KR102552776B1 - Composition for inhibiting melanoma metastasis comprising miRNA - Google Patents
Composition for inhibiting melanoma metastasis comprising miRNA Download PDFInfo
- Publication number
- KR102552776B1 KR102552776B1 KR1020150169426A KR20150169426A KR102552776B1 KR 102552776 B1 KR102552776 B1 KR 102552776B1 KR 1020150169426 A KR1020150169426 A KR 1020150169426A KR 20150169426 A KR20150169426 A KR 20150169426A KR 102552776 B1 KR102552776 B1 KR 102552776B1
- Authority
- KR
- South Korea
- Prior art keywords
- composition
- melanoma
- metastasis
- melanoma metastasis
- mir
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Liposomes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
본 명세서는 서열번호 1을 포함하는 8 내지 100 mer 길이의 RNA 핵산분자를 유효성분으로 포함하는 흑색종 전이 억제용 조성물에 관한 것으로, 상기 RNA 핵산분자는 서열번호 2의 서열을 포함할 수 있으며, 본 발명의 일 측면에 따른 조성물은 흑색종의 전이를 억제하거나 흑색종 전이유전자의 발현을 억제할 수 있고, 또한, 본 명세서는 시험물질에 대한 흑색종 전이 억제 물질을 스크리닝하는 방법 및 흑새종 전이 진단용 키트를 제공한다.The present specification relates to a composition for inhibiting melanoma metastasis comprising an RNA nucleic acid molecule having a length of 8 to 100 mer comprising SEQ ID NO: 1 as an active ingredient, wherein the RNA nucleic acid molecule may include the sequence of SEQ ID NO: 2, The composition according to one aspect of the present invention can inhibit melanoma metastasis or inhibit the expression of a melanoma transgene, and the present specification provides a method for screening a melanoma metastasis inhibitory substance for a test substance and melanoma metastasis Diagnostic kits are provided.
Description
본 명세서는 흑색종 전이 억제용 조성물; 흑색종 전이 억제 물질을 스크리닝하는 방법; 및 흑색종 전이 진단용 키트 또는 조성물;에 관한 것이다.The present specification is a composition for inhibiting melanoma metastasis; a method for screening a substance that inhibits melanoma metastasis; and a kit or composition for diagnosing melanoma metastasis.
miRNA는 발달 시기, 세포사멸사, 지방 신진대사 및 조혈 세포 분화의 조절을 포함하는 여러 생물학적 과정에서 매우 중요한 역할을 하는 것으로 알려짐에 따라 생명과학분야에서 매우 큰 관심을 받고 있다. miRNAs are of great interest in the life sciences as they are known to play very important roles in several biological processes, including the regulation of developmental timing, apoptosis, fat metabolism and hematopoietic cell differentiation.
한편, 흑색종은 주로 피부 표피의 기저층에 있는 멜라닌 세포가 악성화된 피부암으로 멜라닌 세포가 존재하는 곳 어디든 발생할 수 있는 암이다. 흑색종은 피부암으로 인한 사망의 65%를 차지하고 있는 치명적인 질환으로 전이가 쉽게 발생하며 전이가 이루어지면 5년 생존율이 5%이하로 떨어지는 예후가 좋지 않은 악성 종양으로 알려져 있다. 지난 30년간 전세계적으로 흑색종의 발생률이 점점 증가하고 있으며 특히, 호주 미국과 같은 백인에게서 발생률이 더 높게 나타난다. 우리나라 역시 중앙 암본부에 의해 발표된 자료에 따르면 흑색종은 전체 암 발병 중 0.2%를 차지하지만 점점 발병률이 증가 하고 있는 추세라고 발표되었다. 대부분의 흑색종은 간, 뼈, 뇌로 전이가 되고 피부, 피하조직, 림프절 등이 전이의 원발 부위로 알려져 있다. 전이는 암세포가 다른 조직 또는 기관의 상피세포에 영향을 미쳐 암세포를 이동시키는 단계로 전이된 암은 성장과 분화를 조절하면서 주변조직에 발암을 유도한다. 암세포는 원발 부위에서 분리되어 혈관 속으로 이동하는 침윤과정과 혈관을 통해 다른 부위로 이동하여 혈관 밖으로 빠져 나오는 과정을 통해 신체의 다른 먼 부위로 전이 된다. 발암과정에서 악성화된 멜라닌 세포는 세포간의 단단한 결합력을 느슨하게 바꿔 세포간의 부착력을 약화시키고, 세포의 이동성을 향상시켜 종양세포의 전이를 촉진시킨다. On the other hand, melanoma is a skin cancer in which melanocytes mainly in the basal layer of the skin epidermis are malignant, and can occur anywhere melanocytes exist. Melanoma is a fatal disease that accounts for 65% of deaths due to skin cancer, and metastasis occurs easily. When metastasis occurs, it is known as a malignant tumor with a poor prognosis with a 5-year survival rate of less than 5%. Over the past 30 years, the incidence of melanoma has been increasing worldwide, especially in Caucasians such as Australia and the United States. According to data announced by the Central Cancer Center in Korea, melanoma accounts for 0.2% of all cancers, but the incidence is gradually increasing. Most melanomas metastasize to the liver, bone, and brain, and the skin, subcutaneous tissue, and lymph nodes are known to be primary sites of metastasis. Metastasis is a stage in which cancer cells move by affecting epithelial cells of other tissues or organs, and metastasized cancer induces carcinogenesis in surrounding tissues while regulating growth and differentiation. Cancer cells are separated from the primary site and metastasize to other distant parts of the body through an infiltration process in which they move into blood vessels and a process in which they migrate to other parts of the body through blood vessels and escape out of the blood vessels. In the process of carcinogenesis, malignant melanocytes loosen the tight coupling between cells, weaken the adhesion between cells, and promote the metastasis of tumor cells by improving cell mobility.
암의 전이 및 전이에 영향을 미치는 유전자를 억제하기 위한 연구가 활발히 진행되고 있으며, 특히 21개 내외의 짧은 염기서열을 가진 상기의 miRNA를 이용하여 암 전이에 영향을 미치는 표적 mRNA의 3?비번역부위 (untranslated region, UTR)의 상보적인 염기서열에 결합하여 mRNA를 분해시키거나 해독 억제를 통해 발현을 조절하는 연구가 진행되고 있다. Studies to suppress cancer metastasis and genes that affect metastasis are being actively conducted. In particular, 3? Research is being conducted to regulate expression by degrading mRNA or inhibiting translation by binding to a complementary nucleotide sequence of an untranslated region (UTR).
그러나 흑색종의 전이와 관련하여 miRNA를 이용한 흑색종 전이를 억제하는 연구는 부족하며, 특히 흑색종 세포의 전이와 관련하여 miR-944의 기능은 아직 밝혀지지 않았으며 이에 대한 연구가 필요한 실정이다.However, studies on suppressing melanoma metastasis using miRNA are lacking, and in particular, the function of miR-944 in relation to melanoma cell metastasis has not yet been elucidated, and further research is needed.
본 발명의 일 측면은 흑색종 전이 억제하기 위한 핵산분자를 유효성분으로 포함하는 조성물을 제공하고자 한다.One aspect of the present invention is to provide a composition comprising a nucleic acid molecule for inhibiting melanoma metastasis as an active ingredient.
본 발명의 다른 측면은 흑색종 전이 억제 물질을 스크리닝하는 방법을 제공하고자 한다.Another aspect of the present invention is to provide a method for screening melanoma metastasis inhibitors.
본 발명의 또 다른 측면은 흑색종 전이 진단용 키트를 제공하고자 한다.Another aspect of the present invention is to provide a kit for diagnosing melanoma metastasis.
본 발명의 일측면은, 서열번호 1을 코어서열로 포함하는 8 내지 100 mer 길이의 RNA 핵산분자를 유효성분으로 포함하는 흑색종 전이 억제용 조성물을 제공한다. One aspect of the present invention provides a composition for inhibiting melanoma metastasis comprising, as an active ingredient, an RNA nucleic acid molecule having a length of 8 to 100 mer comprising SEQ ID NO: 1 as a core sequence.
본 발명의 일측면에서, 상기 RNA 핵산분자는 서열번호 4의 서열 또는 그 단편으로서, 상기 단편은 서열번호 1의 코어서열을 포함하는, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is a sequence of SEQ ID NO: 4 or a fragment thereof, wherein the fragment includes a core sequence of SEQ ID NO: 1, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 RNA 핵산분자는 15 mer 이상인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is 15 mer or more, provides a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 RNA 핵산분자는 18 내지 23 mer 길이의 miRNA 핵산분자인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is a miRNA nucleic acid molecule having a length of 18 to 23 mer, and a composition for inhibiting melanoma metastasis is provided.
본 발명의 일측면에서, 상기 RNA 핵산분자는 상기 서열번호 1을 코어서열로 포함하는 서열번호 2의 서열인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is a sequence of SEQ ID NO: 2 including SEQ ID NO: 1 as a core sequence, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 RNA 핵산분자는 이중가닥이며, 서열번호 1의 서열에 혼성화 가능한 서열을 더 포함하는, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is double-stranded, and further comprises a sequence capable of hybridizing to the sequence of SEQ ID NO: 1, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 혼성화 가능한 서열은 서열번호 3인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the hybridizable sequence is SEQ ID NO: 3, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 RNA 핵산분자는 50 내지 100 mer 길이의 헤어핀 구조인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule has a hairpin structure of 50 to 100 mer in length, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 헤어핀 구조의 RNA 핵산분자는 서열번호 4인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule of the hairpin structure is SEQ ID NO: 4, provides a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 RNA 핵산분자는 리포좀(liposome)에 포집 또는 백터(vector)에 삽입된 형태로 포함된, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is included in the form of being captured in a liposome or inserted into a vector, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 RNA 핵산분자는 상기 리포좀에 대하여 농도가 1 내지 200uM인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the concentration of the RNA nucleic acid molecule relative to the liposome is 1 to 200uM, providing a composition for inhibiting melanoma metastasis.
본 발명의 일측면에서, 상기 조성물은 주사제인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the composition provides an injection, a composition for inhibiting melanoma metastasis.
본 발명의 다른 측면은, 흑색종 전이 억제 물질을 스크리닝하는 방법으로서, (a)흑색종 세포를 준비하는 단계; (b)상기 세포에 시험 물질을 처리하는 단계; 및(c)상기 시험물질이 흑색종 세포에서 miR-944의 생성을 유도하는지 또는 활성을 촉진시키는지 여부를 확인하는 단계;를 포함하는 것을 특징으로 하는 흑색종 전이 억제 물질의 스크리닝 방법을 제공한다.Another aspect of the present invention is a method for screening melanoma metastasis inhibitory substances, comprising the steps of (a) preparing melanoma cells; (b) treating the cells with a test substance; and (c) determining whether the test substance induces the production of miR-944 in melanoma cells or promotes its activity. .
본 발명의 또 다른 측면은 miR-944 검출시약을 포함하는 흑색종 전이 진단용 조성물을 제공한다.Another aspect of the present invention provides a composition for diagnosing melanoma metastasis comprising a reagent for detecting miR-944.
본 발명의 또 다른 측면은 miR-944 검출시약을 포함하는 흑색종 전이 진단용 키트를 제공한다.Another aspect of the present invention provides a kit for diagnosing melanoma metastasis comprising a reagent for detecting miR-944.
본 발명의 또 다른 측면에서, 상기 키트는 흑색종 세포의 RNA 추출 시약, 추출된 RNA를 cDNA로 역전사 하기 위한 역전사 효소, 및 역전사된 cDNA 중 miRNA-944를 증폭하기 위한 miRNA-944 프라이머를 포함하는 흑색종 전이 진단용 키트를 제공한다.In another aspect of the present invention, the kit comprises a reagent for extracting RNA from melanoma cells, a reverse transcriptase for reverse transcribing the extracted RNA into cDNA, and a miRNA-944 primer for amplifying miRNA-944 in the reverse transcribed cDNA. A kit for diagnosing melanoma metastasis is provided.
본 발명의 일측면은 서열번호 1을 코어서열로 포함하는 8 내지 100 mer 길이의 RNA 핵산분자를 제공한다.One aspect of the present invention provides an RNA nucleic acid molecule having a length of 8 to 100 mer comprising SEQ ID NO: 1 as a core sequence.
본 발명의 일측면은 서열번호 1을 코어서열로 포함하는 서열번호 2의 서열인, RNA 핵산분자를 제공한다.One aspect of the present invention provides a sequence of SEQ ID NO: 2 comprising SEQ ID NO: 1 as a core sequence, an RNA nucleic acid molecule.
본 발명의 일측면은 상기 RNA 핵산분자는 서열번호 1의 서열에 혼성화 가능한 서열을 더 포함하는 RNA 핵산분자를 제공한다.One aspect of the present invention provides an RNA nucleic acid molecule further comprising a sequence capable of hybridizing to the sequence of SEQ ID NO: 1.
본 발명의 일측면은 50 내지 100 mer 길이의 헤어핀 구조인 RNA 핵산분자를 제공한다.One aspect of the present invention provides an RNA nucleic acid molecule having a hairpin structure of 50 to 100 mer in length.
본 발명의 일측면은 상기 RNA 핵산분자는 리포좀(liposome)에 포집 또는 백터에 삽입된 형태로 포함되는, 흑색종 전이 억제용 조성물을 제공한다.One aspect of the present invention provides a composition for inhibiting melanoma metastasis, wherein the RNA nucleic acid molecule is included in the form of being captured in a liposome or inserted into a vector.
본 발명의 일측면에 따른 조성물은 흑색종의 전이를 억제하는 효과를 가진다.The composition according to one aspect of the present invention has an effect of inhibiting the metastasis of melanoma.
본 발명에 일측면에 따른 조성물은 흑생족 전이 유전자의 발현을 억제하는 효과를 가진다.The composition according to one aspect of the present invention has an effect of inhibiting the expression of the transgene of the black gene.
본 발명의 다른 측면에 따른 방법은 흑색종 전이를 억제하는 물질의 스크리닝 방법으로 시험물질이 흑색종 전이 또는 흑색종 전이 유전자의 발현의 촉진제인지 억제제인지를 빠르고 간단하게 판정할 수 있다는 효과를 제공할 수 있다.The method according to another aspect of the present invention is a screening method for a substance that inhibits melanoma metastasis, and provides an effect of quickly and simply determining whether a test substance is an promoter or inhibitor of melanoma metastasis or the expression of a melanoma metastasis gene. can
본 발명의 또 다른 측면에 따른 흑색종 전이 진단용 키트 또는 조성물은 해당 흑색종이 전이성이 강한 세포인지 아닌지를 빠르고 간단하게 판정할 수 있다는 효과를 제공할 수 있다.A kit or composition for diagnosing melanoma metastasis according to another aspect of the present invention can provide an effect of quickly and simply determining whether or not the melanoma is a cell with strong metastatic properties.
도 1은 본 발명의 일측면에 따른 서열번호 4를 포함하는 핵산분자로, miR-944의 성숙한 서열을 생성하기 전의 전구체 서열이며, 헤어핀 구조를 가진다.
도 2는 본 명세서의 실험예 1에 따른 3가지 흑색종 세포주의 wound healing assay에서의 이동성을 나타낸 사진과 그래프이다.
도 3은 본 명세서의 실험예 1에 따른 3가지 흑색종 세포주의 miR-944 발현량을 도시화한 그래프이다.
도 4는 본 명세서의 실험예 2에서, 대조군과 miR-944(mimic)을 형집도입한 흑색종 세포주에서의 wound healing assay에서 이동성을 나타낸 사진과 그래프이다.
도 5는 본 명세서의 실험예 2에서, 대조군과 miR-944(mimic)을 형집도입한 흑색종 세포주에서의 invasion assay에서 전이성을 나타낸 사진과 그래프이다.Figure 1 is a nucleic acid molecule including SEQ ID NO: 4 according to one aspect of the present invention, a precursor sequence before generating the mature sequence of miR-944, and has a hairpin structure.
Figure 2 is a photograph and a graph showing the mobility in the wound healing assay of three melanoma cell lines according to Experimental Example 1 of the present specification.
Figure 3 is a graph showing the miR-944 expression level of three melanoma cell lines according to Experimental Example 1 of the present specification.
Figure 4 is a photograph and a graph showing the mobility in the wound healing assay in melanoma cell lines transfected with control and miR-944 (mimic) in Experimental Example 2 of the present specification.
Figure 5 is a photograph and a graph showing metastasis in the invasion assay in melanoma cell lines transduced with control and miR-944 (mimic) in Experimental Example 2 of the present specification.
이하, 본 발명을 상세하게 설명한다.Hereinafter, the present invention will be described in detail.
암세포의 전이는 세포간 결합과 관련된 twist, snail 등의 유전자들에 의해 유도된다. twist는 전사인자로 세포에서 snail 유전자의 발현을 유도하며 twist에 의해 유도된 snail은 세포와 세포의 결합에 직접적으로 영향을 미치는 E-cadherin 단백질의 발현을 억제하여 세포의 전이를 촉진하는 역할을 하고 있다. 다른 전이관련 유전자로는 세포 막에 있는 세포 외 기질들을 분해하여 전이를 촉진하는 matrix-metalloproteinase (MMP)가 알려져 있다. 이 중 MMP2와 MMP9은 흑색종 조직의 E-cadherin 같은 세포 외 기질을 직접적으로 분해함으로써 침윤과 이동을 용이하게 하는 효소로 알려져 있다. Metastasis of cancer cells is induced by genes such as twist and snail related to intercellular coupling. Twist is a transcription factor that induces the expression of the snail gene in cells, and the snail induced by twist inhibits the expression of E-cadherin protein, which directly affects cell-to-cell bonding, and promotes cell metastasis. there is. Another metastasis-related gene is matrix-metalloproteinase (MMP), which promotes metastasis by degrading extracellular matrix in cell membranes. Among them, MMP2 and MMP9 are known as enzymes that facilitate invasion and migration by directly degrading extracellular matrix such as E-cadherin in melanoma tissue.
microRNA(miRNA)는 21-22개의 짧은 염기서열을 가진 non-coding RNA로 전사 후 억제를 통해 유전자를 조절하여 세포의 성장, 발생, 생장, 분화, 사멸 등에 영향을 미친다. miRNA 유전자는 핵 내에서 RNA Pol Ⅱ 또는 Pol Ⅲ에 의해 pri-miRNA로 전사된다. Pri-miRNA는 mRNA처럼 5' 말단에 capping과 3' 말단에 poly-A tail 구조를 가지고 있다. 이 후에 핵 내에서 세포질로 precursor miRNA 형태로 방출되고, RnaseⅢ endonuclease (Dicer)에 의해 small hairpin 구조의 precursor miRNA가 절단된 성숙한 형태의 miRNA duplex로 만들어진다. Mature 형태의 miRNA는 표적 mRNA의 3'비번역부위 (untranslated region, UTR)의 상보적인 염기서열에 결합하여 mRNA를 분해시키거나 해독 억제를 통해 발현을 조절한다. 이렇게 생성된 miRNA는 여러 암세포에서 암유전자 또는 암 억제 유전자로써 기능을 발휘한다. 특히, 암의 전이 과정에도 직접 관여하여 전이 관련 유전자들의 발현을 조절한다. 이 중에서 miR-205, miR-182, miR-27a, miR-126, miR-141, miR-373, miR-183, miR-145, miR-17, miR-92a 등이 흑색종에서 전이가 진행됨에 따라 발현이 증가하는 miRNA로 알려져 있다. 이와 같이, 암세포의 전이와 관련한 세포 이동성에 영향을 미치는 miRNA 연구가 있다.microRNA (miRNA) is a non-coding RNA with a short sequence of 21-22 nucleotides, which regulates genes through post-transcriptional suppression and affects the growth, development, growth, differentiation, and death of cells. miRNA genes are transcribed into pri-miRNA by RNA Pol II or Pol III in the nucleus. Pri-miRNA has a capping at the 5' end and a poly-A tail structure at the 3' end like mRNA. After this, it is released from the nucleus into the cytoplasm in the form of precursor miRNA, and the precursor miRNA in the small hairpin structure is cleaved by RnaseIII endonuclease (Dicer) to form a mature miRNA duplex. Mature miRNA binds to the complementary nucleotide sequence of the 3' untranslated region (UTR) of the target mRNA and regulates expression by degrading the mRNA or inhibiting translation. The miRNAs produced in this way function as oncogenes or cancer suppressor genes in various cancer cells. In particular, it is directly involved in the metastasis process of cancer and regulates the expression of metastasis-related genes. Among them, miR-205, miR-182, miR-27a, miR-126, miR-141, miR-373, miR-183, miR-145, miR-17, and miR-92a have been shown to metastasize from melanoma. It is known as a miRNA whose expression increases accordingly. As such, there is a miRNA study that affects cell mobility related to metastasis of cancer cells.
miR-944는 TP63유전자(Genbank의 accession number는 NM_001114978 이다)의 intron에 존재하는 introgenic miRNA이다. 인간을 포함한 침팬지와 원숭이 등 영장류에서만 발견이 되는 miRNA이다. mir-944의 stem loop sequence에 해당하는 miRBase의 accession number는 MI0005769(서열번호 4에 해당)이며, mature sequence에 해당하는 miRBase의 accession number는 MIMAT0004987(서열번호 2에 해당)이다.miR-944 is an introgenic miRNA present in the intron of the TP63 gene (Genbank's accession number is NM_001114978). It is a miRNA found only in primates such as humans, chimpanzees, and monkeys. The accession number of miRBase corresponding to the stem loop sequence of mir-944 is MI0005769 (corresponding to SEQ ID NO: 4), and the accession number of miRBase corresponding to the mature sequence is MIMAT0004987 (corresponding to SEQ ID NO: 2).
miR-944는 상기와 같이 알려진 miRNA지만 아직 흑색종 세포에서 miR-944의 정확한 기능에 대하여 알려진 바는 부족하다.Although miR-944 is a miRNA known as described above, the exact function of miR-944 in melanoma cells is not known yet.
miRNA는 세포 내에 존재하는 작은 RNA(endogenous small RNA)의 일종으로 단백질을 합성하지 않는 DNA에서 유래되어 헤어핀-구조 전사체(hairpin-shaped transcript)로부터 생성이 된다. miRNA는 표적 mRNA의 3'-UTR의 상보적 서열(sequence)에 결합하여 그 mRNA의 번역 억제 또는 불안정화를 유도하여, 궁극적으로 그 표적 mRNA의 단백질 합성을 억제하는 리프레서(repressor) 역할을 하게 된다. 하나의 miRNA는 여러 개의 mRNA를 타겟팅하며, mRNA 역시 여러 개의 miRNA에 의해 조절될 수 있다고 알려져 있다.miRNA is a type of endogenous small RNA present in cells and is derived from DNA that does not synthesize proteins and is generated from hairpin-shaped transcripts. miRNA binds to the complementary sequence of the 3'-UTR of the target mRNA, induces translational inhibition or destabilization of the mRNA, and ultimately acts as a repressor to suppress protein synthesis of the target mRNA. . It is known that one miRNA targets multiple mRNAs, and mRNAs can also be regulated by multiple miRNAs.
본 발명의 일측면은 상기와 같은 miRNA 중 miR-944에 관한 것으로서, 코어 시퀀스인 서열번호 1의 서열을 포함하는 8 내지 100 mer 길이의 RNA 핵산분자를 유효성분으로 포함하는 흑색종 전이 억제용 조성물을 제공한다. One aspect of the present invention relates to miR-944 among the above miRNAs, a composition for inhibiting melanoma metastasis comprising, as an active ingredient, an RNA nucleic acid molecule of 8 to 100 mer length including the sequence of SEQ ID NO: 1 as a core sequence provides
서열번호 1(핵심 서열) : aauuauugSEQ ID NO: 1 (core sequence): aauuauug
상기 코어 시퀀스인 서열번호 1을 포함하는 RNA 핵산분자는 바람직하게 서열번호 2의 mature sequence의 miR-944 또는 서열번호 4의 stem loop sequence의 miR-944일 수 있다.The RNA nucleic acid molecule containing SEQ ID NO: 1 as the core sequence may preferably be miR-944 of the mature sequence of SEQ ID NO: 2 or miR-944 of the stem loop sequence of SEQ ID NO: 4.
본 발명의 일측면에서, 상기 RNA 핵산분자는 8 mer 이상, 15 mer 이상, 20 mer 이상, 21 mer 이상, 22 mer 이상, 25 mer 이상, 30 mer 이상 또는 50 mer 이상일 수 있다. In one aspect of the present invention, the RNA nucleic acid molecule may be 8 mer or more, 15 mer or more, 20 mer or more, 21 mer or more, 22 mer or more, 25 mer or more, 30 mer or more, or 50 mer or more.
또한, 상기 RNA 핵산분자는 100 mer 이하, 90 mer 이하, 89 mer 이하, 88 mer 이하, 87 mer 이하, 85mer 이하, 80 mer 이하, 70 mer 이하, 60 mer 이하, 50 mer 이하, 30 mer 이하, 25 mer 이하, 24 mer 이하 또는 23 mer 이하일 수 있다.In addition, the RNA nucleic acid molecule is 100 mer or less, 90 mer or less, 89 mer or less, 88 mer or less, 87 mer or less, 85 mer or less, 80 mer or less, 70 mer or less, 60 mer or less, 50 mer or less, 30 mer or less, 25 mer or less, 24 mer or less, or 23 mer or less.
RNA 핵산분자의 길이가 상기 범위 내일 때, miRNA 로서 흑색종 전이 억제효과가 우수하다. When the length of the RNA nucleic acid molecule is within the above range, the effect of inhibiting melanoma metastasis is excellent as miRNA.
본 발명의 일측면에서, 상기 RNA 핵산분자는 서열번호 4의 서열 또는 그 단편으로서, 상기 단편은 서열번호 1의 코어서열을 포함하는, 흑색종 전이 억제용 조성물을 제공한다. In one aspect of the present invention, the RNA nucleic acid molecule is a sequence of SEQ ID NO: 4 or a fragment thereof, wherein the fragment includes a core sequence of SEQ ID NO: 1, providing a composition for inhibiting melanoma metastasis.
5'- GUUCCAGACACAUCUCAUCUGAUAUACAAUAUUUUCUUAAAUUGUAUAAAGAGAAAUUAUUGUACAUCGGAUGAGCUGUGUCUGGGAU -3' (서열번호 4)5′- GUUCCAGACACAUCUCAUCUGAUAUACAAUAUUUCUUAAAUUGUAUAAAGAGAAAUUAUUGUACAUCGGAUGAGCUGUGUCUGGGAU-3′ (SEQ ID NO: 4)
본 발명의 일측면에서, 상기 RNA 핵산분자는 상기 서열번호 1을 코어서열로 포함하는 서열번호 2의 서열인, 흑색종 전이 억제용 조성물을 제공한다In one aspect of the present invention, the RNA nucleic acid molecule is a sequence of SEQ ID NO: 2 including SEQ ID NO: 1 as a core sequence, providing a composition for inhibiting melanoma metastasis
5'- aaauuauuguacaucggaugag -3' (서열번호 2) 5'-aaauuauuguacaucggaugag-3' (SEQ ID NO: 2)
본 발명의 일측면에서, 상기 RNA 핵산분자는 이중가닥이며, 서열번호 1의 서열에 혼성화 가능한 서열을 더 포함하는, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is double-stranded, and further comprises a sequence capable of hybridizing to the sequence of SEQ ID NO: 1, providing a composition for inhibiting melanoma metastasis.
구체적으로 상기 혼성화 가능한 서열은 서열번호 3인, 흑색종 전이 억제용 조성물을 제공한다.Specifically, the hybridizable sequence is SEQ ID NO: 3, and provides a composition for inhibiting melanoma metastasis.
5'- aaauuauuguacaucggaugag -3' (서열번호 2)5'-aaauuauuguacaucggaugag-3' (SEQ ID NO: 2)
5'- cucauccgauguacaauaauuu -3' (서열번호 3)5'- cucauccgauguacaauaauuu -3' (SEQ ID NO: 3)
본 발명의 일측면에서, 상기 RNA 핵산분자는 서열번호 2 및 서열번호 3의 서열을 포함하고, 상기 서열번호 2 및 서열번호 3은 서로 상보적으로 혼성화된, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule comprises the sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and the SEQ ID NO: 2 and SEQ ID NO: 3 are complementarily hybridized to each other, providing a composition for inhibiting melanoma metastasis .
상기 본 발명의 일측면에 따른 RNA 핵산분자는 흑색종의 전이를 억제하거나 흑색종 전이유전자의 발현을 조절할 수 있다. 따라서, 본 발명의 일측면에 따른 RNA 핵산분자의 단편 또는 변이체를 세포 내로 주입하면 상기 miRNA-944의 과발현 현상을 유발할 수 있다.The RNA nucleic acid molecule according to one aspect of the present invention can inhibit metastasis of melanoma or regulate the expression of a melanoma metastasis gene. Therefore, when a fragment or variant of an RNA nucleic acid molecule according to one aspect of the present invention is injected into a cell, the overexpression of miRNA-944 may be induced.
따라서, 본 발명의 일측면에 따른 서열번호 1을 코어서열로 포함하는 8 내지 100 mer 길이의 RNA 핵산분자는 흑색종의 전이를 억제하거나 흑색종 전이유전자의 발현을 조절할 수 있다.Therefore, the 8 to 100 mer RNA nucleic acid molecule comprising SEQ ID NO: 1 as a core sequence according to one aspect of the present invention can inhibit melanoma metastasis or regulate the expression of a melanoma metastasis gene.
본 발명의 일측면에서, 상기 RNA 핵산분자는 헤어핀 구조로 존재하는, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the RNA nucleic acid molecule is present in a hairpin structure, providing a composition for inhibiting melanoma metastasis.
상기 헤어핀 구조는 서열번호 2의 성숙한 서열을 최종적으로 생성하기 전에 만들어지는 전구체 서열일 수 있으며, 하기 서열번호 4의 서열일 수 있으나, 본 발명의 헤어핀 구조가 서열번호 4의 서열로 제한되는 것은 아니다.The hairpin structure may be a precursor sequence made before the final generation of the mature sequence of SEQ ID NO: 2, or may be the sequence of SEQ ID NO: 4 below, but the hairpin structure of the present invention is not limited to the sequence of SEQ ID NO: 4. .
5'- GUUCCAGACACAUCUCAUCUGAUAUACAAUAUUUUCUUAAAUUGUAUAAAGAGAAAUUAUUGUACAUCGGAUGAGCUGUGUCUGGGAU -3' (서열번호 4)5′- GUUCCAGACACAUCUCAUCUGAUAUACAAUAUUUCUUAAAUUGUAUAAAGAGAAAUUAUUGUACAUCGGAUGAGCUGUGUCUGGGAU-3′ (SEQ ID NO: 4)
상기 서열번호 4는 도 1의 헤어핀 구조일 수 있으며, 핵심 서열인 서열번호 1 및 이를 포함하는 서열번호 2을 포함하므로, 서열번호 4의 miRNA 핵산분자를 포함하는 조성물은 흑색종 전이 억제용 조성물일 수 있다.The SEQ ID NO: 4 may be the hairpin structure of FIG. 1, and since it includes the core sequence SEQ ID NO: 1 and SEQ ID NO: 2 including the same, the composition containing the miRNA nucleic acid molecule of SEQ ID NO: 4 is a composition for inhibiting melanoma metastasis can
그러므로, 본 발명의 일측면에 따른 조성물은 흑색종 전이 억제효과 등을 제공할 수 있다.Therefore, the composition according to one aspect of the present invention can provide melanoma metastasis inhibitory effect and the like.
또한, 본 발명의 일측면으로, 상기 RNA 핵산분자는 리포좀(liposome)에 포집또는 백터에 삽입된 형태로 포함된, 흑색종 전이 억제용 조성물을 제공할 수 있다.In addition, as one aspect of the present invention, the RNA nucleic acid molecule can provide a composition for inhibiting melanoma metastasis, which is included in the form of being captured in a liposome or inserted into a vector.
본 발명의 일측면에 있어서, 상기 RNA 핵산분자는 상기 리포좀에 대하여 농도가 1 내지 200uM 인, 흑색종 전이 억제용 조성물을 제공한다.In one aspect of the present invention, the concentration of the RNA nucleic acid molecule relative to the liposome is 1 to 200uM, providing a composition for inhibiting melanoma metastasis.
상기 RNA 핵산분자는 상기 리포좀에 대하여 농도가 1 uM 이상, 2 uM 이상, 3 uM 이상, 5 uM 이상, 7 uM 이상, 9 uM 이상, 11 uM 이상, 15 uM 이상, 16 uM 이상, 17 uM 이상, 18 uM 이상, 19 uM 이상, 20 uM 이상, 21 uM 이상, 22 uM 이상, 23 uM 이상, 24 uM 이상, 25 uM 이상 또는 50 uM 이상일 수 있다.The RNA nucleic acid molecule has a concentration relative to the liposome of 1 uM or more, 2 uM or more, 3 uM or more, 5 uM or more, 7 uM or more, 9 uM or more, 11 uM or more, 15 uM or more, 16 uM or more, or 17 uM or more. , 18 uM or more, 19 uM or more, 20 uM or more, 21 uM or more, 22 uM or more, 23 uM or more, 24 uM or more, 25 uM or more, or 50 uM or more.
또한, 상기 RNA 핵산분자는 상기 리포좀에 대하여 농도가 200 uM 이하, 190 uM 이하, 180 uM 이하, 170 uM 이하, 150 uM 이하, 130 uM 이하, 100 uM 이하, 80 uM 이하, 50 uM 이하, 40 uM 이하, 30 uM 이하, 29 uM 이하, 28 uM 이하, 27 uM 이하, 26 uM 이하, 25 uM 이하, 24 uM 이하, 23 uM 이하, 22 uM 이하, 21 uM 이하 또는 20 uM 이하일 수 있다.In addition, the RNA nucleic acid molecule has a concentration relative to the liposome of 200 uM or less, 190 uM or less, 180 uM or less, 170 uM or less, 150 uM or less, 130 uM or less, 100 uM or less, 80 uM or less, 50 uM or less, 40 uM or less, 30 uM or less, 29 uM or less, 28 uM or less, 27 uM or less, 26 uM or less, 25 uM or less, 24 uM or less, 23 uM or less, 22 uM or less, 21 uM or less, or 20 uM or less.
상기 RNA 핵산분자의 농도가 상기 범위 내 일 때, 흑색종 전이 억제 효과가 우수하다. When the concentration of the RNA nucleic acid molecule is within the above range, the melanoma metastasis inhibitory effect is excellent.
또한, 본 발명의 일측면으로, 상기 조성물은 본 발명의 일측면 따른 핵산분자를 포함하는 리포좀을 조성물 총 중량에 대하여 0.00001~30.0 중량%의 양으로 포함할 수 있다.In addition, as one aspect of the present invention, the composition may include liposomes containing the nucleic acid molecule according to one aspect of the present invention in an amount of 0.00001 to 30.0% by weight based on the total weight of the composition.
본 발명의 다른 일측면에 따른 피부 외용제 조성물은 화장품 조성물 또는 약학 조성물을 포함한다.A composition for external application for skin according to another aspect of the present invention includes a cosmetic composition or a pharmaceutical composition.
상기 화장품 조성물은 국소 적용에 적합한 모든 제형으로 제공될 수 있다. 예를 들면, 용액, 수상에 유상을 분산시켜 얻은 에멀젼, 유상에 수상을 분산시켜 얻은 에멀젼, 현탁액, 고체, 겔, 분말, 페이스트, 포말(foam) 또는 에어로졸 조성물의 제형으로 제공될 수 있다. 이러한 제형의 조성물은 당해 분야의 통상적인 방법에 따라 제조될 수 있다.The cosmetic composition may be provided in any formulation suitable for topical application. For example, it may be provided in the form of a solution, an emulsion obtained by dispersing an oil phase in an aqueous phase, an emulsion obtained by dispersing an aqueous phase in an oil phase, a suspension, a solid, a gel, a powder, a paste, a foam, or an aerosol composition. Compositions of such formulations may be prepared according to conventional methods in the art.
상기 화장품 조성물은 상기한 물질 이외에 주 효과를 손상시키지 않는 범위 내에서, 바람직하게는 주 효과에 상승 효과를 줄 수 있는 다른 성분들을 함유할 수 있다. 본 발명에 따른 화장품 조성물은 비타민, 고분자 펩티드, 고분자 다당 및 스핑고 지질로 이루어진 군에서 선택된 물질을 포함할 수 있다. 또한 본 발명에 따른 화장품 조성물은 보습제, 에몰리언트제, 계면 활성제, 자외선 흡수제, 방부제, 살균제, 산화 방지제, pH 조정제, 유기 및무기 안료, 향료, 냉감제 또는 제한(制汗)제를 포함할 수 있다. 상기 성분의 배합량은 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 당업자가 용이하게 선정 가능하며, 그 배합량은 조성물 전체 중량을 기준으로0.01~5 중량%, 구체적으로 0.01~3 중량%일 수 있다.In addition to the above substances, the cosmetic composition may contain other ingredients that can give a synergistic effect to the main effect, preferably within a range that does not impair the main effect. The cosmetic composition according to the present invention may contain a substance selected from the group consisting of vitamins, polymer peptides, polymer polysaccharides, and sphingolipids. In addition, the cosmetic composition according to the present invention may include a moisturizer, an emollient agent, a surfactant, a UV absorber, a preservative, a bactericide, an antioxidant, a pH adjuster, an organic and inorganic pigment, a fragrance, a cooling agent or an antiperspirant. . The blending amount of the components can be easily selected by those skilled in the art within a range that does not impair the objects and effects of the present invention, and the blending amount may be 0.01 to 5% by weight, specifically 0.01 to 3% by weight based on the total weight of the composition. there is.
또한, 본 발명은 일 실시예로서 본 발명의 일측면 따른 RNA 핵산분자를 포함하는 흑색종 전이 억제용 약학 조성물을 제공한다.In addition, the present invention, as an embodiment, provides a pharmaceutical composition for inhibiting melanoma metastasis comprising an RNA nucleic acid molecule according to one aspect of the present invention.
본 발명의 일측면에 있어서, 상기 조성물은 주사제인 흑색종 전이 억제용 조성물을 제공한다In one aspect of the present invention, the composition provides a composition for inhibiting melanoma metastasis, which is an injection.
상기 약학 조성물은 국소 적용에 적합한 모든 제형으로 제공될 수 있다. 예를 들면, 피부 외용 용액제, 현탁제, 유액제, 겔, 패취 또는 분무제일 수 있으나, 이에 제한되는 것은 아니다. 상기 제형은 당해 분야의 통상적인 방법에 따라 용이하게 제조될 수 있으며, 계면 활성제, 부형제, 수화제, 유화 촉진제, 현탁제, 삼투압 조절을 위한 염 또는 완충제, 착색제, 향신료, 안정화제, 방부제, 보존제 또는 기타 상용하는 보조제를 적당히 사용할 수 있다.The pharmaceutical composition may be provided in any dosage form suitable for topical application. For example, it may be an external skin solution, suspension, emulsion, gel, patch or spray, but is not limited thereto. The formulation can be easily prepared according to a conventional method in the art, and may include surfactants, excipients, wetting agents, emulsifying accelerators, suspending agents, salts or buffers for adjusting osmotic pressure, coloring agents, spices, stabilizers, preservatives, preservatives, or Other commercially available adjuvants can be suitably used.
본 발명의 일 실시예에 따른 약학 조성물의 유효 성분은 대상의 연령, 성별, 체중, 병리 상태 및 그 심각도, 투여 경로 또는 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 적용량 결정은 당업자의 수준 내에 있으며, 이의 1일 사용 용량은 예를 들어 0.1mg/kg/일 내지 5000mg/kg/일, 보다 구체적으로는 50 mg/kg/일 내지 500 mg/kg/일이 될 수 있으나, 이에 제한되는 것은 아니다.The active ingredient of the pharmaceutical composition according to an embodiment of the present invention will vary depending on the subject's age, sex, weight, pathological condition and its severity, administration route, or prescriber's judgment. Determination of the application amount based on these factors is within the level of those skilled in the art, and its daily use dose is, for example, 0.1 mg/kg/day to 5000 mg/kg/day, more specifically 50 mg/kg/day to 500 mg/kg. / can be, but is not limited to.
본 발명의 다른 측면은, 흑색종 전이 억제 물질을 스크리닝하는 방법으로서, (a)흑색종 세포를 준비하는 단계; (b)상기 세포에 시험 물질을 처리하는 단계; 및 (c)상기 시험물질이 흑색종 세포에서 miR-944의 생성을 유도하는지 또는 활성을 촉진시키는지 여부를 확인하는 단계;를 포함하는 것을 특징으로 하는 흑색종 전이 억제 물질의 스크리닝 방법 을 제공한다.Another aspect of the present invention is a method for screening melanoma metastasis inhibitory substances, comprising the steps of (a) preparing melanoma cells; (b) treating the cells with a test substance; and (c) determining whether the test substance induces the production or promotes the activity of miR-944 in melanoma cells. .
상기 (b) 단계에서 시험물질은 세포의 리포좀(liposome) 또는 백터(vector)에 트렌스펙션시킬 수 있다. 상기 트랜스펙션은 미세 주입법, 칼슘 포스페이트 공동-침전법, 전기 천공법 또는 리포좀 이용법 등을 이용하여 실시할 수 있으나, 이에 한정되는 것은 아니다.In step (b), the test substance may be transfected into a cell liposome or vector. The transfection may be performed using a microinjection method, a calcium phosphate co-precipitation method, an electroporation method, or a liposome method, but is not limited thereto.
또한, 상기 스크리닝은 시험 물질이 miR-944의 과발현 여부는 당업계에 널리 공지된 방법인 RNA assay를 이용하여 결정될 수 있다.In addition, in the screening, whether the test substance overexpresses miR-944 can be determined using RNA assay, a method well known in the art.
본 발명의 또 다른 측면은, miR-944 검출시약을 포함하는 흑색종 전이 진단용 조성물 또는 키트를 제공한다. 구체적으로 상기 키트는 흑색종 세포의 RNA 추출 시약, 추출된 RNA를 cDNA로 역전사 하기 위한 역전사 효소, 및 역전사된 cDNA 중 miRNA-944를 증폭하기 위한 miRNA-944 프라이머를 포함하는 흑색종 전이 진단용 키트일 수 있다.Another aspect of the present invention provides a composition or kit for diagnosing melanoma metastasis comprising a miR-944 detection reagent. Specifically, the kit is a kit for diagnosing melanoma metastasis, including a reagent for extracting RNA from melanoma cells, a reverse transcriptase for reverse transcribing the extracted RNA into cDNA, and a miRNA-944 primer for amplifying miRNA-944 in the reverse transcribed cDNA. can
이하, 실험예, 실시예 및 비교예를 들어 본 발명의 구성 및 효과를 보다 구체적으로 설명한다. 그러나 아래 실험예, 실시예 및 비교예는 본 발명에 대한 이해를 돕기 위해 예시의 목적으로만 제공된 것일 뿐 본 발명의 범주 및 범위가 그에 의해 제한되는 것은 아니다.Hereinafter, the configuration and effects of the present invention will be described in more detail by way of experimental examples, examples and comparative examples. However, the following experimental examples, examples, and comparative examples are provided only for illustrative purposes to aid understanding of the present invention, and the scope and scope of the present invention are not limited thereto.
[실험예1] 흑색종의 전이성과 miR-944의 역할규명[Experimental Example 1] Identification of melanoma metastasis and the role of miR-944
흑색종 세포에서 miR-944의 역할을 규명하기 위해 먼저 세포의 이동성에 차이가 있는 흑색종 세포주(한국세포주은행에서 구입한 A375P, A375SM, Wm266-4) 간에 miR-944의 발현과 세포 이동성을 조사하였다. To identify the role of miR-944 in melanoma cells, we first investigated miR-944 expression and cell migration between melanoma cell lines (A375P, A375SM, Wm266-4 purchased from Korea Cell Line Bank) with differences in cell mobility. did
실험예 1-1 흑색종 세포주의 전이성(3가지 흑색종세포에서 wound healing 어세이를 수행하여 wound closure를 측정)Experimental Example 1-1 Metastatic melanoma cell line (Wound healing assay was performed on three melanoma cells to measure wound closure)
A375P, A375SM, Wm266-4 세포주를 35mm 배양접시에 배양 후 Wound healing assay를 실시하였다. 200μl tip을 이용하여 세포층 표면을 손상시킨 후 PBS로 세척하고 CO2 incubator에서 24시간 배양하였다. 세포 이동거리 계산은 Image j software (National Institutes of Health, MD, USA)를 이용해 산출하였다. 면적 측정은 손상된 면적을 산출한 뒤 0시간의 면적에서 24시간의 면적 값을 뺀 후, 24시간 동안 이동한 거리를 계산하였고, 계산된 값은 대조군 세포의 이동 거리에 대한 백분율(%)로 환산 하였다. After culturing the A375P, A375SM, and Wm266-4 cell lines in a 35mm culture dish, a wound healing assay was performed. After damaging the surface of the cell layer using a 200 μl tip, it was washed with PBS and cultured in a CO 2 incubator for 24 hours. Cell migration distance was calculated using Image j software (National Institutes of Health, MD, USA). For area measurement, after calculating the damaged area, subtracting the area value at 24 hours from the area at 0 hours, the distance traveled for 24 hours was calculated, and the calculated value was converted into a percentage (%) of the distance traveled by the control cells did
실험 결과 A375P 흑색종 세포가 3가지 흑색종 세포주 중에서 가장 이동성이 적었고, Wm266-4 흑색종 세포주가 A375 세포 비하여 약 3.5배 더 많은 이동성을 나타내었다 (도 2). As a result of the experiment, A375P melanoma cells showed the least mobility among the three melanoma cell lines, and the Wm266-4 melanoma cell line showed about 3.5 times more mobility than A375 cells (FIG. 2).
실험예 1-2 흑색종 세포주의 miR-944 발현량 측정Experimental Example 1-2 Measurement of miR-944 expression level in melanoma cell lines
다음으로 이들 세포주에서 서열번호 2의 miR-944의 발현을 측정하였다. 수거한 세포에 Trizol reagent (Invitrogen, Carlabad, CA, USA)를 반응시켜 total RNA를 분리하였다. miRNA 발현 정도는 Taqman microRNA assay (Applied biosystems, Foster city, CA, USA)를 이용하여 측정하였다. Taqman reverse transcription kit (Applide biosystems, foster assay, CA USA)를 이용하여 100ng RNA에서 cDNA를 합성한 다음 miR-944 primer (Applied biosystems, Foster City, CA, USA)(Cat: # 4427975)(ID: 002189) 를 이용하여 Rotor-Gene 6000 기기 (Qigen, Duesseldorf, Germany)로 PCR을 수행하였다. PCR 조건은 95℃에서 10분간 반응 시킨 다음 15초 95℃, 1분 60℃를 한 주기로 40cycle 동안 실시하여 miRNA을 증폭하였다. miRNA 발현량은 U6 SnRNA 발현량 (Cat: # 4427975)(ID: 001093) 에 대한 상대적인 발현량으로 정량하여 ΔΔCt 값을 이용해 보정하였다. Next, expression of miR-944 of SEQ ID NO: 2 was measured in these cell lines. Total RNA was isolated by reacting the harvested cells with Trizol reagent (Invitrogen, Calabad, CA, USA). The level of miRNA expression was measured using Taqman microRNA assay (Applied biosystems, Foster city, CA, USA). cDNA was synthesized from 100ng RNA using the Taqman reverse transcription kit (Applide biosystems, foster assay, CA USA), and then miR-944 primer (Applied biosystems, Foster City, CA, USA) (Cat: # 4427975) (ID: 002189 ) using a Rotor-Gene 6000 machine (Qigen, Duesseldorf, Germany) to perform PCR. PCR conditions were performed at 95 ° C for 10 minutes, followed by 15 seconds of 95 ° C and 1 minute of 60 ° C for 40 cycles to amplify miRNA. The miRNA expression level was quantified as a relative expression level to the U6 SnRNA expression level (Cat: # 4427975) (ID: 001093) and corrected using the ΔΔCt value.
실험 결과, miR-944는 이동성이 가장 적은 세포주인 A375P 세포 주를 기준으로 A375Sm에서는 약 75%, Wm266-4에서는 99.4%의 순서로 발현이 감소하였다. 이는 세포의 이동성과는 반대의 경향성으로 miR-944의 발현 결과가 나타났다 (도 3). 이러한 결과는 흑색종 세포에서 miR-944의 발현이 세포의 전이에 영향을 미칠 수 있음을 나타낸다.As a result of the experiment, the expression of miR-944 decreased in the order of about 75% in A375Sm and 99.4% in Wm266-4 based on the A375P cell line, which is the cell line with the least mobility. This resulted in the expression of miR-944 with a tendency opposite to cell migration (FIG. 3). These results indicate that the expression of miR-944 in melanoma cells can affect cell metastasis.
[실험예2] miR-944 모사체(mimic)를 이용한 흑색종 세포에서 miR-944 과발현 실험[Experimental Example 2] miR-944 overexpression experiment in melanoma cells using miR-944 mimic
흑색종 세포주에서 miR-944의 전이에 대한 기능을 조사하기 위하여 miR-944의 발현이 가장 적게 나타난 흑색종 세포주 Wm266-4에 서열번호 2와 3인 혼성화된miR-944의 mimic를 20nM로 Thermo Fisher Scientific 社의 Lipofectaminer® RNAiMAX Reagent를 이용하여 liposome에 포집하여 트랜스펙션시켰다. miRNA mimics는 GenePharma (Shanghai, China)에서 합성하였다. miR-944의 염기서열을 AAA UUA UUG UAC AUC GGA UGA G, Scramble oligo(NC)의 염기서열은 UUG UAC UAC ACA AAA GUA CUG로 합성하였다. In order to investigate the function of miR-944 in melanoma cell lines for metastasis, miR-944 hybridized with SEQ ID NOs: 2 and 3 in the melanoma cell line Wm266-4, which showed the least expression of miR-944, was used at 20 nM Thermo Fisher Lipofectaminer® RNAiMAX Reagent from Scientific Co. was used to capture liposomes and transfect them. miRNA mimics were synthesized by GenePharma (Shanghai, China). The nucleotide sequence of miR-944 was synthesized as AAA UUA UUG UAC AUC GGA UGA G, and the nucleotide sequence of Scramble oligo (NC) was synthesized as UUG UAC UAC ACA AAA GUA CUG.
실험예2-1 miR-944 과발현 후의 wound healing assay(이동성 측정)Experimental Example 2-1 Wound healing assay after miR-944 overexpression (mobility measurement)
miRNA mimic을 흑색종 세포주 Wm266-4에 도입후 24시간 후에 wound healing assay를 실시하였다. Wound healing assay은 실험예1-1과 같은 방법으로 실시하였다. Wound healing assay was performed 24 hours after miRNA mimic was introduced into melanoma cell line Wm266-4. Wound healing assay was performed in the same way as Experimental Example 1-1.
실험결과 wound healing assay 실험에서 대조군에 비해 miR-944가 도입된 세포에서 세포 이동성이 약 60%정도 감소하였다 (도 4). 이러한 결과는 흑색종 세포에서 miR-944 발현이 세포의 이동성을 감소 시킬 수 있음을 나타낸다.As a result of the experiment, in the wound healing assay experiment, cell mobility was reduced by about 60% in miR-944-introduced cells compared to the control group (FIG. 4). These results indicate that miR-944 expression in melanoma cells can reduce cell migration.
실험예2-2 miR-944 과발현 후의 invasion assay(전이성 측정)Experimental Example 2-2 Invasion assay after overexpression of miR-944 (measurement of metastasis)
miRNA mimic을 흑색종 세포주 Wm266-4에 도입후 24시간 후에 invasion assay를 실시하였다. 세포 전이 실험은 martrigel이 깔려있는 8μm pore size로 구성된 24well plate(Corning, NY, USA)를 이용하여 실험하였다. Wm266-4 세포에 실험 하루전 날 miR-944 mimc을 형질주입 한 후에 각각의 세포를 transwell에 혈청이 포함되지 않은 배지를 이용하여 1.0 X 105으로 분주하였다. transwell 아래 쪽에 10% FBS가 포함된 정상배지를 공급한 다음 48시간 동안 배양하였다. 이후 세포를 포름알데하이드로 고정화 시키고, 면봉을 이용하여 martrigel 위쪽에 전이가 되지 않은 세포를 제거하고 아래로 이동한 세포를 0.1% crystal violet으로 염색하여 관찰하였다. 무작위로 5부분을 선택하고 광학현미경을 이용하여 세포 수를 측정하였다.An invasion assay was performed 24 hours after introducing the miRNA mimic into the melanoma cell line Wm266-4. Cell transfer experiments were conducted using a 24-well plate (Corning, NY, USA) composed of 8 μm pore size coated with martrigel. Wm266-4 cells were transfected with miR-944 mimc the day before the experiment, and then each cell was seeded at 1.0 X 10 5 in transwell using serum-free medium. A normal medium containing 10% FBS was supplied to the bottom of the transwell and cultured for 48 hours. Then, the cells were fixed with formaldehyde, and the cells that did not metastasize to the top of the martrigel were removed using a cotton swab, and the cells that migrated to the bottom were stained with 0.1% crystal violet and observed. Five parts were randomly selected and the number of cells was measured using an optical microscope.
실험 결과, 대조군 (miR-negative control)에 비하여 miR-944 mimic을 도입한 Wm266-4 세포에서 약 60%정도 전이된 세포가 감소하였다(도 5). 이러한 결과는 흑색종 세포에서 miR-944 발현이 세포의 전이를 감소 시킬 수 있음을 나타낸다.As a result of the experiment, about 60% of the transferred cells were reduced in Wm266-4 cells into which the miR-944 mimic was introduced compared to the control group (miR-negative control) (FIG. 5). These results indicate that miR-944 expression in melanoma cells can reduce metastasis of cells.
따라서, 상기 실험예 1과 실험예 2로부터 본 발명의 일측면에 따른 조성물 및 스크리닝 방법이 흑색종 전이 억제에 사용될 수 있음을 확인할 수 있었다.Therefore, it was confirmed from Experimental Example 1 and Experimental Example 2 that the composition and screening method according to one aspect of the present invention can be used to inhibit melanoma metastasis.
본 발명의 일측면에 따른 조성물의 제형예를 아래에서 설명하나, 다른 여러 가지 제형으로도 응용 가능하며, 이는 본 발명을 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다.Formulation examples of the composition according to one aspect of the present invention will be described below, but can also be applied to various other formulations, which are only intended to be specifically described and not intended to limit the present invention.
[제형예 1] 영양로션[Formulation Example 1] Nutrition Lotion
하기 표 1에 기재된 조성에 따라 통상적인 방법으로 영양로션을 제조할 수 있다.According to the composition shown in Table 1 below, a nutritional lotion can be prepared by a conventional method.
[제형예 2] 영양크림[Formulation Example 2] Nutrition Cream
하기 표 2에 기재된 조성에 따라 통상적인 방법으로 영양크림을 제조할 수 있다.Nutritional cream can be prepared by a conventional method according to the composition shown in Table 2 below.
[제형예 3] 연고[Formulation Example 3] Ointment
하기 표 3에 기재된 조성에 따라 통상적인 방법으로 연고를 제조할 수 있다.An ointment can be prepared by a conventional method according to the composition shown in Table 3 below.
[제형예 4] 주사제[Formulation Example 4] Injection
하기 표 4에 기재된 조성에 따라 통상적인 방법으로 주사제를 제조할 수 있다.According to the composition shown in Table 4 below, an injection can be prepared by a conventional method.
<110> AMOREPACIFIC CORPORATION <120> Composition for inhibiting melanoma metastasis comprising miRNA <130> 15P615IND <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> core sequence of miR-944 <400> 1 aauuauug 8 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mature sequence of miR-944 <400> 2 aaauuauugu acaucggaug ag 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> antisense sequence of miR-944 <400> 3 cucauccgau guacaauaau uu 22 <210> 4 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> hairpin of miR-944 <400> 4 guuccagaca caucucaucu gauauacaau auuuucuuaa auuguauaaa gagaaauuau 60 uguacaucgg augagcugug ucugggau 88 <110> AMOREPACIFIC CORPORATION <120> Composition for inhibiting melanoma metastasis comprising miRNAs <130> 15P615IND <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 8 <212> RNA <213> artificial sequence <220> <223> core sequence of miR-944 <400> 1 8 <210> 2 <211> 22 <212> RNA <213> artificial sequence <220> <223> mature sequence of miR-944 <400> 2 aaauuauugu acaucggaug ag 22 <210> 3 <211> 22 <212> RNA <213> artificial sequence <220> <223> antisense sequence of miR-944 <400> 3 cucauccgau guacaauaau uu 22 <210> 4 <211> 88 <212> RNA <213> artificial sequence <220> <223> hairpin of miR-944 <400> 4 60 60 uguacaucgg augagcugug ucugggau 88
Claims (15)
상기 RNA 핵산분자는 상기 서열번호 1을 코어서열로 포함하는 서열번호 2의 서열인, 흑색종 전이 억제용 조성물.
Contains an RNA nucleic acid molecule as an active ingredient,
The RNA nucleic acid molecule is a sequence of SEQ ID NO: 2 comprising SEQ ID NO: 1 as a core sequence, a composition for inhibiting melanoma metastasis.
상기 서열번호 2의 서열에 상보적이고 같은 길이를 갖는 서열을 더 포함하는, 흑색종 전이 억제용 조성물.
According to claim 1,
A composition for inhibiting melanoma metastasis, further comprising a sequence complementary to the sequence of SEQ ID NO: 2 and having the same length.
상기 상보적이고 같은 길이를 갖는 서열은 서열번호 3의 서열인, 흑색종 전이 억제용 조성물.
According to claim 5,
The complementary sequence having the same length is a sequence of SEQ ID NO: 3, a composition for inhibiting melanoma metastasis.
상기 RNA 핵산분자는 리포좀(liposome)에 포집된 형태 또는 백터에 삽입된 형태로 포함된, 흑색종 전이 억제용 조성물.
The method of any one of claims 1 and 5 to 6,
The RNA nucleic acid molecule is a composition for inhibiting melanoma metastasis, which is contained in a form captured in a liposome or inserted into a vector.
상기 RNA 핵산분자는 상기 리포좀에 대하여 농도가 1 내지 200uM인, 흑색종 전이 억제용 조성물.
According to claim 9,
The RNA nucleic acid molecule has a concentration of 1 to 200uM with respect to the liposome, a composition for inhibiting melanoma metastasis.
상기 조성물은 주사제인, 흑색종 전이 억제용 조성물.
According to claim 9,
The composition is an injection, a composition for inhibiting melanoma metastasis.
(a)흑색종 세포를 준비하는 단계;
(b)상기 세포에 시험 물질을 처리하는 단계; 및
(c)상기 시험물질이 흑색종 세포에서 miR-944의 생성을 유도하는지 또는 활성을 촉진시키는지 여부를 확인하는 단계;
를 포함하는 것을 특징으로 하는 흑색종 전이 억제 물질의 스크리닝 방법.As a method for screening melanoma metastasis inhibitory substances,
(a) preparing melanoma cells;
(b) treating the cells with a test substance; and
(c) determining whether the test substance induces the production of miR-944 in melanoma cells or promotes its activity;
A screening method for melanoma metastasis inhibitory substances comprising a.
A composition for diagnosing melanoma metastasis comprising a miR-944 detection reagent.
A kit for diagnosing melanoma metastasis containing a miR-944 detection reagent.
상기 키트는
흑색종 세포의 RNA 추출 시약,
추출된 RNA를 cDNA로 역전사 하기 위한 역전사 효소, 및
역전사된 cDNA 중 miRNA-944를 증폭하기 위한 miRNA-944 프라이머를 포함하는 흑색종 전이 진단용 키트.According to claim 14,
The kit
RNA extraction reagent from melanoma cells,
A reverse transcriptase for reverse transcribing the extracted RNA into cDNA, and
A kit for diagnosing melanoma metastasis comprising miRNA-944 primers for amplifying miRNA-944 in reverse-transcribed cDNA.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150169426A KR102552776B1 (en) | 2015-11-30 | 2015-11-30 | Composition for inhibiting melanoma metastasis comprising miRNA |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150169426A KR102552776B1 (en) | 2015-11-30 | 2015-11-30 | Composition for inhibiting melanoma metastasis comprising miRNA |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20170063263A KR20170063263A (en) | 2017-06-08 |
KR102552776B1 true KR102552776B1 (en) | 2023-07-10 |
Family
ID=59221125
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020150169426A KR102552776B1 (en) | 2015-11-30 | 2015-11-30 | Composition for inhibiting melanoma metastasis comprising miRNA |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102552776B1 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101965496B1 (en) | 2017-08-31 | 2019-04-03 | 중앙대학교 산학협력단 | Biomarker for Prognosing Metastasis of Melanoma, Kit Comprising the Same, and Screening Method for Compound Preventing Metastasis of Melanoma |
CN110241219B (en) * | 2019-07-18 | 2024-04-16 | 北京泱深生物信息技术有限公司 | Application of MYOM3 in melanoma metastasis |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014210341A2 (en) | 2013-06-27 | 2014-12-31 | Institute For Systems Biology | Products and methods relating to micro rnas and cancer |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2336353A1 (en) * | 2009-12-17 | 2011-06-22 | febit holding GmbH | miRNA fingerprints in the diagnosis of diseases |
KR101711687B1 (en) | 2009-09-28 | 2017-03-02 | 램 리써치 코포레이션 | Unitized confinement ring arrangements and methods thereof |
KR102027451B1 (en) * | 2012-11-02 | 2019-10-02 | (주)아모레퍼시픽 | Micro RNA, and screening method using the micro RNA |
KR101466768B1 (en) | 2013-02-27 | 2014-11-28 | 케이티메드 주식회사 | Nebulizer and housing for nebulizer |
-
2015
- 2015-11-30 KR KR1020150169426A patent/KR102552776B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014210341A2 (en) | 2013-06-27 | 2014-12-31 | Institute For Systems Biology | Products and methods relating to micro rnas and cancer |
Non-Patent Citations (1)
Title |
---|
Nucleic Acids Research. 2015. Vol.43(15), pp.7462-7479. |
Also Published As
Publication number | Publication date |
---|---|
KR20170063263A (en) | 2017-06-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2018214137B2 (en) | MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway | |
Sun et al. | SIRT1 suppresses colorectal cancer metastasis by transcriptional repression of miR-15b-5p | |
Zhu et al. | miR-154 inhibits prostate cancer cell proliferation by targeting CCND2 | |
Li et al. | MiR-124 down-regulation is critical for cancer associated fibroblasts-enhanced tumor growth of oral carcinoma | |
Zhou et al. | miR-503 regulates metastatic function through Rho guanine nucleotide exchanger factor 19 in hepatocellular carcinoma | |
Feng et al. | miR-141-3p inhibits fibroblast proliferation and migration by targeting GAB1 in keloids | |
EP3800256A1 (en) | Combination to be used in therapeutic use against diseases or conditions associated with melanoma, or in diseases or conditions associated with activated b-raf pathway | |
Jin et al. | MicroRNA-544 inhibits glioma proliferation, invasion and migration but induces cell apoptosis by targeting PARK7 | |
Liu et al. | miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells | |
Chen et al. | MicroRNA-302d downregulates TGFBR2 expression and promotes hepatocellular carcinoma growth and invasion | |
US20140045924A1 (en) | Melanoma treatments | |
Hashemi et al. | Additive effect of metastamiR-193b and breast cancer metastasis suppressor 1 as an anti-metastatic strategy | |
KR102552776B1 (en) | Composition for inhibiting melanoma metastasis comprising miRNA | |
WO2008053909A1 (en) | Agent for controlling growth and/or differentiation of mesenchymal stem cell | |
Cong et al. | SGK1 is involved in cardioprotection of urocortin-1 against hypoxia/reoxygenation in cardiomyocytes | |
CN109745335B (en) | Application of miR-218 in preparation of breast cancer chemotherapeutic drug sensitizer | |
Li et al. | MicroRNA-486–3p promotes the proliferation and metastasis of cutaneous squamous cell carcinoma by suppressing flotillin-2 | |
KR101413581B1 (en) | Compositon for preventing or treating cancer comprising miR-186, miR-216b, miR-337-3p and miR-760 | |
Jin et al. | Inhibition of DLC-1 gene expression by RNA interference in the colon cancer LoVo cell line | |
CN108165632B (en) | Application of LINC01426 in diagnosis and treatment of hepatocellular carcinoma | |
KR102541256B1 (en) | A melanoma preventing or treating agent through LIPA inhibition, and screening method thereof | |
Pei et al. | MicroRNA-3646 promotes cell proliferation, migration and invasion by targeting RhoA in breast cancer | |
CN108277276B (en) | Application of long-chain non-coding RNA and composition thereof in diagnosis/treatment of gastric cancer | |
KR102475128B1 (en) | A melanoma preventing or treating agent through ENTPD4 inhibition, and screening method thereof | |
KR20200041599A (en) | A melanoma preventing or treating agent through SH3BP4 inhibition, and screening method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E902 | Notification of reason for refusal | ||
E90F | Notification of reason for final refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |