KR101839356B1 - Composition for inhibiting a growth of cancer stem cells comprising primaquine - Google Patents

Abstract

The present invention relates to a composition for inhibiting cancer stem cell growth, which comprises Primaquine or a pharmaceutically acceptable salt thereof as an active ingredient, a pharmaceutical composition for inhibiting metastasis of cancer comprising the composition or for treating or preventing cancer, Compositions and the like.
The Primaqueen of the present invention inhibits the growth of breast cancer cells and inhibits the formation of breast cancer stem cells. In addition, it inhibited the expression of self-regenerating genes such as Nanog, C-myc, Oct4, Sox2, Snail and CD44, which are known to be expressed in breast cancer stem cells. Accordingly, the Primaqueen inhibits the growth of breast cancer and breast cancer stem cells, and can be used for the treatment of cancer such as breast cancer.

Description

[0001] The present invention relates to a composition for inhibiting growth of cancer stem cells,

The present invention relates to a composition for inhibiting growth of cancer stem cells comprising Primaquine or a pharmaceutically acceptable salt thereof as an active ingredient, a pharmaceutical composition for inhibiting cancer metastasis or treating or preventing cancer, .

Interest in cancer stem cells has emerged as chemotherapy has not been able to effectively target and treat tumor cells in the tumor, leading to tumor recurrence and metastasis. Many cytotoxic anticancer drugs target rapidly proliferating cells, and cancer stem cells with slow proliferation characteristics can survive cytotoxic chemotherapy. Basal cell phenotype Breast cancer is believed to originate from the earliest mammary progenitor cell in the early stage of differentiation process and is known to be poor in prognosis and resistant to conventional chemotherapy. This is a good example to support that the target treatment for cancer stem cells failed.

Several treatments have been devised based on the cancer stem cell hypothesis. One of the most popular methods is the self-renewal pathway of cancer stem cells. The important point in this treatment is that the self regeneration of normal stem cells should be maintained while targeting only the self regeneration of cancer stem cells. For example, the Notch signal is driven by an enzyme called a secretase, and its inhibitor (secretase inhibitor) can be used to inhibit tumor growth when used in breast cancer that overexpresses Notch1. There is a recent report that the targeting of the Hedgehog signaling system also has an anticancer effect, which is that the tumor suppressor was dramatically reduced when cyclopamine, a hedgehog inhibitor, was administered to an animal tumor xenograft.

On the other hand, breast cancer is a common cancer in women and is known to be the leading cause of death in women with cancer (al A, Bray F, Center MM, Ferlay J, Ward E and Forman D. Global cancer statistics. 61 (2): 69-90). Breast cancer is still the most dangerous disease due to recurrence and metastasis, although polychemotherapy in early breast cancer and extensive mammograms and adjuvant therapies with tamoxifen have reduced the mortality rate of breast cancer. Cancer stem cells (CSCs) were first identified in myeloid leukemia and subsequently found in a variety of solid tumors, including breast, brain, colon, ovary, pancreas, and prostate cancer. The cancer stem cells may also be referred to as tumor-initiating cells and cancer stem-like cells. It has also been shown that a variety of cancer types, including breast cancer, are derived from cancer stem cells (CSCs), a small group of tumors. These groups are known to induce changes in tumor volume through self-renewal and differentiation. Shh (Sonic hedgehog), Stat3, NF-κB, Wnt / β-catenin, TGF-β and Notch signaling pathways are known to be critical for self-renewal of CSCs.

Cancer stem cells represent drug resistance and radiation resistance to chemotherapy and radiation therapy, and cause cancer recurrence and metastasis. Therefore, target therapy for cancer stem cells is essential for cancer treatment. Cancer stem cells are known to express certain proteins including Oct4, C-myc, Nanog, and Aldehyde dehydrogenase-1 (ALDH). The ALDH is an enzyme that oxidizes genetic toxic aldehyde and its enzyme activity is widely used as CSC (cancer stem cells) marker of leukemia, head and neck, bladder, bone, colon, liver, lung, pancreas, prostate, thyroid and cervical cancer have. ALDH is known as a therapeutic target for cancer stem cells. It is also known that the clinical specimens have an excellent ability to form tumors in the breast cancer group expressing CD44 ^high / CD24 ^low (Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ and Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci US A. 2003; 100 (7): 3983-3988).

Stat3 (signal transducers and activators of transcription 3) and NF-κB are mainly activated in CSCs, and mammalian mammosphere formation is associated with JAK1 / 2-STAT3 and NF-κB pathways. Secreted IL-6 activates the JAK1 / 2-STAT3 pathway and increases the expression of the Oct4 gene. The IL-6 / JAK1 / 2-STAT3 signaling pathway is known to be important for the conversion of NSCCs (Non-CSCs) to CSCs. Blocking the STAT3 signaling pathway has been shown to inhibit the growth of stem cell-like cells from CD44 ^high / CD24 ^low breast cancer cells. NF-κB transcription factors are structurally (constantly) activated and regulated by IκB kinase (IKK) complexes in tumor cells including colon, breast, and liver cancer. Pyrrolidinedithiocarbamate (PDTC), an inhibitor of NF-κB, is known to inhibit breast cancer stem-like cells.

It is known that the breast cancer stem cells can be identified by expression of biomarkers such as CD44 ^high / CD24 ^low , ESA + (epithelial specific antigen) and ALDH. Cancer chemotherapy is known to increase the proportion of cancer cells expressing CD44 ^high / CD24 ^low and the formation of mammoth pairs. CSCs overexpress specific ABC transporters to protect CSCs from toxins. ABC pumps are used to isolate the side population (SP) and can be classified by the ABCG2 transporter-specific Hoechst 33342 dyes. Because breast CSCs produce less reactive oxygen species (ROS) than tumor cells, breast cancer stem-like cells are radiation resistant. Because ROSs are the main mediators of ionizing radiation-induced apoptosis, CSCs are known to be less damaging to DNA than non-stem cancer cells (Diehn M, Cho RW, Lobo NA, Kalisky T, Dorie MJ, Kulp AN, 2009, Nature, 2009; 29 (1): 29-31. [CrossRef], [PubMed], [Web of Science ®] 458 (7239): 780-783).

The breast cancer cell lines MCF-7 and MDA-MB-231 are known to have a partial colony of cells with similar ability to grow into elliptical cells without apoptosis without attachment in vitro. When stuck culture conditions are artificially made by suspension culture, cells with the properties of stem cells attach to each other to form spherical cell clusters, and these cell masses are named as neurospheres. The application of this concept to human breast stem cells is called "mammosphere". Mammoth pairs have 8 times more progenitor cells than normal human breast cells, and are capable of continuous subculture. After several passages, 100% of the cells are all bi-potent precursors. Mammoth pairs can be differentiated into adult mammary gland epitherlial cells, ductal epithelial cells and alveolar epitherlial cells. In mammary glands, It is observed that a complex functional breast structure is formed in a three-dimensional structure. Mammoth pairs are one of the most distinctive features of stem cells. They are capable of multiplying themselves, so that a large number of mammoth pairs or mammary stem cells can be obtained from one mammoth pair. In addition, it has been confirmed that many expression genes are overlapped with hematopoietic stem cells, neural stem cells, embryonic stem cells, and the mammoth pair has been reported to be an actual breast stem cell. This standard method of analyzing the self-renewal ability of cancer stem cells is to analyze in vivo transplantation and in vitro mammoth pair formation.

In addition to breast cancer cell lines, cells having stem cell characteristics in various cancer cell lines including lung cancer can attach to each other to form spherical cell masses, which are called tumorspheres. The Tumor Spare means a tumor organs developed by the proliferation of one cancer stem cell or cancer precursor cell.

Until now, research on cancer stem cells has been limited, and its role in tumor formation and maintenance has not been clarified. In order to efficiently treat cancer stem cells only without damaging normal stem cells, knowledge and understanding of the molecular biologic characteristics important for maintenance and regulation of cancer stem cells and their control pathways are needed.

To date, there have been few studies on anticancer drugs or extracts derived from natural products that directly target cancer stem cells. Conventional techniques have been carried out to inhibit cancer stem cells by directly inhibiting target genes of cancer stem cells, or to inhibit cancer stem cells by suppressing high signal transduction proteins of cancer stem cells. However, many tumor patients have difficulty in targeting these genes due to mutations in the oncogenes or protein variants.

It is an object of the present invention to provide a composition for inhibiting cancer stem cell growth, which comprises Primaqueen represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for treating or preventing cancer, which comprises a composition for inhibiting cancer stem cell growth.

It is another object of the present invention to provide a pharmaceutical composition for suppressing cancer metastasis comprising the composition for inhibiting cancer stem cell growth.

Another object of the present invention is to provide a food composition for improving or preventing cancer, which comprises a composition for inhibiting cancer stem cell growth.

It is another object of the present invention to provide a food composition for improving or preventing cancer metastasis which comprises the composition for inhibiting cancer stem cell growth.

Another object of the present invention is to provide a method for inhibiting the growth of cancer stem cells in an individual other than a human, comprising administering Prima queen represented by the formula (1) or a pharmaceutically acceptable salt thereof.

The present inventors have confirmed that the compounds inhibit the growth of cancer stem cells by using various compounds as inhibitory candidates of cancer stem cells. Among them, it has been confirmed that primaquine selectively inhibits breast cancer stem cells. Although Primaquine is known to control malaria as an anti-malarial drug, it inhibits the growth of breast cancer stem cells for the first time by the present inventors and selectively inhibits the STAT3 signaling pathway in breast cancer-derived mammalian cells compared to MCF-7 bulk cells . In addition, it was confirmed that tumor growth was effectively inhibited by using a mouse xenograft model. Accordingly, it has been confirmed that Primaqueen can be used for cancer treatment including breast cancer by inhibiting the growth of cancer stem cells including breast cancer by targeting CSCs, and completed the present invention.

In order to achieve the above object, the present invention provides a composition for inhibiting cancer stem cell growth comprising Primaqueen represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

[Chemical Formula 1]

In the present invention, the Primaqueen is known as an anti-malarial drug, but it was confirmed by the present inventors that the growth of breast cancer stem cells was inhibited for the first time. In the present invention, the pharmaceutically acceptable salt of Primaqueen may be Primaqueen Phosphate and may be represented by Formula (2), but is not limited thereto.

(2)

In the present invention, the term "cancer " refers to or represents the physiological condition of a mammal that is generally characterized by unregulated cell growth. "Cancer " refers to a state in which abnormally excessive proliferation occurs due to a problem in regulating functions of normal division, differentiation, and death of cells, resulting in formation of lumps and destruction or transformation of existing structures.

In the present invention, the term "cancer stem cell" is undifferentiated cell capable of differentiating into various cancer cells, and examples of the cancer include colon cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer Lymphoma, gastric cancer, lung cancer, pancreatic cancer, liver cancer, esophageal cancer, small intestine cancer, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, head and neck cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, Cancer of the endocrine system, cancer of the thyroid, parathyroid cancer, adenocarcinoma, soft tissue sarcoma, urethral cancer, endometrioid cancer, endometrial carcinoma, endometrial carcinoma, endometrioid carcinoma, Penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, or pituitary adenoma. Although not limited thereto, the cancer stem cells may be stem cell of breast cancer.

The term "breast cancer stem cell" in the present invention means undifferentiated cells having the ability to differentiate into breast cancer cells.

The term "inhibiting breast cancer stem cell growth" in the present invention is meant to include inhibition of breast cancer stem cell maintenance, inhibition of breast cancer stem cell malignancy, breast cancer stem cell migration and invasive inhibition of breast cancer stem cells.

In one embodiment of the present invention, in order to determine whether Primaqueen can inhibit the growth of breast cancer stem cells, Primaqueen was added to primary mammoth mammosphere derived from MCF-7 and MDA-MB-231 cells As a result, it was confirmed that Primaqueen inhibits the formation of a first mammalian pair derived from a breast cancer cell line. Specifically, the number of mammoth pairs derived from breast cancer cells MCF-7 and MDA-MB-231 cells 70 to 90%, and it was confirmed that the size of the mammoth pair also decreased (FIGS. 3A and 3B). Accordingly, it has been confirmed that the Primaqueen of the present invention can inhibit the formation of mammosphere mosquitoes or inhibit the proliferation of mammoth pairs.

Accordingly, the compound of the present invention can inhibit the formation of mammalian mammosphere from breast cancer or inhibit the proliferation of mammalian pair derived from breast cancer.

In one embodiment of the present invention, the breast cancer stem cells may express one or more self-renewal genes selected from Nanog, C-myc, Oct4, Sox2, Snail and CD44. In one embodiment of the present invention, the Prima queen inhibited the expression of self-regenerating genes such as Nanog, C-myc, Oct4, Sox2, Snail and CD44, which are characteristic expressions in breast cancer stem cells (Fig. 5C) (FIG. 5A and FIG. 5B), which is involved in the formation of mammalian pairs of cells. Thus, it was confirmed that the compound could inhibit the growth of breast cancer stem cells.

The composition of the present invention can be used as a pharmaceutical composition or a food composition.

When the composition of the present invention is utilized as a pharmaceutical composition, it may contain the Primaqueen or a pharmaceutically acceptable salt thereof.

 The term "pharmaceutically acceptable salt" as used herein means all salts which possess the desired biological and / or physiological activity of the compounds and which exhibit minimal undesired toxicological effects. Means a salt prepared according to methods customary in the art, and such methods of preparation are known to those skilled in the art. In particular, the pharmaceutically acceptable salts include, but are not limited to, salts derived from pharmacologically or physiologically acceptable inorganic and organic acids and bases.

For example, pharmaceutically acceptable base addition salts may be prepared from inorganic and organic bases. Salts derived from inorganic bases may include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines; Substituted amines including naturally occurring substituted amines; And organic amines such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, The compounds of the present invention can be used in the form of hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamine, theobromine, purine, piperazine, piperidine, Lt; RTI ID = 0.0 > of Cyclic < / RTI > Carboxylic acid amides including other carboxylic acid derivatives such as carboxamides, lower alkylcarboxamide, di (lower alkyl) carboxamide, and the like can also be included.

For example, pharmaceutically acceptable acid addition salts may be prepared from inorganic and organic acids. Salts derived from inorganic acids include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, phosphoric acid and the like. Salts derived from organic acids include those derived from acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tartaric, citric, benzoic, cinnamic, But are not limited to, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and / or salicylic acid.

In the present invention, the pharmaceutical composition may contain a pharmaceutically acceptable carrier or an additive. In the present invention, the expression "pharmaceutically acceptable" means that the application (subject) does not have the above-mentioned toxicity that is adaptable without inhibiting the activity of the active ingredient. The "carrier" is defined as a compound that facilitates the addition of a compound into a cell or tissue.

The Primaqueen of the present invention may be administered alone or in combination with any convenient carrier, etc., and such dosage forms may be single-dose or repeated-dose formulations. The pharmaceutical composition may be a solid preparation or a liquid preparation. Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like. Solid form preparations may include, but are not limited to, carriers, flavoring agents, binders, preservatives, disintegrants, lubricants, fillers, and the like. Examples of the liquid preparation include water, a solution such as a solution of propylene glycol, a suspension, an emulsion, and the like, but not limited thereto, and it can be prepared by adding a suitable coloring agent, a flavoring agent, a stabilizer, a tackifying agent and the like. For example, the powders can be prepared by simple mixing of a pharmaceutical acceptable carrier such as lactose, starch, microcrystalline cellulose and Primaqueen which is an effective ingredient of the present invention. The granules may comprise the primaqueen of the present invention; A suitable pharmaceutically acceptable carrier; And a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone or hydroxypropylcellulose, followed by wet granulation using a solvent such as water, ethanol, or isopropanol, or dry granulation using a compressive force . Tablets can also be prepared by mixing the granules with a pharmaceutically acceptable, suitable lubricant such as magnesium stearate and then tableting using a tablet machine.

The primaqueen of the present invention can be administered orally or parenterally depending on the condition to be treated and the condition to be treated, such as an oral preparation, an injection (for example, intramuscular injection, intraperitoneal injection, intravenous injection, infusion, subcutaneous injection, implant) , Rectal, rectal, sublingual, transdermal, topical, and the like, but is not limited thereto. May be formulated into suitable dosage unit formulations, including those conventionally used and non-toxic, pharmaceutically acceptable carriers, additives, vehicles, depending on the route of administration.

The pharmaceutical composition of the present invention may be administered at a daily dose of from about 0.0001 mg / kg to about 10 g / kg, and from about 0.001 mg / kg to about 1 g / kg. However, the dosage may vary depending on the degree of purification of the mixture, the condition of the patient (age, sex, weight, etc.), severity of the condition being treated, and the like. For convenience, the total daily dose may be administered in divided doses several times a day as needed.

When the composition of the present invention is used as a pharmaceutical composition, the content of Primaqueen in the composition can be appropriately adjusted to an effective amount capable of exhibiting anti-inflammatory activity according to the symptom of the disease, the progression of symptoms, the condition of the patient, The amount of queen may be 0.0001 wt% or more, specifically 0.001 wt% or more, and 80 wt% or less, specifically, 50 wt% or less based on the total weight of the composition, but is not limited thereto.

Further, it has been confirmed that the Primaqueen of the present invention inhibits the growth (proliferation) of a mammalian pair derived from breast cancer cells, and thus it can be used as a food composition for inhibiting breast cancer stem cell growth.

When the composition of the present invention is used as a food composition, it may contain an acceptable food-aid additive, and may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of foods.

In the present invention, the term " food " means a natural product or a processed product containing one or more nutrients. Specifically, the term " food " means that the food can be directly eaten through a certain degree of processing. Functional foods, beverages, food additives, and beverage additives. Examples of the food include various foods, beverages, gums, tea, vitamin complex, and functional foods. In addition, the food of the present invention may contain special nutritional foods (eg, crude oil, spirit, infant food, etc.), meat products, fish products, tofu, jelly, noodles (eg, (Such as soy sauce, soybean paste, hot pepper paste, mixed sauce), sauces, confectionery (eg snacks), dairy products (eg fermented milk, cheese), other processed foods, kimchi, pickled foods But are not limited to, natural flavors (eg, ramen soup, etc.), vitamin complexes, alcoholic beverages, alcoholic beverages and other health supplement foods. The functional food, beverage, food additive or beverage additive may be produced by a conventional production method.

The term "functional food" as used herein refers to a food group that is imparted with added value to function or express the function of the food by physical, biochemical, biotechnological techniques, etc., or to control the biological defense rhythm of the food composition, Means a food which is designed and processed so as to sufficiently express the body's control function with respect to the living body. Specifically, it may be a health functional food.

The term "health functional food " as used in the present invention refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and rings using raw materials and components having useful functions in the human body. Here, the term "function" means that the structure and function of the human body can be used to control nutrients or obtain a beneficial effect for health use such as physiological action. The health functional food of the present invention can be prepared by a method commonly used in the art and can be prepared by adding raw materials and ingredients that are conventionally added in the art. In addition, the formulations of the above health functional foods may also be manufactured without limitations as long as they are acceptable as health functional foods. The composition for food of the present invention can be manufactured in various forms, and unlike general pharmaceuticals, it has the advantage that there is no side effect that may occur when a drug is used for a long period of time, and is excellent in portability, Can be ingested as an adjuvant to enhance the effect of breast cancer stem cell growth inhibition.

In addition, the functional food may include a food-acceptable food-aid additive, and may further include suitable carriers, excipients and diluents commonly used in the production of functional foods.

In addition, in the food composition, the amount of the primequeen may be 0.00001 wt% or more, specifically 0.1 wt% or more, and 80 wt% or less, specifically 50 wt% or less, more specifically 40 wt% or less , And when the food is a beverage, it is contained in a proportion of not less than 0.001 g, specifically not less than 0.01 g, not more than 50 g, specifically not more than 10 g, more specifically not more than 2 g based on 100 ml of the total volume of the food But is not limited thereto.

The food composition of the present invention may contain sweetening agents, flavoring agents, physiologically active ingredients, minerals and the like in addition to the active ingredients thereof. Sweetening agents may be used in an amount that sweetens the food in a suitable manner, and may be natural or synthetic. Specific examples of natural sweeteners include corn syrup solids, sugar sweeteners such as honey, sucrose, fructose, lactose and maltose. Flavors may be used to enhance taste or flavor, both natural and synthetic. Specifically, a natural one is used. When using natural ones, the purpose of nutritional fortification can be performed in addition to the flavor. Examples of natural flavoring agents include those obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, and the like, or those obtained from green tea leaves, Asiatica, Daegu, Cinnamon, Chrysanthemum leaves and Jasmine. Also, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, banks and the like can be used. The natural flavoring agent may be a liquid concentrate or a solid form of extract. Synthetic flavors may be used depending on the case, and synthetic flavors such as esters, alcohols, aldehydes, terpenes and the like may be used. Examples of the physiologically active substance include catechins such as catechin, epicatechin, gallocatechin and epigallocatechin, and vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine and riboflavin. As the mineral, calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium and zinc can be used.

In addition, the food composition of the present invention may contain preservatives, emulsifiers, acidifiers, thickeners and the like in addition to the above sweeteners.

Such preservatives, emulsifiers and the like are preferably added in a very small amount as long as they can attain an application to which they are added. The term " trace amount " means, when expressed numerically, in the range of 0.0005% by weight to about 0.5% by weight based on the total weight of the food composition. Examples of the preservative which can be used include calcium sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate and EDTA (ethylenediaminetetraacetic acid). Examples of the emulsifier which can be used include acacia gum, carboxymethyl cellulose, xanthan gum, pectin and the like. Examples of the acidulant that can be used include acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, and phosphoric acid. Such an acidulant may be added so that the food composition has a proper acidity for the purpose of inhibiting the growth of microorganisms other than the purpose of enhancing the taste. Agents that may be used include suspending agents, sedimentation agents, gel formers, bulking agents and the like.

In another aspect, the present invention provides a pharmaceutical composition for treating or preventing cancer, which comprises the composition for inhibiting cancer stem cell growth.

In one example of the present invention, it was confirmed that the treatment of Primaqueen with MCF-7 and MDA-MB-231 cells inhibited the growth of breast cancer cell lines (FIGS. 1A and 1B). In addition, in one embodiment of the present invention, the Primaquine inhibitor decreased the population expressing CD44 ^high / CD24 ^low in breast cancer cells (FIG. 4A) and decreased the proportion of ALDH-positive breast cancer cells (FIG. 4B) . Accordingly, in the present invention, the cancer may be, but is not limited to, breast cancer, and the composition may inhibit the growth of breast cancer cells expressing CD44 ^high / CD24 ^low , and may be used for the treatment of breast cancer with an aldehyde dehydrogenase (ALDH) The growth of the cells can be inhibited.

In another aspect, the present invention provides a pharmaceutical composition for suppressing cancer metastasis comprising the composition for inhibiting cancer stem cell growth.

The cancer is divided into a primary cancer that is present at the site of development and a metastatic cancer that spreads to other parts of the body from the site of development. The term " metastasis "refers to a condition in which malignant tumors have spread to other tissues distant from the onset of the disease. Cancer cells are formed by spreading through blood circulation or lymphatic circulation. They usually develop into new tumors after transferring to other organs by taking blood circulation. In contrast, cancer cells are formed by direct migration to neighboring tissues. In the present invention, cancer metastasis is caused by the spread of cancer cells by invasion of cancer cells that directly migrate into and penetrate into neighboring tissues, and the transfer of cancer cells through blood flow to physically form new tumors in the organs not adjacent to primary cancer (metastasis). On the other hand, in the above-mentioned metastasis, cell migration is essential. Therefore, it is clear that inhibiting the movement of cancer cells is a primary method for preventing cancer metastasis.

In the present invention, the cancer may be, but not limited to, breast cancer. The term "cancer "," cancer stem cell ", "cancer stem cell growth inhibition ", and" pharmaceutical composition "

In one embodiment of the present invention, it was confirmed that Primaqueen inhibits the migration of MDA-MB-231 cells and colony formation in a concentration-dependent manner (FIGS. 1F and 1G). Accordingly, the composition of the present invention can inhibit cancer metastasis by inhibiting the movement of cancer cells, and thus can be utilized as a pharmaceutical composition for inhibiting cancer metastasis.

In another aspect, the present invention provides a food composition for improving or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.

The term "cancer "," cancer stem cell ", "cancer stem cell growth inhibition ", and" food composition " In one embodiment of the present invention, it has been confirmed that the treatment of Primaqueen with MCF-7 and MDA-MB-231 cells inhibits the growth of breast cancer cell lines, and thus it can be used as a food composition for cancer prevention or prevention Do. In the present invention, the cancer may be breast cancer, but is not limited thereto.

In another aspect, the present invention provides a food composition for improving or preventing cancer metastasis comprising the composition for inhibiting cancer stem cell growth.

The term " cancer metastasis ", "cancer stem cell "," cancer stem cell growth inhibition ", and "food composition" In one embodiment of the present invention, it has been confirmed that Primaqueen inhibits the migration of MDA-MB-231 cells and colony formation in a concentration-dependent manner. As a result, it has been confirmed that Primaqueen inhibits cancer metastasis, It is available. In the present invention, the cancer may be breast cancer, but is not limited thereto.

In another aspect, the present invention provides a method for inhibiting the growth of cancer stem cells in a subject other than human, comprising administering Primaquine represented by the following formula (1) or a pharmaceutically acceptable salt thereof .

[Chemical Formula 1]

In the present invention, the terms "primate queen", "volatile", "cancer", "cancer stem cell", "cancer stem cell growth inhibition" are as described above.

The term "individual" in the present invention means all animals including humans who have developed cancer or have developed cancer. Mammals including birds, pigs, sheep, chickens, dogs, and the like, algae, etc., and the growth of cancer stem cells is inhibited by the administration of the composition of the present invention, .

The Primaqueen of the present invention inhibited the growth of breast cancer cells and inhibited the formation of breast cancer stem cells. In addition, it inhibited the expression of one or more self-renewal genes selected from Nanog, C-myc, Oct4, Sox2, Snail and CD44, which are known to be expressed in breast cancer stem cells, STAT3 signaling pathway, which is known to be involved in the formation of the STAT3 signaling pathway. Accordingly, the compound inhibits the growth of cancer stem cells such as breast cancer and the growth of these cancers, and thus can be used for the treatment of cancers such as breast cancer.

Figure 1 shows that Primaqueen inhibits various cancer features in breast cancer cell lines. Specifically, it shows the survival rates of MCF-7 and MDA-MB-231 cells according to (A and B) Primaquine phosphate structure and Primaqueen treatment. MCF-7 and MDA-MB-231 cells were treated with increasing concentrations of Primaquine for 48 hours. The antiproliferative effect of Primaqueen was measured by MTS analysis.
(C, D, E) breast cancer cells. MDA-MB-231 cells were treated with Primaqueen for 24 hours, and apoptotic cells were analyzed by FACS using the Annexin V-PI staining kit. The caspase-3/7 activity in MDA-MB-231 cells was analyzed by Caspase-Gloss 3/7 kit. Apoptotic cells were analyzed by fluorescence staining, and nuclei were stained with Hoechst 33258 (enlarged, x200) in breast cancer.
(F) The effect of Primaqueen on the migration potential of human breast cancer cells. Wound healing of MDA-MB-231 cells was performed at 0 h and 18 h, depending on whether Primaqueen treatment was applied.
(G) shows the effect of Primaqueen on colony formation in human breast cancer cells. The dissociated 1000 MDA-MB-231 cells were seeded into 6-well plates and treated with the indicated concentrations of Primaqueen and DMSO for 7 days. Representative images of colonies were recorded. The displayed data represents the mean ± SD of three independent experiments. * p < DMSO-treated control.
Figure 2 shows the effect of Primaquine on tumor growth in a xenograft model. Three million cells were injected into the breast fat pad of an immunodeficient NOD-SCID female nude mouse.
(A) The effect of Primaqueen on tumor growth in immunodeficient nude mice producing MCF-7 cells. The drug dose used is 10 mg / kg / day. After 9 weeks, the images were captured with an Odyssey® image (LICOR, pearl image system, USA). Using the IRDye 800 CW Optical Probe (2DG), a high grade of tumor was used to detect breast tumors on the 800 nm channel and was expressed in pseudo-color.
(B) Tumor volume was measured twice weekly using a caliper and calculated as (width ² x length) / 2. Tumor growth curves were monitored during the experiment.
(C) the effect of Primaquine on the weight of the tumor.
Tumor volume was measured after treatment initiation. Compared with the control group, * p < 0.05. Representative images were captured at the end of 9 weeks after treatment and the results were expressed as vehicle-treated controls, primequeen-treated mice.
Figure 3 shows the effect of Primaqueen on mammoth pair formation. MCF-7 and MDA-MB-231 cells were cultured for 7 days under conditions of mammoth pair formation.
(A) shows the effect of Primaqueen on the formation of mammalian pairs derived from MCF-7 cells. Primary mammalian pairs were cultured with Primaqueen (2.5 and 5 μM) or DMSO.
(B) shows the effect of Primaqueen on the formation of mammalian pairs derived from MDA-MB-231 cells. The mammoth pair was incubated with Primaqueen (10 and 20 [mu] M) or DMSO. MCF-7 and MDA-MBB-231 cells were treated with Primaqueen and DMSO for 7 days. Images were obtained with a 10x magnification microscope and represent representative mammoth pairs (scale bar = 100μm).
The displayed data represents the mean ± SD of three independent experiments. * p < DMSO-treated control.
Figure 4 shows the effect of Primaqueen on the expression of cancer stem cell markers in breast cancer cell lines.
(A) Represent the population of CD44high / CD24low cells analyzed by flow cytometer analysis on Primaqueen (5 μM) or DMSO-treated MDA-MB-231 cells. For FACS analysis, 50,000 cells were obtained. Gating was based on a control antibody.
(B) shows the effect of Primaqueen on the ALDH positive cell population. MDA-MB-231 cells were pretreated with PrimaQueen (10 μM) or DMSO for 2 days and then subjected to ALDEFLUOR analysis and FACS analysis. The right panel shows ALDH-positive cells treated with DEAD, the ALDH inhibitor as a negative control, and the left panel shows ALDH-positive cells not treated with DEAB. The ALDH positive group was marked on the box.
Figure 5 shows the effect of Primaqueen on the STAT3 signaling pathway in breast cancer mammoth pairs.
(A) shows the effect of Primaqueen on the STAT3 signaling pathway in the mammoth pair. Nucleic protein expression and activation of STAT3 and NF-kB were measured in mammalian pairs as antibodies to pSTAT3, STAT3, P65 and lamin B, respectively. Primaqueen reduced the level of nuclear p-STAT3 protein in the mammoth pair.
(B) EMSA (electrophoretic mobility shift) analysis of mammalian pair nuclear lysates derived from MDA-MB-231 cells treated with Primaqueen. Nuclear lysates were incubated with biotin-labeled Stat3 probe and separated by 6% PAGE.
Lane 1: probe alone; Lane 2: probe + nuclear extract; Lane 3: probe + prime queen treated nuclear extract; Lane 4: Self-competition; Lane 5: Nuclear extract cultured with mutant STAT3 probe. The Primaqueen reduced DNA / STAT3 interactions in mammoth pair nuclear lysates.
(C) Transcriptional expression levels of the CSC markers Nanog, C-myc, Oct4, Sox2, snail and CD44 genes were measured by real-time PCR (RT-PCR) using primers specific for CSC markers in Primaqueen and DMSO- . β-actin was used as an internal control.
(D) the effect of prime queen on mammoth pair growth. The Primaqueen inhibits mammoth pair growth. The Primaqueen and DMSO-treated mammoth pairs were dissociated into single cells for 2 days and plated in 6 cm dishes in the same cell count. Cells were counted 24 hours after plating. On days 2 and 3, cells were counted and plotted as mean values. The data represent the mean ± SD of three independent experiments. * p < DMSO-treated control.

Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

<A: Materials and Methods>

Example  1: Experimental material

6-well culture plates containing very low attachment cluster plates were obtained from Corning (Tewksbury, Mass., USA). Primaqueen was purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). Cell viability was measured using CellTiter 96® aqueous one-cell cell proliferation assay kit (Promega, Madison, WI, USA). The ALDEFLUOR ™ Kit was purchased from STEMCELL Technologies Inc (Vancouver, BC, Canada).

Example  2: Human breast cancer cell culture and Mammoth Fair ( mammospheres ) formation

Human breast cancer cells, MCF-7 and MDA-MB-231, were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). MCF-7 and MDA-MB-231 cells were cultured in Dulbecco's Modified Essential Medium (DMEM; Hyclone, USA) containing 10% fetal bovine serum (FBS; Hyclone), 100 U / ml penicillin, and 100 μg / ml streptomycin Logan, UT, USA). The MCF-7 and MDA-MB-231 cells were maintained at 37 [deg.] C in a humidified incubator containing 5% CO ₂ . The cells were plated at a density of 1x10 &lt; ⁶ &gt; cells in a 10 cm culture dish. MCF-7 and MDA-MB-231 cells were cultured in an ultra-low attachment 6-well containing 2 ml of complete MammoCult ^TM medium (StemCell Technologies, Vancouver, BC, Canada) to establish a primary mammoth pair plates were inoculated at a cell number of 3.5-4 × 10 ⁴ and 0.5-1 × 10 ^{4 per} well. The complete MammoCult ^™ medium was supplemented with 4 μg / ml heparin, 0.48 μg / ml hydrocortisone, 100 U / ml penicillin and 100 μg / ml streptomycin. The cells were cultured in a 5% CO ₂ incubator at 37 ° C for 7 days.

Example  3: Breast cancer Mammoth Fair  Automatic calculation

On the 7th day of culture, a cell culture plate was placed on a scanner (Epson Perfection V700 PHOTO, Epson Korea, Co, Seoul, Korea) to obtain an 8-bit gray scale image of the mammoth pair. At low resolution (300 dpi), images were obtained using the NICE software program and downloaded from ftp://ftp.nist.gov/pub/physics/mlclarke/NICE. For counting, a preferred number of rows and columns (e.g., 2 x 3 for a 6-well plate) was selected to create ROIs and after selecting the elliptical setting of the NICE program, The provided ROI shape was moved and resized to define it. The background signal of the image was negated using a threshold algorithm, and the selected image was automatically counted. The mammoth pair formation assay determined the formation efficiency (MFE,%) of the mammoth pair in correspondence with the number of total cells plated per 100 number of mammoth pairs per well / well.

Example  4: Breast cancer cell proliferation assay

The proliferation rate of MCF-7 and MDA-MB-231 cells was measured using a CellTiter 96 aqueous one solution cell proliferation kit. MCF-7 and MDA-MB-231 cells were cultured in 96-well plates in the presence of Primaquine 0, 5, 10, 20, 40, and 80 uM for 48 hours. Absorbance was determined at 490 nm using a 96-well plate reader (Dynex Revelation, Dynex Ltd., Billingshurst, UK) according to the manufacturer's protocol. Each data was determined by measuring three sets.

Example  5: Caspase -3/7 ( Caspase -3/7) Analysis

Cancer cells were treated with different concentrations of Primaquine for 24 hours. Caspase-3/7 activity was followed by manufacturer's instructions for the Capase-Glo 3/7 kit (Promega, Wisconsin, USA). 100 [mu] l of Caspase-Glo3 / 7 reagent was added to the cancer cells cultured 96-well. The plate was covered with a plate sealer, incubated at room temperature for 6 hours, and measured using a plate-reading luminometer, GloMax® Explorer (Promega, Wisconsin, USA).

Example  6: Annexin ( Annexin ) V / PI staining analysis

Cancer cells were cultured in 6-well plates and cultured with Primaqueen (20 μM) or DMSO for 24 hours. Double-stained with PI and FITC-Annexin V according to the manufacturer's instructions. The samples were analyzed by flow cytometry (Accuri C6, BD, San Diego, Calif., USA).

Example  7: Cell death by fluorescence staining

MDA-MB-231 cells were treated with Primaqueen 30 μM for 24 hours and the cells were incubated with Hoechst 33258 solution (10 mg / ml) for 10 minutes at 37 ° C. The cells were then observed with a fluorescence microscope.

Example  8: Clonogenic  analysis

MDA-MB-231 cells were inoculated at low density in 6-well plates and treated with different concentrations of Primaqueen in DMEM medium. After 24 hours, the medium was replaced with fresh medium and cultured for 7 days. Growth colonies were counted.

Example  9: scratch  Movement analysis

MDA-MB-231 cells were seeded into 6-well plates and grown to 90% confluency. A scratch was made on the cell layer using a sterile white micropipette tip. After washing with DMEM medium, breast cancer was treated with Primaquine or DMSO. At 16 hours, wounded areas were photographed with a 10x optical microscope.

Example  10: expression of CD44 and CD24 Flow cell  Analysis cytometric  analysis)

Expression of CD44 and CD24 in MDA-MB-231 cells was measured by FACS analysis. After isolating and harvesting cells using 1X trypsin / EDTA, one million cells were suspended and incubated with FITC-conjugated anti-human CD44 and PE-conjugated anti-human CD24 antibody (BD Pharmingen, San Diego, ) And incubated at 4 [deg.] C for 30 minutes. The cells were then washed three times with 1X PBS and analyzed by flow cytometry (Accuri C6, BD, San Diego, Calif., USA).

Example  11: Real time PCR  (RT- PCR )

The levels of transcripts were measured with the One Step SYBR PrimeScript RT-PCR kit (Takara, Tokyo, Japan) using SYBR green as a double-stranded DNA specific dye according to the manufacturer's instructions. One-step RT-PCR reactions were performed using 1 μg of total RNA, 10 μl of 2X One Step SYBR RT-PCR Buffer IV, 1 μl of PrimeScript 1 step Enzyme Mix II, CD44, NANOG, OCT4, SOX2, C-myc, Snail and β- Lt; / RTI &gt; PCR primers, and 10 &lt; RTI ID = 0.0 &gt; uM &lt; / RTI &gt; of PCR forward primer and PCR reverse primer.

The forward and reverse primers are as follows.

CD44 forward primer: AGAAGGTGTGGGCAGAAGAA (SEQ ID NO: 1),

CD44 reverse primer: AAATGCACCATTTCCTGAGA (SEQ ID NO: 2),

NANOG forward primer: ATGCCTCACACGGAGACTGT (SEQ ID NO: 3),

NANOG reverse primer: AAGTGGGTTGTTTGCCTTTG (SEQ ID NO: 4),

OCT4 forward primer: AGCAAAACCCGGAGGAGT (SEQ ID NO: 5),

OCT4 reverse primer: CCACATCGGCCTGTGTATATC (SEQ ID NO: 6),

SOX2 forward primer: TTGCTGCCTCTTTAAGACTAGGA (SEQ ID NO: 7),

SOX2 reverse primer: CTGGGGCTCAAACTTCTCTC (SEQ ID NO: 8),

C-myc forward primer: AATGAAAAGGCCCCCAAGGTAGTTCC (SEQ ID NO: 9),

C-myc reverse primer: GTCGTTTCCGCAACAAGTCC (SEQ ID NO: 10),

Snail forward primer: ACCACTATGCCGCGCTCTT (SEQ ID NO: 11),

Snail reverse primer: GGTCGTAGGGCTGCTGGAA (SEQ ID NO: 12),

β-actin forward primer: TGTTACCAACTGGGACGACA (SEQ ID NO: 13),

β-actin reverse primer: GGGGTGTTGAAGGTCTCAAA (SEQ ID NO: 14).

The relative expression level of the mRNA of the target gene was calculated using the comparative CT method. At least three independent PCR procedures were performed following statistical analysis. PCR products were normalized to the β-actin gene by internal control.

Example  12: ALDEFLUOR  analysis

The ALDEFLUOR assay system provides a novel approach to the identification, evaluation and isolation of CSCs based on the activity of aldehyde dehydrogenase (ALDH). Activated reagent BODIPY-aminoacetaldehyde was added to breast cancer cells and converted to fluorescent BODIPY-aminoacetate by aldehyde dehydrogenase (ALDH). The ALDH inhibitor, diethylaminobenzaldehyde (DEAB), was used as a negative control. MDA-MB-231 cells were treated with 10 μM for 24 h, and the proportion of ALDH-positive cells was analyzed by ALDEFLUOR assay. ALDH positive and negative cells were classified using flow cytometry (Accuri C6, BD, San Diego, Calif., USA).

Example  13: Western Blasting

Proteins isolated from prime queen-treated MCF-7 and MDA-MB-231 mammoth pairs were separated on 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, Mass., USA). The membrane was blocked in PBS-Tween 20 (0.1%, v / v) containing 5% skimmed milk at room temperature for 30 minutes. The blot was incubated overnight at 4 [deg.] C with blocking solution containing primary antibody. The primary antibodies used were: Stat3, p65, Lamin B, and phospho-Stat3 (Cell Signaling, Beverly, Mass., USA). β-actin (Santa Cruz Biotechnology) was used as a loading control. After washing with PBS-Tween 20 (0.1%, v / v), the blot was incubated with horseradish peroxidase-conjugated secondary antibody and sensitized with a chemiluminescence detection kit (Santa Cruz Biotechnology).

Example  14: Electrophoretic  mobility shift assays ( EMSA )

EMSA was detected using a chemiluminscet EMSA kit (Thermoscientific, IL, USA) from Lightshift under manufacturer's instructions. The biotin-upper and lower probes (5'-CTTCATTTCCCGGAAATCCCTA-Biotin 3 ', SEQ ID NO: 15 and 5'-TAGGGATTTCCGGGAAATGAAG-Biotin 3', SEQ ID NO: 16) of the Stat3 probe were annealed and the double stranded oligonucleotides were labeled with biotin. Nuclear extracts from MCF-7 and MDA-MB-231 cells were prepared as described in the references (Choi HS, Hwang CK, Kim CS, Song KY, Law PY, Wei LN and Loh HH. Transcriptional regulation of mouse mu opioid receptor gene: Sp3 isoforms (M1, M2) function as repressors in neuronal cells to regulate the mu opioid receptor gene (Mol Pharmacol. 2005; 67 (5): 1674-1683).

The biotin-labeled DNA probes were incubated with prime queen-treated nucleoprotein in a final volume of 20 占 퐇 of EMSA buffer containing 1 占 퐂 / 占 poly poly [dl-dC] at room temperature for 20 minutes. The reaction mixture was electrophoresed on a 6% polyacrylamide unmodified gel in 0.5 × TBE (45 mM Tris borate and 1 mM EDTA) at 4 ° C. and visualized using a chemiluminescent nucleic acid detection kit (Thermoscientific, IL, USA) Respectively.

Example  15: Immunodeficiency to produce breast cancer cells NOD- SCID  ( BALB / cSIc  (nu / nu)) female Nude mouse chemotherapy

NOD-SCID (BALB / cSIc (nu / nu)) female nude mice producing a total of 18 breast cancer cells were divided into three groups. The negative control mice, 6, did not receive chemotherapy. However, the volume of the tumor in the control mice was measured every 3 days and calculated using the formula (width ² x length) / 2. The other six nude mice received Primaquine using an infusion of breast fat pad at an optimal dose of 10-50 mg / kg / day. The remaining last group was used as a non-tumor group without treatment.

Example  16: Statistical analysis

All data were expressed as mean ± standard deviation (SD). Data were analyzed using student's t-test. A p-value lower than 0.05 was considered statistically significant (GraphPad Prism 5 Software, San Diego, Calif., USA).

<B: Experimental Example > Effects of breast cancer on stem cells and breast cancer

Experimental Example  One: Primaquine  Inducing apoptosis of human breast cancer cells and inhibiting proliferation

The MTS analysis was performed after pretreatment of prime queen in concentrations of MCF-7 and MDA-MB-231 in Primaqueen human breast cancer cell lines shown in FIG. 1A. As a result, it was confirmed that the growth of breast cancer cell lines was inhibited in a concentration-dependent manner at a concentration of more than 80 μM of Primaquine in MCF-7 cell line and more than 40 μM of Primaquine in MDA-MB-231 cell line after 48 hours of PrimaQue treatment 1B).

Next, it was confirmed that the number of breast cancer cells killed (annexin V +) in MDA-MB-231 cells was increased by treatment with Primaquine 40 μM (FIG. 1C).

Next, fluorescence analysis of caspase 3/7 was performed on MDA-MB-231 cells. As a result, it was confirmed that the activity of caspase 3/7 was induced by treatment with Primaqueen 30 μM (FIG. 1D) . In addition, it was confirmed that apoptotic bodies were induced in MDA-MB-231, a breast cancer cell line, by Primaquine treatment (Fig. 1E). In addition, Primaqueen inhibited the migration and colony formation of MDA-MB-231 cells in a concentration-dependent manner (FIG. 1F and FIG. 1G). These results indicate that Primaqueen effectively inhibits various cancer characteristics (proliferation, migration, apoptosis and colony formation).

Experimental Example  2: Prima Quinn  Inhibition of tumor growth in xenotransplantation model

In Fig. 1, Prima queen inhibits the proliferation of breast cancer cells in vitro. Next, we examined whether Primaqueen inhibits tumorigenesis in a xenograft tumor model. As a result, tumor volume in the Primaqueen treated group was smaller than in the control group not treated with Primaqueen (Figs. 2A and 2B). Tumor weight in the Primaquine treated group was also smaller than in the control group not treated with Primaquine (Fig. 2C). However, the body weight of the mice in the Primaquine treated group was similar to that of the control group (Fig. 2A). These results indicate that Primaqueen effectively inhibits tumorigenesis in a xenograft model.

Experimental Example  3: Prima Quinn  Effect to suppress breast cancer stem cells

To assess whether Primaqueen could inhibit the formation of tumorsphere, different concentrations of primequeen were treated in primary mammoth mammosphere derived from MCF-7 and MDA-MB-231 cells . As shown in Figure 3, Primaqueen inhibited the formation of primary mammalian pairs derived from the breast cancer cell line MCF-7. The number of mammoth pairs decreased to 70 ~ 90%, and the size of mammoth pairs decreased (Figure 3A). In addition, the number and size of primary mammoth mammosphere derived from MDA-MB-231 cells were also reduced by the Pramarkein treatment (Fig. 3B).

Experimental Example  4: Prima Quinn CD44 ^high / CD24 ^low To  And ALDH  The effect of reducing the proportion of benign breast cancer cells

MDA-MB-231 cells were treated with Primaquine for 24 hours and the effect of the Primaqueen inhibitor was investigated in a subpopulation expressing CD44 ^high / CD24 ^low in breast cancer cells. As a result, the Primaquine inhibitor reduced the population expressing CD44 ^high / CD24 ^low in breast cancer cells (FIG. 4A). MDA-MB-231 cells were pretreated with Primaqueen for 24 hours and ALDEFLUOR analysis was performed to investigate the effect of Primaquine inhibitor on the proportion of ALDH-positive breast cancer cells. As a result, it was confirmed that Primaqueen reduced the proportion of ALDH-positive breast cancer cells from 0.9% to 0.3% (Fig. 4B).

Experimental Example  5: Prima Quinn At the Mammoth Fair STAT3  The effect of inhibiting the signal path

To investigate the cellular function of prime queen, STAT3 and NF-kB signaling pathways were investigated in mammalian pairs derived from MCF-7 cells under primequeen treatment. As a result, Primaqueen reduced the phosphorylation of nuclear STAT3 protein compared to the control. However, Primaqueen did not decrease the protein level of nuclear p65 (Fig. 5A).

We also analyzed the binding of PrimaQue treated nuclear extract and Stat3 DNA using biotin-labeled Stat binding probes that bind with high affinity to STAT3. As a result, Primaqueen inhibited the binding of Stat3 to the biotin-labeled Stat probe, as shown in Figure 5B (Figure 5B, lane 3). The specificity of the pStat3 / biotin-labeled Stat probe is determined by the unlabeled excess self-competitor (Figure 5B, lane 4) and the mutated Stat competitor (Figure 5B, 5). These data indicate that the Stat3 signaling pathway is important in regulating the growth and regeneration of the mammoth pair and that Primaqueen inhibits self regeneration of the mammoth pair through the Stat3 signaling pathway.

Experimental Example  6: Prima Quinn Of the stem cells (CSCs)  Self-regulated gene expression and Mammoth Effect of suppressing proliferation of fish

To confirm whether Primaqueen inhibits the expression of self-regenerating genes, self-regulated gene expression was examined by real-time PCR (RT-PCR). As a result, Primaqueen reduced the expression of self regenerating genes such as Nanog, Sox2, Oct4, snail, C-myc and CD44 in breast cancer cells (Fig. 5C).

Next, in order to confirm whether Primaqueen inhibits the proliferation of the mammoth pair, the prime queen was treated with the mammoth pair, and the number of the cells of the mammoth pair was counted. As a result, Primaqueen induced cell death of the mammoth pair, and the number of cells observed in the primequeen treated mammoth pair was small. These results indicate that Primaqueen significantly reduces mammoth pair proliferation (FIG. 5D).

Through the above experimental examples, it was confirmed that Primaqueen of the present invention not only inhibited the proliferation of breast cancer but also inhibited the growth of stem cells of breast cancer, and thus it could be used for the inhibition of growth of breast cancer and its stem cells I could.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

The present invention was supported by the Basic Science Research Program (2016R1A6A1A03012862) and the Regional University Specialization Project (CK-I) through the Korea Research Foundation (NRF).

<110> Jeju National University Industry-Academic Cooperation Foundation <120> Composition for inhibiting a growth of cancer stem cells          comprising primaquine <130> DP20160315 <160> 16 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD44 forward primer <400> 1 agaaggtgtg ggcagaagaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD44 reverse primer <400> 2 aaatgcacca tttcctgaga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NANOG forward primer <400> 3 atgcctcaca cggagactgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NANOG reverse primer <400> 4 aagtgggttg tttgcctttg 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> OCT4 forward primer <400> 5 agcaaaaccc ggaggagt 18 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OCT4 reverse primer <400> 6 ccacatcggc ctgtgtatat c 21 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SOX2 forward primer <400> 7 ttgctgcctc tttaagacta gga 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX2 reverse primer <400> 8 ctggggctca aacttctctc 20 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Cmyc forward primer <400> 9 aatgaaaagg cccccaaggt agttatcc 28 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cmyc reverse primer <400> 10 gtcgtttccg caacaagtcc 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Snail forward primer <400> 11 accactatgc cgcgctctt 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Snail reverse primer <400> 12 ggtcgtaggg ctgctggaa 19 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta actin forward primer <400> 13 tgttaccaac tgggacgaca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta actin reverse primer <400> 14 ggggtgttga aggtctcaaa 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> biotin upper strand of Stat3 probe <400> 15 cttcatttcc cggaaatccc ta 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> biotin lowe strand of Stat3 probe <400> 16 tagggatttc cgggaaatga ag 22

Claims (14)

1. A composition for inhibiting breast cancer stem cell growth comprising as an active ingredient Primaquine or a pharmaceutically acceptable salt thereof represented by the following formula (1).
[Chemical Formula 1]

The composition of claim 1, wherein the pharmaceutically acceptable salt of Primaqueen is Primaqueen Phosphate. delete The composition according to claim 1, wherein the Primaqueen represented by Formula (1) inhibits the formation of mammalian mammosphere from breast cancer or inhibits the proliferation of mammalian pairs derived from breast cancer. The composition of claim 1, wherein the breast cancer stem cell expresses one or more self-renewal genes selected from Nanog, C-myc, Oct4, Sox2, Snail and CD44. A pharmaceutical composition for treating or preventing breast cancer, comprising the composition of any one of claims 1, 2, 4, and 5. delete The pharmaceutical composition according to claim 6, wherein the composition inhibits the growth of breast cancer cells expressing CD44 ^high / CD24 ^low . The pharmaceutical composition according to claim 6, wherein the composition inhibits the growth of aldehyde dehydrogenase (ALDH) -positive breast cancer cells. A pharmaceutical composition for inhibiting metastasis of breast cancer comprising the composition of any one of claims 1, 2, 4, and 5. delete A food composition for improving or preventing breast cancer, comprising the composition of any one of claims 1, 2, 4 and 5. A food composition for improving or preventing the metastasis of breast cancer, comprising the composition of any one of claims 1, 2, 4 and 5. A method for inhibiting the growth of breast cancer stem cells in a subject other than human, comprising administering Prima queen represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
[Chemical Formula 1]

Images