KR20180135703A - Diagnostic biomarker for alzheimer's disease and use thereof - Google Patents

Abstract

The present invention relates to a biomarker for diagnosis of Alzheimer′s dementia and uses thereof. MiR-1273g-3p as a biomarker for the diagnosis of Alzheimer′s dementia, according to the present invention, shows an increased expression level in pre-clinical Alzheimer′s dementia patients, patients with mild cognitive impairment and patients with Alzheimer′s dementia compared to normal groups. Therefore, the miR-1273g-3p can be useful as an early diagnostic marker for Alzheimer′s dementia.

Description

[0001] DIAGNOSTIC BIOMARKER FOR ALZHEIMER'S DISEASE AND USE THEREOF [0002]

The present invention relates to a biomarker for the diagnosis of Alzheimer's dementia and its use.

As Korea becomes the world's fastest aging population, there is growing interest in diseases related to aging and its treatment. In particular, the rapid increase in the number of patients with dementia following the aging of Korea is becoming a serious problem. According to a survey by the Ministry of Health and Welfare in 2012, there were 534,000 dementia patients aged 65 or older at the time, and 9% of the total 5.9 million elderly people over 65 years old were identified as dementia patients. In 2012, Alzheimer's Dementia was ranked first with 71.3% of the nation's total dementia population. Alzheimer's dementia, which occurs sporadically in the elderly over 65 years of age, gradually develops and is a degenerative brain disease that progresses gradually with deterioration of cognitive function including memory.

Dementia is an irreversible disease that can not be cured or recovered unless it is diagnosed early. Therefore, preemptive management through prevention and early screening is the only alternative to delaying the onset of dementia. Cognitive psychological tests such as simple mental state examination (MMSE), montreal cognitive test (MoCA) and olfactory recognition test (UPSIT), cerebrospinal fluid examination, PET / MIR brain imaging and blood test are commonly used have. However, the cognitive psychological test has disadvantages such as physical, psychological, and racial influences that are difficult to quantify because of its subjectivity, and it is difficult to apply it universally because of long time testing and high cost problems. In early dementia, It is hard to predict dementia by psychological examination alone. In addition, lumbar puncture for CSF examination is a screening technique with high rejection due to pain. In addition, the diagnosis of Alzheimer's dementia using PET / MIR brain imaging can be performed after the disease progresses considerably, so that it is difficult to diagnose early and high cost problems arise. Therefore, studies are being actively conducted to develop a biomarker capable of diagnosing dementia only by blood tests so as to minimize the suffering and rejection of the patient and reduce the cost. However, there is no consistency of the test results due to differences in genetic and lifestyle habits of individual patients, experimental techniques, and analysis techniques.

In Korea, dementia diagnosis in Korea has been mostly developed in foreign countries. However, there are few reports on genetic variation and brain structure of dementia induced by Westerners and Koreans. However, due to the lack of data on Koreans and the lack of analytical techniques for diverse genetic variations among individuals, it is not possible to develop meaningful and applicable indicators for Koreans.

Accordingly, the inventors of the present invention have been studying a screening technique for solving the problems of the existing Alzheimer's dementia screening technique, such as long time consuming, high cost, pain inconsistency, inconsistent results, and absence of significant dementia screening technique for Koreans, The present inventors have found that the specific miRNAs are significantly increased in plasma of patients with pre-dementia, mild cognitive impairment and Alzheimer's dementia compared to normal individuals. In particular, Dorval (2013) has been reported to develop a specific blood-based miRNA biomarker for Alzheimer's dementia in Western populations, but no study has yet been published on the selection of plasma miRNA biomarkers for Koreans.

 Dorval et al., Front. Mol. Neurosci., 2013 Aug 30; 6: 24

It is an object of the present invention to provide a biomarker for diagnosing Alzheimer's dementia.

Another object of the present invention is to provide an information providing method for diagnosing Alzheimer's dementia using the biomarker.

It is still another object of the present invention to provide a screening method for preventing or treating Alzheimer's dementia.

In order to achieve the above object, the present invention provides a biomarker for diagnosing Alzheimer's disease comprising miR-1273g-3p.

In order to accomplish the above other objects, the present invention provides a method for detecting miR-1273g-3p, comprising the steps of 1) measuring the expression level of plasma miR-1273g-3p in blood collected from an individual, 2) And 3) when the expression level of the miRNA is higher than that of a normal miR-1273g-3p expression level, the individual is in any one state selected from the pre-Alzheimer's stage of dementia, the mild cognitive impairment stage and the Alzheimer's dementia stage The method comprising the steps of: (a) diagnosing Alzheimer's disease;

In order to achieve the above another object, the present invention provides an Alzheimer's dementia diagnostic kit comprising a nucleotide of miR-1273g-3p, a nucleotide complementary thereto, or a fragment of the nucleotide.

According to another aspect of the present invention, there is provided a diagnostic kit for Alzheimer's disease comprising a primer or a probe specifically binding to miR-1273g-3p represented by SEQ ID NO: 1.

In another aspect, the present invention provides a method for producing miR-1273g-3p, comprising the steps of 1) administering miR-1273g-3p to a cell line, 2) Measuring the expression level of at least one selected from the group consisting of? -Amyloid (1-42), BACE1 and Nicastrin in the cell line to which the test substance is administered, and 4) selecting a test substance having decreased expression level of at least one selected from the group consisting of? -Amyloid (1-42), BACE1 and Nicastrin compared with a control group to which no test substance is administered; Or therapeutic agent screening method.

According to another aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating Alzheimer's dementia comprising the screening substance as an active ingredient.

MiR-1273g-3p as a biomarker for diagnosis of Alzheimer's dementia according to the present invention has an increased expression in pre-clinical Alzheimer's dementia patients, patients with mild cognitive impairment and patients with Alzheimer's dementia as compared to normal persons. Thus, miR-1273g-3p can be usefully used as an accurate early diagnosis marker for Alzheimer's Dementia. In addition, the method of diagnosing Alzheimer's dementia using miR-1273g-3p is a method of diagnosing dementia by collecting blood, and it is possible to reduce the cost of dementia examination, and the sampling method is non-invasive and simpler Therefore, the prevalence of early diagnosis of dementia is expected to decrease.

FIG. 1 is a graph showing the results of discrimination of miRNAs showing significant changes according to each test group in Normal, Hard Cognitive Dysfunction (MCI) and Alzheimer's Dementia (AD), and classified into five clusters through hierarchical clustering .
Figure 2a shows the results of quantitative polymerase chain reaction (qPCR) analysis of miR-1273g-3p in the Alzheimer's dementia (AD) experimental group.
Figure 2b shows the receiver operating characteristic (ROC) curve analysis performed to determine the sensitivity and specificity of Alzheimer's dementia screening through qPCR analysis of miR-1273g-3p.
Figure 3a shows the results of qPCR analysis for miR-1273g-3p in each experimental group for normal, pre-clinical alzheimer's disease (PCA), mild cognitive impairment (MCI) and Alzheimer's dementia will be.
FIG. 3B shows the results of ROC curve analysis performed to confirm the sensitivity and specificity of Alzheimer's Dementia screening through qPCR analysis of miR-1273g-3p.
Figures 4a and 4b show the neuropsychological test (K-MMSE, SNSB) score and plasma miR-1 level of normal, preclinical Alzheimer's dementia (PCA), mild cognitive impairment (MCI) and Alzheimer's dementia (AD) 1273g-3p. ≪ tb >< TABLE >
FIG. 5A shows the change in the amount of β-Amyloid (1-42) (Aβ42) released into the culture medium from the H4-APPswe cell line, which is a dementia model cell line according to miR-1273g-3p mimic injection. At this time, CM stands for conditioned media.
5B and 5C show changes in the expression levels of BACE1 and Nicastrin, which promote the formation of β-amyloid (1-42), by miR-1273g-3p mimic transfection into H4-APPswe cells by western blot assay ).
FIG. 5d shows qPCR analysis of changes in mRNA expression levels of BACE1 and Nicastrin following miR-1273g-3p mimic injection into H4-APPswe cells.

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention provides a biomarker for diagnosing Alzheimer's disease comprising miR-1273g-3p.

miRNAs produce two types of mature miRNAs from precursors, either '-3p' or '-5p' when they contain different arms (3 'arm or 5' arm) of the same pre-microRNA. Add miR-n-3p or miR-n-5p to the back. In this case, n is a number and generally indicates a naming sequence. For example, miR-121a and miR-121b were generated from their respective precursors, mir-121a and mir-121b, and the sequence was also very high similar. Here, " mir- " refers to pre-miRNA, and " miR- " with an upper case means mature miRNA. In addition, miRNA nomenclature by species is indicated at the front, for example, hsa-miR-123 is a homo sapiens miRNA and oar-miR-123 is an Ovis aries miRNA.

The exact name of miR-1273g-3p used in one embodiment of the invention is hsa-miR-1273g-3p, which is a mature miRNA generated from the precursor hsa-mir-1273g. MiR-1273g-3p, ACCACUGCACUCCAGCCUGAG (SEQ ID NO: 1).

Currently, the miRNA nomenclature has been well established, but miRNA nomenclature has been slightly different according to the researchers before it was established. Therefore, it is most accurate and desirable to trace the miRNA with the accession number, which is the unique number of the miRNA. The accession number of miR-1273g-3p used in one embodiment of the present invention is as follows: miR-1273g-3p, MIMAT0022742 (miRBase).

In the present invention, the term " Alzheimer ' s dementia " is a degenerative brain disease that occurs sporadically in an elderly person aged 65 years or older, and gradually develops and gradually progresses deterioration of cognitive function including memory.

The disease is an irreversible disease that can not be treated and recovered after the onset, and prevention and early screening are important diseases. Although current technologies such as cognitive psychology, cerebrospinal fluid (CT), PET / MIR brain imaging, and blood tests are widely used for the screening of dementia, long time use, high cost, pain incongruity, inconsistency of results, And the like. In one embodiment of the present invention, the expression level of miR-1273g-3p in the plasma is measured as a biomarker to diagnose Alzheimer's dementia pre-clinical phase, mild cognitive impairment or Alzheimer's dementia, Early screening techniques were used.

In another aspect, the present invention provides a method for detecting miR-1273g-3p, comprising the steps of 1) measuring the expression level of plasma miR-1273g-3p in blood collected from an individual, 2) And 3) when the expression level of the miRNA is higher than that of the normal miR-1273g-3p expression level, it is determined that the individual is in any one of the states selected from the pre-Alzheimer's stage of dementia, the mild cognitive impairment stage, and Alzheimer's dementia A method for providing information for diagnosis of Alzheimer ' s Dementia.

In the step of measuring the expression level of miR-1273g-3p, qPCR or northern blot analysis may be used.

qPCR simultaneously amplifies and quantifies target DNA molecules. The technique measures the amount of DNA currently being amplified in real time.

In one embodiment of the present invention, qPCR analysis was performed by synthesizing cDNA against plasma miRNAs. As a result, miR-1273g-3p showed a significant increase in Alzheimer's dementia and confirmed the possibility as a marker for Alzheimer's dementia (Fig. 2).

Northern blot analysis is a technique used to determine the difference in RNA expression between samples or the presence or absence of RNA in a sample. For example, the difference in expression levels of miR-1273g-3p between plasma samples of a subject diagnosed as normal, Alzheimer's dementia pre-stage, mild cognitive impairment, Alzheimer's demented patient was examined through the above technique, and plasma miR- The possibility of 3p as an early diagnosis marker for Alzheimer's dementia can be confirmed.

On the other hand, when the expression level of miR-1273g-3p of the individual measured by the above method is increased by 1% to 19% as compared with the average expression level of a normal person, the subject to be analyzed is pre-Alzheimer- Can be judged to be at high risk and can be judged to have a mild cognitive impairment or a high risk of onset if increased by 20% to 59%, and can be judged to be at risk of having Alzheimer ' It can be determined that the risk is high.

In another aspect, the present invention provides an Alzheimer's dementia diagnostic kit comprising a nucleotide of miR-1273g-3p, a complementary nucleotide thereof, or a fragment of the nucleotide.

The diagnostic kit of the present invention is a neurodegenerative disease, preferably an Alzheimer's dementia pre-stage, a mild cognitive impairment or Alzheimer's dementia, most preferably for diagnosis of Alzheimer's dementia.

The kit of the present invention may further include other components in addition to the above components. For example, if the kit of the present invention is applied to a PCR amplification procedure, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as buffers, DNA polymerases (e.g., Thermus aquaticus (Taq), Thermus thermophiles Thermostable DNA polymerases obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase joins and dNTPs. The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

In another aspect, the present invention provides an Alzheimer's dementia diagnostic kit comprising a primer or a probe specifically binding to miR-1273g-3p represented by SEQ ID NO: 1.

The " primer " or " probe " may include a nucleic acid sequence having a free 3 'hydroxyl group capable of complementarily binding with the template and allowing the reverse transcriptase or DNA polymerase to initiate replication of the template it means. Based on the sequence information of the miRNA, the probe or the primer can be easily prepared using techniques well known in the art.

The kit of the present invention may be a microarray or a gene amplification kit. When the kit of the present invention is a microarray, the probe is immobilized on the solid-phase surface of the microarray. When the kit of the present invention is a gene amplification kit, it includes a primer.

In another aspect, the present invention provides a method for producing miR-1273g-3p, comprising the steps of 1) administering miR-1273g-3p to a cell line, 2) Amyloid (1-42), BACE1 and Nicastrin in the treated cell line, and 4) measuring the expression level of the β-Amyloid (1-42) in comparison with the control without the test substance -42), BACE1, and Nicastrin. The present invention also provides a method of screening for a preventive or therapeutic agent for Alzheimer's disease.

The term " beta -amyloid " in the present invention is a segment of the amyloid precursor protein (APP) and is a central element of brain pathology seen in Alzheimer ' s dementia patients. β-Amyloid is produced by digesting with normal people and some other proteolytic enzymes in Alzheimer's dementia patients, and they are aggregated with each other to settle outside of nerve cell and form nerve half. This β-amyloid directly induces oxidative stress and indirectly activates microglia, which are toxic to nerves.

The term " BACE1 (beta-secretase 1) " in the present invention is a major enzyme that triggers the production of beta -amyloid peptide, a neurotoxic substance in the brain. In the present invention, the term " Nicastrin " is a relatively high molecular weight protein and is a constituent unit of gamma-secretase existing on the cell membrane. When present on the cell surface, nicastrin is directed to the outside of the cell and serves as a receptor.

The activity of the protein is analyzed by expression of the protein. For example, the plasma miR-1273g-3p according to the present invention is administered to a H4-APPswe cell line, and then the cell to which the miRNA is administered is contacted with the test substance to change the amount of BACE1 and Nicastrin expression before or after the contact By comparison with the control cells that do not express the target gene. In the present invention, the expression level of the protein can be assayed using known methods such as qPCR, a hybridization method using Western blot analysis, and the like.

The H4-APPswe cell (KM670 / 671NL) expresses the Swedish mutation of APP in human glioblastoma H4 cells. These cells are known to increase the abnormal segments of APP by beta-secretase (BACE), leading to hyperphosphorylation of spontaneous Alzheimer's dementia and tau protein (Tau protein).

The present invention also provides a pharmaceutical composition for preventing or treating Alzheimer's dementia comprising the test substance selected through the screening method for preventing or treating Alzheimer's dementia as an active ingredient.

The test substance selected through the screening method for preventing or treating Alzheimer's disease can reduce the expression amount of β-Amyloid (1-42), BACE1 or Nicastrin when compared with the control group to which no test substance is administered.

The present inventors have sought to discover a target molecule capable of treating Alzheimer ' s dementia and to develop a drug targeting the target molecule. As a result, the present inventors confirmed that miR-1273g-3p significantly increased in patients with Alzheimer's dementia. In addition, when the miR-1273g-3p mimic is transfected into the H4-APPswe cell line, the amount of beta amyloid released into the culture medium in the cell line increases and BACE1, which promotes the formation of beta -amyloid (1-42) The increase in Nicastrin was also confirmed.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are illustrative of the present invention, but the present invention is not limited thereto.

Example  1. Ensuring Plasma Samples

1.1. Primary analysis sample

The neuropsychological test showed that the blood of the subjects diagnosed as normal (16 men and 20 women), mild cognitive impairment (12 men and 12 women) and Alzheimer's dementia (20 men and 16 women) And plasma was separated by centrifugation. The information of the patients who provided plasma samples is shown in Table 1 below.

Group you Age Sex
(f / m) MMSE Normal 36 72.86 + - 4.7 20/16 27.3 ± 2.7 　 amnestic MCI 32 74.22 ± 4.5 20/12 25.94 + - 2.5 AD 36 73.58 ± 5.7 16/20 17.34 ± 8.2

1.2. Secondary analysis sample

The blood of the subjects diagnosed as normal (12 males and 12 females) and Alzheimer's dementia (12 males, 12 females) were collected from clinicians through neuropsychological tests and amyloid PET examinations and centrifuged to remove plasma Respectively. The information of the patients who provided plasma samples is shown in Table 2 below.

Group you Age Sex
(f / m) MMSE Amyloid -PET Normal 24 72.08 ± 4.9 12/12 28.46 ± 1.5 Negative AD 24 70.83 ± 9 12/12 19.31 ± 6.2 Positive

1.3. Tertiary analysis sample

(11 males and 16 females), pre-clinical Alzheimer's dementia (5 males and 4 females), mild cognitive impairment (5 males and 2 females), neuropsychological tests and amyloid PET The blood of the subjects diagnosed with Alzheimer's disease (23 men and 13 women) was collected and plasma was separated by centrifugation. The information of the patients who provided plasma samples is shown in Table 3 below.

Group you Age Sex
(f / m) MMSE Amyloid -PET Normal 27 73.37 ± 3.8 11/16 27.96 ± 1.4 Negative Pre-clinical AD 9 73.2 ± 3.7 4/5 28.22 ± 1.3 Positive amnestic MCI 7 75.2 ± 5.7 2/5 25.7 ± 1.7 Positive AD 36 73.9 ± 8 13/23 20.05 ± 5.9 Positive

Experimental Example  One. miRNA  Change analysis

The first analytical plasma samples of Example 1.1 were pooled into four as follows: 9 normal (4 males, 5 females), 6 mild cognitive impairment (3 males, 3 females ), 9 Alzheimer's Dementia (5 males, 4 females). Then, 1 ml of each plasma sample was prepared. Total RNA was isolated from plasma using the miRNeasy serum / plasma kit (# 217184) (Qiagen, Germany) according to the manufacturer's instructions. To this end, a signal value of each plasma miRNA amount was obtained by conducting analysis of Genchip miRNA 4.0 array (Affymetrix, USA) with DNA Link. Of the acquired signal values, miRNAs that showed absent calls in all samples were excluded from the candidates. Through the one-way ANOVA of the obtained microarray signal values, 158 miRNAs showing significant changes according to each experimental group were selected and classified into five clusters through hierarchical clustering. This is shown in FIG.

Experimental Example  2. Biomarker  Selection

Among the 158 miRNAs selected in Experimental Example 1, seven miRNAs (miR-1273g-3p, miR-6798-3p, miR-501-3p, miR-206 and miR -193b-5p, miR-106b-3p, and miR-29a-3p), the following experiment was carried out. 11 μl of total RNA was isolated according to the manufacturer's instructions using the miRNeasy serum / plasma kit (# 217184) in 50 μl of the secondary assay plasma sample from Example 1.2 above. 4 μl of 5 × Hispec, 2 μl of 10 × Nucleic acid mix, 2 μl of RT mix and 1 μl of RNase free DW were mixed with 11 μl of total RNA using a miscript RT kit (# 218161) (Qiagen, Germany) A total of 20 μl of cDNA was synthesized for miRNA.

Then, the synthesized cDNA was incubated at 37 ° C for 1 hour and at 95 ° C for 5 minutes, and then 200 μl of DW was added to dilute the cDNA. 1 μl of the diluted cDNA was extracted and 3 μl of 2x SYBR green master mix, 0.6 μl of 10 × universal primer, 0.6 μl of 10 × specific primer (miscript primer assay, Qiagen, Germany) and 0.8 μl DW were mixed and qPCR analysis was performed using the QuantiTect SYBR Green PCR Kit (Qiagen, Germany).

At this time, qPCR proceeded to triplication. Then, 40 cycles of [94 ° C for 15 sec, 55 ° C for 30 sec, and 70 ° C for 30 sec] were performed for 15 min at 95 ° C using a Roche LightCycler 480. Here, specific primer information used for qPCR is as follows. The results are shown in Fig.

miRNA  name catalog no. miRNA  sequence Other miR-1273g-3p MSC0075541 (customized) ACCACUGCACUCCAGCCUGAG miR-6798-3p MSC0075542 (customized) CUACCCCCCAUCCCCCUGUAG miR-501-3p MS00009828 AAUGCACCCGGGCAAGGAUUCU miR-206 MS00003787 UGGAAUGUAAGGAAGUGUGUGG miR-193b-5p MS00008939 CGGGGUUUUGAGGGCGAGAUGA miR-106b-3p MS00003402 UAAAGUGCUGACAGUGCAGAU miR-29a-3p MS00003262 UAGCACCAUCUGAAAUCGGUUA miR-425-5p MS00009695 AAUGACACGAUCACUCCCGUUGA For normalization miR-23a-3p MS00031633 AUCACAUUGCCAGGGAUUUCC For normalization miR-191-5p MS00003682 CAACGGAAUCCCAAAAGCAGCUG For normalization miR-451a MS00004242 AAACCGUUACCAUUACUGAGUU For normalization Cel-39
(spike-in control) Included in miRNeasy serum / plasma kit 정정 제어

In addition, a receiver operating characteristic (ROC) curve analysis was performed to determine the sensitivity and specificity of the ability to distinguish between normal and Alzheimer demented patients through qPCR analysis of plasma miR-1273g-3p. The results are shown in FIG. 2B.

As shown in Fig. 2A, only miR-1273g-3p showed a significant increase of about 1.6-fold in Alzheimer's dementia (AD). As shown in FIG. 2B, the area under curve (AUC) was 0.78 as a result of the ROC curve analysis. This indicates the possibility of miR-1273g-3p as an Alzheimer's dementia diagnostic marker (t.test, p < 0.00063).

Experimental Example  3. Selected Plasma miRNA  Early diagnosis As a marker  Confirm the possibility

A third analysis sample containing a plasma sample of pre-clinical Alzheimer's dementia was obtained to confirm that the diagnosis of dementia was possible by plasma miR-1237g-3p analysis only before neuropsychiatric problems due to Alzheimer's dementia occurred. Total RNA was isolated from the third analytical sample according to the manufacturer's instructions using miRNeasy serum / plasma kit (# 217184) (Qiagen, Germany). cDNA was synthesized for miRNA in the total RNA using a miscript RT kit (# 218161) (Qiagen, Germany) and qPCR analysis was performed using the QuantiTect SYBR Green PCR kit (Qiagen, Germany). The specific experimental method is the same as in Experimental Example 2 above. The results are shown in Fig. In addition, the ROC curve analysis was performed to determine the sensitivity and specificity of whether to distinguish normal people from Alzheimer's patients with dementia through qPCR analysis of plasma miR-1273g-3p. The results are shown in FIG. 3B.

As shown in FIG. 3A, the change of miR-1273g-3p was confirmed by qPCR analysis on the third analysis plasma sample, and as a result, plasma miR-1273g-3p in some pre-clinical Alzheimer's dementia and mild cognitive impairment patients Respectively. In addition, miR-1273g-3p increased about 1.9 fold in Alzheimer's dementia patients. This indicates that miR-1273g-3p is a possible early marker for early diagnosis of Alzheimer's dementia. As shown in FIG. 3B, the ROC curve analysis showed that the AUC was 0.861. This indicates the possibility of high-precision miR-1273g-3p plasma marker as a diagnostic marker for Alzheimer's dementia.

Experimental Example  4. miRNA -1273g-3p qPCR  Correlation between data and neuropsychological test scores

In order to determine whether the diagnosis of Alzheimer's dementia using plasma miR-1273g-3p could replace the neuropsychological tests used in the diagnosis of dementia, it was recommended that normal, preclinical Alzheimer's dementia (PCA), mild cognitive impairment ) And the qPCR data of plasma miR-1273g-3p were confirmed by the neuropsychological test (K-MMSE, SNSB) scores of each experimental group in Alzheimer's Dementia. The results are shown in Figs. 4A and 4B.

As shown in FIGS. 4A and 4B, there was a negative correlation with the memory domain score of K-MMSE and SNSB. In particular, the amount of miR-1273g-3p in patients with Alzheimer's dementia with a high K- It was confirmed that they belonged to a higher category than normal people.

Experimental Example  5. In dementia model cell line miR -1273g-3p function check

miR-1273g-3p mimic (# C-302446-00-0005) (Dharmacon, USA) was used for biochemistry at Ewha Womans University Mokdong Hospital to confirm intracellular changes due to increase of miR-1273g-3p H4-APPswe (APP Swedish mutant (KM670 / 671NL) overexpressing H4 human neuroglioma cell line) was transfected with the demented model cell line H4-APPswe. Specific experimental methods are as follows.

A frequency divider such that per well 2.5ⅹ10 ⁵ cells in 6-well plates and then, while it _{37 ℃, CO 2 5%,} 24 hours, and cultured using a DMEM (10% FBS) medium. Then, 100 μl of OptiMEM and 75 nM of miRNA mimic were incubated for 5 minutes at room temperature, and 100 μl of OptiMEM and 3.75 μl of Dharmafect 1 reagent were incubated at room temperature for 5 minutes. Each of the incubated solutions was mixed with each other, followed by incubation at room temperature for 20 minutes to treat the divided cells. After 24 hours, the culture broth was replaced. After 24 hours, the cultures were collected and ELISA was performed using a β-Amyloid (1-42) ELISA kit (# KHB3441, invitrogen). Cells were subjected to western blotting and qPCR, and the specific procedure was as follows.

Cells were lysed using a modified RIPA buffer (pH 7.4) consisting of 50 mM Tris, 150 mM NaCl, 1% NP40, 0.25% sodium deoxycholate, NaV, NaF and Proteinase inhibitor cocktail (Roche). After bicinchoninic acid assay (BCA) was quantified, SDS-PAGE (SDS-polyacrylamide gel electrophoresis) was performed by loading 30 μg onto 9% acrylamide gel. Thereafter, a voltage of 100 V was applied to the poly-vinyl difluoride (PVDF) membrane for 80 minutes and blocked with 5% skim milk for 30 minutes at room temperature. The cells were incubated overnight at 4 ° C, and HRP (horseradish peroxidase (HRP)) was incubated overnight at 37 ° C. The cells were incubated at 37 ° C for 1 h with anti- ) The conjugated secondary antibody was incubated at room temperature for 1 hour. Then, ECL (enhanced chemiluminescence) (# DG-WP250, DoGen) was treated and detected. Total RNA of cells was also extracted using miRNeasy mini kit (# 217004, qiagen) according to the manufacturer's instructions. cDNA was synthesized using the miscript RT kit (# 218161) (Qiagen, Germany) and qPCR analysis was performed using the QuantiTect SYBR® Green PCR kit (Qiagen, Germany). The specific experimental method is the same as in Experimental Example 2 above. This is shown in Figs. 5A to 5D.

As shown in FIG. 5A, when the miR-1273g-3p mimic was transfected into H4-APPswe cells, the amount of β-Amyloid (1-42) released into the culture medium from the cell line was increased Respectively. In addition, as shown in Figs. 5B and 5C, the expression levels of BACE1 and Nicastrin, proteins promoting the formation of beta -amyloid (1-42), were evaluated using Western blot analysis, Respectively. As shown in FIG. 5D, bACE1 and Nicastrin mRNA expression levels were evaluated by qPCR analysis, and BACE1 and Nicastrin proteins were found to increase from mRNA expression.

As a result, it was confirmed that the miRNA could be usefully used as a therapeutic target for slowing the onset of Alzheimer's dementia, if the increase in miR-1273g-3p could be detected early and its expression could be reduced.

<110> Gwangju Institute of Science and Technology          Industry-Academic Cooperation Foundation, Chosun University <120> DIAGNOSTIC BIOMARKER FOR ALZHEIMER'S DISEASE AND USE THEREOF <130> FPD / 201704-0043 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-1273g-3p <400> 1 accacugcac uccagccuga g 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-6798-3p <400> 2 cuacccccca ucccccugua g 21 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-501-3p <400> 3 aaugcacccg ggcaaggauu cu 22 <210> 4 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-206 <400> 4 uggaauguaa ggaagugugu gg 22 <210> 5 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-193b-5p <400> 5 cgggguuuug agggcgagau ga 22 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-106b-3p <400> 6 uaaagugcug acagugcaga u 21 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-29a-3p <400> 7 uagcaccauc ugaaaucggu ua 22 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-425-5p <400> 8 aaugacacga ucacucccgu uga 23 <210> 9 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-23a-3p <400> 9 aucacauugc cagggauuuc c 21 <210> 10 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-191-5p <400> 10 caacggaauc ccaaaagcag cug 23 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-451a <400> 11 aaaccguuac cauuacugag uu 22

Claims (12)

biomarker for the diagnosis of Alzheimer &apos; s disease comprising miR-1273g-3p. The method according to claim 1,
Wherein the miR-1273g-3p has a nucleic acid sequence represented by SEQ ID NO: 1. 1) measuring the expression level of plasma miR-1273g-3p in the blood collected from an individual;
2) comparing the expression level of the miRNA and miR-1273g-3p expression level of a normal person; And
3) If the expression level of the miRNA is higher than that of miR-1273g-3p expression in a normal person, it is determined that the individual is in any one state selected from the pre-Alzheimer dementia stage, the mild cognitive impairment stage and the Alzheimer's dementia stage A method of providing information for diagnosing Alzheimer &apos; s Dementia. The method of claim 3,
Wherein when the expression level of miR-1273g-3p is increased by 1% to 19% relative to the mean miR-1273g-3p expression level of a normal person, it is determined to be a pre-Alzheimer stage. The method of claim 3,
A mild cognitive disorder is determined when the expression amount of miR-1273g-3p is increased by 20% to 59% with respect to an average miR-1273g-3p expression amount of a normal person. The method of claim 3,
Wherein when the expression level of miR-1273g-3p is increased by 60% to 99% with respect to an average miR-1273g-3p expression level of a normal person, it is determined to be Alzheimer's dementia. The method of claim 3,
Wherein the measurement of the expression level of the miRNA is performed by qPCR or nostron blot analysis. miR-1273g-3p nucleotide, a complementary nucleotide thereof, or a fragment of said nucleotide. A kit for the diagnosis of Alzheimer's Dementia comprising a primer or a probe specifically binding to miR-1273g-3p represented by SEQ ID NO: 1. 1) administering miR-1273g-3p to the cell line;
2) administering the test substance to the cell line to which miR-1273g-3p is administered;
3) measuring the expression level of any one or more selected from the group consisting of β-Amyloid (1-42), BACE1 and Nicastrin in the cell line to which the test substance is administered; And
4) selecting a test substance having decreased expression level of at least one selected from the group consisting of? -Amyloid (1-42), BACE1 and Nicastrin compared with a control group to which no test substance is administered; Or therapeutic agent screening method. 11. The method of claim 10,
Wherein the cell line is a H4-APPswe cell line. A pharmaceutical composition for preventing or treating Alzheimer's dementia comprising the screening substance according to claim 10 as an active ingredient.

Images