty liver using the nanoemulsion composition according to the present invention as an active ingredient.

The food composition has an effect of preventing or improving cardiovascular disease or fatty liver, and specifically, the cardiovascular disease is a disease occurring in the heart and major arteries, and the cardiovascular disease of the present invention is myocardial infarction, angina, hypertension, heart failure, cardiomyopathy, primary Cardiac arrest, congestive heart disease, ischemic heart failure, arteriosclerosis, arrhythmias, coronary artery disease, stroke, ischemic heart disease (myocardial ischemia), hyperlipidemia, hypotension and peripheral vascular disease may be any one or more selected from the group consisting of, Although not, it may preferably be hyperlipidemia. In the above, "hyperlipidemia" refers to a state in which lipids such as cholesterol, triglycerides and LDL-cholesterol are abnormally high in the blood.

In addition, fatty liver refers to a state in which fat is accumulated in hepatocytes in an excessive amount due to a fatty metabolic disorder in the liver. Specifically, the fatty liver disease as defined herein may be at least one selected from the group consisting of alcoholic fatty liver, nonalcoholic fatty liver, nutrient fatty liver, starvation fatty liver, obese fatty liver and diabetic fatty liver, and preferably includes nonalcoholic fatty liver. do.

The food composition according to the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, sweets, diet bars, dairy products, meat, chocolate, pizza, ramen, other noodles, gums, ice cream, vitamin complexes, health supplements etc.

The food composition of the present invention may include not only the nanoemulsion composition as an active ingredient, but also ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. do. Examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents [taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink or beverage, the present invention may further include citric acid, high fructose, sugar, glucose, acetic acid, malic acid, fruit juice, and various plant extracts in addition to the nanoemulsion composition. there is.

The present invention provides a health functional food comprising a food composition for preventing or improving muscle weakness related diseases comprising the nanoemulsion composition as an active ingredient. Health functional food is a food prepared by adding the nanoemulsion composition to food materials such as beverages, teas, spices, gum, and confectionery, or encapsulating, powdering, suspension, etc., and has a specific health effect when consumed However, unlike general medicines, it has the advantage that there are no side effects that may occur when taking the medicine for a long period of time by using food as a raw material. The health functional food of the present invention obtained in this way is very useful because it can be ingested on a daily basis. The amount of the nanoemulsion composition added in such a health functional food varies depending on the type of health functional food and cannot be uniformly defined, but it may be added in a range that does not impair the original taste of the food, and for the target food It is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight. In addition, in the case of a health functional food in the form of pills, granules, tablets or capsules, it is usually added in an amount of 0.1 to 100% by weight, preferably 0.5 to 80% by weight. In one embodiment, the health functional food of the present invention may be in the form of a pill, tablet, capsule or beverage.

Hereinafter, the present invention will be described in detail by way of examples. However, the examples are intended to illustrate the invention, and the scope of the present invention is not limited thereby.

Examples 1 to 3. Preparation of nanoemulsion

Quercetin (Acros Organics Company (Fisher Scientific, Pittsburgh, PA, USA) (300 mg) at a concentration of 0.47 mg/g was mixed with an emulsifier (Captex® 355, capmul MCM®, caprol micro express) (Abitec Corporation, Janeville, WI, USA) was mixed at 1:10, and stirred at 150 rpm for 3 minutes, 3 g of Tween 80 was added to this mixture, and a homogenizer (Ultra-Turrax T-25, Janhke & Kunkel Gmbh and Co KG, Staufen) , Germany) at 12,000 rpm for 4 minutes.The mixture was reacted for 1-3 hours (3 hours in this experiment) while maintaining at 65° C. to prepare a first solution in which a primary emulsion was formed. 5% (w/w) sodium alginate (Sigma-Aldrich Chemical Company, St. Louis, MI, USA) solution with 1% (w/w) lecithin (IFC Solutions, Linden, NJ, USA) in the solution 15 times (94.5 g) was added and mixed at 10,000 rpm in a homogenizer for 4 minutes.Added to 0.5% content of distilled water to form the mixture, pH was adjusted in the range of 4.5 to 9.0, and stirred at room temperature at 40 rpm for 3 hours After stabilizing for 24 hours, a nanoemulsion composition was prepared, and the composition was filtered and dried using a 0.45 μm filter to obtain a nanoemulsion.

The nanoemulsion prepared using Captex® 355 as an emulsifier was Example 1, the nanoemulsion prepared using capmul MCM® was Example 2, and the nanoemulsion prepared using caprol micro express was Example 3.

Experimental Example 1. Selection of an emulsifier.

Quercetin with various oils (soybean oil, lemone oil, cinnamon oil, clove bud oil, orange oil, peppermint oil, thyhu oil, lime oil, tangerine oil, grapefruit oil, eugenol, caprol micro express, captex®355, soy lecithin, Polyethylene glycol-400, glycerol, carvacrol, capmul MCM®, castor oil, labrasol, cremophor RH40, MCT oil, Transcutol HP, Tween 80, Tween 60, Tween 40, Tween 20) were mixed, and solubility and transparency were compared. did

As a result, Tween 80, caprol micro express, soy lecithin, captex®355, and polyethylene glycol-400 were selected because the mixed solution was transparent and liquid at room temperature, and had excellent solubility in each other and mixed well.

In addition to the above oils, other oils have problems in that the solubility is poor, the mixed solution becomes opaque, or becomes a solid at room temperature.

Experimental Example 2. Transparency and solubility of Quercetin-containing primary emulsion

Quercetin and various emulsifiers were mixed as shown in Table 1 below, vortexed, and then heated at 65 ° C. for 20 minutes to homogenize for 4 minutes to prepare a nanoemulsion containing Quercetin by self-assembly it was The solubility and transparency of the prepared nanoemulsion were visually observed and shown in Table 1 below.

sample Tween 80 soy lecithin captex®355 capmul MCM® caprol micro express PEG 400 sodium alginate Quercetin
(0.47 mg/g) Solubility/Transparency One 3 g 3 g 300 mg ○/○ 2 3 g 3 g 300 mg ○/○ 3 3 g 3 g 300 mg ○/○ 4 3 g 3 g 300 mg ○/○ 5 3 g 3 g 300 mg ○/○ 6 3 g 3 g 300 mg ×/○ 7 3 g 3 g 300 mg ×/○ 8 3 g 3 g 300 mg ×/○ 9 3 g 3 g 300 mg △/○ 10 3 g 3 g 300 mg △/○ 11 3 g 3 g 3 g 450 mg △/○ 12 3 g 3 g 3 g 450 mg ×/○ 13 3 g 3 g 3 g 450 mg ×/○ 14 3 g 3 g 3 g 450 mg ×/○

○: Excellent solubility or the solution is transparent

△: Excellent solubility, but not homogeneously mixed and separated

×: not dissolved and separated or not partially dissolved

As shown in Table 1, when three or more emulsifiers are mixed and used, it was confirmed that the prepared nanoemulsion had a problem in which solubility was significantly deteriorated. In addition, it can be confirmed that the nanoemulsion prepared based on lecithin without Tween 80 also has low solubility or is separated and formed without being homogeneously mixed even if the solubility is excellent.

In conclusion, it can be seen that solubility and transparency can be improved at the same time by preparing a nanoemulsion by essentially including Tween 80, but adding various emulsifiers or hydrophilic biopolymers.

Experimental Example 3. Solubility of the primary emulsion according to the addition ratio of Tween 80

Mix 3 g of captex®355 with 300 mg of Quercetin. After vortexing for 20 minutes, Tween 80 (1 g, 2 g, 2.5 g, 3 g) was mixed to prepare a nanoemulsion, which was mixed at 70 ° C. for 1 hour, and then solubility was measured.

As a result, it was confirmed that the nanoemulsion prepared by mixing 1 to 2.5 g of Tween 80 did not dissolve properly due to low solubility, whereas the nanoemulsion prepared by mixing 3 g of Tween 80 was completely dissolved. Through these results, it can be seen that Tween 80 is preferably mixed in an amount of 3 g or more.

Experimental Example 4. Comparison of forming ability of nanoemulsions prepared using sodium casein and sodium alginate

Quercetin and various emulsifiers were mixed according to the ratio in Table 2 below and mixed at 12,000 rpm for 4 minutes. The mixture was reacted for 1 hour while maintaining at 65° C. to prepare a primary emulsion. 5% sodium caseinate (sodium caseinate) or 5% sodium alginate (sodium alginate) was added to this primary emulsion and mixed for 4 minutes at 10,000 rpm in a homogenizer. A nanoemulsion was prepared by adding the mixture to distilled water in an amount of 0.5% and stirring overnight. Among the nanoemulsions prepared above, when sodium casein was used, most of them had a problem of aggregation, coagulation, or suspension.

Among the samples, 15, 22, 27-29, and 34-36 were homogeneous, stably and well-dissolved nanoemulsions.

sample Primary emulsion (first solution) second solution Tween 80 captex®355 capmul MCM® caprol micro express PEG 400 Quercetin
(0.47 mg/g) 5% sodium caseinate 5% sodium alginate 15 3 g 3 g 300 mg 1 g 16 3 g 3 g 300 mg 1 g 17 3 g 3 g 300 mg 1 g 18 3 g 3 g 300 mg 1 g 19 3 g 300 mg 1 g 20 3 g 150 mg 0.5 g 21 3 g 150 mg 0.5 g 22 3 g 3 g 300 mg 94.5 g 23 3 g 3 g 300 mg 94.5 g 24 3 g 3 g 300 mg 94.5 g 25 3 g 3 g 300 mg 94.5 g 26 3 g 300 mg 94.5 g 27 3 g 3 g 300 mg 1 g 28 3 g 3 g 300 mg 1 g 29 3 g 3 g 300 mg 1 g 30 3 g 3 g 300 mg 1 g 31 3 g 300 mg 1 g 32 3 g 150 mg 0.5 g 33 3 g 150 mg 0.5 g 34 3 g 3 g 300 mg 94.5 g 35 3 g 3 g 300 mg 94.5 g 36 3 g 3 g 300 mg 94.5 g 37 3 g 3 g 300 mg 94.5 g 38 3 g 300 mg 94.5 g

As shown in Table 2, 0.5 g of the nanoemulsion prepared from the selected samples was dispersed in 100 ml purified water, respectively, and the particle size, polydispersity index, potential difference, and visual observation of each dispersed nanoemulsion. The measurement results are shown in Table 3.

To measure the stability of the nanoemulsion, the particle size and potential difference were measured. Particle size and potential difference were measured at 21° C. using a light-scattering particle size analyzer (Zetasizer Nano ZS, Malvern Instruments Ltd., Worecestershire, UK).

sample PS (average particle size) Polydispersity Index (PDI) ZP (potential difference) sample PS (average particle size) Polydispersity Index (PDI) ZP (potential difference) 15 162.9±0.52 0.44±0.04 -18.6±0.49 22 125.0±0.37 0.40±0.02 -22.6±1.17 27 239.7±19.5 0.35±0.04 -37.1±1.15 34 196.7±2.13 0.30±0.01 -50.4±0.52 28 1811.7±629.0 0.90±0.14 - 35 729.9±18.10 0.612±0.06 - 29 481.4±19.5 0.46±0.23 - 36 244.3±0.54 0.69±0.00 -

PS (particle size), particle size (nm); PDI (polydispersity index), polydispersity index; ZP (potential difference), zeta potential (mV)

As shown in Table 3, it was confirmed that there was a difference in the average particle size, polydispersity index, and potential difference depending on the mixing amount of sodium alginate. It was confirmed that the overall physicochemical properties of Samples 22 and 34-36 were more improved than that of Samples 15 and 27-29. Since these physicochemical properties significantly affect the absorption rate and usability of the nanoemulsion in the body, the numerical improvement of the above-mentioned degree has a significant meaning.

In addition, in the case of samples 15 and 22, the potential difference was less than -25 mV, the polydispersity index was also 0.4 or more, confirming that the dispersibility was low, and a slight aggregation phenomenon was observed when visually confirmed. Therefore, it was confirmed that an unstable emulsion was formed when sodium casein was used instead of sodium alginate as the hydrophilic biopolymer.

Furthermore, when using capmul MCM®, caprol micro express, or PEG 400 instead of a mixture of Tween 80 and captex® 355 as the emulsifier, the average particle size of the emulsion containing Quercetin becomes excessively large to the level of a micro emulsion, or polydispersion The index was also observed to have a value of 0.4 or more.

It was confirmed that when the PEG 400 was used, separation or precipitation occurred after the formation of the nanoemulsion.

Experimental Example 5. Comparison of particle size, dispersion, and potential difference of the nanoemulsion containing Quercetin according to pH.

Table 4 compares the particle size, dispersion degree, and potential difference of the nanoemulsion containing Quercetin prepared in Examples 1 to 3 according to each pH.

pH Example 1 Example 2 Example 3 Room temperature (21°C) Room temperature (21°C) Room temperature (21°C) PS PDI ZP PS PDI ZP PS PDI ZP 6.5 227.9±1.2 0.292±0.2 -46.5±0.1 1548±11.2 0.943±0.1 - 501.2±8.8 0.584±0.4 - 7.0 1996±0.6 0.239±0.03 -49.2±0.3 2670±23.02 1.0±0.1 - 2214±11.3 1.0±0.08 - 7.5 198.6±1.4 0.23±0.8 -47.7±0.4 936.7±9.6 0.685±0.06 - 244.6±0.5 0.689±0.01 - 8.0 196.3±0.7 0.253±0.2 -51.0±1.0 724.4±28.8 0.137±0.7 - 251.7±0.5 0.719±0.7 - 8.5 197.0±0.8 0.245±0.07 -52.6±0.4 450.9±1.5 0.692±0.4 - 194.0±4.5 1.0±0.2 - 9.0 198.0±0.7 0.259±0.04 -53.8±0.1 936.1±10.3 0.669±0.03 - 258.0±1.7 0.732±0.01 -

As shown in Table 4, the Quercetin-containing nanoemulsion of Example 1 has an average particle size of 150 to 250 nm under various pH conditions (6.5 to 9.0) and excellent dispersion of less than 0.3 and -45 to -70 mV It was confirmed that the potential difference was shown. When preparing the nanoemulsion containing Quercetin of Preparation Example 1 under the conditions of pH less than 6.5, since the problem of the formation of a precipitate occurs, it is preferable that the pH is 6.5 to 9.0 during production.

In addition, when using capmul MCM® and caprol micro express rather than a mixture of Tween 80 and captex® 355 as emulsifiers, the average particle size of the emulsion containing Quercetin becomes excessively large or non-uniform. In addition, the polydispersity index was observed to have a value of 0.4 or more. That is, in the preparation of the primary emulsion, it is preferable to use Tween 80 and captex®355, and then, to prepare by adding 5% sodium alginate solution containing % content of lecithin, solubility, transparency, dispersibility, potential difference and It is preferable in terms of particle size. If any one of these conditions is out of the conditions, the particle size, dispersion degree and potential difference do not satisfy the above criteria, and precipitate, aggregate, or suspend, so that when used as a food or drug, the absorption rate in the body, the pharmacological effect of Quercetin, etc. are significantly reduced A problem arises.

Experimental Example 5. Evaluation of the formation of nanoemulsion when a mixed solution of sodium casein and lecithin was used as the second solution

When lecithin was added to sodium caseinate, in forming an emulsion, the average particle size was 300 nm or more, the dispersion was 0.65 to 0.7, indicating a very unstable dispersion state, and the potential difference was also very high as -4 to -8 mV. has occurred. That is, it can be seen that when a mixture of sodium caseinate and lecithin is used as the second solution, it is not helpful at all to form a nanoemulsion.

Experimental Example 6. Measurement of holding capacity of Quercetin-containing nanoemulsion

For the measurement of the Quercetin retention capacity of the Quercetin-containing nanoemulsion, the nanoemulsion prepared in Example 1 under various pH conditions (pH 6.5-9.0) was centrifuged twice at 4,000 rpm for 10 minutes, after which the query not covered by the nanoemulsion was repeated. After removing cetin and filtering the supernatant through a filtration membrane having a size of 0.45 μm to obtain a precipitate, it was dissolved in methanol, and the contained quercetin content was analyzed by HPLC. At this time, the Quercetin retention capacity (%) of the Quercetin-containing nanoemulsion was calculated as follows.

[Equation 1]

Quercetin retention (%) =

1 is a graph showing the measurement of the holding power of the nanoemulsion prepared in Example 1 under various pH conditions (pH 6.5-9.0).

As shown in FIG. 1, the Quercetin retention of the nanoemulsion containing Quercetin prepared in the pH range of 6.5-9.0 was in the range of 50-91%, and when the pH was adjusted in the range of 8.0-9.0, the retention power was 90%, indicating the maximum value. it was

Experimental Example 7. Transmission Electron Microscopy (TEM) Measurement of Quercetin-Containing Nanoemulsion

Transmission electron microscopy measurement of the Quercetin-containing nanoemulsion was performed by fixing 7 μl of the Quercetin-containing nanoemulsion on a carbon-coated copper grid for negative staining, washing once with ultrapure water, and immediately adding 7 μl of 2% uranyl acetate to staining. and washed with ultrapure water and dried in air. The prepared specimen was photographed with an accelerated electron beam of 200 kV to obtain a transmission electron microscope picture, and the results are shown in FIG. 2 . The particle shape of the Quercetin-containing nanoemulsion was observed to be circular, and the size ranged from 197 to 328 nm (FIG. 2).

Experimental Example 8. Measurement of storage stability of Quercetin-containing nanoemulsion

The storage stability of the Quercetin-containing nanoemulsion of Example 1 was measured by methods such as particle size, polydispersity index, potential difference and visual observation while stored at room temperature (21°C) and 37°C incubator for 3 months. and the state of the nanoemulsion containing Quercetin after storage at room temperature (21°C) and 37°C for 3 months is shown in FIG. The particle size of the Quercetin-containing nanoemulsion during storage at room temperature (21° C.) was slightly increased in the range of 201-224 nm during storage for 3 months from immediately after preparation when the pH was adjusted to 6.5 immediately after preparation, and adjusted to pH 7.0 In one case, stable results were shown in the range of 191-197 nm. 190-197 nm when adjusted to pH 7.5, 194-198 nm when adjusted to pH 8.0, 188-199 nm when adjusted to pH 8.5, and 185-198 nm when adjusted to pH 9.0 and maintained a stable state. On the other hand, when stored at 37 ° C., a stable nanoemulsion was formed at 180-197 nm over the pH control range of 6.5-9.0.

The polydispersity index during storage of the Quercetin-containing nanoemulsion shows a range of 0.2-0.29 regardless of the pH control range during the storage period of 3 months from immediately after preparation at room temperature and 37 ° C. was formed. The potential difference value showed a value in the range of -44 to -70 mV in the pH range of 6.5-9.0 for 3 months storage period from immediately after preparation at room temperature and 37°C storage conditions, so that the nanoemulsion cambium was stably maintained.

pH immediately after manufacturing 1 month 2 months 3 months Room temperature (21°C) Room temperature (21°C) 37℃ Room temperature (21°C) 37℃ Room temperature (21°C) 37℃ PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP PS PDI ZP 6.5 201 0.30 -47.2 203 0.31 -44.3 180 0.22 -48.5 204 0.25 -51.5 187 0.20 -63.2 224 0.31 -53.3 191 0.19 -61.7 7.0 197 0.24 -50.4 197 0.23 -42.9 184 0.20 -49.0 199 0.22 -58.2 188 0.20 -62.7 205 0.23 -58.1 191 0.20 -60.1 7.5 197 0.28 -48.1 198 0.22 -47.0 185 0.21 -50.2 194 0.20 -57.5 190 0.21 -62.0 212 0.29 -65.6 193 0.19 -63.2 8.0 194 0.25 -51.0 197 0.30 -44.6 197 0.21 -41.0 198 0.24 -55.8 198 0.18 -45.9 198 0.24 -58.2 197 0.25 -45.8 8.5 199 0.25 -53.3 197 0.24 -57.4 188 0.20 -49.8 196 0.21 -67.4 192 0.20 -62.0 198 0.40 -63.5 194 0.22 -60.8 9.0 197 0.26 -55.8 198 0.22 -53.2 185 0.21 -52.2 200 0.24 -66.2 193 0.20 -61.7 198 0.22 -69.1 195 0.20 -62.7

PS (particle size), particle size (nm); PDI (polydispersity index), polydispersity index; ZP (potential difference), zeta potential (mV)

Experimental Example 9. Efficacy evaluation for hyperlipidemia animal model

1) Breeding and diet of laboratory animals

Four-week-old C57BL/6J male mice (Doo Yeol Biotech, Seoul, Korea) were pre-bred in an animal breeding room (22±1℃, relative humidity 55±5%, 12 hours light/dark cycle) for 1 week. Afterwards, by the egg mass method, the high-cholesterol diet control group, the Quercetin group (0.05%, 0.1%) and the Quercetin-containing nanoemulsion group (0.05%, 0.1%) were divided into 5 groups by the egg mass method, and the experimental diet was administered for a total of 6 weeks. supplied.

The control group was supplied with only a high cholesterol diet, and the Quercetin group (0.05%, 0.1%) was supplied with a high cholesterol diet containing either 0.05% or 0.1% of Quercetin (a single compound not a nanoemulsion). In addition, the Quercetin-containing nanoemulsion group (0.05%, 0.1%) was supplied with a high cholesterol diet containing 0.05% or 0.1% of Quercetin-containing nanoemulsion (Example 1). In the hypercholesterol diet-induced hyperlipidemia model, an experimental diet was prepared and supplied based on the dietary composition of AIN-76 (Table 6). Experimental diet and water were freely ingested during the entire breeding period, and the body weight and food intake of the experimental animals were measured twice a week. All animal experiments were carried out according to regulations after obtaining approval from the Institutional Animal Care and Use Committee (IACUC) of Ewha Womans University (Approval No. 16-047).

In Table 6, the experimental sample is Quercetin (a single compound, not a nanoemulsion) in the Quercetin group (0.05%, 0.1%), and Quercetin-containing nanoemulsion group (0.05%, 0.1%) in the Quercetin-containing nanoemulsion means do. That is, it can be seen that the amount of Quercetin supplied to the hyperlipidemia animal model is significantly smaller than that of the Quercetin group because the Quercetin-containing nanoemulsion group was administered based on the weight of the nanoemulsion. Despite this, according to the experimental results to be described later, a significantly improved pharmacological effect was confirmed in the group administered with the Quercetin-containing nanoemulsion, and considering the amount of Quercetin actually administered, the group directly administered with Quercetin (quercetin group) It can be seen that the nanoemulsion containing more Quercetin exhibits a difference in effect of more than 2 times despite containing less than 20 times less Quercetin.

Ingredients control Quercetin Quercetin-containing nanoemulsion (Example 1) 0.05% 0.1% 0.05% 0.1% corn starch 150.0 150.0 150.0 150.0 150.0 Casein 200.0 200.0 200.0 200.0 200.0 Sucrose 485.0 484.5 484.0 484.0 484.0 Corn oil 50.0 50.0 50.0 50.0 50.0 Cellulose 50.0 50.0 50.0 50.0 50.0 Mineral mix ^{2 )} 35.0 35.0 35.0 35.0 35.0 Vitamin mix ^{3 )} 10.0 10.0 10.0 10.0 10.0 DL-Methionine 3.0 3.0 3.0 3.0 3.0 Choline bitartrate 2.0 2.0 2.0 2.0 2.0 test sample 0.0 0.5 1.0 0.5 1.0 Cholesterol 10.0 10.0 10.0 10.0 10.0 Cholic acid 5.0 5.0 5.0 5.0 5.0 gross weight 1000 1000 1000 1000 1000 Total calories (kcal) 3579.7 3579.3 3577.9 3576.1 3572.5 Carbohydrates (% as kcal) 67.1 67.1 67.1 67.1 67.0 Protein (% as kcal) 20.3 20.3 20.3 20.4 20.4 Fat (% as kcal) 12.6 12.6 12.6 12.6 12.6

¹⁾ AIN-76 is based on dietary composition.

²⁾ AIN-76 Mineral mix (mg/kg diet)

³⁾ AIN-76 Vitamin mix (mg/kg diet)

2) Collection and processing of samples

After the experiment was completed, a total of 5 groups of hyperlipidemia animal models prepared in the process of 1) were anesthetized after fasting for 12 hours or more. After blood was collected from the heart, it was centrifuged at 2,800 rpm and 4°C for 20 minutes, and serum was separated and stored at -20°C until analysis. Laparotomy livers were washed with refrigerated physiological saline, weighed, and then rapidly frozen in liquid nitrogen and stored in a deep freezer at -70 °C.

3) Measurement of serum lipids and biochemical indicators

Serum triglycerides, total cholesterol. HDL-Cholesterol. Aspartate aminotransferae (AST) and alanine aminotransferase (ALT) were measured using a commercial kit (Asan Pharmaceutical, Seoul, Korea). LDL-cholesterol concentration was obtained using Friedewald's formula (Friedewald WT, Levey RI. Estimation of the concentration of lowdensity lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18:499-502.), Atherogenic index (AI) was calculated by the following formula by Inkeles et al. (Inkeles S, Eisenberg D. Hyperlipidemia and coronary atherosclerosis. Medicine (Baltimore) 1981;60:110-123.).

LDL-Cholesterol = Total Cholesterol-HDL-Cholesterol-[triglyceride/5]

Arteriosclerosis Index = (Total Cholesterol-HDL-Cholesterol)/HDL-Cholesterol

4) Measurement of lipids in the liver

Intrahepatic lipid extraction was performed according to the method of Bligh and Dyer (Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959;37:911-917.). After the liver tissue was homogenized by adding 1.5 ml of saline, 7.5 ml of 1/2 (v/v) chloroform/methanol solution was added and left at room temperature for 30 minutes. After adding 2.5 ml of chloroform and centrifuging at 3,000 rpm for 20 minutes, 10 g of sodium sulfate (anhydrous) was added to the lower layer and filtered through filter paper (No. 6, UK) to collect the filtrate and evaporated to extract the lipids. did The concentrations of triglycerides and total cholesterol were measured using a commercial kit (Asan Pharmaceutical) using an enzyme colorimetric method.

5) mRNA quantification through real-time quantitative PCR

Total RNA in the liver was extracted using Trizol (Invitrogen, Carlsbad, USA). For cDNA synthesis from total RNA for mRNA quantification, M-MLV Reverse Transcriptase (Bioneer Co., Daejeon, Korea) was used, and the synthesized cDNA was amplified using AccuPower® 2X GreenStar™ qPCR Master Mix (Bioneer Co.). The primer sequences used for quantification of specific mRNA are shown in Table 7. Fluorescence measurement for quantitative analysis was measured every PCR cycle using Rotor-Gene RG-3000A (Corbett Research, Sydney, Australia), and relative quantification of gene expression was performed using the delta-delta Ct method (Livak). KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method Method. Methods 2001;25:402-408.).

gene GeneBank No. Primer sequence (5-3) ABCA1 NM_013454 F: ACGCTGTACCTGCCCTATGT R: GCTCCTCGAAAAGGGCGAAA ACC AY451393 F: CAAGTGCTCAAGTTTGGCGC R: CAAGAACCACCCCGAAGCTC ApoA-1 NM_009692 F: TATGGCAGCAAGATGAACCC R: CCAGGAGATTCAGGTTCAGC β-actin NM_007393 F: GGACCTGACAGACTACCTCA R: GTTGCCAATAGTGATGACCT FAS AF127033 F: CTGGCATTCGTGATGGAGTC R: TGTTTCCCCTGAGCCATGTA HMG-CoA M62766 F: GCACCATGCCATCGATAGAG R: GACAGCTCACCAGCCATCAC SREBP-2 NM_033218 F: ACTGAAGTAGAGCGGGTCCC R: AAGTAGTGCCGCTGACGTTG

6) Statistical analysis

All experimental results were analyzed using SPSS 21.0 (IBM Corporation, Armonk, NY, USA). It was tested by one-way analysis of variance and expressed as mean and standard error, and significance was verified at P<0.05 level according to Tukey's multiple range test.

7) Conclusion

This study compared the lipid-lowering effect when directly administered with Quercetin and administered in the form of a nanoemulsion containing Quercetin using a high-cholesterol diet-induced hyperlipidemia mouse as an animal model. When Quercetin is ingested in the form of a nanoemulsion, it effectively reduces serum and liver lipid levels, reduces fatty acid and cholesterol synthesis-related gene expression in the liver, as well as HDL-cholesterol production, compared to when Quercetin is directly ingested. It was confirmed to increase gene expression.

Specifically, as a result of comparing the increase in insecticide, dietary intake, and dietary efficiency of the group administered directly with the group administered with Quercetin and the group administered in the form of a nanoemulsion, the results are shown in Table 8 (experimental diet was carried out for 6 weeks). As shown in Table 8, there was no significant difference in the initial body weight, final body weight, weight gain, dietary intake and dietary efficiency among all groups. Through these results, it can be seen that the direct administration of 0.05% and 0.1% of Quercetin and the administration of the nanoemulsion containing 0.05% and 0.1% of Quercetin do not affect body weight, dietary intake and dietary efficiency.

control Quercetin Quercetin-containing nanoemulsion 0.05% 0.1% 0.05% 0.1% Initial weight (g) 21.34±0.29 21.34±0.29 21.37±0.26 21.34±0.26 21.33±0.21 final weight (g) 25.15±0.15 24.71±0.16 24.41±0.34 24.25±0.39 24.12±0.48 Weight gain (g/day) 0.09±0.01 0.08±0.01 0.07±0.01 0.07±0.01 0.07±0.01 Dietary intake (g/day) 4.74±0.08 4.62±0.11 4.64±0.10 4.75±0.06 4.64±0.12 Dietary efficiency ¹⁾ (g gain/kcal consumed) 0.019±
0.002 0.017±
0.002 0.016±
0.002 0.015±
0.002 0.015±
0.002

In the table above, values are expressed as mean±standard error (n=6).

¹⁾ Dietary efficiency = weight gain (g) / food intake (g)

In addition, in order to measure the dietary safety of the group administered directly with Quercetin and the group administered with the Quercetin-containing nanoemulsion, the liver weight and AST and ALT activity of the animal models in each group were investigated. 4 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) It is a graph showing the liver weight (a), serum AST (b) and serum ALT (c). Values are expressed as mean±standard error (n=6).

As shown in FIG. 4 , there was no significant difference in the liver weights of each group ( FIG. 4a ), and there was no significant difference between the AST and ALT levels in the serum, which were released in large amounts into the blood when liver harm occurred. (Fig. 4b, c). Therefore, it can be confirmed that both the case of administering the Quercetin containing 0.05% and 0.1% and the administration of the Quercetin-containing nanoemulsion are not harmful to the experimental animals.

5 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) A graph showing serum triglycerides (a), total cholesterol (b), HDL-cholesterol (c), LDL-cholesterol (d), and arteriosclerosis index (e).

The above values are expressed as mean±standard error (n=6). * indicates statistical significance for the control group (*P<0.05, **P<0.01, ***P <0.001), and # indicates statistical significance for the group directly administered with quercetin (# P<0.05, ##P<0.01).

As shown in Figure 5, the serum triglyceride content was decreased by 27.9% and 34.8%, respectively, in the hyperlipidemia animal model (0.05%, 0.1% nano-quercetin) administered with the nanoemulsion containing Quercetin of Example 1 for 6 weeks compared to the control group. , There was no significant difference in the hyperlipidemia animal model (0.05%, 0.1% Quercetin) administered with Quercetin for 6 weeks. Total cholesterol was decreased by 12.1%, 10.7%, and 18.2%, respectively, in the group administered with 0.1% Quercetin directly, 0.05% and 0.1% Quercetin-containing nanoemulsion compared to the control group, and decreased by 0.05% Quebec There was no significant change in the group to which cetin was directly administered.

HDL-cholesterol was increased by 13.5% and 20.7%, respectively, in the group administered with the nanoemulsion containing 0.05% and 0.1% Quercetin compared to the control group, and in the group administered with the nanoemulsion containing 0.1% Quercetin, the same concentration of Quercetin was directly administered It showed a 12.6% significant increase compared to the administered group (Fig. c). LDL-cholesterol was decreased by 19.4%, 19.6% and 33.5%, respectively, in the group administered with 0.1% Quercetin directly, 0.05% and 0.1% Quercetin-containing nanoemulsion compared to the control group, and 0.1% Quercetin-containing nano In the group administered with the emulsion, a significant decrease of 17.5% was shown compared to the group administered directly with the same concentration of quercetin (FIG. 5d). Atherosclerosis index also showed a similar trend. Specifically, there was a significant difference in the group (24.0%) administered directly with 0.1% Quercetin, the group administered with the nanoemulsion containing 0.05% Quercetin (29.6%), and the group administered with the nanoemulsion containing 0.1% Quercetin (45.0%). showed a difference. In the group administered with the 0.1% Quercetin-containing nanoemulsion, compared with the group administered directly with the same concentration of Quercetin, the result was significantly reduced by 27.6% (FIG. 5e). Based on these results, it could be confirmed that the group administered with the Quercetin-containing nanoemulsion more effectively reduced the serum lipid level compared to the group administered directly with Quercetin.

6 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) Total lipids (a), triglycerides (b), and total cholesterol (c) in the liver are shown. The above values are expressed as mean±standard error (n=6). * indicates statistical significance for the control group (**P<0.01, ***P <0.001), and # indicates statistical significance for the group directly administered with quercetin (#P<0.05, ## P<0.01).

As shown in FIG. 6 , the total lipid content in the liver was 10.4%, 16.0% and 42.0% in the group administered directly with 0.1% Quercetin, 0.05% and 0.1% Quercetin-containing nanoemulsion compared to the control group, respectively. In the group administered with the nanoemulsion containing 0.1% Quercetin, compared to the group administered directly with the same concentration of Quercetin, the result was significantly reduced by 35.2%. The triglyceride content in the liver was reduced by 30.6% and 58.6%, and 56.8% and 65.2%, respectively, in the group administered with 0.05% and 0.1% Quercetin and the group administered with the nanoemulsion containing 0.05% and 0.1% Quercetin, respectively, compared to the control group. In the group administered with the nanoemulsion containing 0.05% Quercetin, compared with the group administered directly with the same concentration of Quercetin, the result was significantly reduced by 37.6% (FIG. 6b). The total cholesterol content in the liver was compared to the control group administered directly with 0.1% Quercetin (20.0%), the group administered with the nanoemulsion containing 0.05% Quercetin (17.7%), and the group administered with the nanoemulsion containing 0.1% Quercetin (27.5%) showed a significantly reduced result, there was no significant change in the group directly administered 0.05% Quercetin (Fig. 6c). These results suggest that ingestion of the nanoemulsion containing Quercetin can reduce the lipid level in the liver more effectively than ingestion of Quercetin.

7 is a hyperlipidemia animal model administered with Quercetin for 6 weeks (0.05%, 0.1% Quercetin), a hyperlipidemia animal model administered with Quercetin-containing nanoemulsion of Example 1 for 6 weeks (0.05%, 0.1% Nano Quercetin) The gene expression of lipid metabolism-related genes, ACC (a), FAS (b), SREBP-2 (c), HMG-CoA (d), ABCA1 (e), and ApoA-1 (f) in the liver of . The above values are expressed as mean±standard error (n=6). * indicates statistical significance for the control group (*P<0.05, **P<0.01, ***P <0.001), and # indicates statistical significance for the quercetin group (#P <0.05, ##P<0.01, ###P<0.001).

As shown in Figure 7, direct administration of Quercetin and administration in the form of a nanoemulsion looked at the effect on the mechanism of reducing lipid accumulation in the liver, or the effect on the mRNA expression of related genes was investigated. ACC (acetyl-CoA carboxylase) is an enzyme that catalyzes the production of malonyl-CoA, and FAS (fatty acid synthase) plays a role in promoting fatty acid synthesis from the precursors of acetyl-CoA and malonyl-CoA. Therefore, the increase in ACC and FAS activity in the liver promotes fatty acid synthesis and increases the synthesis of triglycerides. SREBP-2 (sterol regulatory element-binding protein 2) is a transcription factor that directly activates the expression of genes involved in cholesterol synthesis and metabolism, and increases HMG-CoA (3-hydroxy-3-methylglutaryl-coenzyme A) expression. Promotes cholesterol biosynthesis. In addition, ABCA1 (ATP-binding cassette transporter A1) plays an important role in the formation of HDL-cholesterol by supplying cholesterol and phospholipids to apoA-1 (apolipoprotein A-1) as a cholesterol and phospholipid receptor present in the cell membrane.

Referring to Figure 7, the mRNA expression level of ACC is 28.2%, 25.2% and 45.0% in the group administered directly with 0.1% Quercetin, 0.05% and 0.1% Quercetin-containing nanoemulsion compared to the control group, respectively. It was found, and it was confirmed that the group administered with the nanoemulsion containing 0.05% and 0.1% Quercetin significantly reduced the results by 20.8% and 23.4%, respectively, compared to the group administered directly with Quercetin (FIG. 7a). The mRNA expression level of FAS also decreased by 34.2% and 49.5% and 60.5% and 83.8% in the group administered directly with 0.05% and 0.1% Quercetin and the group administered with the nanoemulsion containing 0.05% and 0.1% Quercetin, respectively, compared to the control group. showed results. The group administered with the nanoemulsion containing 0.05% and 0.1% Quercetin showed significant reductions of 40% and 67.9%, respectively, compared to the group administered directly with Quercetin (FIG. 7b).

In addition, the mRNA expression level of SREBP-2 was decreased by 29.0%, 29.6%, and 40.0% in the group administered directly with 0.1% Quercetin, 0.05% and 0.1% Quercetin-containing nanoemulsion, respectively, compared to the control group, but decreased by 0.05 There was no significant change in the group directly administered with % Quercetin (FIG. 7c). The mRNA expression level of HMG-CoA also decreased by 27.6%, 30.2% and 36.3%, respectively, in the group administered with 0.1% Quercetin, 0.05% and 0.1% Quercetin-containing nanoemulsion compared to the control group, respectively, decreased by 0.05% It was found that there was no significant change in the group directly administered with Quercetin (Fig. 7d).

On the other hand, the mRNA expression level of ABCA1 increased 1.7-fold, 1.6-fold, and 1.9-fold in the group administered directly with 0.1% Quercetin, and the group administered with 0.05% and 0.1% Quercetin-containing nanoemulsion, respectively, compared to the control group, and 0.05% The group administered with the Quercetin-containing nanoemulsion showed a 1.25-fold significant increase compared to the group administered directly with the same concentration of Quercetin (Fig. 7e)

The mRNA expression level of ApoA-1 also increased by 1.7-fold, 1.5-fold and 2.1-fold in the group administered directly with 0.1% Quercetin, 0.05% and 0.1% Quercetin-containing nanoemulsion, respectively, compared to the control group, increased by 0.1% In the group administered with the Quercetin-containing nanoemulsion, compared to the group administered directly with the same concentration of Quercetin, the result was significantly increased by 1.21 times (FIG. 7f). Judging from these results, ingestion of Quercetin in the form of a nanoemulsion rather than direct intake effectively reduces the expression of fatty acid and cholesterol synthesis-related genes in the liver, as well as increases the expression of HDL-cholesterol production-related genes. It is known to do

Claims (18)

1) preparing a first solution in which a first emulsion is formed by mixing a quercetin solution at a concentration of 0.47 mg/g, a medium chain fatty acid ester, and a sorbitan fatty acid ester in a weight ratio of 0.1: 1: 1;
2) preparing a second solution in which 1 wt% lecithin, 5 wt% hydrophilic polymer, and the remainder of purified water are mixed;
3) mixing the first solution with the second solution; and
4) adjusting the pH to 6.5 to 9.0 by adding a pH adjuster to the resultant mixture of step 3);
The medium chain fatty acid ester is caprylic/capric glyceride (captex® 355), the sorbitan fatty acid ester is polysorbate 80, and the hydrophilic polymer is sodium alginate. manufacturing method. delete delete According to claim 1,
Step 1) is a method for producing a nanoemulsion composition, characterized in that it is carried out at 50-70 ℃ for 0.5 to 4 hours. According to claim 1,
The nanoemulsion prepared through step 3) has an average particle size of 150-250 nm and a potential difference of -55 to -45 mV. A nanoemulsion composition comprising a nanoemulsion having an average particle size of 150-250 nm, characterized in that it is prepared by the method of claim 1 . delete delete 7. The method of claim 6,
Nanoemulsion composition, characterized in that the surface of the nanoemulsion contained in the nanoemulsion composition has a negative charge. 7. The method of claim 6,
The nanoemulsion composition, characterized in that the surface potential range of the nanoemulsion contained in the nanoemulsion composition is -55 to -45 mV. 7. The method of claim 6,
Nanoemulsion composition, characterized in that the pH of the nanoemulsion composition is 6.5 to 9.0. 7. The method of claim 6,
Nanoemulsion composition, characterized in that the polydispersity index (PDI) of the nanoemulsion contained in the nanoemulsion composition is 0.2-0.29. 7. The method of claim 6,
The nanoemulsion contained in the nanoemulsion composition is a nanoemulsion composition, characterized in that 50-91% of the Quercetin retention calculated through Equation 1 below.
[Equation 1]
Quercetin retention (%) =

A pharmaceutical composition for preventing or treating hyperlipidemia or fatty liver comprising the nanoemulsion composition prepared by the method of claim 1 as an active ingredient. 15. The method of claim 14,
The nanoemulsion composition has the effect of suppressing the expression of genes related to the accumulation of lipids in the liver, reducing the level of lipids in serum and liver, lowering the expression of genes related to fatty acid and cholesterol synthesis in the liver, increasing the expression of genes related to HDL-cholesterol production, and A pharmaceutical composition for preventing or treating hyperlipidemia or fatty liver. 15. The method of claim 14,
The hyperlipidemia is any one or more selected from the group consisting of hypercholesterolemia, complex hyperlipidemia and hypertriglyceridemia,
The fatty liver is a pharmaceutical composition for preventing or treating hyperlipidemia or fatty liver, characterized in that at least one selected from the group consisting of alcoholic fatty liver, non-alcoholic fatty liver, nutrient fatty liver, starvation fatty liver, obese fatty liver and diabetic fatty liver. 15. The method of claim 14,
The composition is a pharmaceutical composition for preventing or treating hyperlipidemia or fatty liver, characterized in that it is for oral administration. A health functional food composition for improving or preventing hyperlipidemia or fatty liver comprising the nanoemulsion composition prepared by the method of claim 1 as an active ingredient.

Images