KR20180124380A - COMPOSITION FOR INHIBITING SENESCENCE OF ADULT STEM CELLS COMPRISING MICRORNAs AND CULTURE METHODS USING THE SAME - Google Patents

Abstract

The present invention relates to a composition for inhibiting the senescence of adult stem cells comprising miR-29a or miR-30c as effective components, and a culture method using the same. It is confirmed that miR-29a or miR-30c normalize the activity of mitochondria that degrade reactive oxygen, a characteristic of cell senescence, and the expression of SOD2 gene, which is an active oxygen degrader, is increased through the inhibition of DNMT3A expression in aged cells. Additionally, the miR-29a or miR-30c is confirmed to inhibit cellular senescence by decreasing intracellular reactive oxygen concentration and to have a function of promoting cell proliferation and survival rate. Therefore, by culturing cells using the composition comprising the miR-29a or miR-30c as effective components, the technique of inhibiting the aging of adult stem cells and promoting the proliferation and survival rate can be developed to be used for the development of a stem cell treatment agent.

Description

TECHNICAL FIELD The present invention relates to a composition for inhibiting the senescence of adult stem cells comprising microRNA as an active ingredient and a culture method using the same. BACKGROUND ART [0002]

The present invention relates to a composition for inhibiting cell senescence comprising microRNA (hereinafter referred to as " miRNA ") as an active ingredient, and a culture method using the same.

For the clinical application of adult stem cells, which are widely regarded as a representative stem cell treatment agent, a long-term subculture is necessary to obtain a large number of cells, but cellular senescence phenomenon occurs during this process. The phenomenon of aging of adult stem cells is directly related to the function as a stem cell treatment agent, such as inhibiting the proliferation, differentiation and regeneration effect of stem cells. Therefore, it is necessary to develop new technology to overcome cell senescence and increase proliferation.

One of the causes of cell senescence is active oxygen. Oxygen, which accounts for about 65% of our bodies, is essential for human survival, but not all oxygen is beneficial to the human body. Oxygen that enters the body during the breathing process is used for the oxidation phosphorylation process, and through various metabolic processes, it generates oxygen by-products, which is called active oxygen or harmful oxygen.

Active oxygen, unlike oxygen, is an unstable state with very strong activity and is caused by environmental pollution, chemicals, ultraviolet rays, blood circulation disorder, stress and the like. These active oxygen protects our body from bacteria and foreign substances when it is present in an appropriate amount, but when it is overproduced, it oxidizes the human body and damages cell membrane, DNA, and all other cell structures, and can lose cell function. On the other hand, in addition to the above-mentioned factors, reactive oxygen species also increase in expression levels of superoxide dismutase 2 (SOD2) genes, which are various kinds of superoxide dismutase (SOD2), which remove active oxygen in mitochondria as cells age. In addition, aging of cells not only increases free radicals but also decreases cell proliferation rate (Yoon, 2000).

On the other hand, miRNAs are single-stranded RNAs composed of approximately 19 to 25 nucleotides (hereinafter referred to as " nt ") and are produced by cleavage by Drosha and DGCR8 protein complexes. These miRNAs bind to the target mRNA and inhibit its expression, thereby acting as a key gene expression regulator in the cell. miRNA is involved in various cell processes such as cell proliferation, death, metabolism, and carcinogenesis.

 Yoon Se - soon. The Role of Abnormal Metabolism and GSK3 Associated with Cell Aging. Molecular Cell Biology News. Korean Society of Molecular and Cellular Biology. 2011. 1-6.

Accordingly, the present inventors have made efforts to research and develop a substance that inhibits cell senescence. When the amount of a specific miRNA is increased in aged adult stem cells, the mitochondrial inner membrane having a function of reducing or degrading active oxygen Was normalized. In addition, the present invention has been accomplished by confirming the increase of cell growth rate and the suppression of aging-related gene expression during miRNA treatment.

Accordingly, the present invention provides a miRNA that inhibits cell senescence and promotes proliferation.

In order to achieve the above object, the present invention provides a pharmaceutical composition comprising at least one selected from the group consisting of nucleic acid molecules which are hsa-miR-29a-3p (miR-29a) and hsa-miR-30c-5p And a composition for suppressing adult stem cell senescence.

In order to accomplish the above other objects, the present invention provides a composition for promoting proliferation or survival rate of adult stem cells comprising one or more miRNAs selected from the group consisting of miR-29a and miR-30c as an active ingredient.

According to another aspect of the present invention, there is provided an adult stem cell proliferation method comprising culturing adult stem cells in the presence of any one or more miRNAs selected from the group consisting of miR-29a and miR-30c, Wherein the stem cells are maintained in an undifferentiated state.

In order to achieve still another object of the present invention, there is provided a cell therapy agent, wherein at least one selected from the group consisting of miR-29a and miR-30c nucleic acid molecules is introduced into the cell.

The composition for inhibiting senescence and promoting proliferation or survival rate of adult stem cells comprising miR-29a and / or miR-30c according to the present invention as an active ingredient is a composition for mitigating active oxygen in senescent adult stem cells Normalize the activity and inhibit the expression of aging-related genes. Therefore, the miRNA inhibits aging of cells and promotes cell proliferation, which is useful for mass culture of adult stem cells, and can be usefully used for development of techniques for inhibiting the senescence of adult stem cells and promoting proliferation of adult stem cells.

1 is a graph showing the results of measurement of active oxygen concentration of cells using 2 ', 7'-dichlorodihydrofluorescein diacetate (H ₂ DCFDA) analysis technique.
FIG. 2 shows the cells observed with a confocal microscope after staining with JC-1 dye to confirm the normal function of mitochondria, which plays a key role in controlling oxidative stress.
Figure 3 is a graph showing the results of MTS [3- (4,5-dimethyl-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium ] Based cell proliferation assay kit at 490 nm.
FIG. 4A shows the results of observing the expression of regulatory proteins in cells using Western blot analysis.
FIG. 4B is a graph showing the expression of DNMT3A (DNA methyltransferase 3A) and SOD2 (Superoxide dismutase 2) gene according to miR-29a or miR-30c treatment.

In one aspect, the present invention provides a composition for inhibiting adult stem cell senescence comprising at least one selected from the group consisting of miR-29a and miR-30c nucleic acid molecules as an active ingredient.

The term " inhibition of aging " means suppression of physiological changes caused by aging. Such physiological changes include energy metabolism degradation, mitochondrial function degradation, and the like. In addition, inhibition of adult stem cell senescence may be to maintain the undifferentiated state of adult stem cells.

miRNAs produce two types of mature miRNAs from precursors, either '-3p' or '-5p' when they originate from different arms (3 'arm or 5' arm) of the same pre- Is added to the rear to name miR-n-3p or miR-n-5p. In this case, n is a number and generally indicates a naming sequence. For example, miR-121a and miR-121b were generated from their respective precursors, mir-121a and mir-121b, and the sequence was also very high similar. Here, " mir- " refers to pre-miRNA, and " miR- " with an upper case means mature miRNA. In addition, miRNA nomenclature by species is indicated at the front, for example, hsa-miR-123 is a homo sapiens miRNA and oar-miR-123 is an Ovis aries miRNA.

The precise names of miR-29a and miR-30c used in one embodiment of the present invention are hsa-mir-29a-3p and hsa-miR-30c-5p, 30c. ≪ / RTI > The sequences of miR-29a and miR-30c are as follows: miR-29a, UAGCACCAUCUGAAAUCGGUUA (SEQ ID NO: 1); miR-30c, UGUAAACAUCCUACACUCUCAGC (SEQ ID NO: 2).

Currently, the miRNA nomenclature has been well established, but miRNA nomenclature has been slightly different according to the researchers before it was established. Therefore, it is most accurate and desirable to trace the miRNA with the accession number, which is the unique number of the miRNA. The accession numbers of miR-29a and miR-30c used in one embodiment of the present invention are as follows: miR-29a, MIMAT0000086; miR-30c, MIMAT0000244.

In the present invention, miR-29a or miR-30c having the above sequence is added to aged adult stem cells to inhibit the expression of DNMT3A in aged cells. As a result, induction of the expression of the SOD2 gene, which is an active oxygen decomposer, decreases the active oxygen concentration in the cell, restraining cell senescence and restoring the growth of cells.

In addition, the adult stem cells referred to in the present specification may be human adult stem cells or animal adult stem cells. Specifically, the adult stem cells may be mesenchymal stem cells (MSCs), multipotential stem cells, or amniotic epithelial cells. In addition, the mesenchymal stem cells may be mesenchymal stem cells derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta. The method of obtaining stem cells from each of the strains can be performed by a method known in the art and is not limited to the method of the embodiment of the present invention.

The composition may be used as a culture medium additive. As a medium used for culturing adult stem cells of the present invention, a conventional medium known to be suitable for stem cell culture in the art may be used. For example, DMEM (Dulbecco's modified Eagle medium) or Keratinocyte-SFM (Keratinocyte serum free medium).

In another aspect, the present invention provides a composition for promoting adult stem cell proliferation or improving survival rate, comprising at least one miRNA selected from the group consisting of miR-29a and miR-30c as an active ingredient.

The term " promoting proliferation " in the present invention means that the proliferation process occurs rapidly or the proliferation efficiency is increased in the process of proliferation. In addition, adult stem cells stop proliferating after a certain degree of cleavage, including increased number of cleavage and proliferation.

The term " survival rate improvement " in the present invention means that the ratio of the surviving population to the total number of the population increases.

In one embodiment of the invention, cell proliferation was measured using CellTiter 96 AQueousz One Solution cell proliferation assay. As a result, it was confirmed that the cell growth rate was decreased by the cell aging phenomenon. As a result of treating miR-29a or miR-30c with the aged cells, the growth rate of the cells was increased compared to the aged cells and the control group (Fig. 3).

In another aspect, the present invention provides a method for adult stem cell proliferation comprising culturing adult stem cells in the presence of any one or more miRNAs selected from the group consisting of miR-29a and miR-30c.

In addition, the present invention provides a propagation method characterized in that the adult stem cells are maintained in an undifferentiated state during differentiation. The adult stem cells can be cultured in a medium in which miR-29a or miR-30c is present to provide culture conditions favorable for maintaining the undifferentiated state.

In one embodiment of the present invention, it was confirmed that when adult stem cells were treated with miR-29a or miR-30c, they had the effect of promoting cell growth and proliferation (Fig. 3).

In the present invention, the term " undifferentiated " means a state in which the cells are not completely differentiated. Specifically, the term " adult stem cell "

In another embodiment, the present invention provides a composition for maintaining undifferentiated adult stem cells comprising miR-29a or miR-30c. The types of adult stem cells are the same as those described above. In addition, the composition may be a culture medium. In this case, the concentration of miR-29a or miR-30c in the composition in the culture medium may be 1 nM to 200 nM, 5 nM to 100 nM, 10 nM to 80 nM and 20 nM to 50 nM.

Also, the culture may be a continuous subculture, and the time for treating miR-29a or miR-30c in the culture may be 1 hour to 24 hours, 2 hours to 10 hours, 4 hours to 6 hours.

In addition, the present invention provides a propagation method characterized in that the mitochondrial function of the adult stem cells is maintained or improved.

Mitochondrial function is usually reduced by the cell aging process. In particular, the mitochondrial function of undifferentiated adult stem cells remains high, but the function of the mitochondria of aged cells deteriorates. Thus, the function of mitochondria can be measured to determine that cells have aged. In particular, as mitochondria function through various ion channels in the membrane, mitochondrial activity can be confirmed through the membrane potential of mitochondria.

In one embodiment of the present invention, the cell potential (? M) of mitochondria was measured after treatment of miR-29a or miR-30c with cells using the JC-1 dye staining method. When stained with JC-1 dye, normally activated mitochondria are stained red, and abnormally activated mitochondria are stained green. It was confirmed that miR-29a or miR-30c normalized the activity of mitochondria as the number of red-stained mitochondria increased after treatment with miR-29a or miR-30c.

That is, miR-29a or miR-30c induced normalization of the mitochondrial inner membrane, and abnormal polarization of mitochondrial inner membrane responsible for active oxygen degradation due to cell senescence disappeared (FIG. 2). This suggests that the addition of miR-29a or miR-30c normalizes the mitochondrial activity and thus favorably maintains the undifferentiated state of adult stem cells.

The present invention also provides a cell therapy agent comprising a cell into which a nucleic acid molecule of miR-29a or miR-30c has been introduced.

In the present invention, miR-29a or miR-30c inhibits DNMT3A expression, thereby increasing the expression of SOD2 gene, thereby decreasing active oxygen concentration in the cell, thereby restraining cell senescence and restoring cell growth. In one embodiment of the present invention, when the miR-29a mimic and miR-30c mimic were treated with cells, the expression level of DNMT3A was decreased and the expression of SOD2 gene was increased. As a result, It was confirmed that the cells were inhibited from aging and restored the growth rate of the cells.

Accordingly, it is possible to provide a composition for increasing the level of miR-29a or miR-30c of the present invention to inhibit cell senescence and promote cell proliferation. Further, it is possible to provide a cell therapy agent containing the cells into which miR-29a or miR-30c nucleic acid molecule as described above is introduced.

In the present invention, the term " cell therapeutic agent " means a series of actions such as alive, homologous or xenogeneic cell propagation, screening, or other means of changing the biological characteristics of a cell in order to restore the functions of cells and tissues Refers to medicines used for therapeutic, diagnostic and prophylactic purposes.

The cell treatment agent can be classified into a somatic cell treatment agent and a stem cell treatment agent depending on the type and degree of differentiation of the cell to be used, and the stem cell treatment agent can be classified into an embryonic stem cell treatment agent and an adult stem cell treatment agent.

In the present invention, a cell therapy agent containing cells into which miR-29a or miR-30c nucleic acid molecules are introduced during cell culture inhibits DNMT3A expression and increases expression of SOD2 to inhibit cell senescence and activate proliferation, It can be used as an effective cell therapy agent by maintaining the ability to differentiate and regenerate cells.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Preparation Example  1. Human Intermediate lobe  Isolation and culture of stem cells

Human mesenchymal stem cells were isolated from the adipose tissue of four donors aged between 33 and 46, as mentioned in the following paper (Zuk et al., 2002, Zuk et al., 2001). Human mesenchymal stem cells were cultured in Dulbecco's modified Eagle's medium (Gibco) containing 10% fetal bovine serum (Gibco), 100 units / ml penicillin, and 100 μg / ml streptomycin (Gibco) and incubated in a humid air containing the% CO _2. The medium was changed every 3 days and human mesenchymal stem cells were used in the early passage (3 to 5 passages) and later passages (11 to 13 passages).

Experimental Example  One. H ₂ DCFDA The fluorescence value  Measurement of active oxygen in used cells

The intracellular reactive oxygen species were measured by oxidation of the fluorescent probe 2 ', 7'-dichlorofluorescin diacetate (H ₂ DCFDA) (ThermoFischer Scientific).

Human mesenchymal stem cells were grown to 50% to 60% in complete medium, and after 1 day, the cells were treated with lipofectamine 2000 (Invitrogen) at a concentration of 32 nM according to a predetermined protocol using DGCR8 (DiGeorge syndrome chromosomal region 8) (siDGCR8) and the GFP control (siGFP; ST Pharm). The siRNA sequence was described in the previous paper (Han et al., 2009): siGFP (sense, 5'-GUU CAG CGU GUC CGG CGA GT TdTdT-3 ' CAC GCU GAA CT TdTdT-3 '(SEQ ID NO: 4)) and siDGCR8 (sense, 5'-CAU CGG ACA AGA GUG UGA UdTdT-3' (SEQ ID NO: 5); antisense, 5'- AUC ACA CUC U UG UCC GAU GdTdT-3 '(SEQ ID NO: 6)).

After 3 days of siDGCR8 treatment, the cells were treated individually or simultaneously with 50 nM miR-29a mimic (GE Dharmacon) (SEQ ID NO: 1) or 50 nM miR-30c mimic (GE Dharmacon) And replaced with fresh serum-free medium daily. For fluorescence quantification, cells were washed with HBSS (Hanks' Balanced Salt Solution) on the 5th day of siRNA treatment, 10 ⁴ cells were suspended in 20 μl of HBSS, 100 μl of 10 μM H ₂ DCFDA was added , And cultured in a 37 ° C carbon dioxide incubator for 30 minutes. Fluorescence was measured at Ex / Em = 485 nm and 538 nm, and the results are shown in FIG.

As shown in FIG. 1, when the cell senescence phenomenon was abnormally induced by the knockdown (KD) of the DGCR8 gene, the concentration of the active oxygen in the cell, which was increased by a factor of 2, Were individually or concurrently treated and then decreased again to the control level. That is, it is suggested that miRNA-29a and / or miRNA-30c induce a decrease in active oxygen, which is a typical characteristic of the aging phenomenon.

Experimental Example  2. JC -1 Identification of normal function of mitochondria by dye dyeing

JC-1 dye (ThermoFischer Scientific, T-3168) was used in accordance with the manufacturer's description to confirm the function of mitochondria in DGCR8 depressed cells. 3 x 10 ⁴ cells were cultured in Ibidi plate (35 mm, ibitreated) (Ibidi) under complete medium. Three days after siDGCR treatment, 50 nM of miR-29a mimic or 50 nM of miR-30c mimic were treated or simultaneously treated with cells, respectively. Four days after the siDGCR8 treatment, cells were treated with 1 μM of Hoechst (ThermoFischer Scientific, 33342) and 10 μM of JC-1 dye was dissolved in Dimethyl sulfoxide (DMSO) for 10 minutes at 37 ° C. A fluorescence image was obtained using a confocal microscope, and the results are shown in Fig.

As shown in FIG. 2, when the cell aging phenomenon was abnormally caused by the decrease of DGCR8 expression, it was observed that the inner membrane of mitochondria controlling the concentration of active oxygen in the cell was polarized by the abnormal inflow of electrons and ions (green ). When the miR-29a mimic or miR-30c mimic was separately or co-treated with such aging cells, abnormal polarization was observed to disappear (red color). This indicates that miR-29a and / or miR-30c induce normalization of the mitochondrial inner membrane responsible for the degradation of reactive oxygen species upon cell senescence.

Experimental Example  3. miR -29a or miR -30c to determine cell growth rate and survival rate

To measure cell proliferation and survival, CellTiter 96® AQueousz One Solution Cell Proliferation Assay (Promega) was used. To summarize the assay, 3 × 10 ³ cells per well of a 96-well plate were dispensed at day zero. One day after treatment with siRNA, the cells were treated individually or simultaneously with 50 nM miR-29a mimic or 50 nM miR-30c mimic and replaced with fresh serum-free medium daily. Five days after treatment, cells were analyzed.

On the 5th day, 20 μl of CellTiter 96® AQueousz One Solution with MTS was added to each well and absorbance was measured at 490 nm using a multi-label plate reader (Perkin Elmer). Each analysis was repeated at least six times under each condition. The measurement results are shown in Fig.

As shown in FIG. 3, it was confirmed that the cell growth rate was reduced by about 10% according to the cell aging phenomenon. Treatment of aged cells with miR-29a revealed that the growth rate of cells was increased by 20% compared to the aged cells and by 10% compared to the control. In addition, miRNA-30c treatment of the aged cells revealed that the growth rate of the cells was increased to about 10%, that is, the control level, as compared with the aged cells. In particular, when miR-29a and miR-30c were simultaneously treated with aged cells, it was confirmed that the growth rate of the cells increased by 40% or more. This means that miR-29a and / or miR-30c induce a decrease in cell growth rate and recovery of survival rate due to the aging phenomenon.

Experimental Example  4. Confirmation of suppression of gene expression related to aging

Western blot analysis was used to identify changes in intracellular gene expression due to aging. After 3 days of siDGCR8 treatment, cells were individually or co-treated with 50 nM of miR-29a mimic or 50 nM of miR-30c mimic, and replaced with fresh serum-free medium daily. Cells were harvested and lysed in RIPA buffer (Biosesang, R2002) containing Halt ™ protease and Phosphatase Inhibitor Cocktail (ThermoFischer Scientific, 78441).

After 10 minutes of vortexing and incubation on ice for 30 minutes, cell debris was removed by centrifugation at 12,000 rpm for 20 minutes at 4 ° C. Proteins were separated using a 4% to 20% gradient gel (Biorad, 4561093) or 8% to 12% SDS-polyacrylamide gels. After electrophoresis, the proteins were transferred to a nitrocellulose membrane (GE Healthcare, 10600002) and incubated overnight at 4 ° C with the appropriate primary antibody. The following primary antibodies were used: DNMT3A Rabbit polyclonal antibody (Cell signaling, 2160, 1: 1000), H-Ras rabbit polyclonal antibody (Santa Cruz, sc-520, 1: 200), MEK1 / 2 (D1A5) rabbit monoclonal antibody (Cell Signaling, 8727, 1: 1000), p-ERK1 / 2 mouse monoclonal antibody (Cell Signaling, 9106, 1: 1000), SOD2 mouse monoclonal antibody (BD Biosciences, 611580, Anti-alpha-tubulin rabbit antibody (Sigma Aldrich, SAB3501071, 1: 5000), anti-alpha-tubulin mouse antibody (Sigma Aldrich, T9026, 1: 5000). Alpha-tubulin was used as a loading control.

The membranes were washed with 1X TBST for 30 minutes and the primary antibody was incubated with the secondary antibody containing the corresponding horseradish peroxidase at room temperature for 1 hour. The following secondary antibodies were used: anti-mouse IgG, HRP-linked antibody (Cell signaling, 7076, 1: 3000), anti-rabbit IgG, HRP- 3000). 5% BSA or 1X TBST skim milk powder was used as the antibody dilution buffer.

After washing 1 × TBST for 30 minutes, the blotted protein was visualized using Immobilon ™ Western ECL solution (Millipore, WBKLO500) and images were obtained using a chemiluminescence image analyzer (GE Healthcare, LAS-4000, Fujifilm). In addition, expression of the SOD2 gene was quantitated by individual treatment of miR-29a mimic or miR-30c mimic using real-time PCR assay. The results are shown in Figs. 4A and 4B, respectively.

As shown in Figs. 4A and 4B, it was observed that the expression level of the SOD2 gene, which functions as an active oxygen scavenger in the mitochondria, was remarkably increased in the experimental group in which miR-29a mimic or miR-30c mimic was separately or simultaneously treated While the expression level of DNMT3A was decreased compared with that of senescent cells. This indicates that the expression of DNMT3A is regulated by the treatment of miR-29a and / or miR-30c, and the expression of the SOD2 gene is regulated by DNMT3A in the senescent state. In addition, when the miR-29a mimic or miR-30c mimic was separately or co-treated with cells showing aging, it was observed that the expression of Ras gene, which induces abnormal aging or affects the progress of aging, is decreased. This indicates that miR-29a and / or miR-30c restore the changes in intracellular gene expression due to the aging phenomenon.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> COMPOSITION FOR INHIBITING SENESCENCE OF ADULT STEM CELLS          COMPRISING MICRORNADS AND CULTURE METHODS USING THE SAME <130> FPD / 201702-0029 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-29a-3p <400> 1 uagcaccauc ugaaaucggu ua 22 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-30c-5p <400> 2 uguaaacauc cuacacucuc agc 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for detecting siGFP, n = dT <400> 3 guucagcgug uccggcgagt tnn 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for detecting siGFP, n = dT <400> 4 cucgccggac acgcugaact tnn 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for detecting siDGCR8, n = dT <400> 5 caucggacaa gagugugaun n 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for detecting siDGCR8, n = dT <400> 6 aucacacucu uguccgaugn n 21

Claims (19)

miR-29a, and miR-30c as an active ingredient. The method according to claim 1,
Wherein the suppression of aging maintains the undifferentiated state of adult stem cells. The method according to claim 1,
Wherein the adult stem cells are mesenchymal stem cells. The method of claim 3,
Wherein the mesenchymal stem cells are derived from any one selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta. miR-29a and miR-30c as an active ingredient. miR-29a and miR-30c as an active ingredient. miR-29a and miR-30c in the presence of at least one miRNA selected from the group consisting of miR-29a and miR-30c. 8. The method of claim 7,
Wherein said adult stem cells are kept in an undifferentiated state. 8. The method of claim 7,
Wherein said culture is a continuous subculture. 8. The method of claim 7,
Wherein the treatment time of miR-29a in said culture is 4 hours to 6 hours. 8. The method of claim 7,
Wherein the treatment time of miR-30c in said culture is 4 hours to 6 hours. 8. The method of claim 7,
Wherein the mitochondrial function of said adult stem cells is maintained or improved. 8. The method of claim 7,
Wherein the concentration of miR-29a is 20 nM to 50 nM. 8. The method of claim 7,
Wherein the concentration of miR-30c is 20 nM to 50 nM. 8. The method of claim 7,
Wherein said adult stem cells are mesenchymal stem cells. 16. The method of claim 15,
Wherein the mesenchymal stem cells are derived from any one selected from the group consisting of umbilical cord, cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta. miR-29a and miR-30c are introduced into the cell. 18. The method of claim 17,
Wherein the cell therapeutic agent is a somatic cell therapeutic agent or a stem cell therapeutic agent. 19. The method of claim 18,
Wherein the stem cell therapeutic agent is an agent for treating an embryonic stem cell or an adult stem cell.

Images