KR20190001523A - Composition for preventing or treating of muscular dystrophy comprising Per-butanoylated N-acetyl-D-mannosamine - Google Patents

Abstract

The present invention provides a pharmacological composition for prevention or treatment of muscular dystrophy (MD) comprising per-butanoylated N-acetyl-D-mannosamine (Bu4ManNAc) or pharmacologically allowable salt thereof. According to the present invention, the Bu4ManNAc restricts inflammation and fibrosis of a muscle cell in a cell line and a mouse model, and reduces muscular obesity and muscular damage to be utilized for treatment of MD.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a composition for prevention or treatment of intramuscular dystrophy comprising per-butanoylated N-acetyl-D-mannosamine.

The present invention relates to a pharmaceutical composition for the prevention or treatment of muscular dystrophy (MD) having an effect of inhibiting muscle fibrosis and inflammation.

Muscular dystrophies (MDs) are hereditary diseases characterized by gradual muscular degeneration. Until now, various types of muscular stapes have been identified, ranging from mild muscle weakness to severe exercise and cognitive disorders.

Muscle weakness is mostly caused by the formation of chronic inflammation and fibrotic tissue, which progressively impedes the body's ability to regenerate damaged muscles by attaching damaged muscle fibers to extracellular matrix.

The most common form of Duchenne muscular dystrophy (DMD) is the rapid progression of muscle degeneration, resulting in wheelchair users from adolescence. In addition, most patients do not survive until the early 20s because their heart and diaphragm are weakened. The Duchen-type intact stropy is characterized by a recessive or mutation in the gene encoding dystrophin, and the loss of dystrophin impairs the connectivity of the sarcolemma in the skeletal muscle with the surrounding extracellular matrix, leading to chronic muscle damage, inflammation And fibrosis.

Although a variety of pathway studies have been conducted to improve or treat myofascial stiffness, there has been no treatment for Duchen-type staphylococci, and cell and gene therapy-based techniques are under development, but the drug delivery method and potential side effects As well. Therefore, it is necessary to develop medicines to treat inflammation and fibrosis, which are pathological features of Duchene type muscular stropy.

Korean Patent Publication No. 10-2016-0026855

SUMMARY OF THE INVENTION The present invention relates to a method for the treatment of muscular dystrophy comprising per-butanoylated N-acetyl-D-mannosamine (Bu4ManNAc) or a pharmaceutically acceptable salt thereof, , ≪ / RTI > MD).

Another object of the present invention is to provide a method for preventing or improving muscular dystrophy (MD) comprising per-butanoylated N-acetyl-D-mannosamine or a pharmaceutically acceptable salt thereof, To provide a food composition.

It is another object of the present invention to provide a method for preventing or ameliorating muscular dystrophy (MD) comprising per-butanoylated N-acetyl-D-mannosamine or a pharmaceutically acceptable salt thereof, And to provide a quasi-quasi-product composition.

In order to attain the above object, the present invention provides a pharmaceutical composition comprising per-butanoylated N-acetyl-D-mannosamine (Bu4ManNAc) represented by the following general formula (1) Or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the prevention or treatment of muscular dystrophy (MD) disease.

[Chemical Formula 1]

The term " per-butanoylated N-acetyl-D-mannosamine (Bu4ManNAc) " in the present invention refers to N-acetyl- mannosamine, ManNAc) is a short chain fatty acid hexosamine (SCFAH) in which all -OH groups are substituted with butyrate groups. Specifically, N-aceto-D-mannosamine (ManNAc ) And anhydrous butyric anhydride (Bu4ManNAc).

In the present invention, " muscular dystrophy (MD) " is also referred to as muscle regression atrophy, and is associated with a chronic hereditary disease group with skeletal muscle degeneration without associated with the central nervous system and peripheral nervous system and exhibiting muscle weakness, It is a name. It is characterized by pseudohypertrophy, in which the muscles are replaced by fat or connective tissue due to the degeneration of specific muscles, and symmetrical muscle atrophy, which is progressive. Pathologically, it is characterized by necrosis (damage) and fibrosis of muscle fibers. Specifically, it is known that the dystrophin-glycoprotein complex is formed by the reduction of a specific protein existing in the muscle cell membrane such as dystrophin due to a mutation of a gene such as a dystrophin gene involved in the stability of muscle cell membrane Therefore, it is known that myocardial necrosis or degeneration of muscular fibers results in muscle weakness and atrophy.

According to the degree of muscle weakness and genetic pattern, the dermatomyosus stroma is composed of Duchenne stiff, Becker stiff, limb-girdle stiff stiff, facioscapulohumeral stiff, Stapes, oculopharyngeal muscular stiffness, and myotonia.

Duchen-type muscular dystrophy is the most severe clinical manifestation, and at the same time, many muscles develop myocardial dysfunction and are accompanied by intellectual disability. In the early stage, some calf muscles are seen to be thicker, and pseudohypertrophy is observed, and usually it is impossible to walk around 12 years old. By 20 years old, it will die from respiratory paralysis caused by respiratory muscle involvement

In the case of the vector-type muscovirus, the severity and progression rate of the symptoms are similar to those of the Duchen-type intestinal staphylococcus, but are generally lighter than those of the Duchen type, and are generally known to survive from about 5 to 15 years old and survive up to 30 to 40 years old. The incidence is low.

Large or small-sized stapes can develop early in children or adults. It is characterized by muscle weakness and atrophy of the shoulder and pelvic region, and the distribution and progression rates of symptoms vary according to type. Facial scapularis arm stiffness is characterized by weakened facial muscles. It exhibits symptom such as asymmetric muscle weakness and muscle atrophy in the shoulder joint, distal leg, winged scapula, and is characterized by slow progression At around 40, daily life becomes difficult.

The pharyngeal stroma of the eye is mainly developed after age 40, and the pharyngeal and atrophy of the pharyngeal muscles, including the eyelids, face muscles and masticatory muscles, are characteristic.

Muscle tension dystrophy is the most common inherited musculoskeletal disorder in adults and is known to invade skeletal muscle, heart, brain, and lens organs. Clinically and genetically, it is classified as muscle tension dystrophy type 1 and muscle tension dystrophy type 2. Muscle tension dystrophy type 1 shows decrease in distal muscle strength and muscular tension dystrophy type 2 shows proximal muscle weakness.

Muscle weakness is mostly caused by the formation of chronic inflammation and fibrotic tissue, which is known to be caused by damage to the extracellular matrix (ECM) of muscle fiber membrane adhesion.

Thus, in the examples of the present invention, it was confirmed that Bu ₄ ManNAc inhibits muscle inflammation and fibrosis in a cell and an animal model, and it is confirmed that muscle weakness can be improved or prevented.

First, the pathway of TGF-β and NF-κ in the muscle precursor C2C12 treated with Bu ₄ ManNAc was analyzed by luciferase assay. As a result, it was confirmed that both TGF-β and NF-κ pathway were inhibited. It was also confirmed that the NF-κ pathway was also inhibited in 3T3 cells. In addition, it was confirmed that the expression of IKKα protein, which induces the release of NF-κB, was decreased when Bu ₄ ManNAc was treated in the Duchen-type muscular stropy mouse model, and the expression of phospho-Smad3 (Ser423 / 425) Protein expression was decreased.

Specifically, to determine the effect of Bu ₄ ManNAc on muscle inflammation and fibrosis, gene expression levels in mouse models were analyzed. First, the comparison of the expression of inflammatory factors CXCL1, s100A8, IL-1α, IL-1β, IκBα and RANTES gene expression in the control (non-heparinized) treatment of Bu ₄ ManNAc-treated Duchen- And RANTES gene expression tended to decrease. The expression levels of SPARC, CTGF and α-SMA genes related to fibrosis were analyzed. As a result, the downward regulation of SPARC, CTGF and α-SMA genes was observed in Bu4ManNAc-treated mice. In other words, it was confirmed that Bu4ManNAc inhibits inflammation and fibrosis in muscle cells.

Next, by comparing the content of collagen and glycosaminoglycans (GAG) involved in fibrosis in the mouse model, the inhibitory effect of Bu ₄ ManNAc on muscle fibrosis was confirmed. The content of collagen and glycosaminoglycans (GAG) was higher in the muscle tissue of the Duchen-type muscular stropy mouse model than that of the wild-type model. When Bu ₄ ManNAc was treated with the Duchen-type muscular stropy mouse model, Of collagen and glycosaminoglycan were reduced to a level similar to that of the wild type.

The tissue analysis also showed that the level of fibrosis in the Bu ₄ ManNAc-treated mouse model was lowered.

In order to confirm the inhibitory effect of Bu ₄ ManNAc on the hypertrophy of muscle, the cross - sectional area of mouse muscle fiber was measured and analyzed. The cross - sectional area of muscular fibers increased in hypercholesterolemic rat stropy mouse model compared with wild - type mouse, and it was confirmed that hypertrophy was observed when Bu4ManNAc was treated, and muscle hypertrophy was improved by decreasing the cross - sectional area of muscle fiber.

We also analyzed muscle damage and permeability using Evans Blue to confirm the inhibition or protective effect of Bu ₄ ManNAc. As a result of the analysis, it was confirmed that the penetration of Evans blue dye into the muscle of the Duchen type muscular dystrophy mouse model was significantly inhibited. In the case of treatment with Bu ₄ ManNAc, it was confirmed that this penetration decreased and muscle damage was suppressed.

To determine the inhibitory effect of Bu ₄ ManNAc on muscle damage, we analyzed the concentrations of aspartate aminotransferase and creatine kinase in the serum of the muscle injury index. Aspartate aminotransferase is known to be prone to increase due to liver damage. To isolate the increase in aspartate aminotransferase concentration due to liver damage, measurements of aspartate aminotransferase and creatine kinase assay Respectively.

According to serum analysis, wild-type mice had low concentrations of aspartate aminotransferase and creatine kinase, while aspartate aminotransferase and creatine kinase concentrations in mdx mice were several times higher than wild-type mice. Treatment with Bu4ManNAc showed a decrease in the concentrations of aspartate aminotransferase and creatine kinase. In other words, it was confirmed that Bu ₄ ManNAc reduced muscle damage without liver toxicity.

It was confirmed that Bu ₄ ManNAc inhibited inflammation and fibrosis of muscles and inhibited muscle damage in the above Examples. As a result, it was confirmed that Bu ₄ ManNAc and pharmaceutically acceptable salts thereof are useful as a composition for preventing or treating intact stropy .

The onychomycosis is caused by a variety of diseases such as Duchenne's dystrophy, Becker's dystrophy, limb-girdle dystrophy, facioscapulohumeral dystrophy, oculopharyngeal dystrophy, myotonia stroma, and more specifically, Duchenne stroma.

The composition is characterized by inhibiting inflammation or fibrosis of muscle cells.

In the present invention, " inflammation inhibition " means reducing gene expression of IL-l [alpha] or RANTES induced by inflammation of muscle cells, or inhibiting inflammation-induced muscle damage and muscle fiber hypertrophy. Specifically, the inhibition of muscle damage may be to decrease the damage of muscles which are increased due to inflammation, and decrease the concentration of aminotransferase or creatine kinase which increases expression upon muscle injury, but is not limited thereto.

In the present invention, " inhibition of fibrosis " means reducing the fibrosis symptom of muscle, which is a pathological phenomenon of muscular dystrophy. Specifically, it may reduce the expression of fibrosis indicator gene or decrease the content of collagen or GAG in muscle tissue , And the fibrosis indicator gene may be SPARC, CTGF or? -SMA.

&Quot; Pharmaceutically acceptable salts " in the present invention means all salts which possess the desired biological and / or physiological activity of the compounds and which exhibit minimal undesired toxicological effects. Means a salt prepared according to methods customary in the art, and such methods of preparation are known to those skilled in the art. In particular, the pharmaceutically acceptable salts include, but are not limited to, salts derived from pharmacologically or physiologically acceptable inorganic and organic acids and bases.

For example, pharmaceutically acceptable base addition salts may be prepared from inorganic and organic bases. Salts derived from inorganic bases may include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines; Substituted amines including naturally occurring substituted amines; And organic amines such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, The compounds of the present invention can be used in the form of hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamine, theobromine, purine, piperazine, piperidine, Lt; RTI ID = 0.0 > of Cyclic < / RTI > Carboxylic acid amides including other carboxylic acid derivatives such as carboxamides, lower alkylcarboxamide, di (lower alkyl) carboxamide, and the like can also be included.

For example, pharmaceutically acceptable acid addition salts may be prepared from inorganic and organic acids. Salts derived from inorganic acids include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, phosphoric acid and the like. Salts derived from organic acids include those derived from acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tartaric, citric, benzoic, cinnamic, But are not limited to, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and / or salicylic acid.

In the present invention, " prophylactic " may mean any action that inhibits or delays the onset of onychomycosis by administration of a composition according to the present invention to a subject. The term " treatment ", as used herein, may refer to any action that would result in the improvement or amelioration of a symptom due to a stabbing by the composition according to the present invention.

In the present invention, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier or an additive. In the present invention, the expression " pharmaceutically acceptable " means that the application (subject) does not have the above-mentioned toxicity that is adaptable without inhibiting the activity of the active ingredient. The " carrier " is defined as a compound that facilitates the addition of a compound into a cell or tissue.

Bu ₄ ManNAc of the present invention may be administered alone or in admixture with any convenient carrier, etc., and such dosage forms may be single or multiple dose formulations. The pharmaceutical composition may be a solid preparation or a liquid preparation. Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like. Solid form preparations may include, but are not limited to, carriers, flavoring agents, binders, preservatives, disintegrants, lubricants, fillers, and the like. Examples of the liquid preparation include water, a solution such as a solution of propylene glycol, a suspension, an emulsion, and the like, but not limited thereto, and it can be prepared by adding a suitable coloring agent, a flavoring agent, a stabilizer, a tackifying agent and the like. For example, powders can be prepared by simple mixing of a pharmaceutically acceptable carrier such as lactose, starch, microcrystalline cellulose, Bu ₄ ManNAc, which is an effective ingredient of the present invention. The granules may be prepared from the Bu ₄ ManNAc; A suitable pharmaceutically acceptable carrier; And a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone and hydroxypropylcellulose, followed by wet granulation using a solvent such as water, ethanol, or isopropanol, or dry granulation using a compressive force . Tablets may also be prepared by mixing the granules with a suitable pharmaceutically acceptable lubricant such as magnesium stearate and then tableting using a tableting machine.

The per-butanoylated N-acetyl-D-mannosamine of the present invention may be administered orally or parenterally in the form of an oral, injectable (e.g., intramuscular, intraperitoneal, intravenous, infusion, ), Subcutaneous injection, implant), an inhalant, a nasal administration agent, a nausea, rectal administration agent, a sublingual agent, a transdermal preparation, a topical preparation and the like. May be formulated into suitable dosage unit formulations, including those conventionally used and non-toxic, pharmaceutically acceptable carriers, additives, vehicles according to the route of administration.

The pharmaceutical composition of the present invention may be administered at a daily dose of from about 0.0001 mg / kg to about 10 g / kg, and from about 0.001 mg / kg to about 1 g / kg. However, the dosage may vary depending on the degree of purification of the mixture, the condition of the patient (age, sex, weight, etc.), severity of the condition being treated, and the like. For convenience, the total daily dose may be administered in divided doses several times a day as needed.

When the composition of the present invention is used as a pharmaceutical composition, the content of per-butanoylated N-acetyl-D-mannosamine in the composition may exhibit anti-inflammatory activity depending on the symptoms of the disease, For example, the amount of per-butanoylated N-acetyl-D-mannosamine may be at least 0.0001% by weight, in particular at least 0.001% by weight, based on the total weight of the total composition, % Or less, specifically 50 wt% or less, but is not limited thereto.

In another aspect of the present invention, there is provided a method for preventing or improving muscular dystrophy (MD) comprising per-butanoylated N-acetyl-D-mannosamine or a pharmaceutically acceptable salt thereof, To provide a food composition.

In the present invention, per-butanoylated N-acetyl-D-mannosamine, indigestion, prevention is as described above.

In the examples of the present invention, it was confirmed that the per-butanoylated N-acetyl-D-mannosamine inhibits inflammation and fibrosis of muscles that cause muscle weakness. As a result, it was confirmed that the per-butanoylated N-acetyl -D-mannosamine can be used as a food composition for preventing or ameliorating myofascial diseases.

&Quot; Improvement " in the present invention may mean any action that improves or alleviates the symptom of idiopathic apoplexy by administering to a subject a food composition containing the composition for preventing or ameliorating it.

When the composition of the present invention is used as a food composition, it may contain an acceptable food-aid additive, and may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of foods.

In the present invention, the term " food " means a natural product or a processed product containing one or more nutrients. Specifically, the term " food " means that the food can be directly eaten through a certain degree of processing. Functional foods, beverages, food additives, and beverage additives. Examples of the food include various foods, beverages, gums, tea, vitamin complex, and functional foods. In addition, the food of the present invention may contain special nutritional foods (eg, crude oil, spirit, infant food, etc.), meat products, fish products, tofu, jelly, noodles (eg, (Such as soy sauce, soybean paste, hot pepper paste, mixed sauce), sauces, confectionery (eg snacks), dairy products (eg fermented milk, cheese), other processed foods, kimchi, pickled foods But are not limited to, natural flavors (eg, ramen soup, etc.), vitamin complexes, alcoholic beverages, alcoholic beverages and other health supplement foods. The functional food, beverage, food additive or beverage additive may be produced by a conventional production method.

The term "functional food" as used herein refers to a food group that is imparted with added value to function or express the function of the food by physical, biochemical, biotechnological techniques, etc., or to control the biological defense rhythm of the food composition, Means a food which has been designed and processed so as to sufficiently express the body's control function with respect to the living body. Specifically, it may be a health functional food. Particularly, the composition of the present invention is preferably used as a food composition for preventing or ameliorating arteriosclerosis. The functional food may include a food-acceptable food-aid additive, and may further comprise suitable carriers, excipients and diluents conventionally used in the production of functional foods.

In the food composition, the amount of the per-butanoylated N-acetyl-D-mannosamine may be 0.00001 wt% or more, specifically 0.1 wt% or more, and 80 wt% or less, More preferably not more than 50% by weight, more specifically not more than 10% by weight, more preferably not more than 10% by weight, more preferably not more than 10% by weight, g or less, more specifically, 2 g or less, but the present invention is not limited thereto.

The food composition of the present invention may contain sweetening agents, flavoring agents, physiologically active ingredients, minerals and the like in addition to the active ingredients thereof. Sweetening agents may be used in an amount that sweetens the food in a suitable manner, and may be natural or synthetic. Specific examples of natural sweeteners include corn syrup solids, sugar sweeteners such as honey, sucrose, fructose, lactose and maltose. Flavors may be used to enhance taste or flavor, both natural and synthetic. Specifically, a natural one is used. When using natural ones, the purpose of nutritional fortification can be performed in addition to the flavor. Examples of natural flavoring agents include those obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, and the like, or those obtained from green tea leaves, Asiatica, Daegu, Cinnamon, Chrysanthemum leaves and Jasmine. Also, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, banks and the like can be used. The natural flavoring agent may be a liquid concentrate or a solid form of extract. Synthetic flavors may be used depending on the case, and synthetic flavors such as esters, alcohols, aldehydes, terpenes and the like may be used. Examples of the physiologically active substance include catechins such as catechin, epicatechin, gallocatechin and epigallocatechin, and vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine and riboflavin. As the mineral, calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium and zinc can be used.

In addition, the food composition of the present invention may contain preservatives, emulsifiers, acidifiers, thickeners and the like in addition to the above sweeteners.

Such preservatives, emulsifiers and the like are preferably added in a very small amount as long as they can attain an application to which they are added. The term " trace amount " means, when expressed numerically, in the range of 0.0005% by weight to about 0.5% by weight based on the total weight of the food composition. Examples of the preservative which can be used include calcium sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate and EDTA (ethylenediaminetetraacetic acid). Examples of the emulsifier which can be used include acacia gum, carboxymethyl cellulose, xanthan gum, pectin and the like. Examples of the acidulant that can be used include acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, and phosphoric acid. Such an acidulant may be added so that the food composition has a proper acidity for the purpose of inhibiting the growth of microorganisms other than the purpose of enhancing the taste. Agents that may be used include suspending agents, sedimentation agents, gel formers, bulking agents and the like.

In another aspect, the present invention provides a method for preventing or ameliorating muscular dystrophy (MD) comprising per-butanoylated N-acetyl-D-mannosamine or a pharmaceutically acceptable salt thereof, A quasi-quasi-product composition is provided.

The description of the per-butanoylated N-acetyl-D-mannosamine, pharmaceutically acceptable salts, intramuscular dystrophies, prevention and improvement of the present invention is as described above.

The term " quasi-drug " of the present invention refers to products which are used for diagnosis, treatment, improvement, alleviation, treatment or prevention of diseases of human beings or animals, and which are less active than drugs. For example, according to the Pharmaceutical Affairs Law, Except for the products used for medicinal purposes, such as fibers and rubber products used for the treatment and prevention of diseases of humans and animals, and which do not act directly on the human body, These include sterilization and insecticides to prevent them.

The kind and formulations of the quasi-drug composition of the present invention are not particularly limited, but may be disinfectant cleaner, shower foam, gagrin, wet tissue, detergent soap, hand wash, ointment or paste.

When the composition of the present invention is included in quasi-drugs for the prevention or improvement of muscular dystrophy (MD), the composition may be used as it is or may be used in combination with other quasi-drugs, . The amount of the active ingredient to be mixed may be suitably determined according to the purpose of use. The quasi-drug composition according to the present invention may contain the per-butanoylated N-acetyl-D-mannosamine in an amount of 0.01 to 20% ≪ / RTI >

The present invention relates to a method for the treatment of muscular dystrophy (MD) comprising per-butanoylated N-acetyl-D-mannosamine, Bu4ManNAc or a pharmaceutically acceptable salt thereof, ) ≪ / RTI > disease.

It has been confirmed that Bu4ManNAc of the present invention inhibits inflammation and fibrosis of muscle cells and reduces muscle hypertrophy and muscle damage in the cell line and mouse model, and thus it can be utilized for the treatment of intestinal stromal fibrosis.

1 is a 1 H-NMR (CDCl 3, 500 MHz) result of SCFAH synthesized in the present invention.
FIG. 2 shows the results of confirming the regulation of TGF-β and NF-κB pathway in Bu ₂ ManNAc (Drug, red) and vehicle (blue) treatment of root cells (C2C12) and fibroblasts (3T3) with time.
FIG. 3 shows the results of confirming the regulation of the TGF-β and NF-κB pathways in the individual treatment of the respective components of the Bu ₄ ManNAc and Bu ₄ ManNAc hybrid molecules. Luciferase assay was performed to evaluate the modulation of A) TGF-β pathway and B) NF-κB pathway upon treatment of source cell (C2C12) cells with a mixture of anhydrous butyric acid, anhydrous butyric acid and ManNAc or a hybrid molecule Bu ₄ ManNAc . Results are expressed as the mean ± standard deviation of the three biological repeat measurements. * p < 0.0001, ** p = 0.0001.
FIG. 4 is a result of measurement of doubling time of a source cell (C2C12) according to a Bu ₄ ManNAc treatment as a hybrid molecule. Doubling time was calculated by counting cells at two time points with an interval of 8 hours. The results represent the mean ± standard deviation of the biological triplicate experimental measurements. * p < 0.05.
Figure 5 shows the results of western blotting of the effect of Bu ₄ ManNAc, a hybrid molecule in an animal model of muscle atrophy. Western blot was performed using a tibialis muscle sample of mice treated with Bu ₄ ManNAc at 5.5 weeks.
FIG. 6 shows the results of analysis of the effect of the treatment with Bu ₄ ManNAc, a hybrid molecule in an animal model of muscle atrophy, on the transcription level of fibrosis or inflammation-related genes using qRT-PCR. qRT-PCR was carried out using a hybrid molecule, Bu ₄ ManNAc, with an anterior tibialis muscle sample of an atrophy rats treated for 4.5 weeks. (A) indicates a gene associated with fibrosis, and (B) indicates an inflammation-related gene. Results are expressed as the mean ± standard deviation of the three biological repeat measurements.
FIG. 7 shows the results of analysis of the effect of Bu ₄ ManNAc on the muscle collagen and glucosaminoglycan (GAG) content in a mouse model. Collagen (A) and GAG (B) assays were performed by hydroxyprolyl and DMMB analysis, respectively. Results are expressed as the mean ± standard deviation of the three biological repeat measurements. * p < 0.025, ** p < 0.05.
Figure 8 shows the results of analysis of the effect of SCFAH on muscle fibrosis in a mouse model. Peak Sirius red staining (PicroSirius red staining) was performed twice. Specifically, in the stained cell image (A), a red-stained fibrotic area was calculated and analyzed (B). Standard = 100 μm.
Figure 9 is the result confirming that the Bu ₄ ManNAc reduced fibrosis and muscle fiber cross-sectional area during treatment in a mouse model. Hematoxylin and eosin staining was performed in three groups (A). The cross-sectional area of the muscle fiber was calculated and the frequency was indicated in the histogram (B). Frequency charts were fitted to Gaussian curves. The blue box shows a clear difference between the untreated mouse and the treated mouse. Standard = 100 μm.
FIG. 10 shows the result of confirming the permeability of muscles in Bu ₄ ManNAc treatment. The quadriceps were separated and fractionated at various locations of A, B, and C to assess muscle permeability. Show representative pictures of mouse quadriceps of each group. Standard = 100 μm.
Fig. 11 shows the inhibition of muscle damage of Bu ₄ ManNAc. After 5.5 weeks, blood was collected from the mice and analyzed in a reagent rotor using a serum analyzer. Results are expressed as the mean ± standard deviation of the three biological repeat measurements.

Hereinafter, the present invention will be described in more detail with reference to examples. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

<Materials and Methods>

1. C2C12 and 3T3 cell culture

C2C12, a source cell, and 3T3 cell line, fibroblasts, were purchased from ATCC. Growth media (GM) was prepared by adding 10% HyClone fetal bovine serum (FBS), 1x L-glutamine and 1x penicillin / streptomycin to DMEM medium (Dulbecco's Modified Eagle Medium). C2C12 and 3T3 cell lines were cultured in growth media (37 ° C and 5% CO ₂ ) in tissue culture plates. The medium was changed every 2 to 3 days until the cell confluency reached about 70 to 80% and the cells were passaged using 0.25% trypsin-EDTA (Gibco). Cells were treated with trypsin for 5 minutes under standard culture conditions, the cells were separated from the plate, centrifuged at 1000 rpm for 5 minutes, and plated at a density of 5000 cells / cm2. If necessary, cells were lyophilized (50% growth medium plus 40% HyClone FBS + 10% DMSO) and slowly frozen to -80 ° C.

For the production of luciferase cell lines, cells were carefully thawed, plated at a density of 5,000 cells / cm2, and allowed to settle for 1-2 days before plating.

2. Synthesis of Bu4ManNAc

To a solution of pyridine (6.0 mL) mixed with N-acetyl-D-mannosamine (1000 mg, 4.52 mmol) and anhydrous butyric acid (5720 mg, 36.16 mmol) and 4- (dimethylamino) pyridine (DMAP, 23.43 mg, 0.2 mmol) was added to prepare a reaction mixture (see Scheme 1). The reaction mixture was stirred at room temperature for 24 hours and then diluted with 100 ml of toluene. The solvent was evaporated in vacuo to leave a residue and 200 mL of chloroform was added. An organic layer was obtained and washed sequentially with cold HCl solution (0.5 N, 25 mL), water (25 mL), saturated NaHCO3 (25 mL) and brine (25 mL). The organic layer was dewatered and dried over anhydrous Na2SO4 and concentrated in vacuo. The concentrate was purified by column chromatography using an ethyl acetate / hexane (2:98, volume ratio) solvent. As a result, 2,086 mg per-butanoylated N-acetyl-D-mannosamine (Bu4ManNAc) (4.16 mmol, yield 92.0%) was obtained.

Reaction 1.

3. This ₄ Check the characteristics of ManNAc

Next, the characteristics of Bu ₄ ManNAc synthesized above were analyzed.

The Rf value of Bu ₄ ManNAc prepared above was measured by 0.4 (hexane: ethyl acetate, 2: 1).

1H-NMR was measured to analyze the structure of Bu ₄ ManNAc. 1 shows the results of 1H-NMR measurement of Bu ₄ ManNAc. 1 H-NMR (CDCl 3, 500 MHz) of Bu ₄ ManNAc gave δ (anomer mixture, α / β~25/75) 6.05 (d, 0.2H), 5.87 ), 5.34 (dd, 0.2H), 5.18 (t, 0.2H), 5.12 (t, 0.7H), 5.06 (dd, (Dd, 0.7H), 4.28 (dd, 0.7H), 4.02 (m, 0.2H) (M, 8H), 2.17 (m, 8H), 2.06 (s, 3H), 1.72-1.55 (m, 8H), 1.00-0.89

4. Pathway modulation assay of TGF-β and NF-κB

C2C12 and 3T3 were used to make a luciferase cell line. Cells were cultured in growth medium in 96-well plates (Coning) several days prior to drug treatment. Cell density reaches the range of 80 to 90%, was treated with a cycle compared to the cells (by PBS containing 50% ethanol), acid anhydride, N- Acetyl -D- only labor min or hybrid molecules of Bu ₄ ManNAc. Bu ₄ ManNAc with a final concentration of 150 μM was used and the same molar concentration of butyrate (two butyrate molecules per anhydrous butyric acid) and N-acetyl-D-mannosine were calculated for consistent treatment. The drug was stored at 4 ° C for up to one month. Drug treatment was carried out in the source medium (DMEM medium supplemented with 2% horse serum, 1x L-glutamine and 1x penicillin / streptomycin). After 24 hours of incubation, the culture was removed and rinsed with PBS. Then, 1x passive lysis buffer was added to the cells, and the cells were lysed at 400 rpm for 30-40 minutes using an orbital shaker. Cell lysates were transferred to 1.7 ml Eppendorf tubes and stored, if necessary, at -20 ° C within 1 week. Cell lysates were centrifuged for 1 minute at 14,000 rpm using a tablet-type centrifuge before analysis. 10 [mu] l of the lysate was analyzed by luciferase using a 96-well plate on a white bottom, and 1 [mu] l of the lysate was analyzed for the bicineconic acid using a standard 96-well plate.

Non-hepatic controls served as background subtractors for TGF-β and NF-κB assays, and protein concentrations were used to standardize the input of the analyte. However, the number of cells in the treatment group was similar, confirming that no protein standardization was required.

4.1 Formation of Luciferase Reporter Cell Line

For path analysis, Luciferase reporter cell lines were formed using CignalTM lent reporter viruses (SA Biosciences). Negative control, TGF-β and NF-κB reporter cell lines were formed for each cell type.

The growth medium was transfected into cells by adding viruses of 0, 5, 10 and 25 multiplicity of infection (MOI). The cells were cultured in the medium containing the virus for 24 hours and then replaced with fresh growth medium. Thereafter, the cells were further cultured for 24 to 48 hours, and cells into which the viral DNA was introduced were selected with a growth medium to which puromycin was added at a concentration determined by the following decay curve experiment. At the same time, puromycin was treated on the cells that were not exposed to the virus to confirm that the selection was appropriate.

4.2 Measurement of death curve

To select cells into which viral DNA was introduced, cells were cultured in a growth medium supplemented with a series of concentrations of puromycin. When the cell confluency reached about 60-70%, cells were cultured in Growth Medium supplemented with puromycin at 0, 1, 2, 3, 4, 6, 8 and 10 μg / ml concentrations. The medium containing puromycin was changed every 2 to 3 days, and the viability of the cells was observed daily, and the concentration at which the cells were completely killed after 3 to 5 days was measured.

4.3 Luciferase assay

The cell lysate was mixed with 50 [mu] l of reconstituted luciferase reagent (One-Glo reagent). After stirring for 3 to 5 minutes at 400 rpm on a rotary stirrer, the light output was measured by setting the exposure time to 1 second with a plate reader.

4.4 Analysis of Biocinchoninic acid (BCA)

For accurate determination using passive cytolytic buffer, cell lysates were mixed with 9 μl of milliQ water prior to analysis. All standards were prepared using the same 1 × passive lysis buffer and bovine serum albumin at concentrations of 0, 25, 125, 250, 500, 750, 1000, 1500 and 2000 μg / ml. Plates were analyzed with each standard curve. 200 쨉 l of the reconstituted BCA assay reagent was added to each cell lysis dilution, and the reaction was carried out at 37 째 C incubator for 30 minutes, cooled to room temperature, and then measured at a wavelength of 562 nm using a plate reader.

5. Population doubling analysis

Cells were plated in 24-well plates (Corning) at a density of 5,000 cells / cm &lt; 2 &gt; and cultured to a logarithmic growth period. Two time points were set at 8 - hour intervals in the accelerated growth phase. At this time, cells were trypsinized and counted using hemocytoometry. The doubling time was calculated by the following equation using an average for each time point.

T _d represents the doubling time determined on the assumption that the growth rate is constant,

t ₁ and t ₂ represent the time at the time of measurement,

q ₁ and q ₂ represent the number of cells.

6. Mouse Model (mdx) Study

All animal studies were performed according to the IACUC protocol. Animal experiments were performed with an mdx mouse model of Duchenne muscular dystrophy (DMD). Male mdx mice (C57BL / 10ScSn-mdx / J) and male control wild-type mice (C57BL / 10ScSnJ) were purchased from The Jackson Laboratory. The mice were weighed and adapted to the new environment. I tagged my ear for identification. Intraperitoneal injection (IP) was performed daily at 7 weeks using a U-100 27G x ½ "insulin syringe (Terumo) for non-hepatic (peanut oil with 10% ethanol) or Bu4ManNAc (3 mg / Mice were injected daily for 4.5 weeks and euthanized after 5.5 weeks.

7. Blood analysis

Immediately after euthanasia, blood was collected from the femoral artery of the mouse. Whole blood was collected in an Eppendorf tube and allowed to solidify at room temperature for 20 minutes. After coagulation, the blood was centrifuged at 4,000 rpm for 20 minutes. Serum was transferred to a new tube and diluted with saline (milliQ water containing 0.9% w / v NaCl). Creatine kinase and aspartate aminotransferase concentrations were measured using Vetscan VS2 (Abaxis). Diluted serum was injected and analyzed with Avian-Reptilian Profile Plus, Abaxis (the number of samples was n = 8 in wild-type, non-hepatic and treated groups).

8. Western blotting

The left tibialis anterior muscle tissue of the mouse was frozen and pulverized in liquid nitrogen for 10 minutes or longer. To the milled tissue was added RIPA lysis buffer containing protease (aprotinin / leupeptin) and phosphatase inhibitor (sodium vanadate / sodium fluoride). Cell lysates were quantified by Bradford assay, loaded with 350 μg of total protein per lane in 8% polyacrylamide gel and electrophoresed at 80V. The protein was then transferred at 350 mA for 1.5 hours to transfer the protein from the gel to the polyvinylidene fluoride membrane. The membranes were blocked with TBST containing 3% BSA and incubated with phospho-Smad2 / 3 (Ser423 / 425; cell signaling; 1: 1000), Smad2 / 3 (Santa Cruz; 1: 200), IKKα / β (Santa Cruz; 1: 200), NF-κB (Santa Cruz, 1: 200) and GAPDH (Santa Cruz; 1: 500) primary antibodies overnight at 4 ° C. The next day, the membrane was washed and reacted with the secondary antibody, and the chemiluminescent reagent (GE healthcare) was treated for X-ray film development.

9. qPCR

RNAlater (Ambion) was added to the tibialis anterior muscle, which was separated from the mouse, and stored at 4 ° C overnight. Total RNA was extracted using Trizol (Invitrogen) and reverse transcription was performed using the iScript cDNA Synthesis Kit (BioRad). The obtained cDNA was used for qRT-PCR using SYBR Premix Ex Taq II Tli RNase H Plus (Takara) in ABI 7300 real-time PCR system (Applied Biosystems). The obtained ΔΔCt value was compared with the internal control, 18S, and the relative fold expression levels were calculated using the ΔΔCt method. The number of samples in the wild type, non-hepatic and drug treatment groups was n = 3. Table 1 shows the sequence (5 'to 3') of the gene primer pairs used in the analysis.

gene Omni-directional primer sequence Reverse primer sequence SPARC GCTGTGTTGGAAACGGAGTTG
(SEQ ID NO: 1) CTTGCCATGTGGGTTCTGACT
(SEQ ID NO: 2) CTGF GTGCCAGAACGCACACTG
(SEQ ID NO: 3) CCCCGGTTACACTCCAAA
(SEQ ID NO: 4) αSMA ATCGTCCACCGCAAATGC
(SEQ ID NO: 5) AAGGAACTGGAGGCGCTG
(SEQ ID NO: 6) CXCL1 GCACCCAAACCGAAGTCATA
(SEQ ID NO: 7) TGGGGACACCTTTTAGCATC
(SEQ ID NO: 8) S100a8 TGAACTGGAGAAGGCCTTGA
(SEQ ID NO: 9) ATTCTGTAGACATATCCAGGG
(SEQ ID NO: 10)

10. Histology and Dyeing

Tissues embedded in frozen in OCT (Optimal Cutting Temperature) solution or fixed in Bouin solution were processed into paraffin sections. The sections were deparaffinized and rehydrated, followed by hematoxylin and eosin staining. The sections were treated with Citra Solv, a xylene substitute, three times for 5 minutes each. Thereafter, the cells were treated three times for three minutes with anhydrous ethanol, three times for three minutes with 95% ethanol and three times for three minutes with 70% ethanol. The sections were washed gently with distilled water, stained with hematoxylin solution for 5 minutes, and then washed with running tap water for 5 minutes. The sections were counterstained with eosin-flocin solution for 2 minutes and finally mounted with a glycerol-based mounting medium. A frequency plot was made by measuring the cross-sectional area of the muscle fibers with the core located in the center. For each of the two biological replicates, three arbitrary microscopic fields were measured, and the Gaussian fit was calculated using Excel.

A Picrosirius Red staining kit (Polysciences) was used to evaluate collagen I and III deposition. The paraffin sections were removed and hydrated with distilled water. It was then stained with Weigerts hematoxylin for 8 minutes and washed extensively with distilled water (when visualizing the cytoplasm). Subsequently, the sections were immersed in the A solution for 2 minutes, washed with distilled water, immersed in the B solution for 60 minutes, immersed in the C solution for 2 minutes, and immersed in 70% ethanol for 45 seconds. Thereafter, the sections were dehydrated and mounted. Fiberization was quantified using ImageJ. Three arbitrary microscopic fields were measured for two biological replicates.

To evaluate myofiber permeability, mice were intraperitoneally injected with phosphate buffered saline containing 0.5% Evans blue dye 12-24 hours prior to euthanasia treatment. Quadriceps were separated to visualize Evans blue dye in permeable muscle tissue.

11. Biochemical analysis

11.1. Prepare tissue sample

Separated tissue samples were placed in pre-weighed clean Eppendorf tubes and rapidly frozen in liquid nitrogen. The tissue was stored at -80 DEG C and then lyophilized for 2 to 3 days. The dried sample was then weighed to determine the dry weight of the tissue. Tissue was digested with papain made of L-cysteine and PBE buffer. The PBE buffer was prepared by dissolving 7.1 g Na ₂ HPO ₄ and 1.86 g Na ₂ EDTA in 500 mL dH ₂ O and the pH was adjusted to 6.5 using HCl. The buffer was then filter sterilized and stored at &lt; RTI ID = 0.0 &gt; 4 C. &lt; / RTI &gt; For decomposition, 24.2 g of L-cysteine was dissolved in 20 ml of PBE buffer and filtered sterilized. 0.1 ml of a sterile papain stock solution was added to the solution using a TB syringe and a needle. After adding 1 ml of the papain solution prepared in the sample, the tissue sample was pulverized with flakes using a pellet pestle. The sufficiently homogenized sample was stored in a constant temperature water bath at 60 DEG C for 16 hours.

11.2. Analysis of glycosaminoglycans (GAG)

0.0875 g of cysteine was dissolved in 50 ml of PBE, and 50 mg of chondroitin sulfate was dissolved in 1 ml of the cysteine-added PBE solution to prepare a stock solution of chondroitin sulfate. A working stock was prepared by diluting 25 μl of the stock solution of chondroitin sulfate with 12.5 ml of the cysteine-added PBE solution. The dimethylmethylene blue (DMMB) dye was prepared by adding 3.04 g of glycine, 2.37 g of NaCl and 95 ml of 0.1 M HCl and 905 ml of dH2O. To this solution was added 16 mg of DMMB and dissolved using a magnetic stirrer. The pH was adjusted to 3 using concentrated HCl. In a 3 ml disposable plastic cuvette, 20 μl of papain digested sample, 80 ml of dH ₂ O was mixed with 2.5 ml of DMMB solution, and the absorbance was measured at 525 nm using a spectrophotometer (Beckman Coulter). Samples were analyzed by extrapolation using a standard chondroitin sulfate solution (1 ml of cysteine-added PBE solution containing 100 占 퐂 of chondroitin sulfate) and a measurement of 0 to 60 占 퐇.

11.3 Collagen analysis

100 μl of papain digested sample and 900 μl of 6M HCl were mixed and placed in a sealable 2 ml microtube and hydrolyzed in a heating block at 110 to 120 ° C.

First, prepare a 17 g NaOH, buffer, citric acid monohydrate 25 g, sodium acetate trihydrate and 60 g glacial acetic acid was added to 60 ㎖, put dH ₂ O to the solution a total volume so that 500㎖ in dH ₂ O 250 ㎖ Respectively. To the buffer solution, 150 ml of isopropanol, 100 ml of dH ₂ O and five drops of toluene were further added. The pH was adjusted to 6 using concentrated HCl.

The acid hydrolyzed papain digested sample was mixed with two drops of methyl red and neutralized with two drops of 2.5 M NaOH, two drops of 0.5 M HCl and one or two drops of 0.5 M NaOH. The neutralized sample was diluted with dH ₂ O to a volume of 3 ml. Approximately 1 ml of the diluted sample was transferred to a new tube prior to analysis. Thereafter, the sample was mixed with 0.5 ml of freshly prepared Chloramine T solution (40 ml of a buffer solution of pH 6 containing 0.705 g of chloramine T and 5 ml of isopropanol), and the mixture was reacted at room temperature for 20 minutes. The sample was mixed with 0.5 ml of a freshly prepared pDAB solution (30 ml of isopropanol, 7.5 g of 60% para-dimethylaminobenzaldehyde and 13 ml of perchloric acid solution), reacted in a constant temperature water bath at 60 ° C for 30 minutes, Lt; / RTI &gt; Absorbance was measured in a 3 ml disposable plastic cuvette using a spectrophotometer (Beckman Coulter) at 550 nm. The absorbance of the sample was compared to the hydroxyproline standard in a standard hydroxyproline solution (10 μg / ml) from 0 to 700 μl.

12. Statistical Analysis

All biochemical data are presented as means ± SD. Outliers were determined and removed from the data set by GraphPad Prism 6 for cross-sectional area (CSA) analysis and the mean and distribution of CSA in wild-type (WT) and mdx mice of all ages were analyzed. Statistical significance was assessed using two-tailed unpaired Student's t-test or single-factor analysis (ANOVA) with Tukey's multiple comparison tests using GraphPad Prism 6 statistical software. variance).

<Result>

1. In vitro Bu ₄ ManNAc effect analysis

1.1. Path analysis

First, we examined TGF-β and NF-κB pathway regulation in vitro in order to confirm the role of the hybrid molecule Bu ₄ ManNAc in TGF-β and NF-κB pathway regulation. The C2C12 cell line was used as a model to demonstrate that ₄ &lt; RTI ID = 0.0 &gt; ManNAc &lt; / RTI &gt; actually down regulated the TGF-beta and NF-kB pathways. In the C2C12 cell line, both TGF-β and NF-κB were down-regulated, and only the NF-κB pathway regulation was observed in the 3T3 cell line.

The present invention demonstrates that two pathways are significantly inhibited in a C2C12 mouse cell line using a luciferase reporter based system. At the beginning, standardization using protein concentration was performed to compensate for differences in cell numbers due to various treatments. However, as a result of the experiment, it was judged that the standardization is not necessary because the difference is only a slight difference.

Luciferase assays were performed using C2C12 cells and 3T3 to confirm the regulation of the TGF-beta pathway and / or NF-kB for the treatment of this _4- ManNAc.

Initially, time-dependent analysis of pathway regulation was performed in real-time. The TGF-β pathway and the NF-κB pathway were markedly elevated in C2C12 cells 24 hours after the _4- ManNAc treatment, and the down-regulation of the NF-κB pathway was also most prominent in 3T3 cells 24 hours after Bu ₄ ManNAc treatment (Fig. 2).

In order to examine the effect of butylate and acetyl-mannosamine (ManNAc), which are components of Bu ₄ ManNAc, on the TGF-β pathway or NF-κB pathway, anhydrous butyric acid, ManNAc, And ManNac, and Bu ₄ ManNAc, a hybrid molecule, were compared, respectively, to evaluate the regulation of TGF-β pathway and NF-κB pathway in C2C12 cells. Both the TGF-β pathway and the NF-κB pathway were inhibited by Bu4ManNAc, but there was a difference in regulation in both pathways. It was confirmed that TGF-β was greatly inhibited only when a mixture of anhydrous butyric acid, anhydrous butyric acid and ManNAc containing Buutyrate molecules or Bu ₄ ManNAc (FIG. 3A). Perhaps most of these effects are attributed to the butyrate molecules released from the main scaffold. On the other hand, in C2C12 cells, NF-κB was significantly down-regulated only in Bu ₄ ManNAc-treated cells (FIG. 3B). In other words, only the entire hybrid molecule (Bu ₄ ManNAc) was found to reduce NF-KB transcription.

1.2. Impact of Bu4ManNAc on object doubling

Next, the effect on the potential toxicity and growth rate of Bu ₄ ManNAc, short chain fatty acid hexosamine (SCFAH) prepared in the present invention, was evaluated. Significant cell death occurred when the cell density was insufficient when treating Bu ₄ ManNAc at a concentration of 150 μM. Thus, the cells were allowed to fill the tissue culture dish before drug treatment, thus greatly reducing the cytotoxic effect.

Next, the doubling time of C2C12 cells according to the treatment of Bu ₄ ManNAc was confirmed. As a result, it was confirmed that when the Bu ₄ ManNAc was treated with C2C12 cells, the proliferation rate was reduced by about 2.5 times (FIG. 4). Considering that a fairly confluent monolayer is obtained due to the rapid recovery of cells and low toxicity after the initial increase of doubling time, next, using the mdx mouse model of Duchenne muscular dystrophy (DMD) The effect of Bu4ManNAc, which inhibits various pathologies of DMD, was evaluated.

2. Effect of Bu4ManNAc on mdx mouse model

2.1. Western blot

In vivo effects of Bu ₄ ManNAc were determined in animal models. Mice were treated with intraperitoneal injection starting at week 7 and daily for 4.5 weeks. Western blotting was performed using the tibialis anterior (Fig. 5). It was confirmed that the expression of IKK [alpha] protein was decreased in Bu ₄ ManNAc-treated mice as compared with the non-hepatic control group. IKKα is involved in the phosphorylation of IκB, and IκB induces the release of NF-κB, which translocates to the nucleus and transcribes the target gene. However, the absolute amount of NF-κB was the same in non-hepatic control and Bu ₄ ManNAc-treated mice. As expected, the NF-κB pathway was found to increase expression in mdx mice over wild-type mice.

Unexpectedly, a large amount of activated Smad3 was found in wild-type mice, and treatment with Bu ₄ ManNAc reduced the level of protein expression of phospho-Smad3 (Ser423 / 425), which is activated in the TGF-beta pathway. Thus, it was confirmed that Bu ₄ ManNAc down-regulates the TGF-β pathway in mouse muscle cells.

2.2. QPCR of genes related to fibrosis and inflammation

Next, we examined the effect of Bu ₄ ManNAc on transcription levels of genes related to fibrosis and inflammation. SPARC, CTGF and α-SMA are genes involved in fibrosis. These ₄ genes were down-regulated when ManNAc was treated.

In addition, the expression level of CXCL1, s100A8, IL-1α, IL-1β, IκBα and RANTES was examined in the inflammation-related gene, and the down-regulation of IL-1α and RANTES gene tended to be observed in Bu ₄ ManNAc- 6).

3. Biochemical analysis

Next, the contents of collagen and glycosaminoglycan (GAG) were measured in the mouse tibialis and quadriceps to examine the effect of Bu ₄ ManNAc on the muscle collagen and glycosaminoglycan (GAG) contents in mouse. As can be seen in Figure 7A, the collagen content of mdx mice tended to be higher than the wild type collagen content. Treatment of this ₄ ManNAc drug has shown that the collagen content of mdx mice tends to decrease to similar levels as wild-type mice. This suggests that Bu ₄ ManNAc drugs inhibit collagen synthesis and accumulation associated with fibrosis symptoms of DMD muscle.

The GAG content was determined using DMMB assay to assess differences in GAG content that could occur in mdx and wild-type mice (Fig. 7B). In general, mdx mice tend to have high GAG content, and these high levels of proteoglycans and glycoproteins may be due to muscular dystrophy.

4.5 week-old Bu ₄ ManNAc-treated mice showed a decrease in GAG levels to a level that was found in wild-type mice.

4. Organizational Analysis

Bu ₄ ManNAc inhibited collagen accumulation. In order to confirm that Bu ₄ ManNAc directly inhibited fibrosis, Picrosirius red staining was performed (FIG. 8A). Measurement of fibrous regions in three arbitrary microscopic fields confirmed that Bu ₄ ManNAc reduced fibrosis. This supports the above biochemical results (Fig. 8B). Wild type had low fibrosis and mdx mouse had higher fibrosis. Treatment of the drug lowers the level of fibrosis in the muscular dystrophy mice, demonstrating a decrease in the fibrosis pathway leading to collagen deposition.

In conclusion, Bu ₄ ManNAc-treated mice showed reduced collagen staining compared to non-hepatic, suggesting that Bu ₄ ManNAc probably prevents fibrosis by modulating the TGF-β pathway.

Hematoxylin and eosin staining were performed to confirm biochemical and staining results and to observe additionally the location and amount of nuclei. As can be seen in FIG. 9, the nondeflexed mdx mice showed a marked increase in muscle fibrosis as compared with wild type mice, but treatment with Bu ₄ ManNAc decreased fibrosis and remained similar to wild type mice. Overall, tissue analysis results support biochemical analysis results.

In order to confirm the effect of Bu ₄ ManNAc on muscle hypertrophy, a cross-sectional area of the muscle fiber was measured to prepare a frequency chart (FIG. 9B). Was confirmed to be a muscle fiber cross-sectional area measurements increased in mdx mouse in a Gaussian (Gaussian) curves in the histogram having a muscle hypertrophy, muscle when dealing with Bu ₄ ManNAc Muscular hypertrophy down from mdx in relation to the muscle fibers are Bu ₄ ManNAc damaged film Hypertrophy, and hypertrophy.

Next, to confirm the inhibitory effect of Bu ₄ ManNAc on muscle damage, the degree of muscle damage was confirmed using Evans blue dye. Evans blue dye was intraperitoneally injected the day before muscle separation to visually inspect muscle damage and muscle permeability of the tissue. Evans blue dye leaks into the skeletal muscle and, if moderately excited, displays fluorescence and can observe the degree of muscle fiber permeability as a result of atrophy. Various cross-sections along the length of the muscle were used to identify muscle damage at various locations within one muscle (Fig. 10). Significant infiltration of Evans blue dye was observed in most areas of the mdx mouse, whereas the Bu ₄ ManNAc-treated mice showed significantly less fluorescence of Evans blue in all areas. In contrast, wild-type muscles showed little fluorescence compared to mdx mice, but perimysium showed high nonspecific fluorescence. That is, daily treatment of Bu4ManNAc reduced skeletal muscle damage in the muscles of mdx mice.

 5. Blood analysis

The levels of aspartate aminotransferase and creatine kinase in serum were measured to evaluate muscle damage. It is known that aspartate aminotransferase and creatine kinase increase in blood concentration depending on degree of muscle damage. On the other hand, aspartate aminotransferase tends to increase due to liver damage. Therefore, in order to isolate increase in the concentration of aspartate aminotransferase due to liver damage, the measured value of aspartate aminotransferase and the measured value of creatine kinase were compared and analyzed.

According to serum analysis, wild-type mice had low concentrations of aspartate aminotransferase and creatine kinase, while aspartate aminotransferase and creatine kinase concentrations in mdx mice were several times higher than wild-type mice. Treatment of Bu ₄ ManNAc showed reduced levels of aspartate aminotransferase and creatine kinase. This suggests that the drug reduces muscle damage without liver toxicity (FIG. 11B). The number of samples in all groups used was n = 8.

In summary, it has been confirmed in the present invention that Bu ₄ ManNAc inhibits fibrosis or inflammation of muscles in vitro and in vivo. This ₄ ManNAc down-regulated the TGF-β pathway by the butyrate molecule released from the hexosaminic support, while down-regulating the NF-κB pathway only when complete whole molecules were present. In addition, PCR and Western blot analysis confirmed that expression of fibrosis and inflammation related genes and proteins was decreased. In particular, the concentrations of IKKa and phospho-Smad3 protein decreased with treatment of the drug. At the transcription level, genes involved in fibrosis such as SPARC, CTGF and α-SMA were down-regulated in Bu ₄ ManNAc treatment. IL-1α and RANTES were down-regulated in inflammation-related genes.

Another evidence to demonstrate the reduction of fibrosis by this ₄ ManNAc treatment is that the collagen content of the tibialis and quadriceps muscles is reduced compared to the niacin-treated mice. This was confirmed by chemical staining and quantification. Indirect evidence of reduced inflammation is reduced muscle damage and hypertrophy of drug-administered mouse muscle.

Specifically, serum levels of aspartate aminotransferase and creatine kinase were decreased to a level similar to that of wild-type mice in drug-treated mice compared to the control group. In addition, Evans blue dye fluorescence analysis showed a significant decrease in dye penetration level, and cross-sectional measurement of muscle fiber showed that the muscle cross-sectional area decreased and hypertrophy decreased in mice treated with Bu ₄ ManNAc . This suggests that drug treatment actually reduced muscle damage.

Thus, the inventive Bu ₄ ManNAc inhibits muscle fibrosis and / or inflammation and reduces muscle hypertrophy and damage, thereby confirming that the mdx mouse can inhibit the pathology of the dystrophy despite lower than expected doses.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> Composition for preventing or treating of muscular dystrophy          comprising Per-butanoylated N-acetyl-D-mannosamine <130> DP20170233 <150> KR 10-2017-0081315 <151> 2017-06-27 <160> 10 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SPARC forward primer <400> 1 gctgtgttgg aaacggagtt g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SPARC backward primer <400> 2 cttgccatgt gggttctgac t 21 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CTGF forward primer <400> 3 gtgccagaac gcacactg 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CTGF backward primer <400> 4 ccccggttac actccaaa 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> alpha SMA forward primer <400> 5 atcgtccacc gcaaatgc 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> alpha SMA backward primer <400> 6 aaggaactgg aggcgctg 18 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CXCL1 forward primer <400> 7 gcacccaaac cgaagtcata 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CXCL1 backward primer <400> 8 tggggacacc ttttagcatc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S100a8 forward primer <400> 9 tgaactggag aaggccttga 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> S100a8 backward primer <400> 10 attctgtaga catatccagg g 21

Claims (7)

The present invention relates to a method for the treatment of muscular dystrophy comprising per-butanoylated N-acetyl-D-mannosamine (Bu4ManNAc) or a pharmaceutically acceptable salt thereof represented by the following formula muscular dystrophy, &lt; RTI ID = 0.0 &gt; MD). &lt; / RTI &gt;
[Chemical Formula 1]

The method according to claim 1,
The atrophic stropy may be classified as Duchenne stiff, Becker stiff, limb-girdle stiff, facioscapulohumeral stiff, oculopharyngeal stiff or muscle tension myotonia) &lt; / RTI &gt; The method according to claim 1,
Wherein said composition inhibits inflammation or fibrosis of muscle cells. A food composition for preventing or ameliorating muscular dystrophy (MD) comprising Bu4ManNAc or a pharmaceutically acceptable salt thereof as represented by the formula of claim 1. 5. The method of claim 4,
The atrophic stropy may be classified as Duchenne stiff, Becker stiff, limb-girdle stiff, facioscapulohumeral stiff, oculopharyngeal stiff or muscle tension myotonia) &lt; / RTI &gt; A quasi-drug composition for preventing or ameliorating muscular dystrophy (MD) comprising Bu4ManNAc or a pharmaceutically acceptable salt thereof represented by the chemical formula of claim 1. The method according to claim 6,
The atrophic stropy may be classified as Duchenne stiff, Becker stiff, limb-girdle stiff, facioscapulohumeral stiff, oculopharyngeal stiff or muscle tension Myotonia) Quasi-Stroopy Quasi-Composition.

Images