KR102232839B1 - Novle polypeptides having turanose productivity and a method for producing turanose using the same - Google Patents

Abstract

The present application includes a polypeptide having an activity of converting sucrose to turranose, a variant polypeptide thereof, a polynucleotide encoding the polypeptide or the variant polypeptide, a vector comprising the polynucleotide, the polynucleotide or the vector It relates to a recombinant microorganism and a method for producing turranose using the same.

Description

Novle polypeptides having turanose productivity and a method for producing turanose using the same}

The present application relates to a polypeptide having an activity of converting sucrose to turranose, a variant polypeptide thereof, and a method for preparing turranose using the same.

Turanose is an isomer of sucrose. α-D-glucopyranosyl-(1→3)-αD-fructopyra, including glucose units and fructose units linked through α(1→3) bonds. North [α-D-glucopyranosyl-(1→3)-α-D-fructopyranose].

Turanose has a sweetness of about half (about 0.5) of sucrose (about 1), can be easily crystallized, and has high solubility and low cariogenicity, so it can be applied to food as a sugar substitute. In addition, Turanose is an inhibitor of α-glucosidase useful in the diagnosis of Pompe's disease, which is of interest in the pharmaceutical and diagnostic fields. However, since Turanose is present in honey in a very small amount of 0% to 3%, an alternative method for industrially producing it is required.

Conventionally, a method of converting sucrose to turranose using an enzyme derived from Neisseria polysaccharea has been proposed (Wang et al, 2012, Food Chemistry , 132, 773-779; Korean Patent Registration No. 10-1177218 No.), because it is not a heat-resistant enzyme, there is a problem that it is difficult to apply to industrial production.

Under this background, the present inventors have made intensive research efforts to develop a polypeptide having an activity to convert to turranose having heat resistance, and as a result, it was confirmed that the polypeptide of the present application has an activity of converting sucrose to turranose while having heat resistance. In addition, the present application was completed by securing a variant polypeptide having further improved turranose conversion activity.

One object of the present application is to provide a polypeptide having an activity of converting sucrose to turranose, comprising an amino acid sequence having 85% or more homology to the amino acid sequence of SEQ ID NO: 1.

The other purpose of this application is

A variant polypeptide comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid mutation has one glycine (G: Glycine) amino acid residue at position 392 from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 It is to provide a variant polypeptide having the activity of converting sucrose to turranose, including those substituted with the above other amino acids.

Another object of the present application is to provide a polynucleotide encoding the polypeptide or variant polypeptide.

Another object of the present application is to provide a vector comprising the polynucleotide of the present application.

Another object of the present application is to provide a recombinant microorganism comprising the polynucleotide or the vector.

Another object of the present application is a polypeptide comprising an amino acid sequence having 85% or more homology to the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a composition for producing turranose comprising a culture of the microorganism To provide.

Another object of the present application is a polypeptide consisting of a sequence consisting of an amino acid sequence having 85% or more identity to the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism by contacting sucrose, the It is to provide a method for producing turranose, comprising the step of converting sucrose to turranose.

Hereinafter, the present application will be described in more detail.

Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be said that the scope of the present application is limited by the specific description described below.

In addition, a person of ordinary skill in the art may recognize or ascertain using only routine experimentation a number of equivalents to certain aspects of the present application described in this application. In addition, such equivalents are intended to be included in this application.

One aspect of the present application for achieving the object of the present application is to provide a polypeptide having the activity of converting sucrose to turranose comprising an amino acid sequence having 85% or more homology to the amino acid sequence of SEQ ID NO: 1 It is to do.

The polypeptide of the present application may include the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80% or more homology or identity thereto, but is not limited thereto. Specifically, the polypeptide comprises a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 1 and SEQ ID NO: 1. I can. The amino acid sequence having homology or identity may exclude a sequence having 100% identity from the above categories, or may be a sequence having less than 100% identity. In addition, if it is a polypeptide having an amino acid sequence that has such homology or identity and exhibits an efficacy corresponding to the polypeptide (i.e., an activity of converting sucrose to turranose), an amino acid sequence in which some sequences are deleted, modified, substituted or added It is obvious that a polypeptide having a can also be used as the polypeptide of the present application.

Another aspect of the present application is a variant polypeptide comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid mutation is glycine at position 392 from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (G: Glycine) It is to provide a variant polypeptide having an activity of converting sucrose to turranose, including those in which an amino acid residue is substituted with one or more other amino acids.

In the variant polypeptide, the 392th glycine amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with threonine (T: Threonine), glutamic acid (E: Glutamic acid), or alanine (A: Alanine). It may be a variant polypeptide having an activity to convert to, but is not limited thereto. Such a variant polypeptide has an enhanced activity of converting sucrose to turranose compared to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

In the present application, the term "polypeptide having the activity of converting sucrose to turranose" refers to a mutant polypeptide having an activity of converting sucrose to turranose, a mutant polypeptide producing turranose, and a mutant polypeptide producing turranose. , Mutant amilosucrase, amilosucrase mutant, etc. may be used in combination.

Specifically, the variant polypeptide may be composed of the amino acid sequence of SEQ ID NO: 3, 5, or 7. In addition, the variant polypeptide may include the amino acid sequence of SEQ ID NO: 3, 5, or 7 or an amino acid sequence having 80% or more homology or identity thereto, but is not limited thereto. Specifically, the variant polypeptide of the present application has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 3, 5 or 7 It may include a polypeptide. In addition, if it is a polypeptide having such homology or identity and an amino acid sequence exhibiting efficacy corresponding to the polypeptide, it is obvious that proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added are also included within the scope of the present application. .

In the present application, the term "variant polypeptide" refers to a culture or individual that exhibits a stable phenotypic change genetically or non-genetically, and specifically, in the present application, one or more amino acid sequences derived from Meiothermus rufus It refers to a mutant polypeptide in which the amino acid is mutated and its activity is weakened compared to that of the wild type, so that the carbon flow is efficiently balanced. For the purposes of the present application, the variant polypeptide is a polypeptide having an activity of converting sucrose to turranose, a mutant polypeptide having an activity of converting sucrose to turanose, mutant amyrosuclase, amylosucra It can be used interchangeably as a first variant.

In addition, the'variant' may be used interchangeably with terms such as variant, mutated protein, and variant polypeptide, and in English, it may be used as variant, modification, modified protein, modified polypeptide, mutant, mutein, divergent, etc. , If it is a term used in a mutated meaning, it is not limited thereto.

In addition, even if it is described in the present application as'a protein or polypeptide having an amino acid sequence described in a specific sequence number', if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the sequence number, some sequences are deleted, It is obvious that proteins having modified, substituted or added amino acid sequences can also be used in the present application. For example, in the case of having the same or corresponding activity as the variant polypeptide, in addition to the specific 392th mutation conferring a specific activity, an insignificant sequence addition before and after the amino acid sequence of the corresponding sequence number or a mutation that may occur naturally, or a mutation thereof It does not exclude silent mutations, and it is obvious that such sequence additions or mutations are within the scope of the present application.

The "homology" refers to the degree of association with two given amino acid sequences or base sequences, and may be expressed as a percentage. In the present specification, a homologous sequence thereof having the same or similar activity as a given amino acid sequence or base sequence is indicated as "% homology".

In addition, the "identity" refers to the degree of correspondence between amino acid or nucleotide sequences, and in some cases is determined by the correspondence between strings of such sequences.

The terms “homology” and “identity” can often be used interchangeably.

The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together. Substantially, homologous or homologous polynucleotides or polypeptides are generally all or at least about 50%, 60%, 70%, 80% or 90% of the full-length of the target polynucleotide or polypeptide with a moderate stringency or Will hybridize at high stringency. Polynucleotides containing degenerate codons instead of codons in hybridizing polynucleotides are also contemplated.

Any two polynucleotide or polypeptide sequences are at least, e.g., 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 Whether it has% or 99% homology or identity is determined, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Alternatively, run in the needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later). As such, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, the BLAST of the National Center for Biotechnology Information, or ClustalW can be used to determine homology or identity.

The homology or identity of a polynucleotide or polypeptide is described, for example, in Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: It can be determined by comparing sequence information using a GAP computer program such as 443. In summary, the GAP program is defined as the total number of symbols in the shorter of the two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a monolithic comparison matrix (contains a value of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps. Thus, as used herein, the term “homology” or “identity” refers to a comparison between polypeptides or polynucleotides.

In addition, a variant polypeptide consisting of an amino acid sequence in which the 392th amino acid from the N-terminus is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1 due to codon degeneracy, or a variant polypeptide having homology or identity thereto It is obvious that polynucleotides that can be translated into can also be included. In addition, a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence and hydride under stringent conditions, the 392th amino acid in the amino acid sequence of SEQ ID NO: 1 is threonine. (T: Threonine), glutamic acid (E: Glutamic acid) or alanine (A: Alanine) is a polynucleotide sequence encoding a variant polypeptide having the activity of a variant polypeptide consisting of an amino acid sequence selected from the group substituted Can be included.

The polypeptide of the present application or the variant polypeptide of the present application may have heat resistance.

The term "heat resistance" as used in the present application means that the thermostability of the variant polypeptide is increased. Specifically, the heat resistance enables an enzymatic reaction at a high temperature, and the solubility of the substrate may be increased in a high temperature reaction process. As the solubility of the substrate increases, it is possible to use a high-concentration substrate, and the diffusion rate or reaction rate of the material is increased to shorten the reaction time, thereby improving productivity. In addition, process contamination due to external microorganisms can be minimized.

In addition, if the polypeptide is expressed in a large amount in GRAS (generally recognized as safety) microorganisms and then heat-resistant properties are used, it can be used as a dead cell. Specifically, not only can the recombinant microorganisms be effectively killed by heat treatment at high temperature, but also when the polypeptide is to be separated and used, proteins derived from the recombinant microorganism can be selectively denatured and removed, thereby improving the efficiency of the polypeptide purification process. There is an advantage to be able to.

Specifically, when the polypeptide or variant polypeptide is heat-treated at 50°C to 70°C for 0.5 to 24 hours, it may maintain 75% or more of the activity before the heat treatment. More specifically, the polypeptide may maintain 100% or more of the activity before the heat treatment when heat-treated at 50° C. to 70° C. for 0.5 to 24 hours. In addition, the mutant polypeptide may maintain an activity of 85% or more of the activity before the heat treatment when heat treatment at 50° C. to 60° C. for 0.5 to 24 hours. In addition, the mutant polypeptide may maintain an activity of 85% or more of the activity before the heat treatment when heat treatment at 50° C. to 70° C. for 0.5 to 9 hours. More specifically, the variant polypeptide in which the amino acid residue 392 glycine (G) from the N-terminus of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 is mutated to threonine (T) is from 50° C. to 70° C. for 0.5 hours to When heat treatment for 24 hours, 95% or more of the activity before the heat treatment, or when heat treatment at 50° C. to 70° C. for 0.5 to 9 hours, may maintain 98% or more of the activity before the heat treatment. In addition, the mutant polypeptide in which the amino acid residue 392 glycine (G) from the N-terminus of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 is mutated to glutamic acid (E) is heat treated at 50° C. to 60° C. for 0.5 to 24 hours. 85% or more of the activity before the heat treatment, 85% or more of the activity before the heat treatment at 50°C to 70°C for 0.5 hours to 9 hours, or the activity before the heat treatment at 50°C to 60°C for 0.5 hours to 24 hours It can maintain more than 90% activity. In addition, the mutant polypeptide in which the amino acid residue 392 glycine (G) from the N-terminus of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 is mutated to alanine (A) is heat treated at 50°C to 60°C for 0.5 to 24 hours. At least 100% of the activity before the heat treatment, at least 90% of the activity before the heat treatment at 50°C to 70°C for 0.5 hours to 9 hours, or the activity before the heat treatment at 50°C to 70°C for 0.5 hours to 3 hours It can maintain more than 100% activity.

The polypeptide of the present application is Meiothermus lupus rufus ) may be derived, but is not limited thereto.

Another aspect of the present application is to provide a polynucleotide encoding the polypeptide or variant polypeptide.

In the present application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA or RNA strand having a predetermined length or more, and more specifically, the polypeptide or variant It means a polynucleotide fragment encoding a polypeptide.

The polynucleotide of the present application may include a base sequence encoding the amino acid sequence of the polypeptide or variant polypeptide of the present application due to the genetic code degeneracy.

In addition, if the polynucleotide encoding the mutant polypeptide having the activity of converting sucrose to turranose of the present application is a polynucleotide sequence encoding the mutant polypeptide having the activity of converting sucrose to turanose of the present application Can be included without limitation. Specifically, the polynucleotide of the present application has various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide due to the degeneracy of the codon or in consideration of the preferred codon in the organism to express the polypeptide. This can be done. Any polynucleotide sequence encoding a variant polypeptide in which the 392th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid may be included without limitation. For example, the variant polypeptide of the present application may be a polynucleotide sequence encoding the variant polypeptide, but is not limited thereto. In addition, a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence and hydride under stringent conditions, and the 392th amino acid in the amino acid sequence of SEQ ID NO: 1 is changed to another amino acid. Any sequence encoding a protein having the activity of the substituted variant polypeptide may be included without limitation.

Specifically, the polynucleotide of the present application is a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, or a nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8 and at least 80% or more, 85% or more, 90 % Or more, 95% or more, 97% or more, 99% or more may be a polynucleotide consisting of a nucleotide sequence having homology or identity, but is not limited thereto.

In addition, as a probe that can be prepared from a known gene sequence, for example, a polypeptide encoded by a polynucleotide that hydrides under stringent conditions and a complementary sequence to all or part of the nucleotide sequence encoding the polypeptide, can Any polypeptide having an activity of converting cross to turranose may be included without limitation. The "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, genes with homology or identity with high homology or high identity are hybridized with each other, and genes having homology or identity of 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, or 99% or more are hybridized. Conditions that do not hybridize with genes of the same sex or low identity, or wash conditions for general Southern hybridization: 60°C, 1 X SSC, 0.1% SDS, specifically 60°C, 1 X SSC, 0.1% SDS, more specifically As examples, conditions for washing once, specifically, two to three times at a salt concentration and temperature corresponding to 68° C., 0.1 X SSC, and 0.1% SDS, can be enumerated.

Hybridization requires that two polynucleotides have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.

The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

The polypeptide or variant polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, 3, 5 or 7 of the present application may be encoded by the polynucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, respectively.

Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.

The term "vector" as used in the present application means a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable control sequence so that the protein of interest can be expressed in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Vectors can be transformed into suitable host cells and then replicated or function independently of the host genome, and can be integrated into the genome itself.

The vector used in the present application is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used. The vector usable in the present application is not particularly limited, and a known expression vector may be used.

For example, a polynucleotide encoding a desired variant polypeptide in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker for confirming whether the chromosome is inserted. Selectable markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a nucleic acid molecule of interest, and selectable phenotypes such as drug resistance, nutrient demand, resistance to cytotoxic agents, or expression of surface variant polypeptides. Markers that give s can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected. As another aspect of the present application, the present application provides a microorganism comprising the variant polypeptide or comprising a polynucleotide encoding the variant polypeptide to produce a purine nucleotide. Specifically, the microorganism comprising the variant polypeptide and/or the polynucleotide encoding the variant polypeptide may be a microorganism produced by transformation with a vector containing the polynucleotide encoding the variant polypeptide, but is not limited thereto. .

In addition, the term "operably linked" in the above means that a promoter sequence for initiating and mediating transcription of a polynucleotide encoding a protein of interest of the present application and the polynucleotide sequence are functionally linked. The operable linkage may be prepared using a gene recombination technique known in the art, and site-specific DNA cleavage and linkage may be prepared using a cleavage and linkage enzyme in the art, but is not limited thereto.

Another aspect of the present application is to provide a recombinant microorganism comprising the polynucleotide of the present application or the vector of the present application.

In the recombinant microorganism of the present application, the recombination may be performed by transformation. In the present application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides may include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto. The transformation method includes any method of introducing a polynucleotide into a cell, and may be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (Ca(H ₂ PO ₄ ) ₂ , CaHPO ₄ , or Ca ₃ (PO ₄ ) ₂ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, There are polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method, but are not limited thereto.

The host cell or microorganism of the present application may be any microorganism capable of producing turranose from sucrose, including the polynucleotide of the present application or the vector of the present application. Specifically, for example, Escherichia (Escherichia) genus, Serratia marcescens (Serratia), An air Winiah (Erwinia) genus, Enterobacter bacteria (Enterobacteria) genus, Providencia (Providencia) genus, Salmonella (Salmonella) genus Streptomyces ( Streptomyces ), Pseudomonas ( Pseudomonas ), Brevibacterium ( Brevibacterium ) or Corynebacterium ( Corynebacterium ) may include microorganism strains such as the genus, specifically Escherichia ( Escherichia ) or Corynebacterium It may be a microorganism of the genus (Corynebacterium ), and a more specific example is Escherichia coli ( Escherichia coli ) or Corynebacterium glutamicum ( Corynebacterium glutamicum ), but is not limited thereto. In addition to the introduction of the polynucleotide of the present application or the vector of the present application, the recombinant microorganism of the present application may express a polypeptide having an activity of converting sucrose into turranose of the present application or a microorganism capable of expressing a mutant polypeptide by various known methods. It can contain all. In one embodiment, the recombinant microorganism of the present application is CJ_Mrf_AS(KCCM11939P), E. coli BL21(DE3)/MRF+G392T(KCCM12113P), E. coli BL21(DE3)/MRF+G392E(KCCM12112P) and E. coli BL21 (DE3)/MRF+G392A(KCCM12111P) may be

As another aspect of the present application, the present application provides a polypeptide comprising an amino acid sequence having 85% or more homology to the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture comprising the microorganism It is to provide a composition for producing lanose. Specifically, the composition for producing turranose may include a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

As another aspect of the present application, the present application provides a variant polypeptide comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the variant polypeptide, or a culture of the microorganism. A composition for production of lanose, wherein the amino acid mutation comprises a substitution of one or more other amino acids for the amino acid residue 392 glycine (G) from the N-terminus of the polypeptide containing the amino acid sequence of SEQ ID NO: 1. Is to provide. The composition is not limited thereto as long as it is involved in the production of turranose.

In addition, the composition may further include sucrose, but is not limited thereto. The composition of the present application may further include any suitable excipient commonly used in the composition for producing turranose. Such excipients may be, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffering agent, a stabilizer, or an isotonic agent, but are not limited thereto.

As another aspect of the present application, the present application provides a polypeptide comprising an amino acid sequence having 85% or more homology to the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or sucrose in the culture of the microorganism. It is to provide a method for producing turranose, including the step of converting the sucrose into turranose by contacting. Specifically, the method for preparing turranose may include a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

As another aspect of the present application, the present application provides a variant polypeptide comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the variant polypeptide, or a culture of the microorganism. A composition for production of lanose, wherein the amino acid mutation comprises a substitution of one or more other amino acids for the amino acid residue 392 glycine (G) from the N-terminus of the polypeptide containing the amino acid sequence of SEQ ID NO: 1. Is to provide. The composition is not limited thereto as long as it is involved in the production of turranose.

In addition, the contact may be performed under pH 5.0 to 9.0 conditions, 40°C to 80°C temperature conditions, and/or 0.5 to 24 hours, but is not limited thereto. Specifically, the contact of the present application may be performed at pH 6.0 to pH 9.0, pH 7.0 to pH 9.0, pH 5.0 to pH 8.0, pH 6.0 to pH 8.0, and pH 7.0 to pH 8.0. In addition, the contact of the present application is 45 ℃ to 80 ℃, 50 ℃ to 80 ℃, 55 ℃ to 80 ℃, 60 ℃ to 80 ℃, 40 ℃ to 75 ℃, 45 ℃ to 75 ℃, 50 ℃ to 75 ℃, 55 ℃ to 75 ℃, 60 ℃ to 75 ℃, 40 ℃ to 70 ℃, 45 ℃ to 70 ℃, 50 ℃ to 70 ℃, 55 ℃ to 70 ℃, 60 ℃ to 70 ℃, 40 ℃ to 65 ℃, 45 ℃ to It can be carried out at 65°C, 50°C to 65°C, 55°C to 65°C, 40°C to 60°C, 45°C to 60°C, or 50°C to 60°C. In addition, the contact of the present application is 0.5 to 24 hours, 0.5 to 12 hours, 0.5 to 6 hours, 1 to 24 hours, 1 to 12 hours, 1 to 6 hours, 3 For hours to 24 hours, 3 hours to 12 hours, 3 hours to 6 hours, 6 hours to 48 hours, 6 hours to 36 hours, 6 hours to 24 hours.

In the composition or method, the culture of the microorganism may be prepared from the step of culturing a microorganism expressing the polypeptide or variant polypeptide of the present application in a medium.

In the present application, the term "culture" refers to growing the microorganism under appropriately controlled environmental conditions. The cultivation of the present application may be performed according to a suitable medium and culture conditions known in the art. Such culture can be easily adjusted and used by a person skilled in the art according to the selected strain. Specifically, the culture of the present application may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like, but is not limited thereto. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used at an appropriate pH (eg, pH 5 to pH 9, specifically For example, pH 6 to pH 8, most specifically pH 6.8) can be adjusted. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress the generation of air bubbles. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas is injected into the culture, or anaerobic and microaerobic conditions are maintained. To maintain, nitrogen, hydrogen or carbon dioxide gas can be injected without injection of gas. The culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, and may be cultured for about 0.5 to 160 hours, but is not limited thereto. The polypeptide or variant polypeptide of the present application produced by the culture may be secreted into a medium or remain in cells.

In addition, the culture medium used is a carbon source such as sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (e.g., soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol), and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (e.g. peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea), or inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and Ammonium nitrate) or the like may be used individually or in combination, but is not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto as a source of phosphorus may be used individually or in combination, but are not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.

The manufacturing method of the present application may further include the step of separating and/or purifying the prepared turanose. The separation and/or purification may be performed using a method commonly used in the technical field of the present application. As non-limiting examples, dialysis, precipitation, adsorption, electrophoresis, ion exchange chromatography and fractionation crystals, and the like can be used. The purification may be performed by only one method, or two or more methods may be performed together.

In addition, the manufacturing method of the present application may further include performing decolorization and/or desalting before or after the separation and/or purification step. By performing the above-described decolorization and/or desalting, turranose having more excellent quality can be obtained.

In another embodiment, the manufacturing method of the present application may further include the step of converting to turranose of the present application, separating and/or purifying, or crystallizing turranose after the step of decoloring and/or desalting. have. The crystallization may be performed using a commonly used crystallization method. For example, crystallization can be carried out using a cooling crystallization method.

In another embodiment, the manufacturing method of the present application may further include the step of concentrating turranose before the step of crystallizing. The concentration may increase crystallization efficiency.

In another embodiment, the preparation method of the present application is a polypeptide or variant polypeptide of the present application, a microorganism or the microorganism expressing the polypeptide or variant polypeptide, after the step of isolating and/or purifying the present application, unreacted sucrose. The step of contacting the culture of the present application, the step of reusing the mother liquor from which the crystals are separated after the step of crystallization of the present application for the separation and/or purification step, or a combination thereof may be further included. Through the additional step, turranose can be obtained in a higher yield, and the amount of discarded sucrose can be reduced, thereby providing an economic advantage.

The present application has the advantage of enabling industrial production of turanose by newly proposing a heat-resistant polypeptide having an activity of converting sucrose to turranose and a variant polypeptide thereof.

1A to 1D are the results of confirming the turranose production activity of MRF, MRF+G392T, MRF+G392E, and MRF+G392A, respectively.
2 is a result of evaluation of activity according to temperature of MRF, MRF+G392T, MRF+G392E, and MRF+G392A.
3A and 3B are results of evaluating the activity of MRF and MRF+G392A according to pH, respectively.

Hereinafter, the present application will be described in more detail by examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited by these examples, and it will be apparent to those of ordinary skill in the art to which the present application belongs.

Example One: Sucrose To Turanos Production of recombinant vectors and recombinant microorganisms for the production of polypeptides having a converting activity and variant polypeptides thereof

1-1. Sucrose To Turanos Preparation of vectors for production of polypeptides with converting activity

In order to discover a polypeptide having heat resistance and an activity that converts sucrose to turranose , gene information of the thermophilic microorganism, Meiothermus rufus , was obtained to prepare a vector and a recombinant microorganism capable of expressing E. coli.

Specifically, a gene predicted to have an activity of converting sucrose to turranose was selected from the sequence of the Mayothermus lupus gene registered in NCBI (National Center for Biotechnology Information). The polynucleotide (SEQ ID NO: 2) encoding the gene-expressed polypeptide (hereinafter referred to as MRF; SEQ ID NO: 1) was synthesized by PCR (SEQ ID NO: 9 and 10, Table 1) for 5 minutes at 94°C. After denaturation, denatured at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and then stretched at 72°C for 90 seconds were repeated 30 times, and the conditions of the stretching reaction at 72°C for 10 minutes) were amplified. Recombinant vector pET21a-Mrf was prepared by inserting the amplified polynucleotide into the expression vector pET21a_SalI6His (a vector in which the restriction enzyme XhoI recognition site CTCGAG of pET21a was modified with SalI recognition site GTCGAC) using restriction enzymes NdeI and SalI.

Sequence number primer Sequence (5'-3') 9 Forward direction GGGCATATGATGGATGTTGCTGCCTTCCTGAA 10 Reverse CCGTCAGCTAGCTTGCCCTCGAGGGGAG

1-2. Production of recombinant vectors for production of variant polypeptides

A recombinant vector for expression of a variant polypeptide of a polypeptide having sucrose-to-turanose-converting activity is a glycine amino acid residue at position 392 from the N-terminus of SEQ ID NO: 1, threonine, glutamic acid. acid) or alanine substituted polypeptide [hereinafter, sequentially MRF+G392T (SEQ ID NO: 3), MRF+G392E (SEQ ID NO: 5) and MRF+G392A (SEQ ID NO: 7)) encoding polynucleotides (sequential As a result, after preparing SEQ ID NOs: 2, 4 and 8), pET21a-Mrf+G392T, pET21a-Mrf+G392E and pET21a-Mrf+G392A were prepared by inserting into the pET21a_SalI6His vector using restriction enzymes NdeI and SalI. As the polynucleotide encoding the variant polypeptide, a saturation mutation method based on reverse PCR was used using pET21a-Mrf as a template (2014. Anal. Biochem . 449:90-98). PCR was performed under conditions of an extension reaction at 94°C for 2 minutes, denatured at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and then stretched for 10 minutes at 72°C for 30 times and 60 minutes at 72°C. As the primer, a 33 bp primer consisting of 15 bp of a base at the front of the substitution site, 3 bp of a base at the substitution site (RMG) and 15 bp at the rear of the substitution site was prepared and used, and the primer sequence is as shown in Table 2 below.

Sequence number primer Sequence (5'-3') 11 Forward direction TGCCACGACGACATCRMGTGGGCCATCTCCGAC 12 Reverse GTCGGAGATGGCCCACKYGATGTCGTCGTGGCA

1-3. Manufacture of recombinant microorganisms

Each of the recombinant vectors prepared in Examples 1-1 and 1-2 was transformed into E. coli BL21 (DE3) (invitrogen) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001) to obtain a recombinant microorganism. After preparation, it was stored frozen in 50% glycerol and used. The recombinant microorganisms were each named CJ_Mrf_AS, E. coli BL21(DE3)/MRF+G392T, E. coli BL21(DE3)/MRF+G392E and E. coli BL21(DE3)/MRF+G392A, respectively, and internationally under the Budapest Treaty. Deposited to the Korean Culture Center of Microorganisms (KCCM), which is a depository institution, deposit number KCCM11939P (deposited on November 22, 2016), KCCM12113P (deposited on September 13, 2017), KCCM12112P (September 13, 2017) (Deposited on September 13, 2017) and KCCM12111P (deposited on September 13, 2017).

Example 2: Recombinant polypeptide and variant polypeptide production

Recombinant microorganisms CJ_Mrf_AS prepared in Example 1, E. coli BL21 (DE3) / MRF + G392T, E. coli BL21 (DE3) / MRF + G392E and E. coli BL21 (DE3) / MRF + G392A each 5 ml LB It was inoculated in a liquid medium, and seed culture was carried out until the absorbance at 600 nm became 2.0. The culture medium after the seed culture was inoculated into LB liquid medium to proceed with the main culture. When the absorbance at 600 nm reached 2.0, 0.5 mM IPTG was added to induce expression of the recombinant polypeptide and the variant polypeptide. The agitation speed of the seed culture and the main culture was 200 rpm, and the culture temperature was maintained at 37°C. After the main culture, the culture solution was centrifuged at 8,000×g at 4°C for 20 minutes to recover the cells, and the recovered cells were washed twice with 50 mM phosphate buffer solution (pH 7.5), and then suspended in the same buffer solution. It was disrupted using an ultrasonic cell disruptor. After centrifuging the cell lysate at 13,000×g for 20 minutes at 4° C., only the supernatant was taken, and MRF, a polypeptide purified from each recombinant microorganism, and MRF+G392T, a purified mutant polypeptide, using His-tag affinity chromatography, MRF+G392E and MRF+G392A were obtained. The purified polypeptides were dialyzed with 50 mM phosphate buffer (pH 7.5) and used for activity analysis.

Example 3: Recombinant polypeptide and variant polypeptide Turranos Conversion activity assay

To confirm the turranose conversion activity of each polypeptide prepared in Example 2, 0.1 unit/ml of each purified polypeptide was added to a 50 mM potassium phosphate (pH 7.5) buffer solution containing 1M sucrose. Then, after reacting at 60° C. for 5 hours, the reaction was stopped on ice, and the generated turanose was analyzed by HPLC and measured. HPLC analysis was performed using a SUGAR SP0810 (Shodex) column at 80° C., while flowing water into the mobile phase at a flow rate of 0.6 ml/min, and turranose was detected with a Refractive Index Detector.

As a result, it was confirmed that all of MRF, MRF+G392T, MRF+G392E, and MRF+G392A have the activity of converting sucrose to turranose. Specifically, MRF produced 60 g/l, MRF+G392T was 100.7 g/l, MRF+G392E was 100.3 g/l, and MRF+G392A produced 123.6 g/l of turanose. All were superior to the wild-type MRF in turranose conversion activity. In particular, it was confirmed that MRF+G392A had a conversion activity of 200% or more of the wild type under the same reaction conditions (Table 3 and FIGS. 1A to 1D).

Strain name Turanose (g/L) Conversion rate (%) Conversion activity (%) MRF 60 17.5 100 MRF+G392T 100.7 29.4 168 MRF+G392E 100.3 29.3 167 MRF+G392A 123.6 36.1 206

Example 4: depending on the reaction conditions Turranos Conversion activity assay

4-1. Activity analysis according to temperature

In order to evaluate the activity according to the temperature, each purified polypeptide was added to a 50 mM potassium phosphate (pH 7.5) buffer solution containing 10% (w/v) sucrose at 40°C, 45°C, 50 After reacting for 1 hour at ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃ and 75 ℃ was measured by analyzing turranose by HPLC in the same manner as in Example 3.

As a result, MRF showed maximum activity at 55°C and MRF+G392T, MRF+G392E and MRF+G392A at 65°C. In addition, MRF at 40 ℃ to 75 ℃, MRF+G392T at 60 ℃ to 75 ℃, MRF + G392E at 45 ℃ to 75 ℃, MRF + G392A at 40 ℃ to 75 ℃ showed more than 80% of the maximum activity Was confirmed (Table 4 and Figure 2).

Relative activity according to temperature division MRF MRF+G392T MRF+G392E MRF+G392A 40℃ 88.0 81.6 71.5 61.1 45℃ 91.5 88.2 81.9 71.8 50℃ 92.4 92.0 83.8 73.9 55℃ 100.0 96.7 84.0 77.2 60℃ 99.8 98.4 91.0 87.5 65℃ 98.4 100.0 100.0 100.0 70℃ 86.3 90.8 98.0 96.9 75℃ 82.7 72.6 93.5 96.2

4-2. Activity analysis according to pH

To evaluate the activity according to pH, 50 mM sodium acetate (SA: sodium acetate, pH 5-6) buffer solution and 50 mM potassium phosphate buffer solution (KPB: potassium phosphate) containing 10% (w/v) sucrose buffer, pH 6-8), purified MRF and MRf+G392A (0.1 unit/ml) were each added and reacted at 55° C. for 1 hour, and then turranose was analyzed and measured by HPLC in the same manner as in Example 3. I did.

As a result, it showed high activity at pH 7 to pH 8, especially at pH 7.5. In addition, it was confirmed that among the buffer solutions corresponding to each pH, the activity was maximized in the potassium-phosphate buffer solution (FIGS. 3A and 3B ).

Example 5: Thermal stability analysis

In order to confirm the thermal stability, each purified polypeptide was heat-treated at 50°C, 60°C and 70°C for 24 hours, and then turranose conversion activity was measured. Activity is 10% (w/v) 50 mM potassium phosphate (pH 7.5) buffer solution containing sucrose, 0.1 unit/ml of each of the heat-treated polypeptides was added and reacted at 55° C. for 1 hour. Turranose was analyzed and measured by HPLC in the same manner as in Example 3.

As a result, it was confirmed that all of MRF, MRF+G392T, MRF+G392A, and MRF+G392E have thermal stability. In particular, MRF was maintained even after 24 hours under all heat treatment conditions (Table 5 and Figure 4a). MRF+G392T maintained 95% or more activity after 24 hours under all heat treatment conditions, and MRF+G392A maintained activity after 24 hours or more under 50℃ and 60℃ heat treatment conditions, and after 24 hours under 70℃ heat treatment conditions. It was confirmed that the activity maintained at least 80% even at the time (Table 5 and FIGS. 4b and 4c). It was confirmed that MRF+G392E maintained 89% or more activity after 24 hours or more at 50°C and 60°C heat treatment conditions, and 79% or more after 24 hours at 70°C heat treatment condition (Table 5 and FIG. 4D).

Relative activity (%) MRF MRF+G392T MRF+G392E MRF+G392A 50°C 60°C 70°C 50°C 60°C 70°C 50°C 60°C 70°C 50°C 60°C 70°C 0 h 100 100 100 100 100 100 100 100 100 100 100 100 3 h 112 110 109 98 109 100 108 92 89 102 109 109 6 h 104 106 100 101 111 100 94 93 93 103 105 93 9 h 103 108 101 99 109 102 95 92 89 104 103 95 24 h 111 109 101 107 113 95 102 89 79 103 101 84

From the above description, those skilled in the art to which the present application pertains will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof.

Name of deposit institution: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM11939P

Consignment date: 20161122

Name of deposit institution: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12111P

Consignment Date: 20170913

Name of deposit institution: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12112P

Consignment Date: 20170913

Name of deposit institution: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12113P

Consignment Date: 20170913

<110> CJ CheilJedang Corporation <120> Novle polypeptides having turanose productivity and a method for producing turanose using the same <130> KPA170941-KR-P1 <150> KR 10-2017-0073233 <151> 2017-06-12 <150> KR 10-2018-0004546 <151> 2018-01-12 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF <400> 1 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln 1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr 20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu 35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln 50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val His Ala Pro 65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp 85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu 100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro 115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg 130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp 180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro 195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro 210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu 260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr 275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg 290 295 300 Ala Ala Val Arg Ile Ala Ala Pro Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln 340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala 355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr 370 375 380 Leu Arg Cys His Asp Asp Ile Gly Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe 420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala 435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu 450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp 500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys 515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys 530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu 580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val 595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg 610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 2 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF <400> 2 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcggctggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 3 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF-G392T <400> 3 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln 1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr 20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu 35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln 50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val His Ala Pro 65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp 85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu 100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro 115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg 130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp 180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro 195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro 210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu 260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr 275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg 290 295 300 Ala Ala Val Arg Ile Ala Ala Pro Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln 340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala 355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr 370 375 380 Leu Arg Cys His Asp Asp Ile Thr Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe 420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala 435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu 450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp 500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys 515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys 530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu 580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val 595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg 610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 4 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF-G392T <400> 4 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcacgtggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 5 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF-G392E <400> 5 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln 1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr 20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu 35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln 50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val His Ala Pro 65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp 85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu 100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro 115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg 130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp 180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro 195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro 210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu 260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr 275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg 290 295 300 Ala Ala Val Arg Ile Ala Ala Pro Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln 340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala 355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr 370 375 380 Leu Arg Cys His Asp Asp Ile Glu Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe 420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala 435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu 450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp 500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys 515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys 530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu 580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val 595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg 610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 6 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF-G392E <400> 6 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcgagtggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 7 <211> 640 <212> PRT <213> Unknown <220> <223> Amino acid sequences of MRF-G392A <400> 7 Met Asp Val Ala Ala Phe Leu Lys Ser Ile Thr Gln Pro Leu Gly Gln 1 5 10 15 Leu Glu Ala Tyr Arg Gln Ala Asp Leu Gln Ala Arg Val Glu Arg Tyr 20 25 30 Leu Asn Asp Leu Gln Ser Gly Leu Gln Ala Val Tyr Pro Gln Ala Glu 35 40 45 Ala Val Ala Glu Arg Val Ala Gln Val Ile Gly Gln Asn Leu Ala Gln 50 55 60 Arg Pro Ala Glu Leu Leu Ala Leu Asp Leu Lys Arg Val His Ala Pro 65 70 75 80 Asp Trp Phe Gln Gln Pro His Met His Gly Tyr Ile Ala Tyr Ala Asp 85 90 95 Arg Phe Ala Gly Asn Leu Lys Gly Val Ala Glu His Ile Pro Tyr Leu 100 105 110 Lys Glu Leu Gly Ile Arg Tyr Leu His Leu Met Pro Leu Leu Leu Pro 115 120 125 Arg Glu Gly Glu Asn Asp Gly Gly Tyr Ala Val Ala Asp Tyr Arg Arg 130 135 140 Val Arg Pro Asp Leu Gly Ser Met Asp Asp Leu Glu Ala Leu Cys Thr 145 150 155 160 Gln Leu Arg Gln Glu Gly Ile Ser Leu Cys Leu Asp Leu Val Leu Asn 165 170 175 His Val Ala Arg Glu His Pro Trp Ala Glu Ala Ala Arg Lys Gly Asp 180 185 190 Leu His Tyr Arg Gly Tyr Phe Tyr Ile Phe Pro Asp Arg Thr Leu Pro 195 200 205 Asp Ala Phe Glu Arg Ser Leu Pro Glu Val Phe Pro Asp Phe Ala Pro 210 215 220 Gly Asn Phe Thr Trp Asp Asp Glu Leu Lys Gly Trp Val Trp Thr Thr 225 230 235 240 Phe His Ser Trp Gln Trp Asp Val Asn Trp Ser Asn Pro Glu Val Phe 245 250 255 Leu Glu Tyr Leu Asp Leu Ile Leu Trp Leu Ala Asn Lys Gly Val Glu 260 265 270 Val Phe Arg Leu Asp Ala Ile Ala Phe Thr Trp Lys Arg Met Gly Thr 275 280 285 Pro Cys Gln Asn Gln Pro Glu Val His Ala Leu Thr Gln Ala Leu Arg 290 295 300 Ala Ala Val Arg Ile Ala Ala Pro Ala Val Ala Phe Lys Ala Glu Ala 305 310 315 320 Ile Val Ala Pro Glu Asp Leu Ile Ala Tyr Leu Gly Thr Gly Ala His 325 330 335 Tyr Gly Lys Val Ser Glu Leu Ala Tyr His Asn Thr Leu Met Val Gln 340 345 350 Ile Trp Ser Ser Leu Ala Ser Arg Asp Thr Arg Leu Phe Thr Gln Ala 355 360 365 Leu Arg Arg Phe Pro Gln Lys Pro Pro Ser Thr Ala Trp Ala Thr Tyr 370 375 380 Leu Arg Cys His Asp Asp Ile Ala Trp Ala Ile Ser Asp Thr Asp Ala 385 390 395 400 Ala Ala Val Gly Leu Ser Gly Pro Ala His Arg Arg Phe Leu Ser Glu 405 410 415 Phe Tyr Lys Gly Asp Phe Pro Gly Ser Phe Ala Arg Gly Met His Phe 420 425 430 Gln Glu Asn Pro Ala Thr Gly Asp Arg Arg Thr Ser Gly Ser Thr Ala 435 440 445 Ser Leu Ala Gly Leu Glu Thr Ala Leu Ala Ser Gly Asn Pro Arg Leu 450 455 460 Ile His Leu Ala Leu Glu Arg Ile Leu Leu Ala His Ala Val Phe Ile 465 470 475 480 Gly Tyr Gly Glu Gly Ile Pro Leu Ile Tyr Met Gly Asp Glu Leu Gly 485 490 495 Leu Leu Asn Asp Tyr Asp Tyr Val Gln Asp Pro Ala His Lys Asp Asp 500 505 510 Asn Arg Trp Leu His Arg Pro Lys Met Asp Trp Ala Lys Ala Glu Lys 515 520 525 Arg His Gln Glu Gly Thr Ile Glu His Arg Leu Phe His Gly Ile Lys 530 535 540 Arg Leu Leu Glu Ala Arg Ala Arg Thr Pro Gln Leu His Ala Ala Phe 545 550 555 560 Pro Thr Glu Ala Leu Trp Gln Pro Asn Pro His Leu Leu Val Leu Lys 565 570 575 Arg Ala His Pro Met Gly Thr Leu Val Gln Val Tyr Asn Phe Ser Glu 580 585 590 Gln Asp Gln Pro Leu Pro Trp Glu Thr Leu Arg Thr Glu Gly Ile Val 595 600 605 Gln Pro Tyr Asp Arg Ile Glu Glu Thr Ile Ala Pro Ala Tyr Leu Arg 610 615 620 Pro Tyr Ala Arg Leu Trp Leu Val Gln Pro Pro Leu Glu Gly Lys Leu 625 630 635 640 <210> 8 <211> 1923 <212> DNA <213> Unknown <220> <223> Nucleotide sequences of MRF-G392A <400> 8 atggatgttg ctgccttcct gaaaagcatc acccaacccc tgggccaact cgaggcctac 60 cgccaggccg acctacaagc ccgggtagag cgctacctaa acgacctcca aagcgggtta 120 caggcggttt acccccaggc cgaggcggta gccgaacggg tggcccaggt catcgggcag 180 aacctggccc aacgcccggc ggagttgttg gccctggacc tcaagcgcgt ccacgccccg 240 gactggttcc agcagcccca catgcacggc tacatcgcct acgccgaccg cttcgctggc 300 aacctcaaag gggtggccga acatatcccc tacctcaagg agctgggtat tcgctacctg 360 cacctgatgc ccttgctgct gccccgcgag ggcgaaaacg acgggggcta cgcggtagcc 420 gactaccgcc gggtgcgccc cgacctgggc agcatggacg acctcgaggc cctctgcacc 480 cagctccgcc aggagggcat cagcctttgc ttagacctgg tgctcaacca cgtagcccgc 540 gagcacccct gggccgaggc cgcccgcaaa ggcgacctcc attaccgcgg ctacttctac 600 atcttccccg accgcaccct gcccgatgcc ttcgagcgga gcctgcccga ggtcttcccc 660 gacttcgccc cgggcaactt cacctgggac gacgagctaa aaggctgggt ctggaccacc 720 ttccatagct ggcagtggga cgtgaactgg agcaaccccg aggtgttctt ggagtacctc 780 gacctgattc tgtggctggc caacaagggg gtggaggtct tccggctgga tgccattgcg 840 ttcacctgga agcgcatggg caccccctgc caaaaccagc ccgaggtaca cgcccttacg 900 caggccttac gggctgcggt gcgaattgcc gcccccgcgg tggccttcaa agccgaggcc 960 atcgtggccc ccgaagacct gattgcctat ctaggcacgg gcgcgcacta cggcaaggtc 1020 tctgaactgg cctaccacaa cactctgatg gtgcagatct ggtcgagcct ggccagccgc 1080 gacacccgcc tgttcaccca ggccttgcgc cgctttcccc aaaaacctcc cagcaccgcc 1140 tgggccacct acctgcgctg ccacgacgac atcgcgtggg ccatctccga caccgatgcg 1200 gctgcggtgg gcctgagcgg gcccgcccac cggcgcttcc tctctgagtt ttacaagggc 1260 gattttcccg ggtcttttgc caggggaatg cactttcagg aaaaccccgc caccggtgac 1320 cggcgcacct cgggcagcac ggccagcctg gctggtttag aaaccgcgct ggcctcgggc 1380 aacccccgcc tgatccacct ggccctcgag cgcatccttc tggcccacgc cgtctttatc 1440 ggctacggcg agggtatccc gctgatttac atgggcgacg aactgggcct gctcaacgac 1500 tacgactacg tgcaagaccc tgcccacaag gatgataacc gctggctgca ccggcccaag 1560 atggactggg ccaaggcgga aaaacgccat caagaaggga cgatagaaca ccgactcttc 1620 cacggcatca aaaggttgtt agaggcccgg gcccgcaccc ctcagctcca cgctgcattc 1680 cccaccgagg ccctctggca gcccaacccc cacctcttgg tgctgaagcg ggcccaccct 1740 atgggcacct tggttcaggt ctacaacttc agcgagcagg accagcccct accctgggaa 1800 accttgcgaa ccgagggcat cgtacagccc tacgaccgca tcgaagaaac catcgccccg 1860 gcctacctgc gcccttacgc ccggctttgg ttggtacagc ctcccctcga gggcaagcta 1920 tag 1923 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Mrf <400> 9 gggcatatga tggatgttgc tgccttcctg aa 32 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Mrf <400> 10 ccgtcagcta gcttgccctc gaggggag 28 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Mrf mutant <400> 11 tgccacgacg acatcrmgtg ggccatctcc gac 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Mrf mutant <400> 12 gtcggagatg gcccackyga tgtcgtcgtg gca 33

Claims (16)

delete delete delete delete delete delete delete delete A composition for producing turranose comprising a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism.
delete A mutant polypeptide comprising one or more amino acid mutations in the amino acid sequence consisting of SEQ ID NO: 1, a microorganism expressing the mutant polypeptide, or a composition for producing turranose comprising a culture of the microorganism,
In the amino acid mutation, the amino acid residue 392 from the N-terminus of the polypeptide corresponding to the amino acid sequence consisting of SEQ ID NO: 1 is threonine (T:Threonine), glutamic acid (E:Glutamic acid), or alanine (A : Alanine) containing a substituted, turranose production composition.
The composition for producing turranose according to claim 9 or 11, wherein the composition further comprises sucrose.
A method for producing turranose comprising the step of converting the sucrose into turranose by contacting the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism.
delete Converting the sucrose to turranose by contacting sucrose with a mutant polypeptide comprising one or more amino acid mutations in the amino acid sequence consisting of SEQ ID NO: 1, a microorganism expressing the mutant polypeptide, or a culture of the microorganism In the turranose production method comprising a,
The amino acid mutation is that the amino acid residue 392 from the N-terminus of the polypeptide corresponding to the amino acid sequence consisting of SEQ ID NO: 1 is threonine (T:Threonine), glutamic acid (E:Glutamic acid), or alanine ( A: Alanine) will be substituted with, turranose production method.
[16] The method of claim 13 or 15, wherein the contacting is carried out at a pH of 5.0 to 9.0, at a temperature of 40 to 80 C, or for 0.5 to 24 hours.

Images