RU2771757C2 - Biomarkers of traumatic brain injury - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: provided is a method for diagnosing and/or monitoring a traumatic brain injury (TBI) in an individual. Method involves determining the level of at least one micro-RNA in a fluid sample from an individual. McRNA can be selected from miR-425-5p, miR-502, miR-21 and miR-335. Method may include determining whether an individual suffers from mild TBI or moderate-to-severe TBI. Also provided is a composition and a kit for diagnosing and/or monitoring TBI, and a method for determining a suitable treatment for an individual with suspected TBI.

EFFECT: invention extends the range of tools for diagnosing and/or monitoring a traumatic brain injury.

11 cl, 4 dwg, 5 tbl, 3 ex

Description

The field of technology to which the invention belongs

The present invention relates to compositions, kits, systems and methods for diagnosing and/or monitoring traumatic brain injury (TBI). More specifically, the present invention relates to the diagnosis and monitoring of TBI using miRNA biomarkers.

State of the art prior to the invention

Traumatic brain injury (TBI) is the leading cause of death and disability under the age of 45 in Western countries. Health system and social costs are expected to rise and by 2020 the World Health Organization predicts that TBI will become the third leading cause of disability in the world.

Despite many studies, no reliable biomarkers have been found to assess the severity of TBI and predict recovery. This is especially true for mild TBI (mTBI), which is currently difficult to evaluate in clinical practice. Although patients with TBI are initially assessed using the Glasgow Coma Scale (GCS) and neuroimaging techniques that require expensive equipment, current diagnostic tools lack the ability to accurately determine and quantify the actual severity of brain damage, which is why Thus, it leads to easy detection of severe TBI, but not mTBI, which makes up the majority of cases (75-90%).

Accurate diagnosis of mTBI is especially important in patients such as athletes, soldiers, and children, who are at greater risk of recurrent mTBI and a catastrophic form of brain injury known as reconcussion syndrome (SIS), in which the synergistic action of repeated TBI results in deep injury and even death. Thus, early diagnosis and assessment of the severity of TBI become critical to the well-being of patients and ultimately save their lives.

Frequent references to sports concussion in the media have led to significant interest in the search for TBI biomarkers. In recent years, much research has focused on biomarkers that can support clinical decision making on the field or in a sport-related treatment center. However, the protein biomarkers described in the literature lack specificity or sensitivity or are not detectable for some time after injury. This may be because following a concussion, which is a form of TBI, only very small amounts of brain-derived compounds are released and the blood-brain barrier remains predominantly closed.

MicroRNAs (miRNAs) are a large class of highly conserved non-coding RNA molecules of approximately 22 nucleotides in length that induce mRNA degradation, translational repression, or both through pairing with partially complementary regions in the 3'UTR of target genes. The human genome encodes over 2000 miRNAs that can target approximately 60% of all genes. However, despite the prevalence of miRNAs, their bimolecular functions and involvement in pathology remain completely unclear. They play a central role in many biological processes, including cell cycle, cell metabolism, apoptosis, and immune responses, and are of increasing interest in clinical research as possible biomarkers for the detection, identification, and classification of cancers and other disease states, including neurodegenerative diseases.

The present invention has been developed with these problems in mind.

The essence of the invention

The present invention relates to a method for diagnosing or monitoring traumatic brain injury (TBI) in an individual.

According to a first aspect of the invention, a method for diagnosing and/or monitoring traumatic brain injury (TBI) in an individual is provided, wherein the method comprises detecting the presence and/or determining the level of at least one miRNA in a sample from the individual.

At least one miRNA (also referred to herein as "miR") can be selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR -425-5p, miR-502, miR-21, miR-let-7g, miR-335, miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365 , miR-590-3p, miR-624, miR-625*, miR-671-3p, hsa-let-7c-5p, hsa-let-7i-5p miR-142-3p, miR-148a-3p, miR -15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR- 29a-3p, miR-29c-3p, miR-424-5p, miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p; miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR- 27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629. These miRNAs may be referred to herein as miRNAs of interest or target miRNAs.

In certain embodiments, at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502 , miR-21, miR-let-7g, miR-335, hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p , miR-624, miR-625* and miR-671-3p. These microRNAs were found to be biomarkers expressed in all patients with TBI (mild or severe).

In certain embodiments, at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502 , miR-21, miR-let-7g and miR-335.

In certain embodiments, at least one miRNA is selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p , miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p and miR-424-5p; miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p.

In certain embodiments, at least one miRNA is selected from the group consisting of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618 , miR-95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR -99a, miR-520D-3p and miR-629.

For the avoidance of doubt, it should be understood that "at least one miRNA is selected from the group of miRNAs" as used herein means that the method in question, whether carried out for diagnostic, prognostic or therapeutic purposes, can be carried out with any one of the listed miRNAs, or any combination of the listed miRNAs (eg, two, three, four or more of the listed miRNAs). It follows that any one or more of the listed miRNAs can be explicitly excluded. For example, when at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g and miR-335, the method may include detecting and/or leveling any combination of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b , miR-425-5p, miR-502, miR-21 and miR-let-7g except miR-335.

According to one aspect of the invention, a method is provided for diagnosing and/or monitoring traumatic brain injury (TBI) in an individual, wherein the method comprises determining the level of at least one miRNA in a sample from the individual, wherein the miRNA is selected from the group consisting of: miR-425- 5p, miR-502, miR-21 and miR-335.

Traumatic brain injury occurs when an external force causes traumatic brain injury. There are various classification systems for TBI based on, for example, severity, type of injury, and prognosis. The most widely used TBI classification system is the Glasgow Coma Scale (GCS), which rates an individual's level of concussion on a scale of 3-15 based on verbal, motor, and eye-opening responses to stimuli. In general, a TBI with a GCS score of 13 or higher is defined as mild, 9-12 as moderate, and 8 or higher as severe. Another system, the Mayo grading system, includes three main classifications, including defined moderate-to-severe TBI, probable mild TBI, and probable TBI. Multiple criteria are used in each diagnosis, including loss of consciousness, post-traumatic amnesia, skull fracture, and evidence of neuroradiologic abnormalities, including subdural hematoma, cerebral contusion, and hemorrhagic cerebral contusion. Those skilled in the art are familiar with the classification of TBI using GCS or Mayo systems.

As used herein, reference to "light", "medium" and "heavy" TBI is given in accordance with the GCS. References herein to "mild to severe" TBI include both mild and severe TBI according to the GCS.

It is expected that the diagnosis and/or monitoring of TBI using the biomarkers of the present invention will assist in clinical decision making and treatment regimens in a variety of situations, including the following situations: as an initial assessment by emergency physicians to determine whether patients should be transported to a center with a neurosurgical unit , main trauma center or local trauma facility; in the emergency department of hospitals to determine appropriate treatment, including the need for a CT scan of the brain; "by the field" to assist in the decision to remove the player from the game and assess the need to send the player to the hospital; in sports medicine treatment centers to confirm the concussion and enable a decision to return to the game; in combat situations to determine the need to send a rescue team and evacuate victims. Thus, individuals to whom the present invention provides a particular benefit include accident victims, sports players and military personnel.

In any case, but probably especially when the individual is at increased risk of TBI (eg, when the individual is a professional athlete or is in the military), a sample can be obtained from the individual at a time prior to any known or recent injury (eg, at the onset of sports career or prior to military service) and any miRNA of interest can be assessed at that point in time or later when the individual has suffered a possible TBI. Thus, such samples can represent an internal reference standard.

In certain embodiments, the individual is a human.

TBI may be mild TBI (mTBI), moderate TBI, or severe TBI (sTBI). In certain embodiments, the TBI is moderate to severe TBI (m-sTBI).

The level of miRNA or each miRNA in a sample can be quantified or semi-quantitatively determined. By "quantitatively" it is to be understood that the absolute amount or concentration of miRNA or each miRNA is determined in the sample. The absolute amount of miRNA or each miRNA in the sample can then be compared to a predetermined threshold value (e.g., the value of expected normal levels published in the literature), a known level of the same or reference miRNA in a control sample obtained from a healthy individual, or the amount of reference miRNA in sample from an individual. In certain embodiments, an individual is diagnosed with TBI when the miRNA level is below a predetermined threshold level, or is reduced relative to a reference or control sample. In other embodiments, an individual is diagnosed with TBI when the miRNA level is elevated above a predetermined threshold level.

By "semi-quantitative" it is to be understood that the level of miRNA or each miRNA of interest is measured relative to a reference.

The reference may be an invariant miRNA, ie. miRNA with an expression level that remains essentially unchanged when compared between healthy individuals and individuals with TBI. An individual can be diagnosed as having suffered TBI if the level of the miRNA or each miRNA of interest is elevated or decreased relative to the level of the invariant miRNA. Suitable invariant miRNAs include miR-331, miR-223*, miR-23a-3p and miR148b-3p. MiR-23a-3p and miR148b-3p are only invariant in saliva.

In certain embodiments, the level of miRNA or each miRNA in a sample obtained from an individual may be about 0.01-100 times, about 0.05-50 times, about 0.1-10 times, about 0.5-5 times , about 1.0-3 times or about 1.5-2.0 times lower or higher than the level in the control sample, the reference level or the published level.

If a device or method is used to obtain the level, authors may qualify this value by the term "approximately" to reflect the indicated value and any change in this value that is characteristic of the device or method used. When specifically describing values or ranges of values, "about" can mean plus or minus 10% of the specified value or range. For example, approximately 10 minutes may mean 9-11 minutes.

The level of miRNA or each miRNA of interest can be determined by methods known to those skilled in the art. In certain embodiments, determining the level of miRNA or each miRNA of interest includes amplifying the miRNA. In certain embodiments, total miRNA can first be isolated from a sample by standard methods, such as using the miRNeasy mini kit (Qiagen). The miRNA of interest can then be quantified. In certain embodiments, the level of miRNA or each miRNA of interest in a sample is determined using PCR (polymerase chain reaction). For example, quantitative PCR can be used to quantify the level of miRNA or each miRNA of interest. PCR can also be used for semi-quantification by comparing the level of miRNA or each miRNA of interest in a sample to that of a reference (eg, invariant miRNA).

Suitable miRNA detection and/or quantification techniques, which will be known to those skilled in the art, include qPCR, miRNA, next generation sequencing (NGS), and multiplex miRNA profiling assays.

In certain embodiments, the level of the miRNA or each miRNA of interest is determined using in situ hybridization, for example, using a probe (eg, labeled probe) specific for the miRNA.

The level of miRNA can be determined in a sample that is obtained from an individual immediately after injury (i.e., less than 1 hour after injury) and/or in a sample obtained at one or more time points several hours or days after injury. Thus, changes in miRNA level can be detected over an extended period of time to enable monitoring of TBI monitoring. If miRNA levels change over an extended period of time, the methods for monitoring TBI described herein can be expanded to include maintaining or changing the individual's treatment regimen, respectively.

Depending on the particular miRNA and the type of TBI, the level of miRNA in an individual can vary significantly over an extended period of time. Thus, in certain embodiments, it may be preferable to measure miRNA immediately after injury to ensure an accurate diagnosis. In certain embodiments, the miRNA level is determined in a sample obtained from an individual, no more than 72 hours, no more than 48 hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, no more than 2 hours, or no more than 1 hour after damage.

The level of certain miRNAs is substantially stable over an extended period of time, thus allowing a diagnosis to be made hours, days or even weeks after injury. In certain embodiments, the miRNA level is determined in a sample obtained from an individual after a time period of up to 20, 18, 15, 12, 10, 8, 5, or 2 days after injury.

In certain embodiments, the miRNA level is determined in a sample obtained from an individual immediately after injury (e.g., T=0 hour), 4-12 hours after injury, 48-72 hours after injury, or 15 days after injury.

In certain embodiments, the TBI is mild TBI (mTBI) or moderate-severe TBI (m-sTBI), and at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR -655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g, miR-335, hsa-miR-126*, miR-193a-5p, miR- 144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625* and miR-671-3p.

In certain embodiments, the TBI is light TBI (mTBI) and the miRNA is selected from the group consisting of miR-425-5p and miR-502. An individual can be diagnosed with mTBI if miR-425-5p and/or miR-502 levels are determined to be below a predetermined threshold level or to be reduced relative to a reference.

In certain embodiments, a miR-425-5p and/or miR-502 level that is below a predetermined threshold level or is reduced relative to a reference is diagnostic of mTBI when the level is determined in a sample obtained less than 48 hours after injury.

In certain embodiments, the TBI is moderate to severe TBI (m-sTBI) and the miRNA is selected from the group consisting of miR-21 and miR-335. An individual may be diagnosed with moderate-to-severe TBI if miR-21 and/or miR-335 levels are determined to be above a predetermined cut-off level or elevated relative to a reference.

In certain embodiments, a miR-21 and/or miR-335 level that is above a predetermined threshold level or is elevated relative to a reference is diagnostic of moderate-severe TBI when the level is determined in a sample obtained up to 15 days after damage.

In certain embodiments, the TBI is moderate-severe TBI (m-sTBI) and at least one miRNA is selected from the group consisting of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR -18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361 , miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629.

An individual can be diagnosed with m-sTBI if it is determined that the level of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-618, miR-95, miR-130a, miR -152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642 and/or miR-99a is above a predefined threshold, or is higher than the standard.

An individual can be diagnosed with m-sTBI if miR-192, miR-429, miR-520D-3p and/or miR-629 is determined to be below a predetermined threshold level or is reduced relative to a reference.

MiRNA can be used alone to diagnose TBI. For example, in sports concussion, it is fashionable to use miR-502 or miR-425-5p to confirm that a traumatic brain injury has occurred.

Thus, an additional aspect of the present invention is a method for determining the severity of TBI, and the steps of this method can be repeated to monitor the individual over an extended period of time. It should be understood that a positive result per miRNA (eg, determining that the level of one miRNA is above/below a predetermined threshold level or is elevated/decreased relative to a reference) is sufficient to determine the severity of TBI. For example, if the level of miR-425-5p is below a predetermined threshold level or is lower than a reference, the severity of TBI is determined to be moderate (mTBI). However, it may be appropriate to combine different miRNAs (eg, in a test panel) to facilitate assessment of the severity of TBI.

In certain embodiments, the method includes determining the population level (eg, two or more) miRNAs in the sample. In certain embodiments, two or more miRNAs are selected from the group consisting of: miR-425-5p, miR-502, miR-21, and miR-335.

In certain embodiments, the method includes determining the level of:

(i) a first miRNA selected from miR-425-5p and miR-502; and

(ii) a second miRNA selected from miR-21 and miR-335.

An individual can be diagnosed with TBI if miR-425-5p or miR-502 is determined to be below a predetermined cut-off level or is down relative to reference, or miR-21 or miR-335 is determined to be above a predetermined cut-off level or is elevated relative to reference .

In certain embodiments, the TBI is light TBI (mTBI) and at least one miRNA is selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR -15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miRmmiR-29a-3p, miR-29c-3p, miR-424 -5p, miR-30a-5p, miR-107, miR-135b-5p, miR-199b-5p, miR-324-5p and miR-652-3p, or combinations thereof. An individual can be diagnosed with mTBI if a change of at least 0.5, at least 1.0, at least 1.5, at least 2.0, at least 2.5, by at least 3.0, at least 3.5 or at least 4.0 times the level of miRNA compared to the reference. In certain embodiments, an individual is diagnosed with mTBI if the level(s) of miRNA is(are) elevated from a reference.

The sequences and accession numbers for the miRNAs described herein are shown in Table 1:

Table 1

miRNA subsequence miRBase Access No. hsa-miR-21 uagcuuaucagacugauguuga (SEQ ID No.1) MIMAT0000076 hsa-miR-425-5p augacacgaucaccccguuga (SEQ ID No.2) MIMAT0003393 hsa-miR-502-5p (also known as hsa-miR-502) auccuugcuaucggggcua (SEQ ID No.3) MIMAT0002873 hsa-miR-335-5p (also known as hsa-miR-335) ucaagagcaauaacgaaaaaugu (SEQ ID No.4) MIMAT0000765 hsa-miR-301b-3p (also known as hsa-miR-301b) cagugcaaugauauuugucaaagc (SEQ ID No.5) MIMAT0004958 hsa-miR-184 uggacggagaacugauaagggu (SEQ ID No.6) MIMAT0000454 hsa-miR-505-3p (also known as hsa-miR-505) cgucaacacuugcugguuuccu (SEQ ID No.7) MIMAT0002876 hsa-miR-203a-3p (also known as hsa-miR-203a, hsa-miR-203) gugaaauguuuaggaccacuag (SEQ ID No.8) MIMAT0000264 hsa-miR-654-3p uaugucugcugaccaucaccuu (SEQ ID No.9) MIMAT0004814 hsa-miR-655-3p (also known as hsa-miR-655) auaauacaugguuaaccucuuu (SEQ ID No.10) MIMAT0003331 hsa-miR-331-3p (also known as hsa-miR-331) gccccugggccuauccuagaa (SEQ ID No.11) MIMAT0000760 hsa-miR-223-5p (also known as hsa-miR-223*) cguguauuugacaagcugaguu (SEQ ID No.12) MIMAT0004570 hsa-miR-let-7g ugagguaguaguuuguacaguu (SEQ ID No.13) MIMAT0000414 hsa-miR-126* (also known as B hsa-miR-126-5p) cauuauuacuuuugguacgcg (SEQ ID No.14) MIMAT0000444 hsa-miR-193a-5p ugggucuuugcgggcgagauga (SEQ ID No.15) MIMAT0004614 hsa-miR-144* (also known as hsa-miR-144-5p) ggauaucaucauauacuguaag (SEQ ID No.16) MIMAT0004600 hsa-miR-190 (also known as hsa-miR-190a or hsa-miR-190a-3p) cuauauaucaaacauauuccu (SEQ ID No.17) MIMAT0026482 hsa-miR-194 (also known as hsa-miR-194-5p) uguaacagcaacuccaugugga (SEQ ID No.18) MIMAT0000460 hsa-miR-365 (also known as hsa-miR-365a-3p) uaaugccccuaaaaauccuuau (SEQ ID No.19) MIMAT0000710 hsa-miR-590-3p (also known as hsa-miR-590) uaauuuuauguauaagcuagu (SEQ ID No.20) MIMAT0004801 hsa-miR-624 uaguaccaguaccuuguguuca (SEQ ID No.21) MI0003638 hsa-miR-625* (also known as hsa-miR-625-3p) gacuauagaacuuucccccuca (SEQ ID No.22) MIMAT0004808 hsa-miR-671-3p uccgguucucagggcuccacc (SEQ ID No.23) MIMAT0004819 hsa-let-7c-5p ugagguaguagguuguaugguu (SEQ ID No.24) MIMAT0000064 hsa-let-7i-5p (also known as hsa-let-7i) ugagguaguaguuugugcuguu (SEQ ID No.25) MIMAT0000415 hsa-miR-142-3p uguaguguuuccuacuuuuugga (SEQ ID No.26) MIMAT0000434 hsa-miR-148a-3p (also known as hsa-miR-148a) ucagugcacuacagaacuuugu (SEQ ID No.27) MIMAT0000243 hsa-miR-15b-5p (also known as hsa-miR-15b) uagcagcacaucaugguuuaca (SEQ ID No.28) MIMAT0000417 hsa-miR-16-5p (also known as hsa-miR-16) uagcagcacguaaauauuggcg (SEQ ID No.29) MIMAT0000069 hsa-miR-181a-5p (also known as hsa-miR-181a) aacauucaacgcugucggugagu (SEQ ID No.30) MIMAT0000256 hsa-miR-20a-5p (also known as hsa-miR-20; hsa-miR-20a) uaaagugcuuauagugcagguag (SEQ ID No.31) MIMAT0000075 hsa-miR-20b-5p (also known as hsa-miR-20b) caaagugcucauagugcagguag (SEQ ID No.32) MIMAT0001413 hsa-miR-221-3p (also known as hsa-miR-221) agcuacauugucugcuggguuuc (SEQ ID No.33) MIMAT0000278 hsa-miR-24-3p (also known as hsa-miR-24) uggcucaguucagcaggaacag (SEQ ID No.34) MIMAT0000080 hsa-miR-27b-3p (also known as hsa-miR-27b) uucacaguggcuaaguucugc (SEQ ID No.35) MIMAT0000419 hsa-miR-29a-3p (also known as hsa-miR-29a) uagcaccaucugaaaucgguua (SEQ ID No.36) MIMAT0000086 hsa-miR-29c-3p (also known as hsa-miR-29c) uagcaccauuugaaaucgguua (SEQ ID No.37) MIMAT0000681 hsa-miR-30a-5p (also known as hsa-miR-30a) uguaaacauccucgacuggaag (SEQ ID No.38) MIMAT0000087 hsa-miR-107 (also known as hsa-miR-107-10) agcagcauuuguacagggcuauca (SEQ ID No.39) MI0000114 hsa-miR-135b-5p (also known as hsa-miR-135b) uauggcuuuucauuccuauguga (SEQ ID No.40) MIMAT0000758 hsa-miR-199b-5p (also known as hsa-miR-199b) cccaguguuuagacuaucuguuc (SEQ ID No.41) MIMAT0000263 hsa-miR-324-5p cgcauccccuagggcauuggugu (SEQ ID No.42) MIMAT0000761 hsa-miR-652-3p (also known as hsa-miR-652) aauggcgccacuaggguugug (SEQ ID No.43) MIMAT0003322 hsa-miR-424-5p (also known as hsa-miR-424) cagcagcaauucauguuuugaa (SEQ ID No.44) MIMAT0001341 hsa-miR-10a (also known as hsa-miR-10-5p) uacccuguagauccgaauuugug (SEQ ID No.45) MIMAT0000253 hsa-miR-132 (also known as hsa-miR-132-3p) uaacagucuacagccauggucg (SEQ ID No.46) MIMAT0000426 hsa-miR-223 (also known as hsa-miR-223-3p) ugucaguuugucaaauacccca (SEQ ID No.47) MIMAT0000280 hsa-miR-143 (also known as hsa-miR-143-3p) ugagaugaagcacuguagcuc (SEQ ID No.48) MIMAT0000435 hsa-miR-148b (also known as hsa-miR-148b-3p) ucagugcaucacagaacuugugu (SEQ ID No.49) MIMAT0000759 hsa-miR-18a (also known as hsa-miR-18; hsa-miR-18a-5p) uaaggugcaucuagugcagauag (SEQ ID No.50) MIMAT0000072 hsa-miR-192 (also known as hsa-miR-192-5p) cugaccuaugaauugacagcc (SEQ ID No.51) MIMAT0000222 hsa-miR-429 uaauacugucugguaaaaccgu (SEQ ID No.52) MIMAT0001536 hsa-miR-618 aaacucuacuuguccuucugagu (SEQ ID No.53) MIMAT0003287 hsa-miR-95 (also known as hsa-miR-95-5p) ucaauaaaugucuguugaauu (SEQ ID No.54) MIMAT0026473 hsa-miR-130a (also known as hsa-miR-130a-3p) cagugcaauguuaaaagggcau (SEQ ID No.55) MIMAT0000425 hsa-miR-152 (also known as hsa-miR-152-5p) agguucugugauacacuccgacu (SEQ ID No.56) MIMAT0026479 hsa-miR-27b (also known as hsa-miR-27b-3p) uucacaguggcuaaguucugc (SEQ ID No.57) MIMAT0000419 hsa-miR-301 (also known as hsa-miR-301a-3p or hsa-miR-301a ) cagugcaauaguauugucaaagc (SEQ ID No.58) MIMAT0000688 hsa-miR-326 ccucugggcccuuccuccag (SEQ ID No.59) MIMAT0000756 hsa-miR-345 (also known as hsa-miR-345-5p) gcugacuccuaguccagggcuc (SEQ ID No.60) MIMAT0000772 hsa-miR-361 (also known as hsa-miR-361-5p) uuaucagaaucuccagggguac (SEQ ID No.61) MIMAT0000703 hsa-miR-422a acuggacuuagggucagaaggc (SEQ ID No.62) MIMAT0001339 hsa-miR-579 (also known as hsa-miR-579-3p) uucauuugguauaaaccgcgauu (SEQ ID No.63) MIMAT0003244 hsa-miR-642 (also known as hsa-miR-642a-5p; hsa-miR-642) gucccucuccaaaugugucuug (SEQ ID No.64) MIMAT0003312 hsa-miR-99a (also known as hsa-miR-99a-5p) aacccguagauccgaucuugug (SEQ ID No.65) MIMAT0000097 hsa-miR-520D-3p (also known as hsa-miR-520D) aaagugcuucucuuugggggu (SEQ ID No.66) MIMAT0002856 hsa-miR-629 (also known as hsa-miR-629-5p) uggguuuacguugggagaacu (SEQ ID No.67) MIMAT0004810 hsa-miR-23a-3p (also known as hsa-miR-23a) aucacauugccagggauuucc (SEQ ID No.68) MIMAT0000078 hsa-miR-148b-3p (also known as hsa-miR-148b) ucagugcaucacagaacuuugu (SEQ ID No.69) MIMAT0000759

For convenience, the sample may be any suitable fluid or tissue sample obtained from an individual. For example, a biological sample may contain at least one of the group consisting of: urine, saliva, whole blood, plasma, serum, sputum, semen, feces, nasal swab, tears, vaginal swab, rectal swab, cervical swab , tissue biopsy and urethral swab. In certain embodiments, the sample is a liquid sample. Accordingly, the sample is a sample that can be easily obtained from an individual, such as urine, saliva, blood, and sputum. In certain embodiments, the sample contains saliva, blood, plasma, or serum. It should be understood that in certain embodiments, the implementation of the process of obtaining a sample is not part of the invention described in the present description.

In certain embodiments, the sample contains or consists of serum. While serum has practical advantages, it also does not contain anticoagulants such as heparin, a possible inhibitor of PCR reactions. Serum may also be less susceptible to hemolysis than plasma.

In certain embodiments, the sample is saliva. Saliva is fashionably easy to obtain from a patient (eg, near a field or in a field) without special training or special medical equipment.

miRNAs found to be characteristic of mTBI in saliva include: hsa-let-7ca-5p, hsa-let-7i-5p, hsa-miR-1421-3p, hsa-miR-148a-3p, hsa -miR-15b-5p, hsa-miR-16-5p, hsa-miR-181a-5p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-221-3p, hsa-miR -24-3p, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-340-5p, hsa-miR-424-5p, miR-30a-5p , miR-107, miR-135b-5p; miR-199b is selected from the group consisting of -5p; miR-324-5p; and miR-652-3p.

miRNA levels can be used to track an individual's recovery from injury. Thus, the present invention relates to monitoring the recovery of an individual after TBI as an alternative to or in addition to the initial diagnosis.

In certain embodiments, the method includes monitoring TBI, and the level of at least one miRNA is determined in a sample obtained from an individual after at least 2, at least 3, at least 5, at least 7, at least at least 10 or at least 14 days after injury. In certain embodiments, the level of at least one miRNA is determined in a sample obtained from an individual 15 days after injury. In certain embodiments, the level of at least one miRNA is determined in at least two samples obtained at different time intervals after injury, thus allowing recovery to be monitored. For example, miRNA levels can be determined 7 and 14 days after injury or 5, 10 and 15 days after injury. Return of miRNA levels to normal values may indicate recovery of the individual from TBI.

In certain embodiments, an individual is determined to have recovered from mTBI if the miR-425-5p and/or miR-502 level is no longer below a predetermined threshold level or no longer reduced relative to a reference.

In certain embodiments, an individual is determined to have recovered from moderate-to-severe TBI if the miR-21 and/or miR-335 level is no longer above a predetermined cut-off level or no longer elevated relative to a reference.

Diagnosing an individual as having TBI, and specifically diagnosing mild TBI or moderate-severe TBI, can facilitate the determination of appropriate treatment. Thus, the present invention provides a test that enables healthcare professionals such as physicians, clinicians, emergency room physicians, and even non-medical personnel (e.g., teachers, athletic trainers, military personnel) to take an appropriate action on an individual suspected of having TBI. . An individual determined to be suffering from TBI may thus receive the most appropriate treatment as a result of the diagnosis. Thus, the method of the invention may further include directing an appropriate therapy to an individual who has been diagnosed with TBI.

An individual diagnosed with TBI can be further assessed, for example, by CT scan. In certain embodiments, the individual is hospitalized. In certain embodiments, if moderate-to-severe TBI can be ruled out, the individual may not need to be hospitalized for evaluation. An individual diagnosed with moderate-to-severe TBI may be admitted to a hospital or specialized center with a neurotrauma unit.

An individual who is diagnosed with TBI (in particular mTBI) outside of a hospital setting, such as during a sporting event, during a fight, or during a game, may be immediately removed from the game or fight. Then you can begin the procedure for the final return to the game or the battle of the individual.

In a further aspect, a method is provided for determining whether it is appropriate to administer therapy to an individual to alleviate TBI, wherein the method comprises:

determining the level of at least one miRNA in a sample from an individual; and

determining whether or not it is appropriate to administer therapy to alleviate TBI based on the level of at least one miRNA.

It should be understood that the step of administering therapy to the individual is not part of the claimed method, unless specifically stated.

In certain embodiments, the method may further comprise administering an appropriate treatment to the subject. In certain embodiments, the implementation of the treatment may include therapy to alleviate the condition of TBI. Thus, the invention relates to methods for diagnosing and treating TBI in an individual, wherein the method includes the steps of (a) obtaining a sample (eg, a blood, plasma, urine, or saliva sample) from the individual; (b) detecting one or more miRNAs (selected from miRNAs described herein); diagnosing a TBI patient when miRNA(s) level(s) differ from a reference standard (as described herein); and treatment of TBI.

In a further aspect, the invention relates to a method for determining an appropriate treatment for an individual suspected of having TBI, wherein the method comprises identifying whether or not the individual is suffering from TBI by determining the level of at least one miRNA in a sample from the individual.

If a TBI is identified in an individual, suitable treatment may include one or more of the following: additional assessment of the individual, for example, through additional tests (eg, verbal, cognitive, motor and/or visual tests), CT scan and/or MRI scan; cessation of activity by the individual (eg, the activity during which the TBI occurred); admission of the individual to a hospital or specialized clinic; surgery; and administering therapy to alleviate the individual's TBI condition.

Therapy to alleviate TBI may include neuroprotective drugs, for example, drugs to treat cerebral edema, such as mannitol and hypertonic saline, and/or other neuroprotective agents, such as avoidance of hypotensive resuscitation and use of a sedative.

The individual can then be monitored in certain embodiments to track their recovery, such as in a hospital or clinic setting.

According to a further aspect of the invention, a method is provided for detecting and/or determining the level of a target miRNA in an individual, wherein the method comprises the steps of (a) obtaining a sample from the individual; and (b) detecting and/or determining the level of the target miRNA in the sample by contacting the sample with a probe that is specific for the target miRNA.

The sample may be any suitable fluid or tissue sample obtained from an individual as defined above. In certain embodiments, the sample is blood, serum, plasma, urine, or saliva.

In certain embodiments, the method may include determining the level of two or more target miRNAs in a sample.

According to a further aspect of the invention, a therapy for alleviating TBI is provided for use in a method of treating an individual in need thereof, wherein said individual is identified as suffering from TBI by determining the level of at least one miRNA in a sample from the individual.

The step of determining the level of the target miRNA may include bringing the sample into contact with a substrate functionalized with the probe, such as a chip containing the probe. The substrate or chip may conveniently contain multiple probes that are specific for different target miRNAs.

The individual may have suffered an injury, in particular a head injury. The individual may be suspected of TBI. In certain embodiments, the sample is obtained in no more than 72 hours, no more than 48 hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, not more than 2 hours, or not more than 1 hour after damage.

In certain embodiments, the method further comprises treating the subject. Treatment may include one or more of the following: additional assessment of the individual, for example, through additional tests (eg, verbal, cognitive, motor and/or visual tests), CT scan and/or MRI scan; cessation of activity by the individual (eg, the activity during which the TBI occurred); admission of the individual to a hospital or specialized clinic; and administering therapy to alleviate the TBI condition to the individual. In certain embodiments, the treatment comprises administering an effective amount of a neuroprotective drug.

Thus, in yet another additional aspect, the invention relates to a method for treating TBI, where the method includes:

determining the level of at least one miRNA in a sample from an individual; and

if the level of at least one miRNA is indicative of mTBI, treatment corresponding to mTBI; or

if the level of at least one miRNA is indicative of m-sTBI, treatment corresponding to m-sTBI.

Those skilled in the art will appreciate that various treatments for mTBI and m-sTBI can be used.

Suitable treatment for mTBI may include: termination of activity by the individual; in situ or community treatment; additional evaluation of the individual in hospital without an overnight stay (typically, patients with mTBI are quickly discharged with advice regarding head injury); or hospital stay during the observation period (usually 1-2 days). The individual may additionally be assessed using tests (eg, verbal, cognitive, motor and/or visual tests). Generally, CT scanning is required if there are certain indications, including suspected skull fracture, post-traumatic seizures, focal neurological deficit, recurrent vomiting, GCS score less than 13 at initial assessment (less than 14 for children or less than 15 for an infant less than 1 year old) according to NICE guidelines.

Suitable treatment for m-sTBI may include: MRI scan or CT scan (particularly within 1 hour of injury); admission to a hospital (which may include admission to intensive care and/or transfer to a specialized clinic or main trauma center with a neurosurgical unit); neuromonitoring; surgical operation; administration of therapy to alleviate TBI, such as administering neuroprotective drugs, for example, drugs for the treatment of cerebral edema, such as mannitol and hypertonic saline, and/or other neuroprotective agents, such as avoiding hypotensive resuscitation and use of a sedative.

Thus, the present invention allows for the rapid stratification of individuals with TBI to mTBI or m-sTBI, so that they can receive the most appropriate treatment.

According to a further aspect of the invention, a detection system for diagnosing and/or monitoring TBI is provided, wherein the detection system comprises a sensor element containing a substrate functionalized with a target miRNA-specific probe. The detection system may further comprise a detection device that is capable of detecting binding of the target miRNA to the probe.

In accordance with another additional aspect of the invention, a sensor element is provided for use in a detection system for diagnosing and/or monitoring TBI, where the sensor element contains a substrate functionalized with a target miRNA-specific probe.

The sensor element may further comprise a sample addition zone for the resulting sample (eg, a liquid sample).

The probe can selectively bind to the miRNA of interest. The substrate can be functionalized with a plurality of probes. The probes may all be the same, or two or more different probes may be provided. For example, in certain embodiments, the substrate can be functionalized with a first probe specific for a first miRNA and a second probe specific for a second miRNA. The first and second probes can be grouped with each other, for example, in different areas of the sensor element.

In a further aspect of the invention, a composition is provided for use in a method for diagnosing and/or monitoring traumatic brain injury (TBI) in an individual, wherein the composition comprises a probe specific for a target miRNA. The composition may contain any of the listed miRNAs or any combination of the listed miRNAs (eg, two, three, four or more of the listed miRNAs).

In certain embodiments, the target miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR -21, miR-let-7g, miR-335, miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624 , miR-625*, miR-671-3p, hsa-let-7c-5p, hsa-let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16- 5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p , miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p, miR-424-5p, miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR- 95, miR-130a, miR-152, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D- 3p and miR-629.

In certain embodiments, the target miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR -21, miR-let-7g, miR-335, hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR -624, miR-625* and miR-671-3p. These microRNAs were found to be biomarkers expressed in all patients with TBI (moderate or severe).

In certain embodiments, the target miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR -21, miR-let-7g and miR-335.

In certain embodiments, the target miRNA is selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR -181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p,B miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p,B and miR-424-5p; miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p.

In certain embodiments, the target miRNA is selected from the group consisting of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR -95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a , miR-520D-3p and miR-629.

In certain embodiments, the target miRNA is selected from the group consisting of miR-425-5p, miR-502, miR-21, and miR-335.

The probe may contain a biological molecule such as a protein (eg, an antibody) or a nucleic acid. In certain embodiments, the probe contains a nucleic acid. The nucleic acid may contain a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical a sequence that is complementary to the full-length sequence of the target miRNA. In certain embodiments, the nucleic acid contains a sequence that is 100% identical to a sequence that is complementary to the target miRNA sequence (i.e., the receptor contains a nucleic acid sequence that is an exact complement to the target miRNA sequence).

The probes can be bonded to the surface of the substrate by any suitable means, such as through bonding chemistry known to those skilled in the art. In certain embodiments, each probe is bonded to the surface of the substrate via a linker. In certain embodiments, the probe contains a functional group for immobilizing the probe on a substrate or for binding the probe to a linker immobilized on the substrate.

Alternatively, or in addition, the probe may contain a detectable label. The detectable label may be, for example, a radioactive, fluorescent, luminescent, or antibody-based label (eg, it may be a conventional tetrameric antibody or a detectable fragment thereof).

The sensor element substrate may be any suitable substance. In certain embodiments, the implementation of the substrate contains or consists of metal, plastic, glass, silicon dioxide, silicon, graphite, graphene, or any combination thereof. In certain embodiments, the implementation of the substrate contains many layers. For example, the substrate can be obtained by forming a surface or layer of graphene on a layer of silicon carbide or silicon dioxide. The surface of graphene can be chemically modified, for example, to graphene oxide (GO) or graphene amine (GA). Methods for forming graphene layers are known to those skilled in the art, such as epitaxial growth and sublimation growth.

For convenience, probes containing or consisting of a nucleic acid can be linked to the GO surface via a linker using an amide coupling reagent (e.g., (O-(7-azabenzotriazol-1-yl)-N,N,N,N'- tetramethyluronium hexafluorophosphate (HATU) The sensor element containing the surface functionalized with the nucleic acid probe can then be used to selectively detect its complementary miRNA.

Suitable linkers may contain an aniline (or derivative) moiety, a benzoic acid (or derivative) moiety, or an ethanediamine (or derivative) moiety. An aniline-based linker can be obtained by attaching a molecule of nitrobenzene (or a derivative) to the surface of graphene (for example, using a diazonium salt) and reducing the nitrobenzene to aniline. The amino group of the aniline can then be used to bind to the probe. Similarly, a diazonium salt (eg, 4-benzoic acid diazonium tetrafluoroborate) can be used to bond benzoic acid or a benzoic acid derivative to the graphene surface. The ethanediamine moiety can be bonded to carboxylated graphene or graphene oxide.

The sensor element can be enclosed in a test strip. The test strip may be disposable.

The detection device can be configured to detect binding of the target miRNA to the receptor by any suitable means known to those skilled in the art, such as by detecting changes in electrical resistance, hydrogen ion concentration, or conformational changes resulting from hybridization.

The detection device may further comprise a user interface for outputting data to the user.

In certain embodiments, the detection device includes a database of treatment information. The device can identify suitable treatment options from a database depending on the levels of the miRNA or each miRNA of interest. The treatment information may be provided to the user via a user interface.

For convenience, the detection device may be portable, eg handheld. The detection device may include a data storage unit for storing information about miRNA levels and other information associated with the individual. In certain embodiments, the implementation of the device contains the means of transmitting data to other devices. For example, a device can transmit data wirelessly via WiFi, 3G, 4G, Bluetooth, or through a mobile phone app. This may allow for easy access to healthcare professionals' data when needed.

Thus, it is contemplated that the detection device of the invention provides an affordable, portable healthcare delivery tool for diagnosing and monitoring TBI in a non-invasive manner. The device can be used by ambulance crews, military, schools, sports clubs, and healthcare professionals to ensure proper assessment and scheduling of patients with suspected TBI.

In a further aspect, a kit is provided for use in the present methods. The kit may contain at least a probe (eg, a protein, such as an antibody, or a nucleic acid) that is capable of selectively binding to the miRNA of interest. In certain embodiments, the kit comprises a block containing a plurality of probes. In certain embodiments, at least one probe is a PCR primer. The kit may further contain instructions for use, such as instructions for use in diagnosing and/or monitoring TBI. The kit may further contain suitable buffers and reagents such as primers and amplification enzymes (eg DNA polymerase, reverse transcriptase to convert miRNA to cDNA).

It should be understood that the statements given in the present description in relation to any aspect of the invention can be applied equally to any other aspect of the invention, if necessary.

Detailed description of the invention

Embodiments of the invention are described below by way of example and with reference to the accompanying figures:

Figure 1: miR-425-5p and miR-502 expression in 3 different categories of injury and HV

Expression of miR-425-5p and miR-502 in 10 HV, 10 mTBI+EC (1 day), 10 mTBI+EC (15 days), 10 EC (1 day), 10B EC (15 days), 10 sTBI+EC (1 day) and 10 sTBI+EC (15 days) in patients, detectable by qPCR-RT analysis. It was found that miR-425-5p expression was markedly reduced in mTBI+EC (1 day) compared with HV (p<0.01), mTBI+EC (15 days) (p<0.001) and sTBI+EC (1 day ) (p<0.01) (Figure 1A). miR-502 expression was found to be markedly reduced with mTBI+EC (1 day) compared with HV (p<0.05), mTBI+EC (15 days) (p<0.01) and sTBI+EC (1 day) (p<0.05) (figure 1B).

Figure 2: miR-21 and miR-335 expression in 3 different categories of injury and HV

Expression of miR-21 and miR-335 in 10 HV, 10 mTBI+EC (1 day), 10 mTBI+EC (15 days), 10 EC (1 day), 10B EC (15 days), 10 sTBI+EC (1 day) and 10 sTBI+EC (15 days) in patients detected by qPCR-RT analysis. miR-21 expression was found to be significantly increased with sTBI+EC (1 day and 15 days) compared to HV (p<0.01) (Figure 2A). miR-335 expression was found to be markedly increased with sTBI+EC (day 1) compared with HV (p<0.001), EC (15 days) (p<0.001) and mTBI+EC (day 1) (p<0 .05) (figure 2B).

Figure 3: Period of expression of miR-425-5p (Figure 3A) and miR-502 (Figure 3B) in 3 different categories of injury and HV

Expression of miR-425-5p and miR-502 in 30 HV, 30 mTBI+EC patients, 30 EC patients, 30 sTBI+EC patients at various time points after injury (T0, T4-12 hours, T48-72 hours , 15 days) detected by real-time qPCR analysis. miR-425-5p expression was found to be markedly reduced in mTBI+EC at T0 and T4-12 hours compared to HV, sTBI+EC and EC (p<0.05). miR-502 expression was found to be markedly reduced in mTBI+EC at T0 and T4-12 hours compared to HV, sTBI+EC and EC (p<0.05). P values were determined using Tukey's post hoc test.

* significant difference from HV

Figure 4: Period of expression of miR-21 (Figure 4A) and miR-335 (Figure 4B) in 3 different categories of injury and HV

Expression of miR-21 and miR-335 in 30 HV, 30 mTBI+EC patients, 30 EC patients, and 30 sTBI+EC patients at various time points after injury (T0, T4-12 hours, T48-72 hours, 15 days) detected by real-time qPCR analysis. It was found that the expression of miR-21 significantly increased with sTBI+EC after T4-12 hours, T48-72 hours and 15 days compared with HV (p<0.01). miR-335 expression was found to be markedly increased in sTBI+EC at T0, T4-12 hours, T48-72 hours and 15 days compared to HV and mTBI+EC (p<0.001), but not EC. P values were determined using Tukey's post hoc test.

* significant difference from HV

Examples

Since miRNAs are becoming promising biomarkers in a number of different pathologies, the authors of the present invention tried to study their role in TBI.

Example 1

Materials and methods

Patient selection and specimen collection

Study participants were recruited from the Surgical Reconstruction and Microbiology Research Center (SRMRC) at the Queen Elizabeth Hospital, Birmingham, UK, as part of The Golden Hour Study on brain biomarkers after injury ( reference to ethics commission 13/WA/0399).

First, the authors scanned 754 miRNAs in 5 mTBI cases in patients with extracranial injury (EC), in 5 patients with sTBI+EC injury and healthy volunteers (HV) at day 1 and 15 days after injury in order to select specific candidate biomarkers, which can distinguish mild from severe TBI and predict recovery from mTBI after 15 days. Then, based on this information (Table 2), it was possible to confirm the results of the study in an expanded cohort of patients consisting of 40 individuals divided into 4 different categories: HV (n=10), EC (n=10), mTBI+EC (n=10 ), sTBI+EC (n=10). Healthy volunteers consented and were included in the RECOS study. Patients with EC injury suffered from radiographically confirmed fractures, did not suffer from head trauma, did not suffer from infection, did not have a history of neurological or psychiatric disorders, and did not suffer from alcohol or drug dependence. Mild TBI with EC included TBI with non-penetrating head injury and a Glasgow Coma Scale (GCS) score >13. Severe TBI with EC included patients with a GCS score of 8 or below. All patients had sex and age comparable to HV.

Sample processing

Peripheral blood samples were obtained on day 1 and 15 days after injury in each patient. Blood samples were processed for serum isolation within 2 hours after blood collection. Before centrifugation at 3000 rpm. for 10 min at 4°C whole blood was left to settle for approximately 30 min at room temperature. Serum was divided into aliquots and stored at -80°C until analysis.

RNA isolation, reverse transcription and miRNA profiling with the TaqMan Low Density Array (TLDA)

Initial screening (initial set) was performed in 5 patients with mTBI+EC and 5 patients with sTBI+EC, which were compared with HV at two different time points (after 1 day and 15 days after injury). Serum from these patients was used for transcriptome profiling of 754 miRNA. Serum samples were centrifuged at 2000 rpm. within 10 minutes yes sediment and removed any circulating cells or debris. MiRNAs were extracted from 400 µl of serum samples using the Qiagen miRNeasy mini kit (Qiagen, GmbH, Hilden, Germany) according to Qiagen's additional protocol for the purification of small RNAs from serum and plasma and finally eluted in a volume of 30 µl of RNase-free water. The concentration and purity of the resulting RNA was determined using an ND-1000 UV-Vis (NanoDrop) spectrophotometer. 20 ng of serum RNA was reverse transcribed and pre-amplified according to the manufacturer's instructions. Pre-amplification products were loaded into TLDA, TaqMan Human MicroRNA Array v3.0 A and B (Applied Biosystems LifeTechnologies™). TLDA PCR was performed on a 7900HT Fast RealTime PCR system (Applied Biosystem, LifeTechnologies™).

Data analysis

To obtain an accurate miRNA profile, the authors used global median normalization. Similar to micropanel analysis, Ct values from each sample were normalized to the median Ct of the panel. In addition, by calculating the Pearson correlation of the median and mean Ct of each panel and the Ct of each miRNA, the authors identified two miRNAs for which they showed an expression profile close to the median and mean TLDA, i.e. miR-331 and miR-223*. These miRNAs were also confirmed to be among the most stable in TLDA by using two different methods [DataAssistv.3software (AppliedBiosystem Life Technologies™)] and the geNorm algorithm. Thus, miR-331 and miR-223* were used as reference genes for the validation of individual TaqMan assays. The fold change in expression was calculated by the 2-ΔΔCT method. Differentially expressed miRNAs (DE miRNAs) were identified by a microarray analysis (SAM) value calculated by Multi experiment viewer v4.8.1 using a two-pair unpaired test for ΔCt and using a p-value based on 100 permutations; substitution module: K-nearest neighbors (10 neighbors); a false positive rate of <0.15 was used as an adjustment for multiple comparisons. The authors accepted as reliable only miRNA DEs consistent with the use of all endogenous controls.

Separate TaqMan assays

Ten differentially expressed miRNAs were selected from the panel as potential candidate biomarkers to be able to distinguish between mild TBI and severe TBI and to monitor recovery from mild TBI. These candidates were used to validate data in an expanded cohort of 30 patients (confirmation set) divided into 3 different categories (mTBI+EC, sTBI+EC and EC only) and 10 controls (HV) at two different time points (at 1 and 15 days after injury) by separate TaqMan assays (AppliedBiosystems, Life Technologies™). Samples were extracted and reverse transcribed as described above and real-time qPCR analysis was performed on a Bio-Rad iQ5 Real-time PCR detection system (Bio-Rad, CA, USA). The fold changes in expression were calculated by the 2-ΔΔCT method.

Statistical analysis

The data was tested for normal distribution and transformed to apply parametric criteria. Comparisons within groups at each time point and within groups over an extended period of time were performed by one-way ANOVA and Tukey's post hoc test on the transformed data. Receiver performance analysis was used to calculate the sensitivity and specificity of each biomarker in the diagnosis of mTBI or sTBI expressed as area under the curve (AUC). All analyzes were performed on SPSS v.20 (IBM). Differences were considered statistically significant at p<0.05.

RESULTS

Expression profiles resulting from TaqMan Low Density Arrays (TLDA)

Of the 754 screened TLDA miRNAs, we identified ten differentially expressed circulating miRNAs at day 1 and day 13-15 in mTBI+EC, at day 19-1 and at day 22-15 in the sTBI+EC group (Table 2). hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625* and miR -671-3p for additional analysis as they were expressed in the majority of patients, thus not being suitable candidate biomarkers for only mild or severe injury. However, the above miRNAs can identify TBI of any severity and are thus useful biomarkers of TBI. On the other hand, miR-184, miR-301b, miR-502, and miR-505, which are exclusively and differentially expressed in mTBI+EC on day 1, were selected as early candidate mTBI biomarkers. In addition, miR-203, miR-425-5p, miR-654-3p and miR-655 differentially expressed 15 days after mTBI+EC were selected as candidate biomarkers capable of tracking mTBI recovery.

In conclusion, two miRNAs, miR-21 and miR-335, which are consistently expressed at both time points in TBI+EC, were selected for further study.

Table 2 : Fold change in microRNAs differentially expressed in 5 mTBI+EC patients (1 and 15 days) and 5 sTBI+EC patients (1 and 15 days) compared to 5 HV and detectable TLDA.

mTBI+EC 1 day vs. HV mTBI+EC 15 days vs. HV sTBI+EC 1 day vs. HV sTBI+EC 15 days vs. HV hsa-miR-184 0.1383 hsa-miR-193a-5p 24.901 hsa-let-7g 0.3250 hsa-miR-130a 14.979 hsa-miR-190 0.1278 hsa-miR-194 20.946 hsa-miR-10a 11.953 hsa-miR-152 9.8921 hsa-miR-425-5p 0.0798 hsa-miR-203 4.1763 hsa-miR-132 8.1875 hsa-miR-190 0.0277 hsa-miR-502 0.0538 hsa-miR-365 3.7087 hsa-miR-143 26.193 hsa-miR-193a-5p 13.655 hsa-miR-505 7.7696 hsa-miR-425-5p 3.0166 hsa-miR-148b 20.095 hsa-miR-194 12.301 hsa-miR-126* 0.1570 hsa-miR-654-3p 0.0878 hsa-miR-18a 26.806 hsa-miR-21 12.662 hsa-miR-144* 0.2758 hsa-miR-655 0.0756 hsa-miR-190 0.0634 hsa-miR-27b 18.977 hsa-miR-590-3p 0.3842 hsa-miR-671-3p 4.0584 hsa-miR-192 0.2245 hsa-miR-301 21.954 hsa-miR-624 0.0836 hsa-miR-126* 0.2978 hsa-miR-193a-5p 29.785 hsa-miR-326 93.099 hsa-miR-301b 0.0435 hsa-miR-144* 0.2645 hsa-miR-21 7.1654 hsa-miR-335 45.050 hsa-miR-590-3p 0.3035 hsa-miR-223 4.6799 hsa-miR-345 37.699 hsa-miR-624 0.1643 hsa-miR-335 37.192 hsa-miR-361 37.295 hsa-miR-625* 0.1521 hsa-miR-365 5.5771 hsa-miR-422a 77.373 hsa-miR-429 0.1294 hsa-miR-579 4.7203 hsa-miR-618 29.527 hsa-miR-642 41.515 hsa-miR-95 20.788 hsa-miR-671-3p 8.4425 hsa-miR-144* 0.2759 hsa-miR-99a 12.218 hsa-miR-624 0.0304 hsa-miR-144* 0.2905 hsa-miR-625* 0.0981 hsa-miR-520D-3p 0.2579 hsa-miR-590-3p 0.4188 hsa-miR-625* 0.1575 hsa-miR-629 0.2793

Separate TaqMan assay for candidate mTBI biomarkers

Then, to confirm these findings, the authors tested the expression of selected miRNAs in triplicate and in independent groups (10 mTBI+EC, 10 sTBI+EC, 10 EC) at two selected time points (1 and 15 days after injury) using separate assays. Taqman. The results were compared with 10 HV. The fold change was calculated by the 2-ΔΔCT method using miR-331 and miR-223* as reference genes.

Among the mTBI candidate biomarkers at both time points (miR-184, miR-301b, miR-502, miR-505, miR-203, miR-425-5p, miR-654-3p and miR-655), where for two miRNAs showed interesting results, and they were significantly and differentially expressed in three different categories compared to HV. In particular, miR-425-5p and miR-502 showed a similar trend (Fig 1). They were both significantly suppressed with mTBI+EC (mean 0.387±0.201 and 0.314±0.146), respectively, 1 day after injury compared to HV (p<0.001), EC (p<0.001) and sTBI+EC (p<0.001) . 15 days after mild injury, miR425-5p and miR-502 returned to normal levels (0.886±0.310 and 1.157±0.258). The expression of miR-425-5p and miR-502 in EC samples 1 day and 15 days after injury was also found to be similar to that in HV, suggesting that these two biomarkers are differentially expressed only in patients with brain injury. In addition, none of them showed any significant difference in sTBI+EC compared to HV at both time points. Thus, miR-425-5p and miR-502 can be considered as the most promising candidate biomarkers for early diagnosis and monitoring of mTBI 15 days after injury. The AUCs of these biomarkers are shown in Table 3.

Separate TaqMan assay for candidate sTBI biomarkers

MiR-21 and miR-335 were analyzed as possible sTBI biomarkers, as they are both overexpressed at both sTBI+EC time points on primary screening. They were also shown to be strong candidates in the second set of patient data (FIG. 2). Mir-21 also increased significantly at both time points in sTBI with EC (7.106±4.192 and 4.012±1.577) for HV (p.0.001), EC (p<0.001) and mTBI (p<0.001). No significant differences were observed in the remaining categories compared to HV. miR-335 showed increased expression at sTBI+EC and at both time points (16.824±14.195 and 12.324±8.931, respectively). On day 1, this group was significantly different from controls (p=0.001) and mTBI+EC (p=0.031), but not from EC. It should be noted that a significant increase in expression in patients with EC was found on day 1 (7.951±4.870), but not 15 days after injury (1.260±0.531). For this reason, at day 15 miR335 was significantly higher in the sTBI+EC group compared to HV (p=0.002), EC (p=0.007) and mTBI+EC (p=0.001). miR-335 did not show any significant difference in mTBI+EC at both time points compared to HV. AUCs for these biomarkers are also shown in Table 3.

Table 3: Area under the curve

Variable(s) Square Asymptotic 95% confidence interval Bottom line Upper bound miR-502В 1 day 0.993 0.972 1,000 miR-502В 15 days Minor - - miR-425-5p 1 day 0.994 0.977 1,000 miR-425-5pIn 15 days Minor - - miR-21В 1 day 0.979 0.934 1,000 miR-21В 15 days 0.975 0.929 1,000 miR-335B 1 day 0.758 0.592 0.921 miR-335В 15 days 0.957 0.884 1,000

Discussion

The present study examined whether changes in miRNA levels could be taken to diagnose TBI and assess its severity. Four miRNAs were identified as being differentially expressed in TBI; miR-425-5p, miR 502, miR-21 and miR-335.

For miR-425-5p showed significant results after day 1 with mTBI+EC compared with HV and similar results were obtained in all other categories. Their decrease in expression during the first 24 hours after mild injury and their return to normal levels after 15 days makes miR-425-5p a suitable candidate biomarker for mild injury.

miR-502 was also found to be differentially expressed in mTBI+EC. The trend of this miRNA was very similar to miR-425-5p. It has been shown to be specific for brain-injured patients and can also be used to track recovery as it returns to its normal value 15 days after the average injury.

It was noted that after sTBI, 2 miRNAs (miR-21, miR-335) were expressed both after 1 day and after 15 days, and thus they were chosen as possible sTBI biomarkers. miR-21 and miR-335 expression was significantly increased at both time points compared to controls at sTBI+EC. Thus, increased expression confirmed the results of the panel and demonstrated the effectiveness of these molecules as sTBI biomarkers.

With the miRNA panel of choice, TBI can be accurately diagnosed and patients can be stratified according to severity, which in turn allows for the most appropriate treatment.

Example 2

Patient selection and specimen collection

Study participants were recruited from the Surgical Reconstruction and Microbiology Research Center (SRMRC) at Queen Elizabeth Hospital Birmingham (UK) as part of the SIR (Steroids and Immunity from Injury to Rehabilitation) study (link to Ethics Committee 11/SW/0177), the ReCoS (Repeated Concussion in Sport) study (Ethics Committee ref. 11-0429AP28), and the Golden Hour study (Ethics Committee ref. 13/WA/0399). Prior to enrollment in the study, written informed consent was obtained from the participants or an acting trustee (family member or professional not directly involved in the study).

The second set of sample data used serum samples from a total of 120 individuals divided into 4 different categories: HV (n=30), EC (n=30), mTBI+EC (n=30), sTBI+EC (n=30 ), and blood was taken at different time points (T0-1 hour, T4-12 hours, T48-72 hours, 15 days) from each patient. Healthy volunteers gave consent and were included in the study. Patients with EC injury suffered from radiographically confirmed fractures, did not suffer from head trauma, did not suffer from infection, did not have a history of neurological or psychiatric disorders, and did not suffer from alcohol or drug dependence. Mild TBI with EC included TBI with nonpenetrating head injury and Glasgow Coma Scale (GCS) score ≥13. Severe TBI with EC included patients with a GCS score ≤8.

Sample processing

Blood samples were processed for serum isolation within 2 hours of collection. Before centrifugation at 3000 rpm. for 10 min at 4°C whole blood was left to settle for approximately 30 min at room temperature. Serum was divided into aliquots and stored at -80°C until analysis.

RNA isolation, data analysis, analyses, and statistical analysis were performed as described in Example 1.

results

Separate analysis of TaqMan candidate mTBI biomarkers

To confirm the data obtained from example 1 at different time points (T0, T4-12 hours, T48-72 hours and 15 days after injury), the expression of selected miRNAs was measured in 3 separate and independent groups (30 mTBI+EC, 30 sTBI+EC, 30 EC) at various time points (T0, T4-12 hours, T48-72 hours and 15 days after injury) using separate TaqMan assays. The results were compared with 10 HV. The fold change was calculated by the 2-ΔΔCT method using miR-331 and miR-223* as reference.

Among mTBI candidate biomarkers at both time points (miR-184, miR-502, miR-505, miR-301b, miR-203, miR-425-5p, miR-654-3p and miR-655), only two showed interesting results, and they were significantly and differentially expressed in 3 different categories compared to HV. Specifically, miR-425-5p and miR-502 showed a similar trend (Figure 3). They were both significantly suppressed with mTBI+EC, miR-425-5p at T0-1 hour (p=0.01845) and T4-12 hours (p=0.01962), respectively, compared to HV or EC and sTBI+EC (p<0.05), and miR-502 at T0-1 hour and T4-12 hours compared to HV (p=0.02538 and p=0.03718, respectively), or EC and sTBI +EC (p<0.01). 48 hours after mild injury, miR425-5p and miR-502 returned back to normal levels. Expression of miR-425-5p and miR-502 was also detected in the EC group at a comparable level to HV, thus confirming that only these two biomarkers are downregulated in brain injury. In addition, none of them showed any significant decrease in expression at sTBI+EC compared to HV at all time points. Thus, miR-425-5p and miR-502 can be considered as the most promising candidate biomarkers for early diagnosis and monitoring of mTBI. The AUCs for these biomarkers at the most relevant time points are shown in Table 4.

Separate TaqMan assay for candidate sTBI biomarkers

MiR-21 and miR-335 were analyzed as possible sTBI biomarkers, as they both appear to be overexpressed at both sTBI+EC time points in the primary screen. They were shown to be strong candidates also in the second set of patient data (Figure 4). mir-21 expression was significantly increased at sTBI with EC at all time points 4 hours post-injury compared to HV, EC and mTBI+EC (p=0.00306 at T4-12 hours, p=0.00844 at time T48-72 hours and p=0.00077 after 15 days). No significant differences were observed in the remaining categories compared to HV. miR-335 showed increased expression at sTBI+EC and at all time points compared to HV (p=0.00109 at time T0-1 hour, p=0.00284 at time T4-12 hours, p=0 .00012 T48-72 hour and p=0.01284 at 15 days) and mTBI+EC, but did not show an increase in expression compared to EC. The AUCs for these biomarkers are also shown in Table 4.

Table 4 : Area under the curve of four candidate TBI biomarkers at various time points.

Only the most relevant times are shown.

Variable(s) Square Significance Asymptotic 95% Confidence interval Bottom line Upper bound miR-425-5pВ T0 mTBI versus HV one 0.002 one one mTBI versus sTBI 0.911 0.020 0.778 1,000 mTBI versus EC 0.950 0.01 0.860 1,000 miR-502 T0 mTBI versus HV one 0.001 1,000 1,000 mTBI versus sTBI 0.990 0.001 0.960 1,000 mTBI versus EC 0.990 0.001 0.940 1,000 miR-21 T4-12 hour sTBI versus HV 0.961 0.003 0.880 1,000 sTBI versus mTBI 0.960 0.001 0.870 1,000 sTBI versus EC 0.900 0.004 0.740 1,000 miR-335 T0 sTBI versus HV 0.990 0.000 0.960 1,000 sTBI versus mTBI 0.780 0.023 0.590 0.960 sTBI versus EC 0.500 one 0.240 0.780

Discussion

This study confirmed previous findings that changes in miRNA levels can be used to diagnose TBI and assess its severity. The study confirmed that the following four miRNAs are differentially expressed in TBI: miR-425-5p, miR 502, miR-21 and miR-335.

Showed significant results for miR-425-5p through T0 and T4-12 hours with mTBI+EC compared to HV and similar results were obtained in all other categories. Their decrease in expression returns to normal levels after T48-72 hours, confirming that miR-425-5p is a suitable candidate biomarker for mild injury.

It was also confirmed that miR-502 is differentially expressed in mTBI+EC. The trend of this miRNA was very similar to miR-425-5p. It has been shown to be specific in patients with brain injury and can also be used to track recovery as it returns to normal in T48-72 hours after a slight injury.

It was noted that after sTBI, 2 miRNAs (miR-21, miR-335) were expressed at all analyzed time points, and thus they were confirmed as possible biomarkers for sTBI. Expression of miR-21 and miR-335 was significantly increased compared to controls at sTBI+EC. Thus, increased expression confirmed the efficacy of these molecules as sTBI biomarkers.

Example 3

Saliva samples were collected from professional athletes with concussion 2-3 days after injury and microRNAs contained in saliva were analyzed. Athletes were clinically diagnosed with mTBI.

Materials and methods

MicroRNAs were analyzed using nCounter technology (nanoString Technologies®), which uses molecular barcodes and microscope imaging to detect and count up to several hundred unique transcriptomes in a single hybridization reaction. Each color-coded barcode was attached to one target-specific probe corresponding to the microRNA of interest.

Analyzes were performed according to the manufacturer's protocol, which included the following steps:

Hybridization : The method uses two ~20 bp microRNA probes that hybridize in solution. The reporter probe carries the signal, while the capture probe immobilizes the data collection complex.

Purification and Immobilization : After hybridization, excess probes are removed and the probe/target complexes are aligned and immobilized in an nCounter cartridge.

Data collection : The sample cartridges are placed in the digital analyzer instrument for data collection. The color codes on the surface of the cartridge are counted and tabulated for each target molecule.

results

Table 5 below is a list of miRNAs that have been found to be significantly and differentially expressed in athletes with concussion compared to healthy volunteers. The table shows the fold change in microRNA expression in patients compared with the control group. Fold changes were calculated using miR-23a-3p and miR-148b-3p as reference genes.

Table 5

miRNA Multiple change hsa-let-7c-5p 2.80 hsa-let-7i-5p 1.82 hsa-miR-142-3p 1.41 hsa-miR-148a-3p 1.72 hsa-miR-15b-5p 2.30 hsa-miR-16-5p 2.32 hsa-miR-181a-5p 1.54 hsa-miR-20a-5p+hsa-miR-20b-5p 2.16 hsa-miR-221-3p 2.90 hsa-miR-24-3p 1.94 hsa-miR-27b-3p 3.45 hsa-miR-29a-3p 4.03 hsa-miR-29c-3p 1.44 hsa-miR-424-5p 2.88 hsa-miR-30a-5p 2.16 hsa-miR-107 1.72 hsa-miR-135b-5p 1.97 hsa-miR-199b-5p 1.88 hsa-miR-324-5p 5.61 hsa-miR-652-3p 3.43

values for miR-20a-5p and miR-20b-5p were pooled because using nCounter technology, it is impossible to distinguish between them.

Discussion

This study demonstrates that miRNAs contained in saliva are indicative of concussion/mTBI. This is important because saliva is easier to obtain than blood, and thus miRNA detection in saliva provides a fast and convenient way to diagnose TBI, particularly in the field.

--->

SEQUENCE LIST

<110> The University of Birmingham

<120> BIOMARKERS FOR TRAUMATIC BRAIN INJURY

<130> PB150144WO

<150>GB1603967.9

<151> 2016-03-08

<160> 69

<170>PatentIn version 3.5

<210> 1

<211> 22

<212> RNA

<213> Homo sapiens

<400> 1

uagcuuauca gacugauguu ga 22

<210> 2

<211> 23

<212> RNA

<213> Homo sapiens

<400> 2

augacacga ucacucccgu uga 23

<210> 3

<211> 21

<212> RNA

<213> Homo sapiens

<400> 3

auccuugcua ucggggcu a 21

<210> 4

<211> 23

<212> RNA

<213> Homo sapiens

<400> 4

ucaagagcaa uaacgaaaaa ugu 23

<210> 5

<211> 23

<212> RNA

<213> Homo sapiens

<400> 5

cagugcaaug auauugucaa agc 23

<210> 6

<211> 22

<212> RNA

<213> Homo sapiens

<400> 6

uggacggaga acugauaagg gu 22

<210> 7

<211> 22

<212> RNA

<213> Homo sapiens

<400> 7

cgucaacacu ugcugguuuc cu 22

<210> 8

<211> 22

<212> RNA

<213> Homo sapiens

<400> 8

gugaaauguu uaggaccacu ag 22

<210> 9

<211> 22

<212> RNA

<213> Homo sapiens

<400> 9

uaugucugcu gaccaucacc uu 22

<210> 10

<211> 22

<212> RNA

<213> Homo sapiens

<400> 10

auaauacaug guuaaccucu uu 22

<210> 11

<211> 21

<212> RNA

<213> Homo sapiens

<400> 11

gccccugggc cuauccuaga a 21

<210> 12

<211> 22

<212> RNA

<213> Homo sapiens

<400> 12

cguguauuug acaagcugag uu 22

<210> 13

<211> 22

<212> RNA

<213> Homo sapiens

<400> 13

ugagguagua guuuguacag uu 22

<210> 14

<211> 21

<212> RNA

<213> Homo sapiens

<400> 14

cauuauuacu uuugguacgc g 21

<210> 15

<211> 22

<212> RNA

<213> Homo sapiens

<400> 15

ugggucuuug cgggcgagau ga 22

<210> 16

<211> 22

<212> RNA

<213> Homo sapiens

<400> 16

ggauaucauc auauacugua ag 22

<210> 17

<211> 21

<212> RNA

<213> Homo sapiens

<400> 17

cuauauauca aacauauucc u 21

<210> 18

<211> 22

<212> RNA

<213> Homo sapiens

<400> 18

uguaacagca acuccaugug ga 22

<210> 19

<211> 22

<212> RNA

<213> Homo sapiens

<400> 19

uaaugccccu aaaaauccuu au 22

<210> 20

<211> 21

<212> RNA

<213> Homo sapiens

<400> 20

uaauuuuaug uauaagcuag u 21

<210> 21

<211> 22

<212> RNA

<213> Homo sapiens

<400> 21

uaguaccagu accuuguguu ca 22

<210> 22

<211> 22

<212> RNA

<213> Homo sapiens

<400> 22

gacuauagaa cuuucccccu ca 22

<210> 23

<211> 21

<212> RNA

<213> Homo sapiens

<400> 23

uccgguucuc agggcuccac c 21

<210> 24

<211> 22

<212> RNA

<213> Homo sapiens

<400> 24

ugagguagua gguuguaugg uu 22

<210> 25

<211> 22

<212> RNA

<213> Homo sapiens

<400> 25

ugagguagua guuugugcug uu 22

<210> 26

<211> 23

<212> RNA

<213> Homo sapiens

<400> 26

uguaguguuu ccuacuuuau gga 23

<210> 27

<211> 22

<212> RNA

<213> Homo sapiens

<400> 27

ucagugcacu acagaacuuu gu 22

<210> 28

<211> 22

<212> RNA

<213> Homo sapiens

<400> 28

uagcagcaca ucaugguuua ca 22

<210> 29

<211> 22

<212> RNA

<213> Homo sapiens

<400> 29

uagcagcacg uaaauauugg cg 22

<210> 30

<211> 23

<212> RNA

<213> Homo sapiens

<400> 30

aacauucaac gcugucggug agu 23

<210> 31

<211> 23

<212> RNA

<213> Homo sapiens

<400> 31

uaaagugcuu auagugcagg uag 23

<210> 32

<211> 23

<212> RNA

<213> Homo sapiens

<400> 32

caaagugcuc auagugcagg uag 23

<210> 33

<211> 23

<212> RNA

<213> Homo sapiens

<400> 33

agcuacauug ucugcugggu uuc 23

<210> 34

<211> 22

<212> RNA

<213> Homo sapiens

<400> 34

uggcucaguu cagcaggaac ag 22

<210> 35

<211> 21

<212> RNA

<213> Homo sapiens

<400> 35

uucacagugg cuaaguucug c 21

<210> 36

<211> 22

<212> RNA

<213> Homo sapiens

<400> 36

uagcaccauc ugaaaucggu ua 22

<210> 37

<211> 22

<212> RNA

<213> Homo sapiens

<400> 37

uagcaccauu ugaaaucggu ua 22

<210> 38

<211> 22

<212> RNA

<213> Homo sapiens

<400> 38

uguaaacauc cucgacugga ag 22

<210> 39

<211> 23

<212> RNA

<213> Homo sapiens

<400> 39

agcagcauug uacagggcua uca 23

<210> 40

<211> 23

<212> RNA

<213> Homo sapiens

<400> 40

uauggcuuuu cauuccuaug uga 23

<210> 41

<211> 23

<212> RNA

<213> Homo sapiens

<400> 41

cccaguguuu agacuaucug uuc 23

<210> 42

<211> 23

<212> RNA

<213> Homo sapiens

<400> 42

cgcauccccu agggcauugg ugu 23

<210> 43

<211> 21

<212> RNA

<213> Homo sapiens

<400> 43

aauggcgcca cuaggguugu g 21

<210> 44

<211> 22

<212> RNA

<213> Homo sapiens

<400> 44

cagcagcaau ucauguuuug aa 22

<210> 45

<211> 23

<212> RNA

<213> Homo sapiens

<400> 45

uacccuguag auccgaauuu gug 23

<210> 46

<211> 22

<212> RNA

<213> Homo sapiens

<400> 46

uaacagucua cagccauggu cg 22

<210> 47

<211> 22

<212> RNA

<213> Homo sapiens

<400> 47

ugucaguuug ucaaauaccc ca 22

<210> 48

<211> 21

<212> RNA

<213> Homo sapiens

<400> 48

ugagaugaag cacuguagcu c 21

<210> 49

<211> 22

<212> RNA

<213> Homo sapiens

<400> 49

ucagugcauc acagaacuuu gu 22

<210> 50

<211> 23

<212> RNA

<213> Homo sapiens

<400> 50

uaaggugcau cuagugcaga uag 23

<210> 51

<211> 21

<212> RNA

<213> Homo sapiens

<400> 51

cugaccuaug aauugacagc c 21

<210> 52

<211> 22

<212> RNA

<213> Homo sapiens

<400> 52

uaauacuguc ugguaaaacc gu 22

<210> 53

<211> 23

<212> RNA

<213> Homo sapiens

<400> 53

aaacucuacu uguccuucug agu 23

<210> 54

<211> 21

<212> RNA

<213> Homo sapiens

<400> 54

ucaauaaaug ucuguugaau u 21

<210> 55

<211> 22

<212> RNA

<213> Homo sapiens

<400> 55

cagugcaaug uuaaaagggc au 22

<210> 56

<211> 23

<212> RNA

<213> Homo sapiens

<400> 56

agguucugug aucacuccg acu 23

<210> 57

<211> 21

<212> RNA

<213> Homo sapiens

<400> 57

uucacagugg cuaaguucug c 21

<210> 58

<211> 23

<212> RNA

<213> Homo sapiens

<400> 58

cagugcaaua guauugucaa agc 23

<210> 59

<211> 20

<212> RNA

<213> Homo sapiens

<400> 59

ccucugggcc cuuccuccag 20

<210> 60

<211> 22

<212> RNA

<213> Homo sapiens

<400> 60

gcugacuccu aguccagggc uc 22

<210> 61

<211> 22

<212> RNA

<213> Homo sapiens

<400> 61

uuaucagaau cuccaggggu ac 22

<210> 62

<211> 22

<212> RNA

<213> Homo sapiens

<400> 62

acuggacuua gggucagaag gc 22

<210> 63

<211> 23

<212> RNA

<213> Homo sapiens

<400> 63

uucauuuggu uaaaccgcg auu 23

<210> 64

<211> 22

<212> RNA

<213> Homo sapiens

<400> 64

gucccucucc aaaugugucu ug 22

<210> 65

<211> 22

<212> RNA

<213> Homo sapiens

<400> 65

aacccguaga uccgaucuug ug 22

<210> 66

<211> 22

<212> RNA

<213> Homo sapiens

<400> 66

aaagugcuuc ucuuuggugg gu 22

<210> 67

<211> 21

<212> RNA

<213> Homo sapiens

<400> 67

uggguuuacg uugggagaac u 21

<210> 68

<211> 21

<212> RNA

<213> Homo sapiens

<400> 68

aucacauugc cagggauuuc c 21

<210> 69

<211> 22

<212> RNA

<213> Homo sapiens

<400> 69

ucagugcauc acagaacuuu gu 22

<---

Claims (28)

1. A method for diagnosing mild traumatic brain injury (mTBI) in an individual, where the method includes determining the level of miR-502 miRNA in a fluid sample obtained from the individual within no more than 72 hours after injury, where the specified fluid sample contains serum. 2. A method for monitoring mild traumatic brain injury (mTBI) in an individual, wherein the method includes determining the level of miR-502 miRNA in a fluid sample obtained from the individual within no more than 72 hours after the injury, wherein said fluid sample contains serum. 3. The method of claim 1 or 2, wherein said method further comprises comparing the miR-502 level to a predetermined threshold or reference level, optionally wherein said reference level is a reference miRNA level in a control sample taken from a healthy individual, or a reference miRNA level in a sample taken from an individual. 4. The method according to any one of paragraphs. 1-3, further comprising determining the level of two, three, four or more miRNAs. 5. The method according to any one of paragraphs. 1-3 further comprising determining the level of at least one additional miRNA, wherein said at least one additional miRNA is selected from the group consisting of: (a) miR-425-5p; (b) miR-425-5p, miR-21 and miR-335, or any combination thereof; (c) miR-143, miR-425-5p, miR-21 and miR-335, or any combination thereof; (d) miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-let-7g, miR-126*, miR-193a-5p, miR-144* , miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, miR-671-3p, hsa-let-7c-5p, hsa-let-7i-5p miR -142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24 -3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, miR-424-5p, miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p; miR-10a, miR-132, miR-223, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-27b, miR- 301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629, or any combination thereof; (e) miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-let-7g, hsa-miR-126*, miR-193a-5p, miR- 144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625* and miR-671-3p, or any combination thereof; (f) miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b and miR-let-7g, or any combination thereof; (g) let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p , miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, and miR-424-5p; miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p or any combination thereof; (h) miR-10a, miR-132, miR-223, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-194 , miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629, or any combination thereof . 6. The method according to any one of paragraphs. 1-5, where an individual is diagnosed as having mTBI if the miR-502 level is determined to be below a predetermined threshold level or is reduced relative to a reference. 7. The method according to any one of paragraphs. 1-5, where the method includes determining the level: (i) miR-502; and (ii) a second miRNA selected from miR-21 and miR-335, optionally, where an individual is diagnosed with TBI of any severity if miR-502 is determined to be below a predetermined threshold level or is decreased relative to a reference, and miR-21 or miR-335 is determined to be above a predetermined threshold level or is elevated relative to standard. 8. The method according to any one of the preceding claims, wherein the fluid sample containing serum was obtained from an individual: (a) not more than 48 hours after the damage; or (b) no more than 24 hours after the damage. 9. A kit for use in a method for diagnosing and/or monitoring mild traumatic brain injury (mTBI) in a fluid sample from an individual, where the kit contains a probe specific for miR-502, where said fluid sample contains serum, and where the probe contains a nucleic acid where the nucleic acid contains a sequence that is at least 80% identical to a sequence that is complementary to the miR-502 sequence. 10. A composition for use in a method for diagnosing and/or monitoring moderate traumatic brain injury (mTBI) in an individual, where the composition contains a probe specific for miR-502, where said probe contains a nucleic acid, where said nucleic acid contains a sequence that is at least 80% sequence identical, which is complementary to miR-502 sequence. 11. The kit or composition according to claim 9 or 10, further comprising at least one probe specific for the target miRNA, where the miRNA is selected from the group consisting of: (a) miR-425-5p; (b) miR-425-5p, miR-21 and miR-335, or any combination thereof; (c) miR-143, miR-425-5p, miR-21 and miR-335, or any combination thereof; (d) miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-let-7g, miR-126*, miR-193a-5p, miR-144* , miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, miR-671-3p, hsa-let-7c-5p, hsa-let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR- 24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p, miR-424-5p, miR-10a, miR-132, miR-223miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629 or any combination of them.

Images