KR20180112561A - Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract - Google Patents

Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract Download PDF

Info

Publication number
KR20180112561A
KR20180112561A KR1020170043805A KR20170043805A KR20180112561A KR 20180112561 A KR20180112561 A KR 20180112561A KR 1020170043805 A KR1020170043805 A KR 1020170043805A KR 20170043805 A KR20170043805 A KR 20170043805A KR 20180112561 A KR20180112561 A KR 20180112561A
Authority
KR
South Korea
Prior art keywords
fatty liver
constipation
extract
hyperlipidemia
composition
Prior art date
Application number
KR1020170043805A
Other languages
Korean (ko)
Other versions
KR102098264B1 (en
Inventor
손원록
정지훈
정태우
Original Assignee
손원록
정지훈
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 손원록, 정지훈 filed Critical 손원록
Priority to KR1020170043805A priority Critical patent/KR102098264B1/en
Publication of KR20180112561A publication Critical patent/KR20180112561A/en
Application granted granted Critical
Publication of KR102098264B1 publication Critical patent/KR102098264B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105Plant extracts, their artificial duplicates or their derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/73Rosaceae (Rose family), e.g. strawberry, chokeberry, blackberry, pear or firethorn
    • A61K36/732Chaenomeles, e.g. flowering quince
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/88Liliopsida (monocotyledons)
    • A61K36/899Poaceae or Gramineae (Grass family), e.g. bamboo, corn or sugar cane
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/3262Foods, ingredients or supplements having a functional effect on health having an effect on blood cholesterol

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Botany (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Medical Informatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

The present invention relates to a composition having Phragmites rhizome and Humulus japonicus extracts as active ingredients for preventing, improving, or treating fatty liver, hyperlipidemia, and constipation and, more specifically, to a food composition including having Phragmites rhizome and Humulus japonicus extracts as active ingredients for preventing or improving one or more diseases selected from a group consisting of fatty liver, hyperlipidemia, and constipation or a pharmaceutical composition for preventing or treating one or more diseases selected from a group consisting of fatty liver, hyperlipidemia, and constipation. A method of the present invention can be useful for preventing or treating fatty liver and hyperlipidemia or preventing or treating constipation using a composition including Phragmites rhizome and Humulus japonicus extracts or including mixture of Phragmites rhizome, Humulus japonicus, and Chinese quince.

Description

노근 및 율초 추출물을 유효성분으로 하는 지방간, 고지혈증 및 변비 예방, 개선 또는 치료용 조성물{Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract}TECHNICAL FIELD The present invention relates to a composition for prevention, improvement or treatment of fatty liver, hyperlipidemia and constipation, which comprises an extract of Aspergillus oryzae as an active ingredient,

본 발명은 노근 및 율초 추출물을 유효성분으로 하는 지방간 고지혈증 및 변비 예방, 개선 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물 또는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물에 관한 것이다. The present invention relates to a composition for prevention, improvement or treatment of fatty liver hyperlipidemia and constipation, comprising as an active ingredient a caspase and a chrysanthemum extract. More particularly, the present invention relates to a composition for preventing, ameliorating or treating constipation, , Or a pharmaceutical composition for the prevention or treatment of one or more diseases selected from the group consisting of fatty liver, hyperlipidemia and constipation.

지방간은 간 세포 속에 지방이 축적된 상태를 의미하며, 의학적으로 지방이 전체 간 무게의 5% 이상을 초과하는 병적 상태를 의미하는데, 이를 포함하는 간질환은 선진국 40-50대 성인 인구의 사망 원인에서 암 다음으로 심각한 질환으로 인정된다. 선진국을 포함한 주요 국가의 인구 중 30%는 지방간 증상을 보이고 있으며, 이들 중 20%는 간경변증으로 진행하게 되며, 간경변증 환자의 약 절반은 진단 후 10년 이내에 간질환으로 사망한다.Fatty liver means fat accumulation in liver cells and medically refers to a disease state in which fat exceeds 5% or more of total liver weight. Liver disease including liver disease is the cause of death in 40-50 adult population in developed countries Is regarded as a serious disease next to cancer. About 30% of the population of major countries, including the developed countries, have fatty liver disease, 20% of them progress to liver cirrhosis, and about half of liver cirrhosis patients die of liver disease within 10 years of diagnosis.

지방간은 크게 과음으로 인한 알코올성 지방간 질환(alcoholic fatty liver disease)과 비만, 당뇨병, 고지혈증, 약물 등으로 인한 비알코올성 지방간 질환(nonalcoholic fatty liver disease, NAFLD)으로 나눌 수 있다.Fatty liver can be divided into alcoholic fatty liver disease and nonalcoholic fatty liver disease (NAFLD) due to obesity, diabetes, hyperlipidemia, and drug.

비알코올성 지방간 질환은 과량의 알코올을 섭취하지 않은 환자에게서 나타나는 염증 반응을 동반하지 않는 단순 지방간, 및 이에 의해 진전되며, 간세포의 염증반응, 간섬유화 및 간경화를 포함하는 넓은 범위의 질환을 의미한다. 비알코올성 지방간 질환은 원인에 따라 원발성과 속발성으로 나뉘는데 원발성은 대사 증후군의 특징인 고지혈, 당뇨, 또는 비만 등에 의해 발생하며, 속발성은 영양적 원인(급격한 체중 감소, 기아, 장 우회술), 다양한 약물, 독성 물질(독버섯, 세균 독소), 대사성 원인 및 기타 요인에 의해 발생하는 것으로 알려져 있다. 원발성 요인인 대사증후군의 중요한 특징인 당뇨 및 비만과 관련된 비알코올성 지방간 질환의 발생률은 당뇨 환자의 약 50%, 비만 환자의 약 76%, 비만한 당뇨 환자의 거의 대부분에서 발생하는 것으로 알려져있다(Gupte P et al., 2004). 또한 알라닌 아미노트랜스퍼라제(Alanine aminotransferase, ALT)의 수준이 증가된 당뇨 및 비만환자에서 생검을 실시한 결과 지방간염의 발생률이 18-36%로 나타났다(Braillon A et al., 1985).Non-alcoholic fatty liver disease refers to a wide range of diseases, including simple inflammatory reactions in patients without excessive alcohol consumption, and which develops thereby, including inflammation of hepatocytes, liver fibrosis and cirrhosis. Non-alcoholic fatty liver disease is divided into primary and secondary by cause. Primary is caused by hypercholesterolemia, diabetes, or obesity, which is characteristic of metabolic syndrome. Secondary cause is nutritional cause (rapid weight loss, starvation, It is known to be caused by toxic substances (poisonous bacteria, bacterial toxins), metabolic causes and other factors. The incidence of nonalcoholic fatty liver disease associated with diabetes and obesity, an important feature of the primary metabolic syndrome, is known to occur in approximately 50% of diabetic patients, approximately 76% of obese patients, and almost all obese diabetic patients (Gupte P et al., 2004). The incidence of hepatitis was 18-36% in patients with increased levels of alanine aminotransferase (ALT) and diabetic patients (Braillon A et al., 1985).

현재까지 비알코올성 지방간 질환에 대한 확립된 치료법은 없는데 이는 비알코올성 지방간 질환이 당뇨병, 비만, 관상동맥 질환, 생활 습관 등의 다양한 요소와 연관되어 나타나기 때문이다. 몇 가지 당뇨 또는 비만 치료 약제 투여에 의한 지방간 질환에 대한 효과가 보고되었는데 경구용 비만치료제로 사용되고 있는 올리스탓(Orlistat)의 경우 지방간염 환자에서 간의 조직학적 향상을 유도했다는 보고(Hussein et al., 2007)가 있으며, 메트포민(Metformin)이 당뇨를 동반하지 않는 비알코올성 지방간 환자에서 혈중 간 효소 수치, 간의 괴사성 염증 및 섬유화를 감소시켰다는 보고가 있다(Bugianesi et al., 2005). 또한 PPAR(peroxisome proliferatoractivated receptor)의 작용물질(agonist)인 티아졸리딘디온(Thiazolidinedione, TZD) 계열의 약물은 간과 근육에서의 지방 축적을 억제하고, 비알코올성 지방간 질환의 동물 모델에서 간에 대해 직접적인 항 섬유화 작용을 나타내는 것으로 보고된 바 있다(Galli A et al., 2002). 그러나 현재 지방간을 약물학적으로 치료하는데 유용한 약제는 거의 없는 상태이며 운동과 식이요법만이 권장되고 있기 때문에 신규한 지방간 치료제의 개발이 요구된다.Until now, there has been no established treatment for nonalcoholic fatty liver disease because nonalcoholic fatty liver disease is associated with diverse factors such as diabetes, obesity, coronary artery disease, and lifestyle habits. The effects of diabetes or obesity therapy on fatty liver disease have been reported. Orlistat, which is used as a treatment for oral obesity, has been shown to induce liver histologic improvement in patients with hepatitis (Hussein et al. 2007), and metformin has been shown to reduce serum liver enzyme levels, necrotic inflammation and fibrosis in nonalcoholic fatty liver patients without diabetes (Bugianesi et al., 2005). In addition, thiazolidinedione (TZD) -based drugs, agonists of PPAR (peroxisome proliferatoractivated receptor), inhibit fat accumulation in liver and muscle, and direct anti-fibrosis in the animal model of nonalcoholic fatty liver disease (Galli A et al., 2002). However, there are few medicines currently available for the pharmacological treatment of fatty liver, and only exercise and diet are recommended.

한편, 변비는 건강할 때에 비하여 변이 굳고 건조하며, 배변의 횟수와 변의 양이 상당히 감소되어 배변시 불쾌감이나 생리적 장애를 수반하는 증상이 있는 경우를 말한다. 이러한 변비증상을 개선하고 치료하기 위하여 섬유질이 많은 식품, 예를 들면 고구마, 녹황색 채소류, 곤약, 과일류 및 육류 등의 섭취가 권장되고 있으나, 식사주기가 일정치 않은 현대인들, 특히 다이어트가 잦아 식사횟수가 적은 젊은 여성들이 이러한 식품을 섭취하기는 매우 어려운 현실이다. 이에, 변비치료 효과가 뛰어난 한약제 및 생약제를 사용함으로써 부작용이 없고 손쉽게 음용할 수 있는 차 및 음료에 대한 요구가 증가되어 왔다.On the other hand, constipation is stiff and dry compared to when it is healthy, and the number of stools and the amount of stool is significantly reduced, and there are symptoms with discomfort or physiological disorder at the time of bowel movement. In order to improve and cure these constipation symptoms, it is recommended that foods containing a lot of fiber such as sweet potatoes, green vegetables, konjacs, fruits and meats are consumed. However, It is a very difficult reality for young women with a small number of times to consume these foods. Accordingly, the use of herbal medicine and herbal medicine excellent in the therapeutic effect of constipation has increased the demand for tea and beverage which can be easily consumed without side effects.

이에 본 발명자들은 지방간, 고지혈증 및 변비에 대한 예방 또는 치료 효과가 높으며, 부작용이 적은 새로운 물질을 개발하기 위하여 다양한 천연재료를 이용한 연구를 수행한 결과, 노근 및 율초를 혼합하여 제조한 추출물이 지방간, 고지혈증 및 변비에 치료 효과가 있음을 확인하여 본 발명을 완성하였다. Accordingly, the present inventors have conducted studies using various natural materials in order to develop a novel substance having a high effect of preventing or treating fatty liver, hyperlipidemia and constipation and having few side effects. As a result, Hyperlipidemia and constipation, and thus completed the present invention.

따라서 본 발명의 목적은 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물을 제공하는 것이다.Accordingly, an object of the present invention is to provide a food composition for preventing or ameliorating at least one disease selected from the group consisting of fatty liver, hyperlipemia, and constipation, which comprises Angelica keiskei koidz.

본 발명의 다른 목적은 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating one or more diseases selected from the group consisting of fatty liver, hyperlipemia, and constipation, which comprises as an effective ingredient, camel root extract and chrysanthemum extract.

상기와 같은 목적을 달성하기 위하여, 본 발명은 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물을 제공한다. In order to achieve the above object, the present invention provides a food composition for preventing or ameliorating at least one disease selected from the group consisting of fatty liver, hyperlipidemia, and constipation, which comprises an extract of Angelica keiskei and a chrysanthemum extract as an active ingredient.

본 발명의 다른 목적을 달성하기 위하여, 본 발명은 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물을 제공한다.In order to accomplish still another object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating at least one disease selected from the group consisting of fatty liver, hyperlipemia and constipation, which comprises Angelica keiskei koidz.

이하 본 발명을 상세히 설명한다. Hereinafter, the present invention will be described in detail.

본 발명은 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물을 제공한다.The present invention provides a food composition for preventing or ameliorating at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation, which comprises Angelica keiskei koidz. And Chrysanthemum extract as an active ingredient.

본 발명의 ‘노근(蘆根)’은 아직 이삭이 피지 않은 시기의 갈대로서, 성질은 차고 맛은 달다. 노근은 폐열을 내려 가슴이 답답하고 편안치 않고 열이 나며 진액이 말라 갈증이 나고 입안이 타는 증상을 치료하며, 위열을 내려 구역질, 메스꺼움, 구토를 멎게 하는 효능이 있고, 폐열로 인하 해수, 가래, 폐결핵, 폐농양에 쓰며 생선독을 해독시키는 효능이 있다. 또한 약리작용으로 이뇨작용, 해열작용, 간보호작용, 조혈기능 강화작용 등이 있다고 보고된 바 있다. The 'nongge' of the present invention is a reed at a time when the ears are not yet eaten, and the nature is cold and the taste is sweet. It has the effect of stopping the nausea, nausea and vomiting by lowering the fever, treating the symptoms of thirst and dryness of the mouth, , Pulmonary tuberculosis, lung abscess, and has the effect of detoxifying fish poison. In addition, pharmacological actions such as diuretic, antipyretic, liver protection, and hematopoietic function have been reported.

본 발명의 ‘율초’는 한삼덩굴 Humulus japonicus Siebold et Zuccarini(뽕나무과 Moraceae)의 지상부로, 주로 잎이 달린 덩굴성 줄기로 되어 있고 열매가 달려 있는 것도 있다. 율초는 각지의 개울가와 길옆, 산기슭에서 자라며, 여름철 잎이 무성할 때 전초를 베어 그늘에서 말려 사용한다. 맛은 달고 쓰며 찬 성질을 가지고 있다. 율초는 혈압 강하 작용, 이뇨 작용, 그람양성균에 대한 항균 작용이 있다고 밝혀졌으며, 예로부터, 열이 나고 가슴이 답답하며 갈증이 나는 데, 학질, 폐결핵으로 열이 나는 데, 소화 장애, 급성 위장염, 부종, 설사, 이질, 방광염, 요도염, 임증(淋證), 요로결석, 고혈압, 부스럼, 헌데 등에 사용한다.The present invention is based on the ground of Humulus japonicus Siebold et Zuccarini (Mulberry and Moraceae), which is mainly composed of foliage-bearing vine stalks, and has fruit. Uchucho grows in the streams, on the sides of the roads, at the foot of mountains, and when the leaves are thick in summer, the outposts are cut and dried in the shade. The taste is sweet and spicy and has a cold temperament. It has been proved that Yuko has antihypertensive action against blood pressure lowering effect, diuretic effect and Gram positive bacteria. Since then, fever, chest tightness and thirst have been developed, and the fever and heat of pulmonary tuberculosis, digestive disorders, acute gastroenteritis, It is used for edema, diarrhea, dysentery, cystitis, urethritis, 淋 证, urinary stone, hypertension, swelling and boils.

본 발명의 ‘지방간(fatty liver) 질환’은 정상 간에 비해 많은 지방이 축적된 상태를 의미한다. 지방간은 크게 과음으로 인한 알코올성 지방간과 비만, 당뇨병, 고지혈증, 약물 등으로 인한 비알코올성 지방간으로 나눌 수 있다. 알코올성 지방간은 알코올을 많이 섭취하게 되면 간에서 지방 합성이 촉진되고 정상적인 에너지 대사가 이루어지지 않아 발생하게 된다. 비알코올성 지방간은 비만, 성인형 당뇨병, 고지혈증 등의 대사증후군과 연관되어 나타나는데 과도한 열량을 계속 섭취하게 되면 체내 지방세포 및 간에 지방이 축적되고 증가된 지방에서 간에 해로운 여러 가지 물질(사이토카인)이 분비되어 발생하게 되며, 가벼운 지방간에서부터 만성 간염, 간경변증에 이르는 다양한 병을 포함한다. 바람직하게는 비알코올성 지방간 질환 또는 단순성 지방간인 것을 특징으로 할 수 있다.The 'fatty liver disease' of the present invention means a state in which more fat is accumulated compared to normal liver. Fatty liver can be divided into alcoholic fatty liver due to excessive drinking, non-alcoholic fatty liver due to obesity, diabetes, hyperlipidemia, drug and the like. Alcoholic fatty liver is caused by a high intake of alcohol, which promotes fat synthesis in the liver and does not allow normal energy metabolism. Non-alcoholic fatty liver is associated with metabolic syndrome such as obesity, adult type diabetes, and hyperlipidemia. Continuous ingestion of excessive calories leads to accumulation of fat cells in the body and liver, and secretion of various substances (cytokines) And includes various diseases ranging from mild fatty liver to chronic hepatitis and cirrhosis. Preferably a non-alcoholic fatty liver disease or a simple fatty liver.

본 발명의 ‘고지혈증(hyperlipidemia)’은 지질대사의 이상으로 혈청 내 콜레스테롤(cholesterol)과 중성지방을 운반하는 지방단백이 증가하여 주요 지질(cholesterol, triglyceride, phospholipid, free fatty acid)의 혈관 내 함량이 현저하게 증가된 상태를 말하는 것으로 총 cholesterol 수치가 240 mg/dl 이상, triglyceride 치가 200 mg/dl 이상인 경우 고지혈증으로 진단한다. 고지혈증의 원인으로는, 유전적인 요인으로 혈액 내에 특정 지질이 증가하여 고지혈증이 발생하는 경우가 많지만, 비만, 당뇨병, 술, 스트레스, 흡연 등과 같은 환경적인 요인에 의해서도 발생할 수 있다.The hyperlipidemia of the present invention increases the amount of cholesterol and triglyceride-bearing lipoproteins in the blood serum due to an abnormality of lipid metabolism, and thus the content of major lipids (cholesterol, triglyceride, phospholipid, free fatty acid) Hyperlipidemia is diagnosed when the total cholesterol level is more than 240 mg / dl and the triglyceride level is more than 200 mg / dl. As a cause of hyperlipemia, hyperlipidemia often occurs due to an increase in specific lipid in the blood due to genetic factors, but it can also be caused by environmental factors such as obesity, diabetes, alcohol, stress, smoking.

본 발명의 ‘변비(constipation)’는 배변 시 무리한 힘이 필요하거나 대변이 과도하게 딱딱하게 굳은 경우, 불완전 배변감(후중감) 또는 항문직장의 폐쇄감이 있는 경우, 일주일에 배변 횟수가 3번 미만인 경우 등을 말하며, 변비의 원인으로는 이차성 원인인 기질적 국소성 질환, 전신적 질환, 약제 사용과 원발성 원인인 대장의 운동기능 이상이나 항문직장의 기능 이상이 있다. 변비의 90% 이상이 이차성 원인이 밝혀지지 않는 원발성 원인에 의한 변비이며, 이를 기능성 또는 특발성 변비라고 한다.The "constipation" of the present invention means that when an excessive force is required at the bowel movement, when the bowel movement is excessively hardened, when the bowel movement is incomplete or when there is a sense of closing the anus rectum, . The causes of constipation are secondary focal locality diseases, systemic diseases, drug use and primary cause of movement disorders of the colon, and anorectal dysfunctions. More than 90% of constipation is a constipation caused by a primary cause of secondary cause is unknown, it is called functional or idiopathic constipation.

본 발명은 상기 조성물의 노근 및 율초의 중량비율이 1:0.5~5인 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물을 제공한다. 보다 바람직하게는 노근 및 율초의 중량비율이 1:1~3일 수 있으며, 가장 바람직하게는 노근 및 율초의 중량비율이 1:1일 수 있다.The present invention provides a food composition for prevention or amelioration of at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation, wherein the weight ratio of the lambs and the juice of the composition is 1: 0.5 to 5. More preferably, the ratio of the weight of the camber and the camber may be 1: 1 to 3, and most preferably the weight ratio of camber and camber may be 1: 1.

본 발명의 실시예에서 노근 및 율초 추출물은 1:1-3의 중량비율로 혼합하였고, 총량이 500mg/kg이 되도록 제조하여 사용하였다.In the examples of the present invention, camel and chrysanthemum extract were mixed in a weight ratio of 1: 1-3, and the total amount was prepared to be 500 mg / kg.

본 발명은 상기 조성물에 목과 추출물을 추가로 더 포함하는 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물을 제공한다. 보다 바람직하게는 노근, 율초 및 목과의 중량비율이 1:1:1일 수 있다.The present invention provides a food composition for preventing or ameliorating at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation, further comprising a neck and an extract in the composition. More preferably, the ratio of the weight to the nose, throat, and neck may be 1: 1: 1.

본 발명의 ‘목과(木瓜)’는 장미과의 모과나무(Chaenomeles sinensis(Thouin) Koehne)의 익은 열매로 만든 약재로서, 성질은 따뜻하고 맛은 약간 시다. 목과는 풍습성 사지마비동통, 근육이 굴신이 되지 않을 때, 하체마비경련, 근육이 땅겨서 목이 돌아가지 않을 때, 각기병, 토사곽란, 소화불량 등에 사용한다. 또한 약리작용으로 단백성관절염부종억제작용, 복수암억제작용, 추간판탈출증완화작용 등의 효과가 있다고 보고된 바 있다.The "throat" of the present invention is a medicinal product made of ripe fruit of Chaenomeles sinensis (Thouin) Koehne of Rosaceae, which is warm in nature and slightly tasteless. When the muscles are not bending, the lower paralytic spasm, when the muscles are not turning back to the throat, it is used for angina pectoris, dirt burning, and indigestion. In addition, pharmacological actions have been reported to have the effects of inhibiting arthritis edema, inhibiting multiple cancers, and alleviating herniated disc herniation.

본 발명의 추출물의 추출용매로는 예를 들어, 물, 에탄올, 메탄올, 프로판올(propanol), 이소프로판올(isopropanol), 부탄올(butanol)과 같은 탄소수 1 내지 6개의 알코올, 아세톤, 에테르, 클로로포름, 에틸아세테이트, 메틸렌클로라이드, 헥산, 시클로헥산, 석유에테르(petrolem ether), 디에틸에테르, 벤젠과 같은 유기용매로 이루어진 군에서 선택된 하나 이상의 용매를 이용하여 추출할 수 있다. 본 발명의 노근 및 율초 추출물은 바람직하게는 물, 에탄올, 클로로포름, 에틸아세테이트, 1-부탄올로 이루어진 군에서 선택된 하나 이상의 용매를 사용하여 추출할 수 있으며, 가장 바람직하게는 물을 용매로 이용하여 추출될 수 있다.Examples of the extraction solvent of the extract of the present invention include alcohols having 1 to 6 carbon atoms such as water, ethanol, methanol, propanol, isopropanol and butanol, acetone, ether, chloroform, ethyl acetate , And organic solvents such as methylene chloride, hexane, cyclohexane, petroleum ether, diethyl ether, benzene, and the like. The roots and rhizome extracts of the present invention can be extracted preferably using at least one solvent selected from the group consisting of water, ethanol, chloroform, ethyl acetate and 1-butanol, and most preferably, extracted with water as a solvent .

본 발명에 따른 노근 및 율초 추출물 또는 노근, 율초 및 목과 혼합물을 이용한 식품용 조성물은 기능성 식품(functional food), 영양보조제(nutritional supplement), 건강식품(health food) 및 식품첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형들은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한 본 발명의 식품용 조성물은 지방간 질환의 예방, 개선 또는 치료 효과가 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.The composition for food using the ragweed and chrysanthemum extract or the mixture of ragweed, rhododendron and chrysanthemum according to the present invention may be used for functional food, nutritional supplement, health food and food additives Includes all forms. The types can be prepared in various forms according to conventional methods known in the art. They can be manufactured in the form of links and drunk, granulated, encapsulated and powdered. The food composition of the present invention may be prepared in the form of a composition by mixing with known substances or active ingredients known to be effective for preventing, improving or treating fatty liver disease.

예를 들면, 건강식품으로는 본 발명의 식품용 조성물 자체를 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한 본 발명의 식품용 조성물은 체지방 감소, 콜레스테롤 개선, 혈압강하의 효과가 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.For example, as a health food, the food composition itself of the present invention may be prepared in the form of tea, juice, and drink and then consumed, granulated, encapsulated, and powdered. In addition, the food composition of the present invention may be prepared in the form of a composition by mixing with known substances or active ingredients known to have effects of reducing body fat, improving cholesterol, and lowering blood pressure.

또한 기능성 식품으로는 음료(알코올성 음료 포함), 과실 및 그의 가공식품(예를 들어 과일 통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예를 들어 햄, 소시지콘비이프 등), 빵류 및 면류(예를 들어 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예를 들어 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예를 들어 된장, 간장, 소스 등) 등에 본 발명의 식품용 조성물을 첨가하여 제조할 수 있다.Functional foods also include beverages (including alcoholic beverages), fruits and their processed foods (such as canned fruits, bottled, jam, maalmalade, etc.), fish, meats and processed foods such as ham, Etc.), breads and noodles (for example, udon, buckwheat noodles, ramen noodles, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, Vegetable protein, retort food, frozen food, various seasonings (for example, soybean paste, soy sauce, sauce, etc.) by adding the composition for food of the present invention.

본 발명에 따른 식품용 조성물의 바람직한 함유량으로는 이에 한정되지 않지만 바람직하게는 최종적으로 제조된 식품 총 중량 중 0.01 내지 50중량% 이다. 본 발명의 식품용 조성물을 식품첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.The preferred content of the food composition according to the present invention is not particularly limited, but is preferably 0.01 to 50% by weight based on the total weight of the final food product. In order to use the food composition of the present invention in the form of a food additive, it may be used in the form of powder or concentrate.

본 발명은 노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating at least one disease selected from the group consisting of fatty liver, hyperlipemia, and constipation, which comprises Angelica keiskei koidz. And Chrysanthemum extract as an active ingredient.

본 발명은 상기 조성물에 목과 추출물을 추가로 더 포함하는 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation, which further comprises a neck and an extract in the composition.

본 발명에 따른 약학적 조성물은 노근 및 율초 추출물 또는 노근, 율초 및 목과 혼합물을 단독으로 함유하거나 약학적으로 허용되는 담체와 함께 적합한 형태로 제형화될 수 있으며, 부형제 또는 희석제를 추가로 함유할 수 있다. 상기에서 '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 비독성의 조성물을 말한다. The pharmaceutical composition according to the present invention may be formulated into a suitable form together with a lavender and a chrysanthemum extract or a lavender, a chrysanthemum and a mixture with a neck or pharmacologically acceptable carrier, and may further contain excipients or diluents have. &Quot; Pharmaceutically acceptable " as used herein refers to a nontoxic composition that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to humans.

약학적으로 허용되는 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 아울러, 펩티드 제제에 대한 경구투여용으로 사용되는 다양한 약물전달물질을 포함할 수 있다. 또한, 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코오스 및 글리콜 등을 포함할 수 있으며, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸-또는 프로필-파라벤 및 클로로부탄올이 있다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현택제 등을 추가로 포함할 수 있다. 그 밖의 약학적으로 허용되는 담체 및 제제는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, it may contain various drug delivery materials used for oral administration to peptide preparations. In addition, the carrier for parenteral administration may contain water, a suitable oil, a saline solution, an aqueous glucose and a glycol, and may further contain a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, etc. in addition to the above components. Other pharmaceutically acceptable carriers and preparations can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

본 발명의 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여할 수 있다. 비경구적인 투여방법으로는 이에 한정되지는 않으나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다.The composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration Lt; / RTI >

본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.The pharmaceutical composition of the present invention can be formulated into oral preparations or parenteral administration preparations according to the administration route as described above.

경구 투여용 제제의 경우에 본 발명의 조성물은 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 본 발명의 약학적 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.In the case of a preparation for oral administration, the composition of the present invention may be formulated into a powder, a granule, a tablet, a pill, a sugar, a tablet, a liquid, a gel, a syrup, a slurry, . For example, an oral preparation can be obtained by combining the active ingredient with a solid excipient, then milling it, adding suitable auxiliaries, and then processing the mixture into a granular mixture. Examples of suitable excipients include, but are not limited to, sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, Cellulose such as methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose and the like, fillers such as gelatin, polyvinylpyrrolidone and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant. Further, the pharmaceutical composition of the present invention may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

비경구 투여용 제제의 경우에는 주사제, 크림제, 로션제, 외용연고제, 오일제, 보습제, 겔제, 에어로졸 및 비강 흡입제의 형태로 당업계에 공지된 방법으로 제형화할 수 있다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA,1995)에 기재되어 있다.In the case of a preparation for parenteral administration, it can be formulated by a method known in the art in the form of injection, cream, lotion, external ointment, oil, moisturizer, gel, aerosol and nasal aspirate. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, Pa., 1995, which is a commonly known formulary for all pharmaceutical chemistries.

본 발명의 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 바람직하게 본 발명의 약학적 조성물의 바람직한 전체 용량은 1일당 환자 체중 1㎏ 당 약 0.01㎍ 내지 10,000mg, 바람직하게는 0.1㎍ 내지 500mg, 가장 바람직하게는 100mg 내지 500mg일 수 있다. 그러나 상기 약학적 조성물의 용량은 제제화 방법, 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 본 발명의 조성물의 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다. The total effective amount of the composition of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol administered over a prolonged period of time in multiple doses. In the pharmaceutical composition of the present invention, the content of the active ingredient may be varied depending on the degree of the disease. Preferably, the total preferred dose of the pharmaceutical composition of the present invention may be from about 0.01 μg to 10,000 mg, preferably from 0.1 μg to 500 mg, and most preferably from 100 mg to 500 mg per kg body weight of the patient per day. However, the dosage of the pharmaceutical composition may be determined depending on various factors such as the formulation method, administration route and frequency of treatment, as well as the patient's age, body weight, health condition, sex, severity of disease, diet and excretion rate, It will be possible to determine the appropriate effective dose of the composition of the present invention by those of ordinary skill in the art in view of this point. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, administration route and administration method as long as the effect of the present invention is exhibited.

본 발명의 실시예에서는 마우스에 고지방 식이를 실시하여 지방간 질환을 유발하였고, 노근 추출물, 율초 추출물, 목과 추출물, 노근 추출물+율초 추출물, 노근 추출물+목과 추출물, 목과 추출물+율초 추출물의 조합으로 경구투여 하였고, 노근 및 율초 추출물을 3:1, 2:1, 1:1, 1:2, 1:3의 중량비율로 제조하여 경구투여하였다. 마우스에서 간 조직을 추출하였고, 간에서 추출한 세포를 배양한 뒤 oil red o 염색법을 실시한 결과, 정상식이(ND)를 실시한 경우보다 고지방 식이(HFD)를 실시한 경우에 지방량이 증가한 것으로 나타났고, 각 추출물을 처리한 경우에 지방량이 감소하는 것으로 나타났다. 또한 노근, 율초 또는 목과 추출물을 단독으로 처리한 군에 비해, 각각의 혼합물을 처리한 경우에 지방량이 감소하는 것을 확인할 수 있었다(도 1 참조).In the examples of the present invention, a high fat diet was administered to mice to induce fatty liver disease. Oral administration was carried out using a combination of mugwort, chrysanthemum extract, neck and extract, mugwort extract + mulberry extract, mugwort extract + The extracts were prepared at the weight ratio of 3: 1, 2: 1, 1: 1, 1: 2, 1: 3 and administered orally. The liver tissue was extracted from the mouse. After the liver cells were cultured and the oil red o staining was performed, the amount of fat was increased when the high fat diet (HFD) was performed than when the normal diet (ND) When the extract was treated, the amount of fat decreased. In addition, it was confirmed that when each mixture was treated, the fat amount was reduced as compared with the group treated with nonggeuna, rhizoma, or neck and extract alone (see Fig. 1).

본 발명의 또 다른 실시예에서는 지방간을 유발한 마우스에 상기와 같이, 노근, 율초 또는 목과 추출물을 단독 혹은 혼합하여 경구투여하였다. 마우스에서 간 조직을 추출하고 분쇄한 뒤 키트를 사용하여 중성지질을 정량한 결과, 각 추출물을 처리하였을 때 중성지질이 감소하는 것을 확인하였고, 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 중성지질이 더 감소하는 것을 확인할 수 있었으며, 노근과 율초를 1:1의 중량비로 혼합한 경우에 중성지질의 양이 가장 적은 것을 확인할 수 있었다(도 2 참조).In another embodiment of the present invention, as described above, the mouse induced by fatty liver is administered orally, alone or in combination, with lice, thymus, or throat and extract. After extracting and pulverizing the liver tissues from the mice, the neutral lipids were quantified using the kit. As a result, it was confirmed that the neutral lipids decreased when each extract was treated. It was confirmed that the neutral lipid was further reduced when the cholesterol + cholesterol was mixed, and it was confirmed that the amount of neutral cholesterol was lowest when the cholestyramine and cholesterol were mixed at a weight ratio of 1: 1 (see FIG. 2).

본 발명의 또 다른 실시예에서는 지방간을 유발한 마우스에 상기와 같이, 노근, 율초 또는 목과 추출물을 단독 혹은 혼합하여 경구투여하였다. 마우스에서 간 조직을 추출한 뒤 mRNA를 추출하여 RT-PCR 방법으로 FAS(fatty acid synthase) 및 SCD1(Stearoy-CoA desaturase-1)의 발현량을 측정한 결과, 각 추출물을 처리하였을 때 FAS 및 SCD1의 발현량이 감소하는 것을 확인하였고, 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 FAS 및 SCD1의 발현량이 더 감소하는 것을 확인할 수 있었으며, 노근과 율초를 1:1의 중량비로 혼합한 경우에 FAS 및 SCD1의 발현량이 가장 적은 것을 확인할 수 있었다(도 3 및 도 4 참조).In another embodiment of the present invention, as described above, the mouse induced by fatty liver is administered orally, alone or in combination, with lice, thymus, or throat and extract. The expression levels of FAS (fatty acid synthase) and SCD1 (Stearoy-CoA desaturase-1) were measured by RT-PCR after extracting liver tissues from mice. FAS and SCD1 The expression level of FAS and SCD1 was decreased in the case of the combination of the canine + neck, the canine + oocyte, and the oocyte + neck. 1, the expression amount of FAS and SCD1 was the smallest (see Figs. 3 and 4).

본 발명의 또 다른 실시예에서는 지방간을 유발한 마우스에 상기와 같이, 노근, 율초 또는 목과 추출물을 단독 혹은 혼합하여 경구투여한 다음 혈액을 추출하였고, ELISA 키트를 사용하여 TNF-α 및 아디포넥틴(adiponectin)의 양을 측정한 결과, 각 추출물을 처리하였을 때 TNF-α의 농도가 감소하고, 아디포넥틴이 증가하는 것을 확인하였고, 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 TNF-α의 농도가 더 감소하고 아디포넥틴이 더 증가하는 것을 확인할 수 있었다. 또한 노근과 율초를 2:1의 중량비로 혼합한 경우에 TNF-α의 농도가 가장 적은 것을 확인할 수 있었으며, 1:1의 중량비로 혼합한 경우에 아디포넥틴의 농도가 가장 높은 것을 확인할 수 있었다(도 5 및 도 6 참조).In another embodiment of the present invention, blood was extracted from orally administered to the mice induced by fatty liver, as described above, either alone or in combination, and the blood was extracted. Using an ELISA kit, TNF-α and adiponectin ), The concentration of TNF-α was decreased and adiponectin was increased when each extract was treated. It was confirmed that the combination of canine + neck, canine + ulcer, ulcer + In one case, it was confirmed that the concentration of TNF-α was further decreased and adiponectin was further increased. In addition, it was confirmed that the concentration of TNF-α was the lowest when the mixture of Angelica keiskei kerosene and Rhizoma tendon was mixed at a weight ratio of 2: 1, and it was confirmed that the concentration of adiponectin was the highest when the mixture was mixed at a weight ratio of 1: 1 5 and Fig. 6).

따라서, 본 발명은 노근 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비 예방, 개선 또는 치료용 조성물을 제공한다. 본 발명의 방법은 노근 및 율초 추출물 또는 노근, 율초 및 목과 혼합물을 포함하는 조성물을 이용하여 지방간, 고지혈증을 예방 또는 치료하거나, 변비를 예방 또는 개선하는 데에 유용하게 이용될 수 있다. Accordingly, the present invention provides a composition for preventing, ameliorating or treating fatty liver, hyperlipidemia and constipation, which comprises an extract of Angelica keiskei and Rhizoma extract as an active ingredient. The method of the present invention can be usefully used to prevent or treat fatty liver, hyperlipemia, or prevent or ameliorate constipation by using a composition comprising candy and chrysanthemum extract or a mixture comprising candy, chopsticks and neck.

도 1은 간에서 추출한 세포를 배양하여 Oil red o 용액으로 염색한 결과를 나타낸 것이다(ND: Normal diet(정상식이), HFD: High fat diet(고지방식이), 1: 노근, 2: 목과, 3: 율초).
도 2A는 노근, 목과, 율초의 단독 추출물과 혼합물을 투여한 마우스의 간에서 중성지질을 정량한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 2: 목과, 3: 율초).
도 2B는 노근 및 율초의 단독 추출물과 중량비를 다르게 한 혼합물을 투여한 마우스의 간에서 중성지질을 정량한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 3: 율초)
도 3A는 노근, 목과, 율초의 단독 추출물과 혼합물을 투여한 마우스의 간에서 mRNA를 추출하여 RT-PCR 법으로 FAS(fatty acid synthase)의 발현량을 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 2: 목과, 3: 율초).
도 3B는 노근 및 율초의 단독 추출물과 중량비를 다르게 한 혼합물을 투여한 마우스의 간에서 mRNA를 추출하여 RT-PCR 법으로 FAS(fatty acid synthase)의 발현량을 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 3: 율초).
도 4A는 노근, 목과, 율초의 단독 추출물과 혼합물을 투여한 마우스의 간에서 mRNA를 추출하여 RT-PCR 법으로 SCD1 (Stearoyl-CoA desaturase-1)의 발현량을 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 2: 목과, 3: 율초).
도 4B는 노근 및 율초의 단독 추출물과 중량비를 다르게 한 혼합물을 투여한 마우스의 간에서 mRNA를 추출하여 RT-PCR 법으로 SCD1 (Stearoyl-CoA desaturase-1)의 발현량을 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 3: 율초).
도 5A는 노근, 목과, 율초의 단독 추출물과 혼합물을 투여한 마우스의 혈액에서 ELISA 법으로 혈액 내 TNF-α의 농도를 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 2: 목과, 3: 율초).
도 5B는 노근 및 율초의 단독 추출물과 중량비를 다르게 한 혼합물을 투여한 마우스의 혈액에서 ELISA 법으로 혈액내 TNF-α의 농도를 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 3: 율초,)
도 6A는 노근, 목과, 율초의 단독 추출물과 혼합물을 투여한 마우스의 혈액에서 ELISA 법으로 혈액내 아디포넥틴(adiponectin)의 농도를 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 2: 목과, 3: 율초).
도 6B는 노근 및 율초의 단독 추출물과 중량비를 다르게 한 혼합물을 투여한 마우스의 혈액에서 ELISA 법으로 혈액내 아디포넥틴(adiponectin)의 농도를 측정한 것을 그래프로 나타낸 것이다(HFD: High fat diet(고지방식이), 1: 노근, 3: 율초).
FIG. 1 shows the result of culturing cells extracted from liver and staining with Oil red o solution (ND: normal diet, HFD: high fat diet, high fat diet, low fat diet, 3.
FIG. 2A is a graph showing the determination of neutral lipids in the liver of mice administered with the extracts of roots, necks, and yuchos and the mixture (HFD: high fat diet, 1: roots, 2: 3.
FIG. 2B is a graph showing the determination of neutral lipids in the liver of a mouse to which a mixture of squamous and juvenile extracts was administered in a weight ratio different from that of the extract (HFD: high fat diet, 1: In addition,
FIG. 3A is a graph showing the expression of FAS (fatty acid synthase) expressed by RT-PCR using mRNA extracted from liver of mice, mice, and rats administered with the mixture (HFD: High fat diet, high fat diet, low fat diet, low fat diet, high fat diet, high fat diet.
FIG. 3B is a graph showing the expression level of FAS (fatty acid synthase) by RT-PCR after extracting mRNA from the liver of a mouse to which a mixture of squamous cell carcinoma and goat juice having different weight ratio was administered (HFD : High fat diet (high fat diet), 1: follicle, 3: follicle.
FIG. 4A is a graph showing the expression level of SCD1 (Stearoyl-CoA desaturase-1) by RT-PCR after extracting mRNA from the liver of mice administered with the extracts of squamous cell carcinoma, HFD: High fat diet, 1: noodles, 2: neck and 3: cholesterol.
FIG. 4B is a graph showing the expression levels of SCD1 (Stearoyl-CoA desaturase-1) by RT-PCR using mRNA extracted from the liver of a mouse to which a mixture of squamous and juvenile extracts was administered in different weight ratios (HFD: High fat diet, 1: noodles, 3: chow).
FIG. 5A is a graph showing the concentration of TNF-α in the blood by ELISA in the blood of a mouse administered with a combination of soleus, throat, and yucho extracts and a mixture (HFD: high fat diet, 1: nogeun, 2: neck, and 3: chorus).
FIG. 5B is a graph showing the concentration of TNF-α in the blood by ELISA in the blood of a mouse to which a mixture having a weight ratio different from that of a single extract of Angelica keiskei koidz. ), 1: noose, 3:
FIG. 6A is a graph showing the concentration of adiponectin in the blood by ELISA in the blood of a mouse administered with a single extract and a mixture of rabbit, throat, and uricosum (HFD: high fat diet) , 1: follicle, 2: neck, and 3: follicle).
FIG. 6B is a graph showing the concentration of adiponectin in the blood by ELISA in the blood of a mouse to which a mixture of squamous and perennial extracts was administered at a different weight ratio (HFD: high fat diet 1), 1: inferior, 3: inferior).

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

<실험방법><Experimental Method>

노근, 율초 및 목과 추출물의 제조.Manufacture of carrageenan, rhinorrhea, and throat and extracts.

노근(Phragmitis Rhizoma), 율초 및 목과를 분쇄하여 각각의 중량의 10배의 물을 넣고 90~100℃에서 5~15시간 동안 가열하여 추출하였다. 추출액은 25 마이크론 필터를 이용하여 여과하였고, 여과된 추출액은 농축온도 70~75℃에서 26bx까지 농축하였다. 농축된 원료는 스프레이 건조기를 이용하여 건조하였다. 그 다음, 노근:율초=1:1~3의 중량비율로 혼합하여 혼합물을 제조하였고, 노근:율초:목과를 1:1:1의 중량비율로 혼합하여 혼합물을 제조하였다.Phragmitis Rhizoma, Chrysanthemum morifolium and Chrysanthemum were crushed and 10 times as much water as each weight was added and extracted by heating at 90 to 100 ° C for 5 to 15 hours. The extract was filtered using a 25 micron filter, and the filtered extract was concentrated to 26 bx at a concentration of 70-75 ° C. The concentrated material was dried using a spray dryer. Then, the mixture was prepared by mixing the mixture at a ratio by weight of 1: 1 to 3: 1: 1 to 3, and the mixture was prepared by mixing the mixture of weevil, liquorice and sorghum in a weight ratio of 1: 1: 1.

동물실험Animal experiment

6주령의 C57BL/6 mouse를 구입하여 사용하였다. 일반사료와 물을 충분히 공급하고 실온 22 ± 2℃, 습도 50~70%, 조명시간 12시간(08:00∼20:00), 조도 150∼300 Lux로 설정하여 1주일간 실험실 환경에 적응시킨 후 실험에 사용하였다. 6-week-old C57BL / 6 mice were purchased and used. After a sufficient feed of normal diet and water was set at room temperature of 22 ± 2 ° C, humidity of 50 ~ 70%, illumination time of 12 hours (08:00 ~ 20:00) and illumination of 150 ~ 300 Lux, Was used for the experiment.

비알코올성 지방간을 유벌하기 위하여 고지방 식이(High Fat Diet, HFD)용 사료를 중앙실험동물에서 공급받아 8주 동안 자유롭게 섭취하도록 하였다. 이 때, 사료조성에서 실험 결과에 영향을 줄만한 요인을 배제 하였다. 그 다음 노근 추출물, 율초 추출물, 목과 추출물, 노근 추출물+율초 추출물, 노근 추출물+목과 추출물, 목과 추출물+율초 추출물의 조합으로 총량이 500 mg/kg이 되도록 하여 경구투여를 실시하였다.High Fat Diet (HFD) feeds were fed from a central laboratory animal for 8 weeks to induce nonalcoholic fatty liver disease. At this time, factors that might affect the experimental results in feed composition were excluded. Then, oral administration was carried out so that the total amount was 500 mg / kg in combination with egg root extract, chrysanthemum extract, neck and extract, egg root extract + chrysanthemum extract, egg root extract + neck and extract, neck and extract +

<실시예 1>&Lt; Example 1 >

노근 및 율초 혼합물이 간에 미치는 영향Influence of Angelica keiskei and Chrysanthemum mixture on liver

노근 및 율초 추출물이 간에 미치는 영향을 알아보기 위하여 다음과 같이 실험을 실시하였다.In order to investigate the effect of ginseng extract and ginseng extract on the liver, the following experiment was conducted.

상기 실험방법에 따라 고지방식이(HFD)를 한 마우스에 노근 추출물(1), 목과 추출물(2), 율초 추출물(3), 노근 추출물+목과 추출물(1+2), 노근 추출물+율초 추출물(1+3), 목과 추출물+율초 추출물(2+3)을 투여한 마우스로부터 얻은 간 조직을 추출하였다. 마우스로부터 얻은 간 조직으로 동결절편을 만든 뒤, 0.5% oil red o 시약(Sigma)으로 첨가하여 상온에 방치하여, 염색을 시행하였다. 그 다음 PBS로 5회 세척 후 현미경(Axiostarplus; Carl Zeiss, Germany)을 이용하여 관찰하였다.According to the above experimental method, a mouse with high-fat diet (HFD) was administered with the extract of Angelica japonica (1), the extract of the neck and the extract of Chrysanthemum japonica (3) 1 + 3), extracts from the neck and extracts (2 + 3). After the frozen section was prepared from the liver tissue obtained from the mouse, 0.5% oil red o reagent (Sigma) was added and allowed to stand at room temperature for staining. The cells were then washed five times with PBS and then observed using a microscope (Axiostarplus; Carl Zeiss, Germany).

그 결과 도 1에서 나타난 바와 같이, 정상식이(ND)를 실시한 경우보다 고지방 식이(HFD)를 실시한 경우에 지방량이 증가한 것으로 나타났고, 각 추출물을 처리한 경우에 지방량이 감소하는 것으로 나타났다. 또한 노근, 율초 또는 목과 추출물을 단독으로 처리한 군에 비해, 각각의 혼합물을 처리한 경우에 지방량이 더 적은 것으로 나타났다. 또한 각 추출물을 단독으로 처리한 경우보다 혼합물(1+2, 1+3, 2+3)을 처리한 경우에 더 지방량이 적은 것으로 나타났다.As a result, as shown in FIG. 1, when the high fat diet (HFD) was performed, the fat amount was increased and the fat amount was decreased when each extract was treated. In addition, the amount of fat was lower when each mixture was treated, compared to the group treated with soleus, ochoko, or neck and extract alone. In addition, it was found that the amount of fat was lower when the mixture (1 + 2, 1 + 3, 2 + 3) was treated than when each extract was treated alone.

<실시예2> &Lt; Example 2 >

노근 및 율초 혼합물이 중성지질(triglyceride)의 양에 미치는 영향Effect of Mixture of Rhizome and Rhizoma on the Amount of Triglyceride

노근 및 율초 추출물이 간에서 중성지질의 양에 미치는 영향을 알아보기 위하여 다음과 같이 실험을 실시하였다.In order to investigate the effects of nonggue and rhizome extract on the amount of triglyceride in the liver, the following experiment was conducted.

상기 실험방법에 따라 고지방식이(HFD)를 한 마우스에 노근 추출물(1), 목과 추출물(2), 율초 추출물(3), 노근 추출물+목과 추출물(1+2), 노근 추출물+율초 추출물(1+3), 목과 추출물+율초 추출물(2+3)을 투여한 마우스로부터 얻은 간 조직을 추출하였다. 그 다음, 0.5g의 간 조직을 PBS에 넣은 뒤 분쇄한 뒤, 원심분리하여 상층액을 수득하여 샘플을 준비하였다. 제조사의 지침에 따라 Triglyceride assay kit(Abcam)을 사용하여 샘플에 혼입되어 있는 중성지질 정량을 실시하였다. According to the above experimental method, a mouse with high-fat diet (HFD) was administered with the extract of Angelica japonica (1), the extract of the neck and the extract of Chrysanthemum japonica (3) 1 + 3), extracts from the neck and extracts (2 + 3). Then, 0.5 g of liver tissue was placed in PBS, followed by pulverization, followed by centrifugation to obtain a supernatant to prepare a sample. Triglyceride assay kit (Abcam) was used to quantify the amount of neutral lipids incorporated in the sample according to the manufacturer's instructions.

그 결과는 도 2에서 나타내었다.The results are shown in Fig.

정상식이를 한 대조군에 비해 고지방식이를 한 경우에 중성지질이 증가하는 것으로 나타났고, 각 추출물을 처리하였을 때 중성지질이 감소하는 것으로 나타났다. 또한 각 추출물을 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 중성지질이 더 감소하는 것으로 나타났다(도 2A). The neutral lipid was increased in the high fat diet compared with the control diet, and the neutral lipid decreased in each of the treatments. In addition, the neutral lipids were further decreased in the case of mixing the canine + the neck, the canine + the ulcer, the ulcer + the neck (Fig. 2A) than the case of each extract alone.

또한, 노근 및 율초 추출물을 각각 다른 비율(노근:율초= 3:1, 2:1, 1:1, 1:2, 1:3의 중량비)으로 혼합하여 처리하였을 때, 노근과 율초를 1:1의 중량비로 혼합한 경우에 중성지질의 양이 가장 적은 것으로 나타났다.In addition, when the root and root extracts were mixed and treated in different ratios (weight ratio: 3: 1, 2: 1, 1: 1, 1: 2, 1: 3 weight ratio) 1, the amount of neutral grains was the lowest.

이를 통해, 노근, 율초 및 목과 추출물을 각기 단독으로 처리하는 경우보다 혼합물을 처리하는 경우가 중성지방 침착을 억제하는 효과가 좋은 것을 확인할 수 있었고, 노근 및 율초를 1:1의 중량비로 혼합한 혼합물의 경우에 중성지방 침착을 억제하는 효과가 가장 좋은 것을 확인할 수 있었다.It was confirmed that the effect of the treatment of the mixture on the neutral fat deposition was better than that of the case of the treatment of the hair follicle, the hair follicle, the hair follicle, and the extract of the hair follicle. The effect of suppressing triglyceride deposition was the best.

<실시예 3>&Lt; Example 3 >

노근 및 율초 혼합물이 중성지질(triglyceride)의 생성에 미치는 영향Effects of Mixture of Rhizobium and Rhizobium on the Production of Triglyceride

노근 및 율초 추출물이 간에서 중성지질의 생성에 미치는 영향을 알아보기 위하여 다음과 같이 실험을 실시하였다.In order to investigate the effect of the mulberry and perilla extracts on the production of neutrophil in the liver, the following experiment was conducted.

상기 실험방법에 따라 고지방식이(HFD)를 한 마우스에 노근 추출물(1), 목과 추출물(2), 율초 추출물(3), 노근 추출물+목과 추출물(1+2), 노근 추출물+율초 추출물(1+3), 목과 추출물+율초 추출물(2+3)을 투여한 마우스로부터 간을 추출하였고, 추출한 간의 일부를 사용하였다. 간 조직에 TRIaol(Invitrogen)을 처리하고, 균질화(homogenization)하였다. 그 다음 당업계에 알려진 방법에 따라 RNA를 추출하여, cDNA로 합성하였다. 그 다음 real-time RT-PCR 방법을 이용하여 FAS(fatty acid synthase) 및 SCD1(Stearoy-CoA desaturase-1)의 발현량을 측정하였다. 상기 real-time RT-PCR에서 사용한 프라이머는 하기 표 1에 기재되어 있다.According to the above experimental method, a mouse with high-fat diet (HFD) was administered with the extract of Angelica japonica (1), the extract of the neck and the extract of Chrysanthemum japonica (3) 1 + 3), extracts from the neck and extracts (2 + 3), and some of the extracts were used. Liver tissues were treated with TRIaol (Invitrogen) and homogenized. RNA was then extracted and cDNA synthesized according to methods known in the art. Then, the amount of expression of FAS (fatty acid synthase) and SCD1 (Stearoy-CoA desaturase-1) was measured using a real-time RT-PCR method. The primers used in the real-time RT-PCR are shown in Table 1 below.

프라이머 정보Primer Information 명칭designation 서열order 서열번호SEQ ID NO: FAS forwardFAS forward tgatagccgg tatgtcgggg tgatagccgg tatgtcgggg 1One FAS reverseFAS reverse agaccgcttg ggtaatccatagaccgcttg ggtaatccat 22 SCD1 forwardSCD1 forward gcacctccct ccggaaatga gcacctccct ccggaaatga 33 SCD1 reverseSCD1 reverse tactccagct tgggcgggggtactccagct tgggcggggg 44 β-actin forwradβ-actin forwrad tatcgctgcg ctggtcgtcg tatcgctgcg ctggtcgtcg 55 β-actin reverseβ-actin reverse ccttctgacc cattcccaccccttctgacc cattcccacc 66

그 결과를 도 3 및 도 4에 나타냈다.The results are shown in Fig. 3 and Fig.

대조군에 비해 고지방식이를 한 경우에 FAS 및 SCD1의 발현량이 높은 것으로 나타났고, 각 추출물을 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 FAS 및 SCD1의 발현량이 더 적은 것으로 나타났다(도 3A, 도 4A). The expression levels of FAS and SCD1 were higher in the high fat diet compared to the control group. When FAS and SCD1 were mixed, (Fig. 3A, Fig. 4A).

상기 혼합물 중에서 노근 및 율초 추출물을 각각 다른 비율(노근:율초= 3:1, 2:1, 1:1, 1:2, 1:3의 중량비)으로 혼합하여 처리하였을 때, 노근과 율초를 1:1의 중량비로 혼합한 경우에 FAS와 SCD1의 발현량이 가장 적은 것으로 나타났다(도 3B, 도 4B).When the mixture was treated with different amounts of canine and chrysanthemum extracts in different ratios (weight ratio: 3: 1, 2: 1, 1: 1, 1: 2, 1: 3 weight ratio) : 1, the expression level of FAS and SCD1 was the lowest (FIG. 3B, FIG. 4B).

이를 통해, 노근, 율초 및 목과 추출물을 단독으로 처리하는 경우보다 혼합물을 처리하는 경우에 지질 신생합성과 관련된 유전자인 FAS와 SCD1의 발현량이 감소하는 것을 확인할 수 있었으며, 특히 노근 및 율초를 1:1의 중량비로 혼합한 경우에 FAS와 SCD1의 발현량이 현저하게 감소하는 것을 확인할 수 있었다. These results indicate that the expression of FAS and SCD1, which are involved in lipidogenesis synthesis, is decreased in the case of treatment of the mixture than in the case of the treatment of the hair follicle, It was confirmed that the expression level of FAS and SCD1 significantly decreased.

<실시예 4><Example 4>

노근 및 율초 혼합물이 중성지질(triglyceride)의 생성에 미치는 영향Effects of Mixture of Rhizobium and Rhizobium on the Production of Triglyceride

노근 및 율초 추출물이 체내에서 항염증 활성에 미치는 영향을 알아보기 위하여 다음과 같이 실험을 실시하였다.In order to investigate the effects of nonggue and rhizome extracts on the antiinflammatory activity in the body, the following experiment was conducted.

상기 실험방법에 따라 고지방식이(HFD)를 한 마우스에 노근 추출물(1), 목과 추출물(2), 율초 추출물(3), 노근 추출물+목과 추출물(1+2), 노근 추출물+율초 추출물(1+3), 목과 추출물+율초 추출물(2+3)을 투여한 마우스로부터 혈액을 추출하였다. 제조사의 지침에 따라 ELISA kit(R&D systems)를 사용하여 염증성 사이토카인인 TNF-α와 항염증 아디포카인인 아디포넥틴(adiponectin)의 양을 측정하였다.According to the above experimental method, a mouse with high-fat diet (HFD) was administered with the extract of Angelica japonica (1), the extract of the neck and the extract of Chrysanthemum japonica (3) 1 + 3), and extracts from the neck and the extract + 2/3. The amount of TNF-alpha, an inflammatory cytokine, and adiponectin, an anti-inflammatory adipokine, was measured using an ELISA kit (R & D systems) according to the manufacturer's instructions.

그 결과 도 5에 나타난 바와 같이, 대조군에 비해 고지방식이를 한 경우에 TNF-α의 농도가 높은 것으로 나타났고, 각 추출물을 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 TNF-α의 농도가 감소하는 것으로 나타났다(도 5A). 또한, 상기 혼합물 중에서 노근 및 율초 추출물을 각각 다른 비율(노근:율초= 3:1, 2:1, 1:1, 1:2, 1:3의 중량비)로 혼합하여 처리하였을 때, 노근과 율초를 2:1의 중량비로 혼합한 경우에 TNF-α의 농도가 가장 적은 것으로 나타났다(도 5B).As a result, as shown in FIG. 5, the concentration of TNF-α was higher in the case of high-fat diet than in the control, and the amount of TNF-α was higher than that of the control alone The concentration of TNF-a decreased (FIG. 5A). In addition, when lambskin and chrysanthemum extract were mixed and treated in different ratios (weight ratio of lambskin: rhizome = 3: 1, 2: 1, 1: 1, 1: 2, 1: 3) Was mixed at a weight ratio of 2: 1, the concentration of TNF-? Was the lowest (FIG. 5B).

또한 도 6에 나타난 바와 같이, 대조군에 비해 고지방식이를 한 경우 아디포넥틴(adiponectin)이 감소하는 것으로 나타났고, 각 추출물을 단독으로 처리한 경우보다 노근+목과, 노근+율초, 율초+목과를 혼합한 경우에 아디포넥틴이 증가하는 것으로 나타났다. 이중 노근과 율초의 혼합물을 다른 비율(노근:율초= 3:1, 2:1, 1:1, 1:2, 1:3의 중량비)로 혼합하여 처리하였을 때, 노근과 율초를 1:1의 중량비로 혼합한 경우에 아디포넥틴의 농도가 가장 높은 것으로 나타났다.As shown in FIG. 6, adiponectin was decreased in the high-fat diet compared to the control group, and the amount of adiponectin was decreased by the addition of the canine + neck, the canine + ulcer, In one case, adiponectin was found to increase. When the mixture of double sheath and ursuos was mixed and treated in different ratios (weevil: sheep: 3: 1, 2: 1, 1: 1, 1: 2, 1: 3 weight ratio) , The concentration of adiponectin was the highest.

이를 통해, 노근, 율초 및 목과 추출물을 단독으로 처리하는 경우보다 혼합물을 처리하는 경우에 고지방 식이에 의한 TNF-α를 감소시키고 아디포넥틴을 증가시키는 것을 확인하였으며, 특히 노근 및 율초를 1:1의 중량비로 혼합한 경우에 현저한 효과를 나타내는 것을 확인할 수 있었다. It was confirmed that TNF-α was decreased and adiponectin was increased by high fat diet in the case of treatment of the mixture, compared with the case of treating alone, with or without herring root, It was confirmed that a remarkable effect was obtained.

이상 살펴본 바와 같이 본 발명의 방법은 노근 및 율초 추출물 또는 노근, 율초 및 목과 혼합물을 포함하는 조성물을 이용하여 지방간, 고지혈증을 예방 또는 치료하거나, 변비를 예방 또는 치료하는 데에 유용하게 이용될 수 있다.As described above, the method of the present invention can be usefully used for preventing or treating fatty liver, hyperlipemia, or preventing or treating constipation by using a composition comprising calendula and chrysanthemum extract or a composition comprising calendula, .

<110> SUN, YUAN LU JEONG, JI HOON <120> Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract <130> NP17-0015 <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS forward <400> 1 tgatagccgg tatgtcgggg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS reverse <400> 2 agaccgcttg ggtaatccat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD1 forward <400> 3 gcacctccct ccggaaatga 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD1 reverse <400> 4 tactccagct tgggcggggg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forwrad <400> 5 tatcgctgcg ctggtcgtcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse <400> 6 ccttctgacc cattcccacc 20 <110> SUN, YUAN LU          JEONG, JI HOON <120> Composition for prevention, improving or treating fatty liver          diseases, hyperlipidemia and constipation comprising Phragmites          Rhizoma and Humulus japonicus extract <130> NP17-0015 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS forward <400> 1 tgatagccgg tatgtcgggg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS reverse <400> 2 agaccgcttg ggtaatccat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD1 forward <400> 3 gcacctccct ccggaaatga 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD1 reverse <400> 4 tactccagct tgggcggggg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forwrad <400> 5 tatcgctgcg ctggtcgtcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse <400> 6 ccttctgacc cattcccacc 20

Claims (7)

노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물.
And at least one disease selected from the group consisting of fatty liver, hyperlipidemia, and constipation, wherein the composition comprises atorvastatin and chrysanthemum extract as an active ingredient.
제1항에 있어서, 상기 조성물은 노근 및 율초의 중량비율이 1:0.5~5인 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물.
2. The food composition according to claim 1, wherein the composition has a weight ratio of lambskin and yellowness ratio of 1: 0.5 to 5. 5. A food composition for preventing or improving at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation.
제1항에 있어서, 상기 조성물에 목과 추출물을 추가로 더 포함하는 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물.
The food composition according to claim 1, wherein the composition further comprises a nourishment and an extract. The composition for preventing or improving at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation.
제1항에 있어서, 상기 지방간 질환은 비알코올성 지방간 질환 또는 단순성 지방간인 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 개선용 식품 조성물.
The food composition according to claim 1, wherein the fatty liver disease is a non-alcoholic fatty liver disease or a simple fatty liver, wherein the composition is for prevention or improvement of at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation.
노근 추출물 및 율초 추출물을 유효성분으로 포함하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물.
A herbal extract, a herbal extract and a chrysanthemum extract as an active ingredient, a hyperlipemia and a constipation.
제5항에 있어서, 상기 조성물에 목과 추출물을 추가로 더 포함하는 것을 특징으로 하는 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물.
[Claim 7] The pharmaceutical composition according to claim 5, wherein the composition further comprises a neck and an extract. The pharmaceutical composition for preventing or treating at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation.
제5항에 있어서, 상기 지방간 질환은 비알코올성 지방간 질환 또는 단순성 지방간인 것을 특징으로 지방간, 고지혈증 및 변비로 이루어진 군에서 선택된 하나 이상의 질환의 예방 또는 치료용 약학적 조성물.The pharmaceutical composition according to claim 5, wherein the fatty liver disease is a non-alcoholic fatty liver disease or a simple fatty liver. The pharmaceutical composition for preventing or treating at least one disease selected from the group consisting of fatty liver, hyperlipidemia and constipation.
KR1020170043805A 2017-04-04 2017-04-04 Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract KR102098264B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020170043805A KR102098264B1 (en) 2017-04-04 2017-04-04 Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020170043805A KR102098264B1 (en) 2017-04-04 2017-04-04 Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract

Publications (2)

Publication Number Publication Date
KR20180112561A true KR20180112561A (en) 2018-10-12
KR102098264B1 KR102098264B1 (en) 2020-04-10

Family

ID=63876620

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170043805A KR102098264B1 (en) 2017-04-04 2017-04-04 Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract

Country Status (1)

Country Link
KR (1) KR102098264B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102136662B1 (en) * 2019-02-14 2020-07-22 중앙대학교 산학협력단 Composition for preventing or treating ileus comprising humulus japonicus extract

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130102295A (en) * 2012-03-07 2013-09-17 손원록 Composition comprising extract of humulus japonicus or humulus scandens for preventing or treating of metabolic diseases
KR20160094313A (en) * 2015-01-29 2016-08-09 재단법인 전주농생명소재연구원 Composition for anti-obesity comprising Chaenomelis Fructus extract or its fraction as effective component

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130102295A (en) * 2012-03-07 2013-09-17 손원록 Composition comprising extract of humulus japonicus or humulus scandens for preventing or treating of metabolic diseases
KR20160094313A (en) * 2015-01-29 2016-08-09 재단법인 전주농생명소재연구원 Composition for anti-obesity comprising Chaenomelis Fructus extract or its fraction as effective component

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
갈대뿌리 효능, 갈대뿌리 부작용은?, Bonghemian, (2017.02.23.),(https://bonghemian.tistory.com/106) 1부.* *

Also Published As

Publication number Publication date
KR102098264B1 (en) 2020-04-10

Similar Documents

Publication Publication Date Title
US20200171115A1 (en) Composition for preventing or treating visceral fat obesity containing extract of salvia miltiorrhiza radix
KR101756804B1 (en) Functional composition for anti-inflammation and anti-diabetic comprising the extract from a leaf of Angelica gigas Nakai and manufacturing method for functional sauce using the same
KR102182724B1 (en) Antiinflammatory composition comprising Locusta migratoria extract
KR101760512B1 (en) Compositions comprising mixed herbal extracts for preventing, treating or improving chronic inflammatory diseases
KR20190043997A (en) Composition for prevention or treatment respiratory diseases comprising combination extracts of Chrysanthemum morifolium Ramatuelle and Scutellaria baicalensis as an active ingredient
KR20180030274A (en) Composition for the prevention and treatment of Inflammatory Bowl Disease
JP2021514993A (en) Compositions for the prevention, amelioration or treatment of cachexia and muscle loss
KR102002298B1 (en) Compositions for preventing, ameliorating or treating hyperuricemia or metabolic disorders associated with hyperuricemia comprising herbal extracts
CN104940258A (en) Traditional Chinese medicine extractive composition with gastric mucosa protecting function
KR101497109B1 (en) Composition for preventing, improving, or treating a disease controlled by PPAR action
EP1583547B1 (en) Anti-obesity ingredients from medicinal plants and their composition
KR102098264B1 (en) Composition for preventing, improving or treating fatty liver diseases, hyperlipidemia and constipation comprising Phragmitis Rhizoma and Humulus japonicus extract
KR20200081553A (en) Composition for the prevention and improvement of Antitussive and Expectorant
KR20200021738A (en) Composition comprising Forsythia velutina extract for preventing, improving or treating respiratory disease
KR100685472B1 (en) Composition using vinegar processed ginseng preparation for treatment and prevention of type ? diabetes and metabolic syndrome
KR101157214B1 (en) Composition for the prevention and treatment of lipid-related cardiovascular disease or obesity containing the extracts of Dipsacus asperoides as active ingredient
KR20220063029A (en) Composition for preventing or treating cachexia comprising medicinal herb complex extract
JP2000342228A (en) Formulated tea of smallanthus sonchifol with mulberry leaf
KR101181347B1 (en) Composition for the prevention and treatment of lipid-related cardiovascular disease or obesity containing the extracts of Dictamnus dasycarpus as active ingredient
KR101796924B1 (en) Composition for improving hepatic function containing ginseng berry extracts
KR20140064067A (en) Compositions for preventing and treating diabetes or diabetic complications comprising extracts of zanthoxylum piperitum and piper nigrum
KR100473529B1 (en) Composition comprising an extract of sungisan crude drug complex as an effective ingredient for preventing and treating diabetes
KR20040097026A (en) A preventable, curative herb composition of atopic dermatitis and its manufacturing method
KR101451809B1 (en) Composition for Preventing, Treating or Improving of Metabolic Disease comprising Coix Iachryma-jobi and Cudrania tricuspidata Leaf as an Active Ingredient
KR100478150B1 (en) Health care food comprising an extract of the crude drug complex as an effective ingredient for preventing diabetes

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E601 Decision to refuse application
X091 Application refused [patent]
AMND Amendment
E902 Notification of reason for refusal
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant