KR20180135424A - Novle polypeptides having turanose productivity and a method for producing turanose using the same - Google Patents

Abstract

The present application relates to a polypeptide having an activity of converting sucrose into turanose, a mutant polypeptide thereof, a polynucleotide encoding the polypeptide or the mutant polypeptide, a vector comprising the polynucleotide, and a recombinant microorganism comprising the polynucleotide or the vector, and a method for producing turanose using the same.

Description

TECHNICAL FIELD [0001] The present invention relates to a novel polypeptide having a production activity of turanose and a method for producing turanose using the same,

The present invention relates to a polypeptide having an activity of converting sucrose to turanose, a mutant polypeptide thereof, and a process for producing turanose using the polypeptide.

Turanose is an isomer of sucrose that contains α-D-glucopyranosyl- (1 → 3) -α-D-fructopyran including glucose units and fructose units linked via α (1 → 3) ([Alpha] - D-glucopyranosyl- (1 → 3) -α-D-fructopyranose].

Turanose has a sweetness of about half (about 0.5) of sucrose (about 1), can be easily crystallized, has solubility and low cariogenicity and is applicable to food as a sugar substitute. Turanos is also an inhibitor of alpha-glucosidase useful in the diagnosis of Pompe's disease and is of interest in the pharmaceutical and diagnostic arts. However, Turanose is present in honey in very small amounts of 0% to 3%, and an alternative method for industrially producing it is required.

Conventionally, there has been proposed a method of converting sucrose to turanose using an enzyme derived from Neisseria polysacchararea (Wang et al, 2012, Food Chemistry , 132, 773-779; Korean Patent No. 10-1177218 However, there is a problem that it is difficult to apply it to the industrial production of bar which is not a heat-resistant enzyme.

Under these circumstances, the inventors of the present invention have made extensive efforts to develop a polypeptide having an activity of converting thermostable to turanose. As a result, it has been confirmed that the polypeptide of the present application has an activity of converting sucrose to turanos In addition, the present application was completed by securing a mutant polypeptide having a further improved transition activity of turanose.

One object of the present invention is to provide a polypeptide having an activity of converting sucrose containing an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1 into turanose.

Another object of the present application

1. A variant polypeptide comprising at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1, wherein said amino acid mutation is selected from the group consisting of: (1) the 392nd glycine (G: Glycine) amino acid residue from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: The mutant polypeptide having an activity of converting sucrose to turanos, including those substituted with other amino acids.

Another object of the present application is to provide a polynucleotide encoding the polypeptide or the variant polypeptide.

Another object of the present application is to provide a vector comprising the polynucleotide of the present application.

Another object of the present application is to provide the polynucleotide or a recombinant microorganism comprising the vector.

Another object of the present application is to provide a composition for producing turanose comprising a polypeptide comprising an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism .

Another object of the present application is to provide a polypeptide comprising a sequence consisting of an amino acid sequence having 85% or more identity with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism, And converting the sucrose to turanose. ≪ Desc / Clms Page number 2 >

In the following, the present application will be described in more detail.

On the other hand, each description and embodiment disclosed in the present application can be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of the present application. In addition, the scope of the present application is not limited by the specific description to be described below.

In addition, those of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described in this application. Such equivalents are also intended to be included in the present application.

One aspect of the present application for achieving the object of the present application is to provide a polypeptide having an activity of converting sucrose containing an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1 into turanose .

The polypeptide of the present application may include, but is not limited to, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 80% homology or identity thereto. Specifically, the polypeptide comprises a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 1 and SEQ ID NO: . An amino acid sequence having homology or identity may be excluded from the sequence having 100% identity in the above categories, or may be a sequence having less than 100% identity. Further, in the case of a polypeptide having such homology or identity and having an amino acid sequence exhibiting an activity corresponding to the polypeptide (i.e., an activity of converting sucrose into turanose), it is preferable that the amino acid sequence having a deletion, Lt; / RTI > can also be used as the polypeptide of the present application.

Another aspect of the present application is a mutated polypeptide comprising at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1, wherein the mutated amino acid sequence is selected from the N-terminal of the polypeptide comprising the amino acid sequence of SEQ ID NO: (G: Glycine) amino acid residues are substituted with one or more other amino acids. The present invention also provides mutant polypeptides having an activity of converting sucrose into turanose.

Wherein the mutant polypeptide is a mutant polypeptide in which the 392nd glycine amino acid is substituted with threonine, glutamic acid or alanine (A) in the amino acid sequence of SEQ ID NO: 1, Lt; / RTI > polypeptide, but is not limited thereto. Such a mutant polypeptide is characterized in that the activity of converting sucrose to turanos is enhanced compared to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

The term " polypeptide having activity to convert sucrose to turanos " in the present application includes mutant polypeptides having an activity of converting sucrose into turanose, mutant polypeptides of turanose production variant, mutant polypeptides producing turanose , Mutant amylose sucrase, amylose sucrose mutant, and the like.

Specifically, the mutant polypeptide may be composed of the amino acid sequence of SEQ ID NO: 3, 5 or 7. In addition, the mutant polypeptide may include, but is not limited to, an amino acid sequence of SEQ ID NO: 3, 5 or 7 or an amino acid sequence having 80% or more homology or identity thereto. Specifically, the mutant polypeptide of the present application has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 3, Polypeptide. ≪ / RTI > In addition, it is obvious that a polypeptide having an amino acid sequence having such homology or identity and exhibiting an effect corresponding to the polypeptide is also included within the scope of the present application if a polypeptide having an amino acid sequence in which a partial sequence is deleted, modified, substituted or added .

As used herein, the term " mutant polypeptide " refers to a culture or individual that exhibits one stable phenotypic change, either genetically or non-genetically. Specifically, the term " variant polypeptide " Means a mutant polypeptide in which the amino acid is mutated so that its activity is weakened compared to the wild type and the carbon flow is efficiently balanced. For purposes of the present application, the mutant polypeptide includes a polypeptide having an activity to convert sucrose to turanose, a mutant polypeptide having activity to convert sucrose to turanos, mutant aminosugarase, And can be used in combination as mutants.

The term 'mutant' may be used in the form of a variant, a mutated protein, a mutant polypeptide, and the like. Examples of the variant include variant, modification, modified protein, modified polypeptide, mutant, mutein and divergent , And the terms used in the mutated sense are not limited thereto.

In addition, even if it is described as "a protein or polypeptide having an amino acid sequence represented by a specific sequence number" in the present application, if the polypeptide has the same or equivalent activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number, It is obvious that proteins having an amino acid sequence that is modified, substituted or added can also be used in the present application. For example, in the case of having the same or corresponding activity as the mutated polypeptide, in addition to the specific 392nd mutation that imparts a specific activity, addition of a nonsense sequence or a naturally occurring mutation before or after the amino acid sequence of the corresponding SEQ ID NO: It is not excluded from the silent mutation, and it is obvious that the sequence addition or mutation is also within the scope of the present invention.

The " homology " means the degree of association with two given amino acid sequences or base sequences and can be expressed as a percentage. In the present specification, its homologous sequence having the same or similar activity as a given amino acid sequence or base sequence is referred to as "% homology ".

The " identity " refers to the degree of correspondence between amino acid or nucleotide sequences, and in some cases is determined by the correspondence between strings of such sequences.

The terms " homology " and " identity " are often used interchangeably.

Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms and default gap penalties established by the program used can be used together. Substantially homologous or identical polynucleotides or polypeptides will generally have moderate stringency along all or at least about 50%, 60%, 70%, 80% or 90% of the total length of the target polynucleotide or polypeptide It will hybridize at high stringency. Polynucleotides containing degenerate codons instead of codons in hybridizing polynucleotides are also contemplated.

Any two polynucleotides or polypeptide sequences may be at least 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96% % Or 99% homology or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85: 2444, using a default computer algorithm such as the " FASTA " program. Or in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later) Can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453). (GCG program package (Devereux, J. et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994; and CARILLO ETA /. (1988) SIAM J Applied Math 48: 1073) For example, BLAST, or ClustalW, from the National Center for Biotechnology Information Database can be used to determine homology or identity.

Homology or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2: 482, for example, in Needleman et al. (1970), J Mol Biol. 48: 443, by comparing the sequence information using a GAP computer program. In summary, the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similar aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a linear comparison matrix (containing 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap open penalty 10, gap extend penalty 0.5); And (3) no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" refers to a comparison between polypeptides or polynucleotides.

Also, a mutant polypeptide consisting of an amino acid sequence in which the 392nd amino acid from the N-terminus is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1 by codon degeneracy, or a mutant polypeptide having homology or identity thereto Lt; RTI ID = 0.0 > polynucleotides < / RTI > Also, probes that can be prepared from known gene sequences, for example, hydrided under stringent conditions with complementary sequences to all or part of the above base sequence, so that the 392nd amino acid in the amino acid sequence of SEQ ID NO: 1 is threonine A polynucleotide sequence encoding a mutant polypeptide having an activity of a mutant polypeptide consisting of an amino acid sequence selected from the group consisting of T, Threonine, E (glutamic acid), or alanine (A: Alanine) .

The polypeptides of the present application or the variant polypeptides of the present application may have heat resistance.

The term " heat resistance " as used in the present application means that the thermal stability of the mutant polypeptide is increased. Specifically, the enzyme can be reacted at a high temperature by the heat resistance, and the solubility of the substrate can be increased in a high-temperature reaction process. As the solubility of the substrate increases, a high concentration of the substrate can be used, and the diffusion rate or the reaction rate of the substance can be increased, thereby shortening the reaction time and improving the productivity. In addition, process contamination due to external microorganisms can be minimized.

In addition, the present invention can be used as dismutated microorganisms by mass-expressing the polypeptide in GRAS (microcrystalline asbestos) microorganisms and using heat resistance characteristics. More specifically, the method of heat-treating at a high temperature can effectively remove recombinant microorganisms, and when the polypeptide is separated and used, the proteins derived from the recombinant microorganism can be selectively denatured and removed, thereby improving the purification process of the polypeptide There are advantages to be able to.

Specifically, the polypeptide or the variant polypeptide can maintain an activity of 75% or more of the activity before the heat treatment when the heat treatment is performed at 50 ° C to 70 ° C for 0.5 hours to 24 hours. More specifically, the polypeptide may maintain an activity of 100% or more of the activity before the heat treatment at 50 ° C to 70 ° C for 0.5 to 24 hours. In addition, the mutant polypeptide can maintain 85% or more of the activity of the mutant polypeptide at 50 ° C to 60 ° C for 0.5 to 24 hours before the heat treatment. In addition, the mutant polypeptide can maintain 85% or more of the activity before the heat treatment at a temperature of 50 to 70 캜 for 0.5 to 9 hours. More specifically, a mutant polypeptide in which the amino acid residue at position 392 of the glycine (G) amino acid residue is mutated to threonine (T) from the N-terminus of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, It is possible to maintain an activity of 98% or more of the activity before the heat treatment during the heat treatment for 24 hours at 95% or more of the activity before the heat treatment or at 50 to 70 ° C for 0.5 to 9 hours. In addition, the mutant polypeptide wherein the amino acid residue of the glycine (G) at position 392 is mutated to the glutamic acid (E) from the N-terminus of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 is subjected to heat treatment at 50 to 60 DEG C for 0.5 to 24 hours At least 85% of the activity before the heat treatment, at least 85% of the activity before the heat treatment at 50 ° C to 70 ° C for 0.5 hours to 9 hours, or at least 85% of the activity before the heat treatment at 50 ° C to 60 ° C for 0.5 hours to 24 hours 90% or more activity can be maintained. In addition, the mutant polypeptide in which the glycine (G) amino acid residue at position 392 is mutated to the alanine (A) from the N-terminus of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 is subjected to heat treatment at 50 to 60 DEG C for 0.5 to 24 hours At least 100% of the activity prior to the heat treatment, at least 90% of the activity before the heat treatment at 50 ° C to 70 ° C for 0.5 hours to 9 hours, or at least 90% of the activity before the heat treatment at 50 ° C to 70 ° C for 0.5 hours to 3 hours 100% or more activity can be maintained.

The polypeptides of the present application can be obtained from Meiothermus < RTI ID = 0.0 > rufus ). < / RTI >

Another aspect of the present application is to provide a polynucleotide encoding the polypeptide or variant polypeptide.

The term " polynucleotide " as used herein refers to a polymer of nucleotides in which a nucleotide monomer is linked in a long chain by a covalent bond and is a DNA or RNA strand of a certain length or more, Quot; means a polynucleotide fragment encoding a polypeptide.

The polynucleotide of the present application may contain a base sequence encoding the amino acid sequence of the polypeptide or variant polypeptide of the present application due to genetic code degeneracy of the genetic code.

The polynucleotide encoding the mutant polypeptide having the activity of converting the sucrose of the present application into turanose is a polynucleotide sequence encoding the mutant polypeptide having the activity of converting sucrose of the present application into turanos Without limitation. Specifically, the polynucleotides of the present application may be modified in various ways to the coding region, for example, within a range that does not change the amino acid sequence of the polypeptide, due to codon degeneracy or considering the codons preferred in the organism to which the polypeptide is to be expressed. Can be achieved. A polynucleotide sequence encoding a mutant polypeptide in which the 392nd amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid can be included without limitation. For example, the variant polypeptide of the present application may be, but is not limited to, a polynucleotide sequence encoding the mutated polypeptide. Also, a probe that can be prepared from a known gene sequence, for example, a hydride under stringent conditions with a complementary sequence to all or part of the above base sequence, so that the 392nd amino acid in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid Or a sequence coding for a protein having the activity of a substituted mutated polypeptide.

Specifically, the polynucleotide of the present application is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, or a polynucleotide comprising at least 80%, 85%, 90 But is not limited to, a polynucleotide consisting of a nucleotide sequence having at least 95%, at least 97%, at least 99% homology or identity.

Further, probes which can be prepared from known gene sequences, for example, as a polypeptide encoded by a polynucleotide hydrolizing under stringent conditions with a complementary sequence to all or a part of the base sequence encoding the polypeptide, Any polypeptide having an activity of converting the cross into turanos can be included without limitation. The term " stringent conditions " means conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (e.g., J. Sambrook et al., Sangdong). For example, it is possible to hybridize genes having homology or identity of 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, or 99% 1 X SSC, 0.1% SDS, specifically 60 ° C, 1 X SSC, 0.1% SDS, more specifically, a condition that does not hybridize genes having the same or similar identity to each other, or a normal hybrid hybridization washing condition Conditions for washing once, specifically twice to three times at a salt concentration and temperature corresponding to 0.1 占 SSC and 0.1% SDS at 68 占 폚 can be listed.

Hybridization requires that two polynucleotides have a complementary sequence, although mismatches between bases are possible, depending on the severity of hybridization. The term " complementary " is used to describe the relationship between nucleotide bases capable of hybridizing with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions that include a hybridization step at a Tm value of 55 ° C and using the conditions described above. In addition, the Tm value may be 60 ° C, 63 ° C, or 65 ° C, but is not limited thereto and may be suitably adjusted by those skilled in the art according to the purpose.

Suitable stringency to hybridize polynucleotides depends on the length and complementarity of the polynucleotide and the variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).

The polypeptide or the variant polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, 3, 5 or 7 of the present application may be the one encoded by the polynucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, respectively.

Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.

As used herein, the term " vector " means a DNA construct containing a nucleotide sequence of a polynucleotide encoding the desired protein operably linked to a suitable regulatory sequence so as to be capable of expressing the protein of interest in the appropriate host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation. The vector may be transcribed into an appropriate host cell and then cloned or functioned independently of the host genome and integrated into the genome itself.

The vector used in the present application is not particularly limited as long as it is replicable in the host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A and Charon21A can be used as the phage vector or cosmid vector, and pBR, pUC, pBluescriptII , pGEM-based, pTZ-based, pCL-based, pET-based, and the like. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118 and pCC1BAC vectors can be used. The vector usable in the present application is not particularly limited, and known expression vectors can be used.

For example, a polynucleotide encoding a mutated polypeptide in a chromosome can be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto. And may further include a selection marker for confirming whether or not the chromosome is inserted. The selection marker is used to select a cell transformed with a vector, that is, to confirm whether a target nucleic acid molecule is inserted. The selection marker is a selectable phenotype such as resistance to drug resistance, nutritional requirement, tolerance to a cytotoxic agent or expression of a surface mutant polypeptide May be used. In the environment treated with the selective agent, only the cells expressing the selectable marker survive or express different phenotypes, so that the transformed cells can be selected. In another aspect of the present application, the present application is to provide a microorganism which comprises the mutant polypeptide or comprises a polynucleotide encoding the mutant polypeptide to produce a purine nucleotide. Specifically, a microorganism comprising a mutant polypeptide and / or a polynucleotide encoding the mutant polypeptide may be, but is not limited to, a microorganism produced by transformation into a vector comprising a polynucleotide encoding a mutant polypeptide .

Also, the term " operably linked " as used herein above means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the protein of interest of the present application. Operable linkages can be made using known recombinant techniques in the art, and site-specific DNA cleavage and linkage can be made using, but not limited to, cutting and linking enzymes in the art.

Another aspect of the present application is to provide a recombinant microorganism comprising the polynucleotide of the present application or the vector of the present application.

In the recombinant microorganism of the present application, the recombination may be carried out by transformation. The term " transformed " as used herein means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides may include all of these, whether inserted into the chromosome of the host cell or located outside the chromosome, provided that the polynucleotide can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced in any form as far as it is capable of being introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression. The expression cassette can typically include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. Also, the polynucleotide may be introduced into the host cell in its own form and operatively linked to the sequence necessary for expression in the host cell, but is not limited thereto. Such a transformation method includes any method of introducing a polynucleotide into a cell, and can be carried out by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (Ca (H ₂ PO ₄ ) ₂ , CaHPO ₄ , or Ca ₃ (PO ₄ ) ₂ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, Polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method, but the present invention is not limited thereto.

The host cell or microorganism of the present application can be any microorganism capable of producing turanose from sucrose including the polynucleotide of the present application or the vector of the present application. Specifically, for example, Escherichia (Escherichia) genus, Serratia marcescens (Serratia), An air Winiah (Erwinia) genus, Enterobacter bacteria (Enterobacteria) genus, Providencia (Providencia) genus, Salmonella (Salmonella) genus Streptomyces ( Streptomyces sp., Pseudomonas sp ., Brevibacterium sp. Or Corynebacterium sp., And specific examples include Escherichia sp. Or Corynebacterium sp. (Corynebacterium) may be in microorganisms, more specific examples of Escherichia coli (Escherichia coli ) or Corynebacterium ( Corynebacterium < RTI ID = 0.0 > glutamicum ). The recombinant microorganism of the present application may be a polypeptide having an activity of converting sucrose of the present application into turanose or a microorganism capable of expressing a mutant polypeptide by various known methods in addition to the polynucleotide of the present application or the vector introduction of the present application You can include both. In one embodiment, a recombinant microorganism of the present application CJ_Mrf_AS (KCCM11939P), E. coli BL21 (DE3) / MRF + G392T (KCCM12113P), E. coli BL21 (DE3) / MRF + G392E (KCCM12112P) and E. coli BL21 (DE3) / MRF + G392A (KCCM12111P)

In another aspect of the present application, the present application relates to a polypeptide comprising an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture containing the culture of the microorganism And to provide a composition for producing Ranos. Specifically, the composition for producing turanose may include a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

In another aspect of the present application, the present application relates to a mutant polypeptide comprising at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the mutant polypeptide, or a microorganism expressing the mutant polypeptide Wherein the amino acid mutation comprises a substitution of at least one other amino acid for a glycine (G) amino acid residue at position 392 from the N-terminus of a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. . The composition is not limited as long as it is involved in the production of turanos.

In addition, the composition may further include, but is not limited to, sucrose. The composition of the present application may further comprise any suitable excipient conventionally used in the composition for producing turanose. Such excipients can be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizing agents or isotonic agents.

In another aspect of the present application, the present application discloses a polypeptide comprising an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or sucrose to a culture of the microorganism And converting the sucrose to a turanose. The present invention also provides a method for producing turanose. Specifically, the method for producing turanose may include a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

In another aspect of the present application, the present application relates to a mutant polypeptide comprising at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the mutant polypeptide, or a microorganism expressing the mutant polypeptide Wherein the amino acid mutation comprises a substitution of at least one other amino acid for a glycine (G) amino acid residue at position 392 from the N-terminus of a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. . The composition is not limited thereto as long as it is involved in the production of turanose.

In addition, the contact may be carried out at a pH of 5.0 to 9.0, at a temperature of 40 to 80 캜, and / or for 0.5 to 24 hours, but is not limited thereto. Specifically, the contact of the present application can be carried out at pH 6.0 to pH 9.0, pH 7.0 to pH 9.0, pH 5.0 to pH 8.0, pH 6.0 to pH 8.0, pH 7.0 to pH 8.0. The contact of the present application may also be carried out at a temperature of 45 to 80 占 폚, 50 to 80 占 폚, 55 to 80 占 폚, 60 to 80 占 폚, 40 占 폚 to 75 占 폚, 45 占 폚 to 75 占 폚, 60 ° C to 75 ° C, 40 ° C to 70 ° C, 45 ° C to 70 ° C, 50 ° C to 70 ° C, 55 ° C to 70 ° C, 65 占 폚, 50 占 폚 to 65 占 폚, 55 占 폚 to 65 占 폚, 40 占 폚 to 60 占 폚, 45 占 폚 to 60 占 폚, or 50 占 폚 to 60 占 폚. In addition, the contact of the present application is carried out for 0.5 to 24 hours, 0.5 to 12 hours, 0.5 to 6 hours, 1 to 24 hours, 1 to 12 hours, 1 to 6 hours, 3 For 3 hours to 12 hours, for 3 hours to 6 hours, for 6 hours to 48 hours, for 6 hours to 36 hours, for 6 hours to 24 hours.

In the composition or the method described above, the culture of the microorganism may be prepared from the step of culturing the microorganism expressing the polypeptide or the variant polypeptide of the present application in a medium.

The term " cultivation " in this application means cultivation of the microorganism under moderately controlled environmental conditions. The cultivation of the present application can be carried out according to a suitable culture medium and culture conditions known in the art. Such cultivation can be easily adjusted by those skilled in the art depending on the strain to be selected. Specifically, the culture of the present application can be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, and the like, but is not limited thereto. At this time, the culturing conditions are not particularly limited, but may be carried out at an appropriate pH (for example, pH 5 to pH 9, specific) using a basic compound (such as sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound PH 6 to pH 8, most specifically pH 6.8). In addition, during the culture, defoaming agents such as fatty acid polyglycol esters can be used to inhibit the formation of bubbles. In order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas is injected into the culture, In order to maintain, it is possible to inject nitrogen, hydrogen or carbon dioxide gas without injecting gas. The incubation temperature may be maintained at 20 ° C to 45 ° C, specifically at 25 ° C to 40 ° C, for about 0.5 to 160 hours, but is not limited thereto. The polypeptides or variant polypeptides of the present invention produced by the above cultivation can be secreted into the medium or remain in the cells.

In addition, the culture medium used may be a carbon source such as sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as soybean oil, sunflower seeds Alcohols such as glycerol and ethanol, and organic acids such as acetic acid may be used individually or in combination with each other, , But is not limited thereto. Examples of nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, juice, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, Ammonium nitrate), and the like may be used individually or in combination, but the present invention is not limited thereto. As the phosphorus source, potassium dihydrogenphosphate, dipotassium hydrogenphosphate, and the corresponding sodium-containing salt may be used individually or in combination, but the present invention is not limited thereto. In addition, the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate or ferrous sulfate), amino acids and vitamins.

The manufacturing method of the present application may further include the step of separating and / or purifying the produced turanos. The separation and / or purification may be carried out by a method commonly used in the technical field of the present application. Non-limiting examples include dialysis, precipitation, adsorption, electrophoresis, ion exchange chromatography and fractional crystallization. The purification may be carried out by only one method, or two or more methods may be carried out together.

Further, the production method of the present application may further include a step of performing decolorization and / or desalting before or after the separation and / or purification step. By carrying out the decolorizing and / or desalting, it is possible to obtain turanos of higher quality.

In another embodiment, the method of manufacture of the present application may further comprise the step of converting to the turbanos of the present application, the step of separation and / or purification, or the step of crystallizing the turban after the step of decolorizing and / or desalting have. The crystallization may be carried out using a crystallization method that is commonly used. For example, crystallization can be performed using a cooling crystallization method.

In another embodiment, the method of manufacture of the present application may further comprise concentrating the turanos prior to said crystallizing step. The concentration can increase the crystallization efficiency.

In another embodiment, the method of manufacture of the present application is characterized in that the unreacted sucrose after the isolating and / or purifying step of the present application is replaced with a polypeptide or variant polypeptide of the present application, a microorganism expressing the polypeptide or the variant polypeptide, , The step of crystallizing the crystals of the present application, and the step of re-using the separated mother liquor for the separation and / or purification step, or a combination thereof. Through this additional step, it is possible to obtain the turanos in higher yield and to reduce the amount of sucrose discarded, which is economical advantage.

The present application has the advantage of enabling industrial production of turanos by newly proposing a heat-resistant polypeptide having an activity of converting sucrose to turanose and a mutant polypeptide thereof.

FIGS. 1A to 1D are the results of confirming the activity of producing MRSA, MRF + G392T, MRF + G392E and MRF + G392A, respectively.
Fig. 2 shows the results of activity evaluation of MRF, MRF + G392T, MRF + G392E and MRF + G392A.
Figures 3A and 3B are the results of the activity evaluation according to the pH of MRF and MRF + G392A, respectively.

The present application will be described in more detail by the following examples. However, these embodiments are for illustrative purposes only, and the scope of the present application is not limited by these embodiments, and will be apparent to those skilled in the art to which the present application belongs.

Example  One: Sucrose Turanos  Preparation of recombinant vectors and recombinant microorganisms for the production of polypeptide having activity of converting and mutant polypeptides thereof

1-1. Sucrose Turanos  Preparation of vectors for the production of polypeptides with activity to convert

In order to discover a polypeptide having heat resistance and activity to convert sucrose into turanose, gene information of a thermophilic microorganism, Meiothermus rufus , was obtained to prepare an E. coli expressible vector and a recombinant microorganism.

Specifically, a gene which is expected to have an activity of converting sucrose to turanos in the gene sequence of the Mayo Thermus lupus gene registered in the National Center for Biotechnology Information (NCBI) was selected. A polynucleotide (SEQ ID NO: 2) coding for the polypeptide expressed by the gene (hereinafter referred to as MRF; SEQ ID NO: 1) was amplified by PCR (94 ° C for 5 minutes) using synthetic primers (SEQ ID NOS: 9 and 10, Denatured, denatured at 94 DEG C for 30 seconds, annealed at 60 DEG C for 30 seconds, and then stretched at 72 DEG C for 90 seconds, which was repeated 30 times and at 72 DEG C for 10 minutes under elongation reaction condition). The amplified polynucleotide was inserted into pET21a_SalI6His (a vector obtained by modifying the restriction enzyme XhoI recognition site CTCGAG of pET21a with a SalI recognition site GTCGAC) using restriction enzymes NdeI and SalI to prepare a recombinant vector pET21a-Mrf.

SEQ ID NO: primer The sequence (5'-3 ') 9 Forward GGGCATATGATGGATGTTGCTGCCTTCCTGAA 10 Reverse CCGTCAGCTAGCTTGCCCTCGAGGGGAG

1-2. Production of recombinant vectors for mutant polypeptide production

A recombinant vector for expression of a mutant polypeptide of a polypeptide having an activity of converting sucrose into turanose comprises a glycine amino acid residue at position 392 from the N-terminus of SEQ ID NO: 1 as threonine, glutamic acid polynucleotide encoding MRF + G392T (SEQ ID NO: 3), MRF + G392E (SEQ ID NO: 5) and MRF + G392A (SEQ ID NO: 7) sequentially SEQ ID NOS: 2, 4 and 8) were prepared and inserted into the pET21a_SalI6His vector using restriction enzymes NdeI and SalI to prepare pET21a-Mrf + G392T, pET21a-Mrf + G392E and pET21a-Mrf + G392A. The polynucleotide encoding the mutant polypeptide used a PCR-based saturated mutation method inversed with pET21a-Mrf as a template (2014. Anal. Biochem . 449: 90-98). The PCR was performed at 94 ° C for 2 minutes, denaturation at 94 ° C for 30 seconds, annealing at 60 ° C for 30 seconds, and extension at 72 ° C for 10 minutes. Primers were prepared by using a primer of 33 bp consisting of the forward base 15 bp of the substitution site, the base 3 bp (RMG) of the substitution site and the back base 15 bp of the substitution site. The primer sequences are as shown in Table 2 below.

SEQ ID NO: primer The sequence (5'-3 ') 11 Forward TGCCACGACGACATCRMGTGGGCCATCTCCGAC 12 Reverse GTCGGAGATGGCCCACKYGATGTCGTCGTGGCA

1-3. Production of recombinant microorganisms

Each of the recombinant vectors prepared in Examples 1-1 and 1-2 was transformed into Escherichia coli BL21 (DE3) (invitrogen) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001) And then stored frozen in 50% glycerol. The recombinant microorganisms were designated as CJ_Mrf_AS, E. coli BL21 (DE3) / MRF + G392T, E. coli BL21 (DE3) / MRF + G392E and E. coli BL21 (DE3) / MRF + G392A, (KCCM 11939P, deposited November 22, 2016), KCCM 12113P (deposited on September 13, 2017), KCCM12112P (deposited on Sep. 13, 2017), deposited at the Korean Culture Center of Microorganisms And KCCM12111P (deposited on September 13, 2017).

Example  2: Preparation of Recombinant Polypeptides and Mutant Polypeptides

The recombinant microorganisms CJ_Mrf_AS, E. coli BL21 (DE3) / MRF + G392T, E. coli BL21 (DE3) / MRF + G392E and E. coli BL21 (DE3) / MRF + G392A prepared in Example 1 were dissolved in 5 ml LB Liquid culture medium, and seed culture was performed until the absorbance at 600 nm became 2.0. The cultured medium after the seed culture was inoculated into the LB liquid medium and the cultivation was continued. When the absorbance at 600 nm was 2.0, 0.5 mM IPTG was added to induce the expression of the recombinant polypeptide and the mutant polypeptide. The agitation speed of the seed culture and the main culture was 200 rpm, and the incubation temperature was maintained at 37 캜. After the cultivation, the culture was centrifuged at 8,000 × g for 20 minutes at 4 ° C. to recover the cells. The recovered cells were washed twice with 50 mM phosphate buffer solution (pH 7.5), suspended in the same buffer solution And then disrupted using an ultrasonic cell crusher. The cell lysate was centrifuged at 13,000 x g for 20 minutes at 4 DEG C, and only the supernatant was taken, and MRF + G392T, a purified polypeptide, and purified mutant polypeptides, MRF + G392T, MRF + G392E and MRF + G392A. The purified polypeptides were dialyzed into 50 mM phosphate buffer (pH 7.5) and used for activity analysis.

Example  3: Recombinant polypeptide and variant polypeptide Turanos  Conversion activity assay

To confirm the conversion activity of each of the polypeptides prepared in Example 2, 50 mM potassium phosphate (pH 7.5) containing 1 M sucrose was added with 0.1 unit / ml of each purified polypeptide After reacting at 60 ° C for 5 hours, the reaction was stopped on ice, and the produced turanose was analyzed by HPLC. HPLC analysis was carried out using a SUGAR SP0810 (Shodex) column at 80 ° C with flowing water at a flow rate of 0.6 ml / min to the mobile phase, and Turanos was detected with a Refractive Index Detector.

As a result, it was confirmed that MRF, MRF + G392T, MRF + G392E and MRF + G392A all had activity to convert sucrose to turanose. Specifically, MRF + G392E and MRF + G392A produced turanose at a concentration of 60 g / l, 100.7 g / l for MRF + G392T, 100.3 g / l for MRF + G392E and 123.6 g / All of them showed better performance than the wild type MRF. In particular, it was confirmed that MRF + G392A had a conversion activity of 200% or more of the wild type under the same reaction conditions (Table 3 and Figs.

Strain name Turanos (g / L) Conversion Rate (%) Conversion activity (%) MRF 60 17.5 100 MRF + G392T 100.7 29.4 168 MRF + G392E 100.3 29.3 167 MRF + G392A 123.6 36.1 206

Example  4: Depending on the reaction conditions Turanos  Conversion activity assay

4-1. Analysis of activity by temperature

Each purified polypeptide was added to 50 mM potassium phosphate (pH 7.5) buffer containing 10% (w / v) sucrose at 40 ° C, 45 ° C and 50 55 ° C, 60 ° C, 65 ° C, 70 ° C and 75 ° C for 1 hour, and then analyzed by means of HPLC by means of HPLC.

As a result, MRF showed maximum activity at 65 ° C at 55 ° C, MRF + G392T, MRF + G392E and MRF + G392A. Further, MRF + G392A shows activity of 80% or more of the maximum activity at 40 占 폚 to 75 占 폚, 40 占 폚 to 75 占 폚, 60 占 폚 to 75 占 폚 for MRF + G392T, 45 占 폚 to 75 占 폚 for MRF + (Table 4 and Fig. 2).

Relative activity with temperature division MRF MRF + G392T MRF + G392E MRF + G392A 40 ℃ 88.0 81.6 71.5 61.1 45 ° C 91.5 88.2 81.9 71.8 50 ℃ 92.4 92.0 83.8 73.9 55 ° C 100.0 96.7 84.0 77.2 60 ° C 99.8 98.4 91.0 87.5 65 ℃ 98.4 100.0 100.0 100.0 70 ℃ 86.3 90.8 98.0 96.9 75 ℃ 82.7 72.6 93.5 96.2

4-2. Activity analysis by pH

(pH: 5-6) buffer solution containing 10% (w / v) sucrose and 50 mM potassium phosphate buffer solution (KPB: The purified MRF and MRf + G392A (0.1 unit / ml) were each added to the buffer solution (pH 6-8) and reacted at 55 ° C for 1 hour. Respectively.

As a result, it showed high activity at pH 7 to pH 8, especially at pH 7.5. In addition, it was confirmed that the activity was maximized in the potassium-phosphate buffer solution in the buffer solution corresponding to each pH (FIGS. 3A and 3B).

Example  5: Thermal stability  analysis

Each of the purified polypeptides was heat-treated at 50 ° C, 60 ° C, and 70 ° C for 24 hours to confirm thermal stability, and then the conversion activity of the Turanos was measured. The activity was determined by adding 0.1 unit / ml each of the heat-treated polypeptides to 50 mM potassium phosphate (pH 7.5) buffer containing 10% (w / v) sucrose and reacting at 55 ° C for 1 hour The same procedure as in Example 3 was carried out to determine the amount of Turanose by HPLC.

As a result, it was confirmed that MRF, MRF + G392T, MRF + G392A and MRF + G392E all had thermal stability. In particular, MRF remained active even after 24 hours in all heat treatment conditions (Table 5 and FIG. 4A). The activity of MRF + G392T was maintained at over 95% after 24 hours in all heat treatments. The activity of MRF + G392A remained at 24 hours after heat treatment at 50 ℃ and 60 ℃. It was confirmed that the activity was maintained at 80% or more (Table 5 and Figures 4b and 4c). It was confirmed that MRF + G392E maintained more than 79% activity over 24 hours after 50 hours and 60 hours after heat treatment at 70 ° C (Table 5 and FIG. 4d).

Relative activity (%) MRF MRF + G392T MRF + G392E MRF + G392A 50 ° C 60 ° C 70 ° C 50 ° C 60 ° C 70 ° C 50 ° C 60 ° C 70 ° C 50 ° C 60 ° C 70 ° C 0 h 100 100 100 100 100 100 100 100 100 100 100 100 3 h 112 110 109 98 109 100 108 92 89 102 109 109 6 h 104 106 100 101 111 100 94 93 93 103 105 93 9 h 103 108 101 99 109 102 95 92 89 104 103 95 24 h 111 109 101 107 113 95 102 89 79 103 101 84

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present application is to be interpreted as being within the scope of the present application, all changes or modifications derived from the meaning and scope of the appended claims and from their equivalents rather than the detailed description.

Name of depository: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM11939P

Checked on: 20161122

Name of depository: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12111P

Checked on: 20170913

Name of depository: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12112P

Checked on: 20170913

Name of depository: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12113P

Checked on: 20170913

<110> CJ CheilJedang Corporation <120> Novle polypeptides having turanose productivity and a method for          producing turanose using the same <130> KPA170941-KR-P1 <150> KR 10-2017-0073233 <151> 2017-06-12 <150> KR 10-2018-0004546 <151> 2018-01-12 <160> 12 <170> KoPatentin 3.0 <210> 1 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF <400> 1 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln   1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr              20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu          35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln      50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val Ala Pro  65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp                  85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu             100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro         115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg     130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn                 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp             180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro         195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro     210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe                 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu             260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr         275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg     290 295 300 Ala Ala Val Ala Ala Ala Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His                 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln             340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala         355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr     370 375 380 Leu Arg Cys His Asp Asp Ile Gly Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu                 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe             420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala         435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu     450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly                 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp             500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys         515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys     530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys                 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu             580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val         595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg     610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 2 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF <400> 2 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcggctggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 3 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF-G392T <400> 3 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln   1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr              20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu          35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln      50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val Ala Pro  65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp                  85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu             100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro         115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg     130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn                 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp             180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro         195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro     210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe                 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu             260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr         275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg     290 295 300 Ala Ala Val Ala Ala Ala Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His                 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln             340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala         355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr     370 375 380 Leu Arg Cys His Asp Asp Ile Thr Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu                 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe             420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala         435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu     450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly                 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp             500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys         515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys     530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys                 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu             580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val         595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg     610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 4 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF-G392T <400> 4 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcacgtggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 5 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF-G392E <400> 5 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln   1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr              20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu          35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln      50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val Ala Pro  65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp                  85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu             100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro         115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg     130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn                 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp             180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro         195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro     210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe                 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu             260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr         275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg     290 295 300 Ala Ala Val Ala Ala Ala Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His                 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln             340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala         355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr     370 375 380 Leu Arg Cys His Asp Asp Ile Glu Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu                 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe             420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala         435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu     450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly                 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp             500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys         515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys     530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys                 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu             580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val         595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg     610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 6 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF-G392E <400> 6 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcgagtggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 7 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF-G392A <400> 7 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln   1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr              20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu          35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln      50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val Ala Pro  65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp                  85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu             100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro         115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg     130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn                 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp             180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro         195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro     210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe                 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu             260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr         275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg     290 295 300 Ala Ala Val Ala Ala Ala Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His                 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln             340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala         355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr     370 375 380 Leu Arg Cys His Asp Asp Ile Ala Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu                 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe             420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala         435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu     450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly                 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp             500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys         515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys     530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys                 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu             580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val         595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg     610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 8 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF-G392A <400> 8 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcgcgtggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Mrf <400> 9 gggcatatga tggatgttgc tgccttcctg aa 32 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Mrf <400> 10 ccgtcagcta gcttgccctc gaggggag 28 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Mrf mutant <400> 11 tgccacgacg acatcrmgtg ggccatctcc gac 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Mrf mutant <400> 12 gtcggagatg gcccackyga tgtcgtcgtg gca 33

Claims (16)

1. A polypeptide having an activity of converting sucrose comprising an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1 into turanose.
1. A variant polypeptide comprising at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1,
Wherein the amino acid mutation is an activity of converting sucrose to turanos, wherein the 392st Glycine amino acid residue from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 is replaced by one or more other amino acids &Lt; / RTI &gt;
3. The mutant polypeptide according to claim 2, wherein the other amino acid is threonine, glutamic acid, or alanine.
The mutant polypeptide according to claim 2, wherein the mutant polypeptide comprises the amino acid sequence of SEQ ID NO: 3, 5 or 7.
A polynucleotide encoding the polypeptide of claim 1 or a variant polypeptide of any of claims 2 to 4.
A vector comprising the polynucleotide of claim 5.
A recombinant microorganism comprising the polynucleotide of claim 5.
A recombinant microorganism comprising the vector of claim 6.
A polypeptide comprising an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism.
10. The method of claim 9,
Wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.
A mutant polypeptide comprising at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the mutant polypeptide, or a culture of the microorganism, wherein the amino acid mutation is at least one of SEQ ID NO: Wherein the glycine (G) amino acid residue at position 392 is substituted with one or more other amino acids from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO:
The composition for producing turanose according to claim 9 or 11, wherein the composition further comprises sucrose.
A polypeptide comprising an amino acid sequence having 85% or more homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism, in contact with sucrose to convert the sucrose to turanose &Lt; / RTI &gt;
14. The method of claim 13,
Wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.
The step of transforming the sucrose into a turanose by contacting a microorganism expressing the mutant polypeptide, or a culture of the microorganism with sucrose, wherein the mutant polypeptide comprises at least one amino acid mutation in the amino acid sequence of SEQ ID NO: 1, A method for producing a Turanose comprising:
Wherein the mutation of the amino acid is that the glycine (G) amino acid residue at position 392 from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 is replaced with one or more other amino acids.
16. The method according to claim 13 or 15, wherein the contacting is carried out at a pH of from 5.0 to 9.0, at a temperature of from 40 to 80 캜, or from 0.5 to 24 hours.

Images