KR20180098191A - Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids - Google Patents

Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids Download PDF

Info

Publication number
KR20180098191A
KR20180098191A KR1020180098026A KR20180098026A KR20180098191A KR 20180098191 A KR20180098191 A KR 20180098191A KR 1020180098026 A KR1020180098026 A KR 1020180098026A KR 20180098026 A KR20180098026 A KR 20180098026A KR 20180098191 A KR20180098191 A KR 20180098191A
Authority
KR
South Korea
Prior art keywords
lung cancer
nrf2
keap1
clobetasol propionate
lkb1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
KR1020180098026A
Other languages
Korean (ko)
Other versions
KR101978629B1 (en
Inventor
전상민
Original Assignee
아주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단 filed Critical 아주대학교산학협력단
Publication of KR20180098191A publication Critical patent/KR20180098191A/en
Application granted granted Critical
Publication of KR101978629B1 publication Critical patent/KR101978629B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 글루코코르티코이드 계열 화합물, 글루코코르티코이드 계열 화합물 및 mTOR 억제제, 또는 글루코코르티코이드 계열 화합물 및 AMPK 억제제를 유효성분으로 포함하는 폐암 치료 또는 개선용 조성물에 관한 것으로, 상기 글루코코르티코이드 계열 화합물들은 KEAP1 돌연변이 폐암 또는 KEAP1 및 LKB1 돌연변이 폐암에서 NRF2 억제를 통해 암세포 성장을 억제하며, 상기 mTOR 억제제와 병용 시 더 강화된 항암 효과를 보이므로, 돌연변이 폐암의 항암제로 유용하게 사용될 수 있다. 또한 종양미세환경의 특징 중 하나인 저영양 환경은 KEAP1 및 LKB1 정상 폐암에서 NRF2 및 AMPK의 활성화를 유발하고, 상기 글루코코르티코이드 계열 화합물은 KEAP1 및 LKB1 정상 폐암에서 AMPK 억제제와 병용처리 시 저영양 상태에서 강력한 항암 시너지 효과를 보이므로, KEAP1 정상 폐암의 항암제로도 유용하게 사용될 수 있다.The present invention relates to a composition for treating or improving lung cancer, comprising a glucocorticoid compound, a glucocorticoid compound and an mTOR inhibitor, or a glucocorticoid compound and an AMPK inhibitor as an active ingredient, wherein the glucocorticoid compound is KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancers inhibit the growth of cancer cells through inhibition of NRF2 and exhibit a more potent anticancer effect when used in combination with the mTOR inhibitor. Therefore, they can be effectively used as anticancer drugs for mutant lung cancer. In addition, one of the features of tumor microenvironment, low nutrient environment, induces activation of NRF2 and AMPK in KEAP1 and LKB1 normal lung cancer, and the glucocorticoids are in a low nutritional state in combination with AMPK inhibitor in KEAP1 and LKB1 normal lung cancer Because of its strong anticancer synergy, it can also be used as an anticancer agent for KEAP1 normal lung cancer.

Description

글루코코르티코이드계 화합물을 포함하는 비소세포성 폐암 치료용 약학 조성물{Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids}Pharmaceutical Composition for Treating Non-small Cell Lung Cancer Comprising Glucocorticoids containing a glucocorticoid compound

본 발명은 폐암의 치료를 위한 조성물에 대한 것이다.The present invention relates to a composition for the treatment of lung cancer.

폐암(lung cancer)은 남녀 모두의 성별에서 두 번째로 흔히 발생하는 암으로, 모든 암에서 15%를 차지한다. 2011년 미국 암 학회(American cancer society)의 보고에 따르면 한 해 22만 환자 이상이 폐암으로 진단을 받으며 이중 약 70%가 사망에 이르는데, 이는 전체 암 사망 환자의 27%를 차지한다.Lung cancer is the second most common cancer in both sexes, accounting for 15% of all cancers. According to a report by the American Cancer Society in 2011, more than 220,000 patients are diagnosed with lung cancer a year, and about 70% of them die, accounting for 27% of all cancer deaths.

이러한 폐암 중에서도 비소세포성 폐암(non small lung cancer)은 상피성 암(carcinoma)의 일종으로 소세포성 폐암(small lung cancer)이 아닌 모든 상피성 폐암(epithelial lung cancer)을 일컬으며, 폐암 전체의 약 85% 내지 90%를 차지한다. 비소세포성 폐암의 증상은 지속적인 기침, 흉부 통증, 체중감소, 손톱 손상, 관절 통증, 호흡의 단기화(shortness of breath) 등이 있으나, 비소세포성 폐암은 일반적으로 천천히 진행되기 때문에 초기에는 그 증상을 거의 나타내지 않아 조기 발견 및 치료가 어렵고, 뼈, 간, 소장 및 뇌 등 전신에 전이된 후에야 발견될 가능성이 높다.Among these lung cancers, non-small lung cancer is a type of carcinoma and refers to all epithelial lung cancers, not small lung cancer. It accounts for 85% to 90%. Symptoms of non-small cell lung cancer include persistent cough, chest pain, weight loss, nail damage, joint pain, and shortness of breath. It is hardly present, so it is difficult to detect and treat early, and it is highly likely to be detected only after metastasis to the whole body such as bone, liver, small intestine, and brain.

소세포성 폐암에 비해 상대적으로 화학요법(chemotherapy)에 덜 민감한 비소세포성 폐암은 TNM 분류법에 기초하여 다음과 같이 암의 단계를 나눌 수 있다: 종양의 크기(the size of tumor), 국소 림프절(reginal lymph node)로의 암 확산 정도 및 암 전이(metastasis)의 유무.Non-small cell lung cancer, which is relatively less sensitive to chemotherapy than small cell lung cancer, can be divided into the following stages of cancer based on the TNM classification: the size of tumor, regional lymph nodes. The extent of cancer spread to lymph nodes and the presence or absence of metastasis.

비소세포성 폐암 중 초기의 비전이성(non-metastatic) 비소세포성 폐암의 경우. 화학요법 및 방사선에 대한 민감도가 매우 낮기 때문에 일반적으로 백금을 함유하는 시스플라틴(xisplatin)과 관련된 보조적인 화학요법(ancillary chemotherapy)과 함께 수술을 하게 된다. 반면에 초기 단계를 지나 전이성 비소세포성 폐암으로 발달한 경우에는 다양한 화학 요법 및 방사선 치료가 이루어진다.In the case of early non-metastatic non-small cell lung cancer among non-small cell lung cancer. Because the sensitivity to chemotherapy and radiation is very low, surgery is usually performed in conjunction with ancillary chemotherapy involving cisplatin containing platinum. On the other hand, in the case of developing metastatic non-small cell lung cancer past the initial stage, various chemotherapy and radiation treatments are performed.

또한, 비소세포성 폐암은 암세포의 크기, 모양 및 화학적 구성에 따라 몇 가지 하위 종류로 나뉘며, 대표적으로는 선암(adenocarcinoma), 편평상피암(squamous cell carcinoma), 대세포암(large cell carcinoma) 등이 있다. 선암은 전체 폐암의 40% 이상을 차지할 정도로 가장 높은 빈도로 발생하는 폐암으로, 폐의 바깥 부위(outer region)에서 발견되며 다른 폐암보다 천천히 진행되는 경향이 있으나, 초기 높은 전이 경향 및 방사성 저항성을 나타낸다. 편평상피암은 전체 폐암의 25%-30%를 차지하는 비소세포성 폐암의 한 종류로서, 기도(airway)를 이루고 있는 세포의 초기 단계(early version)에서 시작되며, 상기 암은 주로 흡연자에서 높은 발병률을 나타낸다. 또한, 전체 폐암의 10%-15% 정도를 차지하는 대세포암은 폐의 어느 부위에서나 발병할 수 있으며, 그 진행 속도가 소세포성 폐암(small cell lung cancer)과 유사할 만큼 빠르다. 하지만 이러한 높은 발병률과 사망률에도 불구하고 아직까지 비소세포성 폐암을 극복할 수 있는 어떤 약물 또는 치료 방법도 개발되지 못한 실정이다.In addition, non-small cell lung cancer is divided into several sub-types according to the size, shape, and chemical composition of cancer cells, and representatively, adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. have. Adenocarcinoma is lung cancer that occurs with the highest frequency, accounting for more than 40% of all lung cancers, and is found in the outer region of the lungs and tends to progress more slowly than other lung cancers, but shows a high tendency to metastasize and radioactive resistance in the early stages. . Squamous cell carcinoma is a type of non-small cell lung cancer that accounts for 25% to 30% of all lung cancers, and it starts in the early version of cells that make up the airway, and the cancer has a high incidence mainly in smokers. Show. In addition, large cell cancer, which accounts for 10% to 15% of all lung cancers, can develop in any part of the lung, and its progress is fast enough to be similar to that of small cell lung cancer. However, despite such high incidence and mortality, no drugs or treatment methods have been developed to overcome non-small cell lung cancer.

한편, 1970년대 내지 1980년대 종양 유발 및 억제 유전자가 처음 발견된 이후, 새로운 종양 특이적 변이 유전자의 발굴 및 이를 통한 신호전달 경로를 타겟으로 한 표적 항암 치료가 활발히 시도되어 왔으며 최근에는 이러한 항암 표적 치료 전략의 일환으로 미국과 영국을 중심으로 대규모 종양 유전체 프로젝트(TCGA, ICGC, CGP)가 진행되어 왔다. 그 결과, 특이적인 신호전달 과정을 표적으로 한 상피 성장 인자 수용체(Epidermal growth factor receptor. EGFR), 혈관 표피 성장인자(vascular endothelia growth factor, VEGF(R)), mTOR(라파마이신의 기전적 표적, mechanistic target of rapamycin) 억제제 등이 많은 기대를 받으며 개발되어 왔으나 예상만큼 큰 효과를 거두지 못했는데, 이의 원인으로 종양 유전체 프로젝트를 통해 확인된 다양하고 이질적인 돌연변이와 이를 통한 비정상적인 신호전달 경로의 다양성과 이질성 때문일 것으로 예상하고 있다.On the other hand, since the first discovery of tumor inducing and suppressing genes in the 1970s to 1980s, the discovery of new tumor-specific mutant genes and targeted anti-cancer treatments targeting the signaling pathways through the discovery have been actively attempted. As part of the strategy, large-scale tumor genome projects (TCGA, ICGC, CGP) have been carried out, mainly in the United States and the United Kingdom. As a result, epidermal growth factor receptor (EGFR), vascular endothelia growth factor (VEGF(R)), mTOR (mechanical target of rapamycin, Mechanistic target of rapamycin) inhibitors, etc., have been developed with high expectations, but did not produce as much effect as expected. The cause is likely due to the diversity and heterogeneity of various and heterogeneous mutations identified through the tumor genome project and abnormal signaling pathways through them. I'm expecting.

최근, 이러한 표적 항암 치료 전략의 한계점을 극복하기 위해 효과적인 병용 화합요법의 개발에 대한 시도가 많이 이루어지고 있다. 이를 위해 암에서 흔히 함께 발견되는 유전자 돌연변이 조합을 규명하기 위한 연구가 진행되어 왔고, 최근 연구에서 비소세포성 폐암에서 KEAP1(켈히-유사 ECH 연관 단백질 1, kelch-like ECH-associated protein 1) 유전자의 돌연변이와 LKB1(간 키나아제 B1, Liver kinase B1) 돌연변이가 흔히 함께 발생한다는 것이 보고되었다. KEAP1 돌연변이는 NRF2(핵 인자(에리트로이드 2)-유사인자 2, Nuclear factor(erythroid-derived 2)-like 2)의 활성화를 유도하고, KEAP1 돌연변이 폐암에서 NRF2의 발현을 억제하였을 때 암세포의 성장이 효과적으로 억제됨이 보고되어, NFR2 억제제의 개발에 대한 요구가 큰 상황이다. 그러나 천연물 스크리닝을 통해 발견된 몇 가지 NRF2 억제제가 보고되긴 했지만 그 효과가 미미하고 일관성이 없어 아직까지 임상적으로 개발 중인 약물은 없는 실정이다. 한편 LKB1 돌연변이는 mTORC1의 활성화를 유도하고, 현재 mTORC1의 억제제로 라파마이신을 비롯한 여러 가지 약물이 개발되어 있다. 따라서, KEAP1과 LKB1이 함께 돌연변이 되어 있는 비소세포성 폐암에서 활성화 되는 NRF2와 mTORC1을 함께 억제하는 병용 항암 전략이 매우 효과적일 것으로 기대되고 있으나, 아직 이에 대한 연구도 구체적으로 이루어지지 않은 실정이다.Recently, many attempts have been made to develop effective combination chemotherapy in order to overcome the limitations of such targeted anticancer treatment strategies. To this end, research has been conducted to identify the combination of gene mutations commonly found in cancer, and in a recent study, the KEAP1 (Kelch-like ECH-associated protein 1, kelch-like ECH-associated protein 1) gene has been studied. It has been reported that mutations and LKB1 (liver kinase B1) mutations often occur together. The KEAP1 mutation induces the activation of NRF2 (nuclear factor (erythroid 2)-like factor 2, nuclear factor (erythroid-derived 2)-like 2), and when the expression of NRF2 is suppressed in KEAP1 mutant lung cancer, the growth of cancer cells is increased. It has been reported that it is effectively inhibited, and there is a great demand for the development of NFR2 inhibitors. However, although several NRF2 inhibitors discovered through natural product screening have been reported, the effect is insignificant and inconsistent, so there are no drugs under clinical development yet. Meanwhile, LKB1 mutation induces the activation of mTORC1, and various drugs, including rapamycin, have been developed as inhibitors of mTORC1. Therefore, it is expected that a combination anticancer strategy that simultaneously inhibits NRF2 and mTORC1, which are activated in non-small cell lung cancer in which KEAP1 and LKB1 are mutated together, will be very effective, but studies on this have not been done in detail.

1. 한국공개특허 제10-2008-0018150호.1. Korean Patent Publication No. 10-2008-0018150.

본 발명의 목적은 폐암에서 흔히 활성화되어 있는 NRF2 활성을 억제하는 폐암 치료용 약학 조성물을 제공하는 것이다.It is an object of the present invention to provide a pharmaceutical composition for treating lung cancer that inhibits NRF2 activity, which is commonly activated in lung cancer.

본 발명의 목적은 폐암에서 흔히 활성화되어 있는 NRF2 활성을 억제하는 폐암 개선용 건강기능식품 조성물을 제공하는 것이다.It is an object of the present invention to provide a health functional food composition for improving lung cancer that inhibits NRF2 activity, which is commonly activated in lung cancer.

상기 목적을 달성하기 위하여, 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물을 포함하는 폐암 치료용 약학 조성물을 제공한다.In order to achieve the above object, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide ), flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide (budesonide), mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate butyrate), betamethasone sodium phosphate, hydrocortisone, diflorasone diacatate, Prednisolone sodium phosphate, prednisolone sodium phosphate, prednicalone, triamcinone , Methylprednisolone sodium succinate, triamcinolone diacetate, rimexolone, isoflupredone acetate, betamethasone, dexamethasone, dexamethasone, dexamethasone Melengestrol acetate, fluticasone propionate (f luticasone propionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate It provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of (cortisol acetate).

또한, 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 포함하는 폐암 치료용 약학 조성물을 제공한다.In addition, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of an mTOR inhibitor.

더불어 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 AMPK 억제제를 포함하는 것을 특징으로 하는 폐암 치료용 약학 조성물을 제공한다.In addition, the present invention relates to clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

상기 다른 목적을 달성하기 위하여, 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물을 포함하는 폐암 개선용 건강기능식품 조성물을 제공한다.In order to achieve the above other objects, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide ( flunisolide), flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budeso Budesonide, mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate hydrocortisone butyrate), betamethasone sodium phosphate, hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednisolone mcinolone sodium phosphate, prednicalone triarbate, triamcinorbate ), methylprednisolone sodium succinate, triamcinolone diacetate, rimexolone, isoflupredone acetate, betamethasone, betamethasone, dexamethasone acetate, methamethasone Melengestrol acetate, fluticasone propione Fluticasone propionate, prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and It provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of cortisol acetate.

또한, 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 포함하는 폐암 개선용 건강기능식품 조성물을 제공한다.In addition, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and mTOR inhibitor.

더욱이 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 AMPK 억제제를 포함하는 폐암 개선용 건강기능식품 조성물을 제공한다.Furthermore, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

본 발명에 따르면, 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물은 KEAP1 돌연변이 폐암 또는 KEAP1 및 LKB1 돌연변이 폐암에서 NRF2 억제를 통해 세포 성장을 억제하며, mTOR 억제제와 병용 시 더 강화된 항암 효과를 나타내므로, KEAP1 돌연변이를 포함한 폐암의 치료 또는 개선에 유용하게 사용할 수 있다. 또한 KEAP1, LKB1 유전자 정상 폐암에서도 종양미세환경의 특징 중 하나인 영양 부족상태에 처하면 NRF2가 활성화되는 한편 LKB1에 의해 AMPK도 함께 활성화됨을 확인하였고, 이 폐암에서 글루코코르티코이드계 화합물은 AMPK 억제제와 병용 시 항암 시너지 효과를 나타내므로, KEAP1 정상 폐암의 치료 또는 개선에도 유용하게 사용할 수 있다.According to the present invention, clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone p ropionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate), at least one glucocorticoid compound selected from the group consisting of KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer inhibits cell growth through NRF2 inhibition, and exhibits a stronger anticancer effect when used in combination with mTOR inhibitors. It can be usefully used in the treatment or amelioration of lung cancer including mutations. In addition, in normal lung cancer of the KEAP1 and LKB1 genes, it was confirmed that NRF2 is activated when undernourished, one of the characteristics of the tumor microenvironment, while AMPK is also activated by LKB1. In this lung cancer, glucocorticoid compounds are used in combination with AMPK inhibitors. Since it exhibits an anticancer synergistic effect, KEAP1 can be usefully used in the treatment or improvement of normal lung cancer.

도 1은 NRF2 억제제 스크리닝을 위한 루시퍼라아제 활성 측정 시스템의 정확성 및 유효성을 검증한 것이다.
도 2 및 도 3은 1887 임상 화합물 라이브러리를 이용하여 KEAP1-돌연변이 폐암 세포주에서 NRF2 억제 효과가 있는 화합물을 스크리닝한 결과를 나타낸 것이다.
도 4 및 도 5는 KEAP1-돌연변이 폐암 세포주에서 글루코코르티코이드(Glucocorticoids, GCs) 계열 약물 중 가장 효과가 큰 클로베타졸 프로피오네이트에 의한 NRF2 억제 기전을 확인한 것이다.
도 6은 KEAP1-돌연변이 세포주에 클로베타졸 프로피오네이트에 의한 NRF2 타겟 발현 억제효과 및 그로 인한 활성산소 증가 효과를 확인한 것이다.
도 7 및 도 8은 KEAP1-돌연변이 또는 KEAP1-돌연변이/LKB1-돌연변이 폐암 세포주에 클로베타졸 프로피오네이트 단독 및 mTOR 억제제인 라파마이신과 병용 처리 시 나타나는 항암 시너지 효과를 각각 in vitro 및 in vivo에서 확인한 것이다.
도 9는 KEAP1-정상/LKB1-정상 폐암 세포주에서 종양미세환경의 특징 중 하나인 영양소 부족상태에서 NRF2와 AMPK(AMP 활성화 단백질 키나아제, AMP-activated protein kinase)가 함께 활성화됨을 확인한 것이며, 이 폐암 세포주를 저영양 상태에서 배양 시 클로베타졸 프로피오네이트와 AMPK억제제인 수니티닙(sunitinib)과의 병용 처리에 의해 나타나는 항암 시너지 효과를 in vitro에서 확인한 것이다.
1 is a verification of the accuracy and effectiveness of a luciferase activity measurement system for NRF2 inhibitor screening.
2 and 3 show the results of screening a compound having an NRF2 inhibitory effect in the KEAP1-mutant lung cancer cell line using the 1887 clinical compound library.
Figures 4 and 5 confirm the mechanism of inhibition of NRF2 by clobetasol propionate, which is the most effective among glucocorticoids (GCs) series drugs in KEAP1-mutant lung cancer cell lines.
6 shows the effect of inhibiting the expression of NRF2 target by clobetasol propionate in the KEAP1-mutant cell line and the effect of increasing active oxygen therefrom.
7 and 8 are KEAP1-mutant or KEAP1-mutant/LKB1-mutant lung cancer cell lines, confirmed in vitro and in vivo anticancer synergistic effects that appear when treated in combination with clobetazole propionate alone and rapamycin, an mTOR inhibitor, respectively. will be.
9 shows that NRF2 and AMPK (AMP-activated protein kinase) are activated together in a nutrient deficiency state, which is one of the characteristics of the tumor microenvironment, in KEAP1-normal/LKB1-normal lung cancer cell lines, and this lung cancer cell line The anticancer synergistic effect of clobetasol propionate and sunitinib, an AMPK inhibitor, was confirmed in vitro when cultured in a low nutrient state.

본 발명의 발명자들은 이전 수행했던 연구(발표하지 않음) 결과와 종래 공지된 연구(J Thorac Oncol, 2014, Jun;9(6):794-804 ; Cancer Discov, 2015, Aug;5(8):860-77)에서 실제 폐암에서 돌연변이 되어 있는 유전자 조합을 조사한 결과 및 KEAP1(켈히-유사 ECH 연관 단백질 1, kelch-like ECH-associated protein 1)과 LKB1(간 키나아제 B1, Liver kinase B1)이 흔히 함께 돌연변이 되어 있다고 보고한 결과를 기반으로, LKB1/KEAP1 돌연변이에 의해 활성화되는 신호전달 표적으로 알려진 mTOR(라파마이신의 기전적 표적, mechanistic target of rapamycin)과 NRF2(핵 인자(에리트로이드 2)-유사 인자 2, Nuclear factor(erythroid-derived 2)-like 2)를 동시에 억제하는 항암 전략을 수립하였다. 또한 KEAP1/LKB1 유전자 정상 폐암세포에서도 종양미세환경의 특징 중 하나인 영양소 부족 상태에 처하면 NRF2가 활성화되는 한편, LKB1에 의해 AMPK(AMP 활성화 단백질 키나아제, AMP-activated protein kinase)도 함께 활성화됨을 확인하여, NRF2와 AMPK를 동시에 억제하는 항암 전략도 함께 수립하였다. The inventors of the present invention have previously conducted studies (not published) and previously known studies (J Thorac Oncol, 2014, Jun;9(6):794-804; Cancer Discov, 2015, Aug;5(8): 860-77), and KEAP1 (Kelch-like ECH-associated protein 1, kelch-like ECH-associated protein 1) and LKB1 (liver kinase B1, Liver kinase B1) are often combined. Based on the results reported as being mutated, mTOR (mechanistic target of rapamycin) and NRF2 (nuclear factor (erythroid 2)-like factors known as signaling targets activated by the LKB1/KEAP1 mutation) 2, an anti-cancer strategy was established to simultaneously inhibit nuclear factor (erythroid-derived 2)-like 2). In addition, in normal lung cancer cells of the KEAP1/LKB1 gene, NRF2 is activated when under nutrient deficiency, which is one of the characteristics of the tumor microenvironment, while AMPK (AMP-activated protein kinase) is also activated by LKB1. , An anti-cancer strategy to simultaneously inhibit NRF2 and AMPK was also established.

이를 위하여 한국화합물은행에서 제공받은 임상화합물 라이브러리 1887종 중 NRF2 억제 효과가 있는 약물을 스크리닝하여 50% 이상 억제효과가 있는 글루코코르티코이드 계열 화합물 13종을 발굴하였고, 이중 가장 효과가 탁월한 클로베타솔 프로피오네이트를 이용하여 항암 효과를 확인하였다. 먼저 KEAP1 돌연변이 폐암 세포에서 세포 성장 억제 효과를 확인하였고, 특히 KEAP1/LKB1이 함께 돌연변이 되어 있는 폐암 세포에서 mTOR 억제제인 라파마이신(rapamycin) 과의 병용 시 항암 시너지 효과가 나타나는 것을 확인하였다. 또한 KEAP1/LKB1 유전자 정상 폐암 세포를 저 영양 상태에서 배양시 클로베타솔 프로피오네이트와 AMPK 억제제인 수니티닙(sunitinib)과의 병용처리 하였을 때 항암 시너지 효과가 나타나는 것을 확인하여 본 발명을 완성하였다.To this end, 13 kinds of glucocorticoid compounds with an inhibitory effect of more than 50% were discovered by screening drugs with NRF2 inhibitory effect among 1887 clinical compound libraries provided by the Korea Chemicals Bank. Of these, clobetasol propio Anticancer effect was confirmed using Nate. First, the effect of inhibiting cell growth in KEAP1 mutant lung cancer cells was confirmed, and in particular, it was confirmed that the anticancer synergistic effect appeared when combined with rapamycin, an mTOR inhibitor, in lung cancer cells in which KEAP1/LKB1 was mutated together. In addition, when KEAP1/LKB1 gene normal lung cancer cells were cultured in a low nutritional state, it was confirmed that the anticancer synergistic effect appeared when clobetasol propionate and sunitinib, an AMPK inhibitor, were co-treated, thereby completing the present invention. .

상기 KEAP1은 E3 유비퀴틴 리가아제 복합체(E3 ubiquitin ligase complex)에 존재하는 것으로 전사인자인 NRF2 단백질과 결합하여 분해를 유도함으로써 그 기능을 억제한다. 만약 암세포에서 KEAP1 유전자가 돌연변이 되면(폐암에서 20~30%), NRF2 단백질의 양이 증가하여 타겟 유전자의 전사를 증가시키고, 이에 따라 주로 NRF2의 타겟인 항산화 관련 효소들의 활성이 증가한다.The KEAP1 is present in the E3 ubiquitin ligase complex and inhibits its function by binding to the transcription factor NRF2 protein and inducing degradation. If the KEAP1 gene is mutated in cancer cells (20-30% in lung cancer), the amount of NRF2 protein increases to increase the transcription of the target gene, thereby increasing the activity of antioxidant-related enzymes, which are mainly targets of NRF2.

상기 LKB1은 STK11(Serine/Threonine Kinase 11)으로도 알려져 있는 세린/트레오닌 키나아제로서 폐암(20~30%)을 비롯하여 자궁암 및 대장암 등에서 흔히 돌연변이 되거나 발현이 억제되어 기능이 상실되어 있는 종양 억제 유전자로 알려져 있다. LKB1의 기질로는 현재 12가지 정도가 밝혀져 있으며 이 중 AMPK의 활성화를 통한 mTORC1 억제 신호전달 경로가 바로 LKB1의 종양 억제 기능을 나타내는 것으로 제시되고 있다. 하지만 LKB1에 의한 AMPK의 활성화는 세포의 에너지 항상성 유지에 매우 중요한 역할을 수행하며, 이는 영양소 부족상태인 종양미세환경에서 암세포의 생존에 매우 중요하기 때문에 종양 촉진 기능을 나타내기도 한다. 따라서 LKB1-AMPK 경로는 상황에 따라 종양억제와 종양촉진 기능을 모두 수행하는 것으로 알려져 있다. The LKB1 is a serine/threonine kinase, also known as STK11 (Serine/Threonine Kinase 11), and is a tumor suppressor gene that is commonly mutated or inhibited from expression in lung cancer (20-30%), uterine cancer, and colon cancer. Is known. Currently, 12 kinds of substrates for LKB1 have been identified. Among them, the mTORC1 inhibitory signaling pathway through AMPK activation has been suggested to represent the tumor suppressor function of LKB1. However, activation of AMPK by LKB1 plays a very important role in maintaining the energy homeostasis of cells, and this is very important for the survival of cancer cells in the tumor microenvironment, which is in a nutrient-deficient state, so it also exhibits a tumor promoting function. Therefore, the LKB1-AMPK pathway is known to perform both tumor suppression and tumor promotion functions depending on the situation.

따라서 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물을 포함하는 폐암 치료용 약학 조성물을 제공한다.Accordingly, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of.

이때, 상기 폐암은 KEAP1 돌연변이 폐암 또는 KEAP1 및 LKB1 돌연변이 폐암일 수 있다.In this case, the lung cancer may be KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer.

또한, 상기 폐암은 비소세포성 폐암일 수 있다.In addition, the lung cancer may be non-small cell lung cancer.

또한, 본 발명에 따른 약학 조성물은 돌연변이된 KEAP1/LKB1 신호전달에 의해 활성화되는 타겟인 mTOR의 억제제를 더 포함할 수 있다.In addition, the pharmaceutical composition according to the present invention may further include an inhibitor of mTOR, which is a target activated by mutated KEAP1/LKB1 signaling.

따라서 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 포함하는 폐암 치료용 약학 조성물을 제공한다.Accordingly, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of an mTOR inhibitor.

이때, 상기 mTOR 억제제는 라파마이신(rapamycin), 템시로리무스(temsirolimus), 에버롤리무스(Everolimus), 리다포롤리무스(Ridaforolimus), AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226 및 PF-04691502로 이루어진 군에서 선택된 하나 이상일 수 있고, 보다 바람직하게는 라파마이신이나 이에 제한되는 것은 아니다.At this time, the mTOR inhibitor is rapamycin, temsirolimus, everolimus, ridaforolimus, AZD-8055, AZD-2014, OSI-027, INK128, PP242, It may be one or more selected from the group consisting of NVP-BEZ235, XL765, BGT226 and PF-04691502, more preferably rapamycin, but is not limited thereto.

또한 상기 폐암은 KEAP1 돌연변이 폐암 또는 KEAP1 및 LKB1 돌연변이 폐암일 수 있다.In addition, the lung cancer may be KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer.

더욱이, 상기 폐암은 비소세포성 폐암일 수 있다.Moreover, the lung cancer may be non-small cell lung cancer.

상기 약학 조성물은 글루코코르티코이드계 화합물 1 내지 50 중량% 및 mTOR 억제제 50 내지 99 중량%를 포함할 수 있는 바, 이러한 범위 내에서 가장 효과적으로 NRF2와 mTOR을 억제하여 페암의 치료효과를 나타낼 수 있으므로 바람직하다.The pharmaceutical composition is preferable because it can contain 1 to 50% by weight of a glucocorticoid compound and 50 to 99% by weight of an mTOR inhibitor, and can most effectively inhibit NRF2 and mTOR within this range to exhibit the therapeutic effect of lung cancer. .

더욱이, 본 발명의 약학 조성물은 KEAP1/LKB1 정상 폐암세포의 신호전달 과정에서 활성화되는 타겟인 AMPK의 저해제를 더 포함할 수 있다. Moreover, the pharmaceutical composition of the present invention may further include an inhibitor of AMPK, which is a target activated in the signal transduction process of KEAP1/LKB1 normal lung cancer cells.

즉, 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 AMPK 억제제를 포함하는 폐암 치료용 약학 조성물을 제공한다.That is, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pro pionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

이때, 상기 AMPK 억제제는 수니티닙(sunitinib) 및 도르소모르핀(Dorsomorphin, compound C)으로 이루어진 군에서 선택된 하나 이상일 수 있고, 보다 바람직하게는 수니티닙일 수 있으나, 이에 제한되는 것은 아니다.In this case, the AMPK inhibitor may be one or more selected from the group consisting of sunitinib and dorsomorphin (compound C), more preferably sunitinib, but is not limited thereto.

상기 폐암은 KEAP1 및 LKB1 정상 폐암일 수 있는 바, 본 발명에 따른 약학 조성물은 이러한 폐암에서 가장 우수한 치료효과를 나타낼 수 있다.The lung cancer may be KEAP1 and LKB1 normal lung cancer, and the pharmaceutical composition according to the present invention may exhibit the most excellent therapeutic effect in such lung cancer.

또한, 상기 폐암은 비소세포성 폐암일 수 있다.In addition, the lung cancer may be non-small cell lung cancer.

한편, 상기 약학 조성물은 글루코코르티코이드계 화합물 1 내지 50 중량% 및 AMPK 억제제 50 내지 99 중량%를 포함할 수 있는 바, 이러한 범위 내에서 가장 효과적으로 AMPK를 억제하여 폐암의 치료효과를 나타낼 수 있으므로 바람직하다.On the other hand, the pharmaceutical composition may contain 1 to 50% by weight of a glucocorticoid-based compound and 50 to 99% by weight of an AMPK inhibitor, and it is preferable because it can show the therapeutic effect of lung cancer by most effectively inhibiting AMPK within this range. .

상기 약학조성물은 상기 글루코코르티코이드계 화합물, mTOR 억제제 및 AMPK 억제제 외에 약학조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 더 포함할 수 있다.In addition to the glucocorticoid-based compound, mTOR inhibitor, and AMPK inhibitor, the pharmaceutical composition may further include a suitable carrier, excipient, or diluent commonly used in the manufacture of pharmaceutical compositions.

본 발명에서 사용가능한 담체, 부형제 또는 희석제로는, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등을 들 수 있다.Carriers, excipients or diluents usable in the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil.

본 발명에 따른 약학조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.The pharmaceutical composition according to the present invention is formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods. I can.

제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물은 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제할 수 있다. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient, such as starch, calcium carbonate, and sucrose ( sucrose), lactose, or gelatin.

또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. .

비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

본 발명에 따른 약학조성물의 유효성분인 글루코코르티코이드계 화합물 또는 이와 mTOR 억제제 혼합의 사용량은 환자의 나이, 성별, 체중, 질환에 따라 달라질 수 있으나, 0.001 내지 100 mg/kg으로, 바람직하게는 0.01 내지 10 mg/kg을 일일 1회 내지 수회 투여할 수 있다. The amount of the glucocorticoid compound or the mTOR inhibitor mixture, which is an active ingredient of the pharmaceutical composition according to the present invention, may vary depending on the patient's age, sex, weight, and disease, but is 0.001 to 100 mg/kg, preferably 0.01 to 10 mg/kg may be administered once to several times a day.

또한, 본 발명에 따른 약학 조성물의 투여량은 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서 증감될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.In addition, the dosage of the pharmaceutical composition according to the present invention may be increased or decreased depending on the route of administration, the degree of disease, sex, weight, age, and the like. Therefore, the above dosage does not limit the scope of the present invention in any way.

상기 약학조성물은 쥐, 생쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 기관지내 흡입, 자궁내 경막 또는 뇌혈관내(intracerebroventricular) 주사에 의해 투여될 수 있다.The pharmaceutical composition may be administered to mammals such as rats, mice, livestock, and humans by various routes. All modes of administration can be expected, for example, oral, rectal or intravenous, intramuscular, subcutaneous, intrabronchial inhalation, intrauterine dura mater or by intracerebroventricular injection.

더불어 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물을 포함하는 폐암 개선용 건강기능식품 조성물을 제공한다.In addition, the present invention relates to clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of.

또한 본 발명은 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 포함하는 폐암 개선용 건강기능식품 조성물을 제공한다.In addition, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pro pionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and mTOR inhibitor.

이때, 상기 mTOR 억제제는 라파마이신(rapamycin), 템시로리무스(temsirolimus), 에버롤리무스(Everolimus), 리다포롤리무스(Ridaforolimus), AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226 및 PF-04691502로 이루어진 군에서 선택된 하나 이상일 수 있고, 보다 바람직하게는 라파마이신일 수 있으나 이에 제한되는 것은 아니다.At this time, the mTOR inhibitor is rapamycin, temsirolimus, everolimus, ridaforolimus, AZD-8055, AZD-2014, OSI-027, INK128, PP242, It may be one or more selected from the group consisting of NVP-BEZ235, XL765, BGT226 and PF-04691502, more preferably rapamycin, but is not limited thereto.

본 발명은 또한, 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate), 데스옥시메타손(desoxymetasone), 클로코르톨론 피발레이트(clocortolone pivalate), 프리드니솔론 헤미석시네이트(prednisolone hemisuccinate), 하이드로코르티손 뷰티레이트(hydrocortisone butyrate), 베타메타손 소듐 포스페이트(betamethasone sodium phosphate), 하이드로코르티손(hydrocortisone), 디플로라손 디아세테이트(diflorasone diacatate), 프레드니솔론 소듐 포스페이트(Prednisolone sodium phosphate), 프레드니카베이트(prednicarbate), 트리암시노론(triamcinolone), 메틸프레드니솔론 소듐 석시네이트(methylprednisolone sodium succinate), 트리암시놀론 디아세테이트(triamcinolone diacetate), 리멕솔론(rimexolone), 이소플루프레돈 아세테이트(isoflupredone acetate), 베타메타손(betamethasone), 덱사메타손 아세테이트(dexamethasone acetate), 메렌게스트롤 아세테이트(melengestrol acetate), 플루티카손 프로피오네이트(fluticasone propionate), 프레드니솔론(prednisolone), 메틸프레드니솔론 6-알파(methylprednisolone 6-alpha), 하이드로코르티손 베이스(hydrocortisone base), 플루오로메톨론(fluorometholone), 피나스테라이드(finasteride), 플루오시노나이드(fluocinonide) 및 코르티솔 아세테이트(cortisol acetate)로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 AMPK 억제제를 포함하는 폐암 개선용 건강기능식품 조성물을 제공한다.The present invention also provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

이때, 상기 AMPK 억제제는 수니티닙(sunitinib) 및 도르소모르핀(Dorsomorphin, compound C)으로 이루어진 군에서 선택된 하나 이상일 수 있고, 가장 바람직하게는 수니티닙일 수 있으나 이에 제한되는 것은 아니다.At this time, the AMPK inhibitor may be at least one selected from the group consisting of sunitinib and dorsomorphin (compound C), and most preferably sunitinib, but is not limited thereto.

상기 건강기능식품은 분말, 과립, 정제, 캡슐, 시럽 또는 음료의 형태로 제공될 수 있으며, 상기 건강기능식품은 유효성분인 글루코코르티코이드계 화합물, mTOR 억제제 또는 AMPK 억제제 이외에 다른 식품 또는 식품 첨가물과 함께 사용되고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 그의 사용 목적 예를 들어 건강 또는 치료적 처치에 따라 적합하게 결정될 수 있다. The health functional food may be provided in the form of powder, granule, tablet, capsule, syrup, or beverage, and the health functional food is an active ingredient such as a glucocorticoid compound, mTOR inhibitor, or AMPK inhibitor, along with other foods or food additives. Used, and can be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use, for example, health or therapeutic treatment.

상기 건강기능식품에 함유된 글루코코르티코이드계 화합물, 이와 mTOR 억제제 혼합물 또는 이와 AMPK 억제제 혼합물의 유효용량은 상기 약학조성물의 유효용량에 준해서 사용할 수 있으나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 범위 이하일 수 있으며, 유효성분은 안전성 면에서 아무런 문제가 없기 때문에 상기 범위 이상의 양으로도 사용될 수 있음은 확실하다.The effective dose of the glucocorticoid compound, the mTOR inhibitor mixture, or the AMPK inhibitor mixture contained in the health functional food can be used in accordance with the effective dose of the pharmaceutical composition, but for health and hygiene purposes or for health control purposes. In the case of long-term intake, it may be less than the above range, and since there is no problem in terms of safety, the active ingredient can be used in an amount greater than the above range.

상기 건강기능식품의 종류에는 특별한 제한이 없고, 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등을 들 수 있다.There are no particular restrictions on the types of health functional foods, examples of which include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea. , Drinks, alcoholic beverages, and vitamin complexes.

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니며, 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are only illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples, and is provided to more completely describe the present invention to those with average knowledge in the art. will be.

<< 준비예Preparation example 1> 1>

실험에 사용하기 위하여, 유전자 정상 비소세포 폐암 세포주(non-small-cell lung carcinoma, NSCLC)인 H1299(KEAP1-정상, LKB1-정상) 및 KEAP1 돌연변이인 비소세포 폐암 세포주들(H2228(KEAP1-돌연변이, LKB1-정상), A549(KEAP1-돌연변이, LKB1-돌연변이), H460(KEAP1-돌연변이, LKB1-돌연변이))을 한국세포주은행에서 구입하고, 10%의 소태아혈청(FBS, Invitrogen), 1% 페니실린-스트렙토마이신, 1% HEPES가 보충된 둘베코의 수정 이글 배지(DMEM, HyClone Laboratories, USA)에서 5% CO2, 37℃로 배양하였다. 또한 이후 실험에서 스크리닝을 위하여 96-웰 플레이트에 A549-ARE 세포를 높은 밀도로 시딩한 후 1887 임상 화합물 라이브러리(한국화합물은행)를 처리하였다. 클로베타졸 프로피오네이트(CP)는 Sigma-Aldrich(St.Louis, USA)에서 구입하였다. 이외에 기타 실험에 필요한 물질들은 Sigma(CT99021, GSK3 억제제), EMD Millipore(MG132), LC laboratories(라파마이신)에서 구입하였고, 웨스턴 블롯에 사용될 항체들은 GeneTex(ME1, IDH1, G6PD, PGD, GCLM, GCR, NRF2), Cell Signaling Technology(NRF2, LKB1, p-AMPK, AMPK, pGSK-3, GSK3, p-p70S6K, p70S6K, α-tubulin), Sigma(KEAP1), Proteintech(SRXN1)에서 구입하였다.For use in the experiment, H1299 (KEAP1-normal, LKB1-normal), a genetic normal non-small-cell lung carcinoma (NSCLC), and non-small cell lung cancer cell lines (H2228 (KEAP1-mutant, LKB1-normal)) and KEAP1 mutation LKB1-normal), A549 (KEAP1-mutation, LKB1-mutation), H460 (KEAP1-mutation, LKB1-mutation)) were purchased from Korea Cell Line Bank, 10% fetal bovine serum (FBS, Invitrogen), 1% penicillin -Incubated in Dulbecco's Modified Eagle's medium (DMEM, HyClone Laboratories, USA) supplemented with streptomycin and 1% HEPES at 5% CO 2 , 37°C. In addition, for screening in subsequent experiments, A549-ARE cells were seeded at a high density in a 96-well plate, and then a 1887 clinical compound library (Korea Chemical Bank) was processed. Clobetasol propionate (CP) was purchased from Sigma-Aldrich (St. Louis, USA). In addition, materials necessary for other experiments were purchased from Sigma (CT99021, GSK3 inhibitor), EMD Millipore (MG132), and LC laboratories (rapamycin), and antibodies to be used in Western blot were GeneTex (ME1, IDH1, G6PD, PGD, GCLM, GCR). , NRF2), Cell Signaling Technology (NRF2, LKB1, p-AMPK, AMPK, pGSK-3, GSK3, p-p70S6K, p70S6K, α-tubulin), Sigma (KEAP1), Proteintech (SRXN1).

<< 실시예Example 1> 1> NRF2NRF2 억제제 스크리닝 Inhibitor screening

(1) NRF2 활성 측정을 위한 ARE-luciferase 세포주 확립(1) Establishment of ARE-luciferase cell line for measuring NRF2 activity

효과적인 NRF2 억제제를 스크리닝하기 위하여, 도 1a와 같이 NRF2 활성을 모니터링할 수 있는 루시퍼라아제/녹색형광단백질(green fluorescent protein, GFP) 듀얼 산화 방지제 반응 요소(antioxidant responsive element, ARE)-DNA 염기서열(CACCGTGACTCAGCAATTx3) 시스템(Luciferase/GFP dual ARE-receptor cell line system)을 NRF2 활성이 높은 A549(LKB1 정상/KEAP1 돌연변이) 비소세포성 폐암 세포에 확립하였다.In order to screen for effective NRF2 inhibitors, luciferase/green fluorescent protein (GFP) dual antioxidant responsive element (ARE)-DNA nucleotide sequence capable of monitoring NRF2 activity as shown in FIG. 1A ( The CACCGTGACTCAGCAATTx3) system (Luciferase/GFP dual ARE-receptor cell line system) was established in A549 (LKB1 normal/KEAP1 mutation) non-small cell lung cancer cells with high NRF2 activity.

A549 세포주에서 높은 활성을 나타내는 루시퍼라아제 및 GFP 시그널이 NRF2 활성에 특이적임을 증명하기 위해, 하기 <표 1>과 같이 서로 다른 서열을 가진 3개의 독시사이클린(doxycyclin)-유도성 NRF2-shRNA를 제작하였다. Tet-유도성 shRNA 발현 시스템을 구축하기 위해, tet-pLKO-pyro vector(Dmitri Wiederschain: Addgene plasmide #21915)에 하기 shRNA들을 삽입한 후, 형질도입을 통하여 독시사이클린 유도성 NRF2-shRNA를 발현하는 A549-ARE 세포주를 확립하였다.To prove that luciferase and GFP signals showing high activity in the A549 cell line are specific for NRF2 activity, three doxycyclin-inducible NRF2-shRNAs having different sequences as shown in Table 1 below were constructed. I did. To construct a Tet-inducible shRNA expression system, the following shRNAs were inserted into a tet-pLKO-pyro vector (Dmitri Wiederschain: Addgene plasmide #21915), and then A549-expressing doxycycline-inducible NRF2-shRNA through transduction. ARE cell line was established.

이후, NRF2-shRNA 발현을 유도하기 위해 0.2 ㎍/mL의 독시사이클린(doxycycline, DOX; Clontech)를 배지에 매 2일마다 처리해주었다. 그 후 NRF2 발현 억제 효율을 웨스턴 블롯, 루시퍼라아제 활성 측정 및 형광 현미경을 이용한 GFP 발현 측정을 통해 검증하였다.Thereafter, 0.2 µg/mL of doxycycline (DOX; Clontech) was treated in the medium every 2 days to induce NRF2-shRNA expression. Thereafter, the efficiency of inhibition of NRF2 expression was verified through Western blot, luciferase activity measurement, and GFP expression measurement using a fluorescence microscope.

shRNAshRNA 서열order 서열번호Sequence number NRF2sh-1NRF2sh-1 CCGGAGTTGAGCTTCATTGAACTGCCTCGAGGCAGTTCAATGAAGCTCAACTTTTTTGCCGGAGTTGAGCTTCATTGAACTGCCTCGAGGCAGTTCAATGAAGCTCAACTTTTTTG 1One NRF2sh-2NRF2sh-2 CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTTGCCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTTG 22 NRF2sh-3NRF2sh-3 CCGGAGAGCAAGATTTAGATCATTTCTCGAGAAATGATCTAAATCTTGCTCTTTTTTGCCGGAGAGCAAGATTTAGATCATTTCTCGAGAAATGATCTAAATCTTGCTCTTTTTTG 33

구체적으로, 웨스턴블롯을 위해, Tet-pLKO-NCshRNA(음성 대조군) 및 3종류의 Tet-pLKO-NRF2 shRNA를 발현하는 A549 세포에 독시사이클린을 3일, 6일 동안 처리 후 단백질을 분리하였다. 분리된 각 10 ㎍의 단백질을 8% 아크릴아마이드 겔(acrylamide gel)에 로딩하여 전기영동한 후, 니트로셀룰로오스(Nitrocellulose, NC) 멤브레인에 이동시키고 NRF2 항체(Cell signaling, 1:1000)와 액틴(actin) 항체(SCBT, 1:1000)를 5% 탈지유(skim milk)를 함유한 TBST(Tris-Buffered Saline with tween 20) 버퍼에 희석하여 4℃에서 밤새 반응시켰다. 그 후, 2차 항체를 1시간 동안 반응시키고 TBST로 세척한 후, ECL(Enhanced chemiluminescence)을 이용하여 단백질 발현량을 측정하였다. Specifically, for western blot, proteins were isolated after treatment with doxycycline for 3 and 6 days in A549 cells expressing Tet-pLKO-NCshRNA (negative control) and three types of Tet-pLKO-NRF2 shRNA. Each 10 μg of the separated protein was loaded onto an 8% acrylamide gel and subjected to electrophoresis, and then transferred to a nitrocellulose (NC) membrane, followed by NRF2 antibody (Cell signaling, 1:1000) and actin. ) Antibody (SCBT, 1:1000) was diluted in TBST (Tris-Buffered Saline with tween 20) buffer containing 5% skim milk and reacted overnight at 4°C. Thereafter, the secondary antibody was reacted for 1 hour, washed with TBST, and the protein expression level was measured using ECL (Enhanced chemiluminescence).

또한, 먼저 A549-ARE 세포를 96 웰 플레이트에 웰당 5×103 개로 분주하고, 24시간이 지난 후 농도별(1㎛ 또는 5㎛)로 각 임상 화합물을 처리하였다. 처리하고 24시간 지난 후 용혈 버퍼(Lysis buffer) 30 ㎕를 넣어주고, 4℃에서 로커(Rocker)를 이용하여 40분 동안 용해시켰다. 용해된 생성물을 20 ㎕씩 96 웰 화이트 플레이트(96 well white plate)에 넣어주고, 하기 조성과 같은 루시퍼라아제 기질 버퍼(Luciferase substrate buffer) 100 ㎕를 넣어주고 플레이트 리더를 이용하여 루시퍼라아제 활성을 측정하였다.In addition, first, A549-ARE cells were dispensed into a 96-well plate at 5×10 3 cells per well, and after 24 hours, each clinical compound was treated by concentration (1 μm or 5 μm). After 24 hours of treatment, 30 µl of a Lysis buffer was added and dissolved at 4°C using a rocker for 40 minutes. 20 µl of the dissolved product was added to a 96 well white plate, 100 µl of a luciferase substrate buffer as shown in the following composition was added, and luciferase activity was measured using a plate reader. It was measured.

* 기질을 위한 버퍼(Buffer for Substrate)* Buffer for Substrate

1. 버퍼 A(Buffer A)1.Buffer A

1mM D-루시페린(D-Luciferin, pH 6.1 - 6.4 (황색 빛, yellow light) -20℃에서 보관)1mM D-Luciferin (D-Luciferin, pH 6.1-6.4 (yellow light) stored at -20℃)

2. 버퍼 B(Buffer B)2. Buffer B

40 mM 트리신(Tricin, MW 179.2)40 mM Tricine (Tricin, MW 179.2)

2.14 mM (MgCO₃)₄Mg(OH)₂5H₂O(MW 485.7)2.14 mM (MgCO₃)₄Mg(OH)₂5H₂O(MW 485.7)

5.34 mM MgSO₄7H₂O(MW 246.48)5.34 mM MgSO₄7H₂O (MW 246.48)

66.6 mM 디티오트레이톨(dithiothreitol, DTT, MW 1542)66.6 mM dithiothreitol (DTT, MW 1542)

1.06 mM 아데노신삼인산(Adenosine triphosphate, ATP, MW 551)1.06 mM adenosine triphosphate (ATP, MW 551)

0.54 mM 코엔자임(Coenzyme, MW 767.5)0.54 mM coenzyme (Coenzyme, MW 767.5)

0.2 mM 에틸렌디아민사아세트산(ethylenediaminetetraacetic acid, EDTA)렌디아민사아세트산(ethylenediaminetetraacetic acid, EDTA, Stock 0.5M EDTA, pH 7.8, -20℃에 보관)0.2 mM ethylenediaminetetraacetic acid (EDTA) ethylenediaminetetraacetic acid (EDTA, stock 0.5M EDTA, pH 7.8, stored at -20℃)

3. 제조한 분석 혼합물(Make a Assay Mixture, 1 : 1) = 기질 버퍼(substrate buffer)3. Make a Assay Mixture (1:1) = substrate buffer

- 용해 버퍼(Lysis Buffer)-Lysis Buffer

0.1M 포타슘 포스페이트 버퍼(potassium phosphate buffer), pH 7.80.1M potassium phosphate buffer, pH 7.8

(1M K₂HPO₄, 1M KH₂PO₄)(1M K₂HPO₄, 1M KH₂PO₄)

1% 트리톤 X-100(1% Triton X-100)1% Triton X-100

1 mM DTT1 mM DTT

2 mM EDTA2 mM EDTA

남은 용해 생성물은 증류수(distilled water, DW)로 5배 희석하여 브래드포드 어세이(Bradford assay; BioRad) 방법으로 단백질 농도(protein concentration)를 측정하였다. 구체적으로, 브래드포드 시약(쿠마시 브릴리언트 블루 G-250) 원액을 증류수로 5배 희석한 용액 200 ul를 남은 용해 생성물 5 ul와 반응시킨 후 595 nM에서 흡광도를 측정하였다. 표준 단백질로 BSA 용액을 이용하여 동일하게 실험하여 용해 생성물의 단백질 농도를 계산하였다. 이렇게 측정된 단백질 농도로 위에서 측정한 루시퍼라아제 값을 나누어 루시퍼라아제 값을 보정하였다.The remaining dissolved product was diluted 5 times with distilled water (DW), and the protein concentration was measured by the Bradford assay (BioRad) method. Specifically, 200 ul of a solution obtained by diluting the stock solution of Bradford's reagent (Kumashi Brilliant Blue G-250) 5-fold with distilled water was reacted with 5 ul of the remaining dissolved product, and the absorbance was measured at 595 nM. The protein concentration of the lysed product was calculated in the same manner using the BSA solution as a standard protein. The luciferase value was corrected by dividing the luciferase value measured above by the measured protein concentration.

그 결과, 도 1b, 1c 및 1d에 나타난 바와 같이, NRF2sh-2가 가장 효과적으로 NRF2 단백질 발현, 루시퍼라아제 활성 및 GFP 신호를 억제하였으며, 이로부터 A549에서 높게 나타나는 루시퍼라아제 활성 및 GFP 신호가 NRF2에 특이적임을 알 수 있었다.As a result, as shown in Figs. 1b, 1c and 1d, NRF2sh-2 most effectively inhibited NRF2 protein expression, luciferase activity, and GFP signal, from which the luciferase activity and GFP signal high in A549 were NRF2. It was found that it was specific to

(2) 1887 임상 화합물 라이브러리를 이용한 스크리닝(2) Screening using 1887 clinical compound library

도 2a에 나타낸 바와 같이, 상기 루시퍼라아제/GFP 듀얼 ARE-수용체 세포주 시스템을 이용하여 한국화합물은행에서 제공받은 1887종의 임상화합물 라이브러리 중 NRF2 억제 효과가 있는 화합물을 스크리닝하였다. 즉, 상기 실시예 1에서 수행한 방법대로 A438-ARE 세포를 이용하여 루시퍼라아제 어세이를 수행하였다.As shown in Figure 2a, the luciferase/GFP dual ARE-receptor cell line system was used to screen for compounds having an NRF2 inhibitory effect among 1887 clinical compound libraries provided by the Korea Chemicals Bank. That is, the luciferase assay was performed using A438-ARE cells in the same manner as in Example 1 above.

그 결과, 도 2b에 나타난 바와 같이, 임상 화합물 중 글루코코르티코이드(Glucocorticoid, GCs) 계열 약물이 NRF2 억제 효과를 보였으며, 대부분의 GCs 계열 약물들이 1 ㎛ 농도의 24시간 처리에 의해 50% 이상의 뛰어난 억제 효과를 나타냈다.As a result, as shown in Fig. 2b, glucocorticoid (GCs)-based drugs among clinical compounds showed an NRF2 inhibitory effect, and most GCs-based drugs were excellently inhibited by more than 50% by 24 hours treatment at 1 μm concentration. Had an effect.

(3) 글루코코르티코이드 계열 약물의 NRF2 억제효과(3) NRF2 inhibitory effect of glucocorticoid drugs

상기에서 얻은 결과에서 효과가 우수한 13종의 GCs 계열 약물을 선정하고, 상기에서 실시한 방법대로 루시퍼라아제 어세이를 수행하여 13종의 GCs 계열 약물의 농도별로 NRF2 억제 효과를 비교하였다.From the results obtained above, 13 types of GCs-based drugs having excellent effects were selected, and luciferase assay was performed according to the method described above to compare the NRF2 inhibitory effect by concentration of the 13 types of GCs-based drugs.

그 결과, 도 3에 나타난 바와 같이, 대부분 10 nM 수준부터 우수한 억제효과가 나타났으며, 특히 클로베타졸 프로피오네이트(Clobetasol propionate)의 경우 1 nM에서부터 우수한 효과를 보였고, 1 ㎛에서도 가장 뛰어난 억제 효과를 보였다.As a result, as shown in Figure 3, most of the excellent inhibitory effect was exhibited from the 10 nM level, in particular, in the case of clobetasol propionate (Clobetasol propionate) showed an excellent effect from 1 nM, the most excellent inhibition even at 1 ㎛ Showed the effect.

<실시예 2> 클로베타졸 프로피오네이트에 의한 NRF2 억제 기전 확인<Example 2> Confirmation of the mechanism of inhibition of NRF2 by clobetasol propionate

(1) 클로베타졸 프로피오네이트의 억제 기전 확인(1) Confirmation of the mechanism of inhibition of clobetasol propionate

글루코코르티코이드는 클루코코르티코이드 수용체(glucocorticoid receptor, GC receptor, GCR)로 알려진 핵 수용체 서브 패밀리 3(nuclear receptor subfamily 3. group C, member 1)의 리간드로 작용한다. 글루코코르티코이드가 GCR에 결합하면 GCR은 염증이나 대사와 같은 생체 내의 다양한 기능과 관련된 많은 유전자의 전사촉진 또는 전사 억제를 유도한다. 이러한 사실들이 알려져 있는 것을 바탕으로, 글루코코르티코이드, 즉 클로베타졸 프로피오네이트의 NRF2 억제 효과가 GCR과 관련된 것인지를 확인하기 위해, GCR-shRNA를 이용하여 GCR 발현을 억제한 후 상기 웨스턴 블롯과 루시퍼라아제 어세이를 수행하였다.Glucocorticoids act as ligands of the nuclear receptor subfamily 3. group C, member 1 known as the glucocorticoid receptor (GC receptor, GCR). When glucocorticoid binds to GCR, GCR induces transcriptional promotion or transcriptional inhibition of many genes involved in various functions in vivo such as inflammation and metabolism. Based on these facts, in order to confirm whether the NRF2 inhibitory effect of glucocorticoid, that is, clobetazole propionate, is related to GCR, GCR-shRNA was used to inhibit GCR expression, and then the western blot and lucifer. Raase assay was performed.

먼저 GCR-shRNA가 포함된 벡터를 이용하여 형질도입시킨 A549-tet-on 세포를 확립한 후 독시사이클린과 클로베타솔 프로피오네이트를 처리 후 웨스턴 블롯을 수행하기 위해 프로테아제 저해제 칵테일(EMD millipore)이 보충된 세포 용혈 버퍼(Cell signaling technology)로 용혈시켜 단백질 추출물을 준비하였다. 이후 상기 실시예 1에서 수행한 방법대로 웨스턴 블롯을 수행하였다. 이때, 단백질의 농도는 실시예 1에서 실시한 방법대로 브래드포드 어세이를 수행하여 결정하였다. 또한 상기 실시예 1에서 수행한 방법대로 루시퍼라아제 어세이를 수행하였다.First, A549-tet-on cells transduced using a vector containing GCR-shRNA were established, treated with doxycycline and clobetasol propionate, and then supplemented with a protease inhibitor cocktail (EMD millipore) to perform western blot. The protein extract was prepared by hemolysis using the cell signaling technology. Thereafter, Western blot was performed according to the method performed in Example 1. At this time, the concentration of the protein was determined by performing the Bradford assay according to the method carried out in Example 1. In addition, the luciferase assay was performed according to the method performed in Example 1.

그 결과, 도 4a 및 4b에 나타난 바와 같이, GCR 발현억제는 클로베타졸 프로피오네이트에 의한 NRF2 억제를 완전히 방지하였다. 즉, 클로베타졸 프로피오네이트는 NRF2 단백질의 레벨과 활성을 현저히 감소시키는데, 이것은 GCR의 발현 억제에 의해 차단되었다. 이러한 사실은 클로베타졸 프로피오네이트, 즉 글루코코르티코이드의 NRF2 억제 효과가 GCR과 관련된 것임을 명확히 보여준다.As a result, as shown in Figs. 4a and 4b, inhibition of GCR expression completely prevented NRF2 inhibition by clobetasol propionate. That is, clobetasol propionate significantly reduces the level and activity of the NRF2 protein, which was blocked by inhibition of the expression of GCR. This fact clearly shows that the NRF2 inhibitory effect of clobetasol propionate, ie glucocorticoid, is related to GCR.

(2) 농도별 클로베타졸 프로피오네이트의 효과(2) Effect of clobetasol propionate by concentration

또한, 농도에 따른 클로베타졸 프로피오네이트의 효과를 명확히 확인하기 위해, 클로베타졸 프로피오네이트를 100 nM 또는 1 ㎛를 처리하고 8시간, 24시간, 48시간 후의 세포를 대상으로 실시예 1에서 수행한 방법대로 루시퍼라아제 어세이를 수행하여, NRF2의 활성을 측정하였다.In addition, in order to clearly confirm the effect of clobetasol propionate according to the concentration, the cells were treated with 100 nM or 1 μm of clobetasol propionate, and the cells after 8 hours, 24 hours, and 48 hours were treated as Example 1 The luciferase assay was performed according to the method performed in, and the activity of NRF2 was measured.

그 결과, 도 4c 및 4d에 나타난 바와 같이 클로베타졸 프로피오네이트에 의한 NRF2 활성 억제는 100 nM 농도에서 적어도 48시간 동안 유지되었고, 이러한 결과는 감소한 NRF2 단백질의 양과 일치했다. 이는 글루코코르티코이드가 그 단백질 발현을 감소시킴으로써 NRF2를 저해한다는 것을 의미한다.As a result, as shown in Figs. 4c and 4d, the inhibition of NRF2 activity by clobetasol propionate was maintained for at least 48 hours at a concentration of 100 nM, and this result was consistent with the decreased amount of NRF2 protein. This means that glucocorticoid inhibits NRF2 by reducing its protein expression.

(3) NRF2 mRNA 및 단백질 분해에 대한 영향 측정(3) Measurement of effects on NRF2 mRNA and protein degradation

지금까지 축적된 연구 결과에 따르면 NRF2 단백질 레벨은 mRNA 전사, 또는 프로테아좀 관련 분해에 의해 조절될 수 있다. 이에, mRNA 전사억제를 통해 NRF2를 억제하는지, 프로테아좀 관련 분해를 촉진하여 NRF2를 억제하는지 확인하기 위하여, 상기 세포를 대상으로 real-time PCR을 수행하였고, 프로테아좀 저해제인 MG132를 처리한 후, 상기 실시예 1에서 수행한 것과 동일하게 웨스턴 블롯을 수행하였다.Studies accumulated to date show that NRF2 protein levels can be regulated by mRNA transcription or proteasome-related degradation. Therefore, in order to confirm whether NRF2 is inhibited through mRNA transcriptional inhibition or NRF2 is inhibited by promoting proteasome-related degradation, real-time PCR was performed on the cells, and the proteasome inhibitor MG132 was treated. Thereafter, Western blot was performed in the same manner as in Example 1.

구체적으로, Real-time PCR을 위해, A549 세포에서 총 RNA를 TRizol(Invitrogen)을 사용하여 추출하였다. 이후, 총 RNA 1 ㎍을 올리고 dT 프라이머 및 SuperScript II Reverse Transcriptase를 이용하여 제조자의 지시사항(Invitrogen)에 따라 cDNA로 역전사시켰다. 이후, PCR은 HotStart-IT SYBR Green qPCR Master Mix을 이용하여 제조자의 지시사항(Affymetrix)에 따라 수행되었다. PCR에 사용된 NRF2 및 β-액틴의 프라이머는 하기 <표 2>와 같았다.Specifically, for real-time PCR, total RNA was extracted from A549 cells using TRizol (Invitrogen). Thereafter, 1 μg of total RNA was raised and reverse transcribed into cDNA using dT primers and SuperScript II Reverse Transcriptase according to the manufacturer's instructions (Invitrogen). After that, PCR is HotStart-IT It was performed according to the manufacturer's instructions (Affymetrix) using SYBR Green qPCR Master Mix. The primers for NRF2 and β-actin used in PCR were shown in Table 2 below.

유전자gene 종류Kinds 서열order 서열번호Sequence number NRF2NRF2 정방향Forward direction CGGTATGCAACAGGACATTGCGGTATGCAACAGGACATTG 44 역방향Reverse ACTGGTTGGGGTCTTCTGTGACTGGTTGGGGTCTTCTGTG 55 β-actinβ-actin 정방향Forward direction TGCCATCCTAAAAGCCACTGCCATCCTAAAAGCCAC 66 역방향Reverse TCAACTGGTCTCAAGTCAGTGTCAACTGGTCTCAAGTCAGTG 77

그 결과 도 4e 내지 4f에 나타난 바와 같이, 클로베타졸 프로피오네이트는 NRF2의 mRNA 레벨 자체에는 영향을 미치지 않았으나, 반대로 MG132를 처리하자 클로베타졸 프로피오네이트에 의해 저해되었던 NRF2 단백질의 양이 회복되었다. 즉, 이러한 결과를 토대로, 클로베타졸 프로피오네이트 화합물이 GCR 의존적인 프로테아좀 관련 분해를 유도하여 NRF2를 억제한다는 것을 알 수 있었다.As a result, as shown in Figs. 4e to 4f, clobetasol propionate did not affect the mRNA level of NRF2 itself, but when MG132 was treated on the contrary, the amount of NRF2 protein inhibited by clobetazole propionate was recovered. Became. That is, based on these results, it was found that the clobetasol propionate compound inhibits NRF2 by inducing GCR-dependent proteasome-related degradation.

(4) NRF2 단백질 분해 기전 확인(4) Confirmation of NRF2 protein degradation mechanism

일반적으로 NRF2 단백질의 프로테아좀 분해는 도 5a에 나타난 바와 같이 크게 두 가지 경로, 즉, KEAP1에 의한 경로와 GSK3-β-TrCP를 통한 경로로 이루어진다. 상기에서 얻은 결과를 토대로, 글루코코르티코이드 화합물이 둘 중 어떤 경로를 조절하여 NRF2를 억제하는지 확인하기 위하여, 상기 준비예에서 준비한 KEAP1 돌연변이 A549 세포에 GSK3 억제제 및 클로베타졸 프로피오네이트를 투여하고 상기 실시예 1에서 수행한 루시퍼라아제 어세이 및 웨스턴 블롯을 수행하였다. 또한, β-TrCP shRNA가 포함된 벡터를 이용하여 형질도입시킨 A549-tet-on 세포를 확립한 후 독시사이클린으로 β-TrCP 유전자를 넉다운 시킨 세포를 대상으로 동일하게 웨스턴 블롯 및 루시퍼라아제 어세이를 수행하였다.In general, the proteasome decomposition of the NRF2 protein consists of two major pathways, namely, a pathway by KEAP1 and a pathway via GSK3-β-TrCP, as shown in FIG. 5A. Based on the results obtained above, in order to confirm which pathway of the glucocorticoid compound inhibits NRF2 by regulating the two pathways, the GSK3 inhibitor and clobetasol propionate were administered to the KEAP1 mutant A549 cells prepared in the above preparation example. The luciferase assay and Western blot performed in Example 1 were performed. In addition, after establishing A549-tet-on cells transduced using a vector containing β-TrCP shRNA, Western blot and luciferase assays were performed in the same manner for cells knocked down the β-TrCP gene with doxycycline. Performed.

그 결과, 도 5b 및 5c에 나타난 바와 같이, 클로베타졸 프로피오네이트 유도의 NRF2 단백질 분해 및 활성 억제가 GSK3 억제제 처리에 의해 억제되었다. 또한, 도 5d에 나타난 바와 같이, β-TrCP가 넉다운 되었을 때도 클로베타졸 프로피오네이트가 유도한 NRF2의 단백질 분해를 억제했다. 즉, 이러한 결과는 글루코코르티코이드 화합물은 GSK3-β-TrCP를 통한 경로를 이용하여 NRF2 단백질을 분해한다는 것을 의미한다.As a result, as shown in Figs. 5b and 5c, clobetasol propionate-induced NRF2 protein degradation and inhibition of activity were inhibited by GSK3 inhibitor treatment. In addition, as shown in Fig. 5d, even when β-TrCP was knocked down, clobetasol propionate-induced protein degradation of NRF2 was suppressed. That is, these results indicate that the glucocorticoid compound degrades the NRF2 protein using a pathway through GSK3-β-TrCP.

더욱이, 지금까지 알려진 바에 따르면, GSK3은 NRF2의 핵으로의 이동을 억제한다. 이를 증명하기 위해, MG132 처리 하에서 GSK3 억제제 및 클로베타졸 프로피오네이트를 처리한 세포를 핵과 세포질로 분획한 후 웨스턴 블롯을 수행하였다. Moreover, it is known to date that GSK3 inhibits the migration of NRF2 to the nucleus. To prove this, cells treated with a GSK3 inhibitor and clobetasol propionate were fractionated into nuclei and cytoplasm under MG132 treatment, and then Western blot was performed.

그 결과, 도 5e에 나타난 바와 같이, 클로베타졸 프로피오네이트 처리에 의해 NRF2의 핵으로의 이동이 억제되었고, 이러한 효과는 GSK3 억제제에 의해 완벽히 차단되었다. 이러한 결과는, 도 5f 및 5g에 나타난 것과 같이, MG132처리 또는 β-TrCP 넉다운에 의해 NRF2 단백질 분해 억제만으로는 글루코코르티코이드에 의한 NRF2 활성 억제를 회복시키지 못한다는 결과를 뒷받침 해 준다. 즉, 글루코코르티코이드 화합물은 GSK3을 활성화함으로써 NRF2를 분해할 뿐만 아니라 또한 NRF2의 핵으로의 이동을 억제함으로서 NRF2를 억제한다는 것을 의미한다.As a result, as shown in Fig. 5e, the migration of NRF2 to the nucleus was inhibited by clobetasol propionate treatment, and this effect was completely blocked by the GSK3 inhibitor. These results, as shown in Figs. 5f and 5g, support the result that inhibition of NRF2 proteolysis alone by MG132 treatment or β-TrCP knockdown does not restore the inhibition of NRF2 activity by glucocorticoids. That is, the glucocorticoid compound not only decomposes NRF2 by activating GSK3, but also inhibits NRF2 by inhibiting the migration of NRF2 to the nucleus.

따라서 상기 결과들을 종합하면, 도 5h에 나타난 바와 같이, 글루코코르티코이드는 NRF2의 핵으로의 이동 억제 및 β-TrCP-의존적 분해를 촉진하는 GSK3 활성화를 통해 NRF2를 억제한다는 것을 알 수 있다.Therefore, when the above results are summarized, it can be seen that as shown in FIG. 5h, glucocorticoid inhibits NRF2 through GSK3 activation, which inhibits the migration of NRF2 to the nucleus and promotes β-TrCP-dependent degradation.

<실시예 3> 클로베타졸 프로피오네이트에 의한 NRF2 타겟 단백질 발현 억제 및 활성 산소 증가 확인<Example 3> Inhibition of expression of NRF2 target protein by clobetasol propionate and confirmation of increase in active oxygen

(1) 비소세포 폐암 세포주에서 NRF2 발현량 측정(1) Measurement of NRF2 expression level in non-small cell lung cancer cell lines

일반적으로 NRF2는 KEAP1 돌연변이 세포에서 많이 발현되며, p-AMPK는 LKB1 돌연변이 세포에서 발현이 낮은 것으로 알려져 있다. 이를 확인하기 위해 네 가지 세포에 웨스턴 블롯을 수행하였다. 구체적으로, KEAP1 돌연변이 세포인 H2228(KEAP1-돌연변이, LKB1-정상), A549(KEAP1-돌연변이, LKB1-돌연변이), H460(KEAP1-돌연변이, LKB1-돌연변이) 및 정상 유전자 세포인 H1299(KEAP1-정상, LKB1-정상)의 KEAP1 및 LKB1 돌연변이 유무를 검증하고자 실시예 1에서 수행한 방법과 동일한 방법으로 웨스턴 블롯을 수행하여 NRF2와 p-AMPK 발현 정도를 확인하였다.In general, it is known that NRF2 is highly expressed in KEAP1 mutant cells, and p-AMPK is low in expression in LKB1 mutant cells. To confirm this, Western blot was performed on four cells. Specifically, KEAP1 mutant cells H2228 (KEAP1-mutant, LKB1-normal), A549 (KEAP1-mutant, LKB1-mutant), H460 (KEAP1-mutant, LKB1-mutant), and normal gene cells H1299 (KEAP1-normal, To verify the presence or absence of KEAP1 and LKB1 mutations in LKB1-normal), Western blot was performed in the same manner as in Example 1 to confirm the expression levels of NRF2 and p-AMPK.

그 결과, 도 6a에 나타난 바와 같이, H2228, A549, H460 세포주에서는 NRF2 발현량이 높았으므로 이를 통해 KEAP1 돌연변이를 가지고 있음을 확인하였고, A549 및 H460 세포주의 AMPK의 활성이 낮은 것을 토대로 LKB1 돌연변이를 가지고 있음을 확인하였다.As a result, as shown in FIG. 6A, since the H2228, A549, and H460 cell lines had high NRF2 expression levels, it was confirmed that they had the KEAP1 mutation, and based on the low AMPK activity of the A549 and H460 cell lines, they had the LKB1 mutation. Was confirmed.

(2) 클로베타졸 프로피오네이트의 효과 확인(2) Confirmation of the effect of clobetasol propionate

이렇게 NRF2의 활성이 높은 세포에 글루코코르티코이드가 미치는 영향을 확인하기 위해, KEAP1 돌연변이 세포(A549 및 H2228)세포에 클로베타졸 프로피오네이트를 2일, 4일 또는 5일 동안 처리하고 상기에서 수행한 웨스턴 블롯 방법으로, 산화환원 조절과 관련된 주요 NRF2 타겟 단백질(G6PD, PGD, ME1, GCLM, AKR1B10, AKR1C3)의 발현을 측정하였다. 대조군으로는 H2228 세포주에 NRF2-shRNA를 형질전환시켜 NRF2 발현을 억제한 세포를 사용하였다.In order to confirm the effect of glucocorticoid on cells having high NRF2 activity, KEAP1 mutant cells (A549 and H2228) were treated with clobetazole propionate for 2, 4 or 5 days, and the above was performed. By Western blot method, expression of major NRF2 target proteins (G6PD, PGD, ME1, GCLM, AKR1B10, AKR1C3) related to redox regulation was measured. As a control, cells in which NRF2 expression was suppressed by transforming the H2228 cell line with NRF2-shRNA were used.

그 결과, 도 6b에 나타난 바와 같이, H2228 세포주에 NRF2-shRNA를 형질전환한 대조군과 클로베타졸 프로피오네이트를 처리한 경우 모두, 항산화 작용을 주로 하는 NRF2 타겟 단백질 발현을 효과적으로 억제하는 것을 확인할 수 있었다. 마찬가지로, 도 6c에 나타난 바와 같이, A549 세포주에 클로베타졸 프로피오네이트를 처리한 경우 또한 NRF2 타겟 단백질 발현이 효과적으로 억제되었다. As a result, as shown in Figure 6b, it can be confirmed that both the control group transformed with NRF2-shRNA in the H2228 cell line and the case where clobetazole propionate was treated effectively inhibited the expression of the NRF2 target protein, which mainly has an antioxidant action. there was. Likewise, as shown in Fig. 6c, when the A549 cell line was treated with clobetasol propionate, the NRF2 target protein expression was also effectively suppressed.

또한, ME1, GCLM 단백질은 과산화수소 해독작용을 하는 단백질들인 바, 이의 변화를 확인하기 위해 상기 클로베타졸 프로피오네이트를 처리한 이후의 과산화수소 양을 다음과 같이 측정하였다: 상기 A549 및 H2228 세포주를 5 ㎛ CMH2DCF-DA(Invitrogen)으로 30분간 배양한 후, 배양된 세포를 포스페이트 인산완충식염수(phosphate buffered saline)으로 두번 세척하고 어둠 속에서 40분 동안 90% 디메틸 설폭사이드(DMSO) 및 10% PBS로 배양하며 형광 다이를 방출시켰다. 배양 후, 배양액의 상층액을 96-웰 플레이트에 분주하고 480/530 nm에서 형광량을 측정하였다. 측정된 형광량의 표준화를 위해, 상층액 제거 및 PBS 세척 후 남은 세포를 크리스탈 바이올렛 용액(20% 메탄올 및 0.5% 크리스탈 바이올렛)으로 10분 간 상온에서 염색하였다. 이후 3번 세척하고 1% SDS 용액에서 가용화를 위해 배양된 후 570 nm 파장에서의 흡광도를 측정하였다.In addition, since ME1 and GCLM proteins are proteins that detoxify hydrogen peroxide, the amount of hydrogen peroxide after treatment with clobetasol propionate was measured as follows to confirm the change thereof: The A549 and H2228 cell lines were 5 After incubating for 30 minutes with ㎛ CMH2DCF-DA (Invitrogen), the cultured cells were washed twice with phosphate buffered saline and 90% dimethyl sulfoxide (DMSO) and 10% PBS for 40 minutes in the dark. During incubation, the fluorescent die was released. After cultivation, the supernatant of the culture solution was dispensed into a 96-well plate and the amount of fluorescence was measured at 480/530 nm. In order to standardize the measured fluorescence amount, the cells remaining after removal of the supernatant and washing with PBS were stained with a crystal violet solution (20% methanol and 0.5% crystal violet) for 10 minutes at room temperature. After washing three times and incubating for solubilization in 1% SDS solution, absorbance at a wavelength of 570 nm was measured.

그 결과, 도 6d에 나타난 바와 같이, A549 및 H2228에 클로베타졸 프로피오네이트를 처리한 경우 활성산소가 유의적으로 증가함을 확인하였다. 즉, 클로베타졸 프로피오네이트와 같은 글루코코르티코이드는 NRF2의 항산화 기능을 효과적으로 억제할 수 있다는 사실을 증명해준다.As a result, as shown in FIG. 6D, it was confirmed that active oxygen was significantly increased when clobetasol propionate was treated with A549 and H2228. In other words, it proves that glucocorticoids such as clobetasol propionate can effectively inhibit the antioxidant function of NRF2.

<실시예 4> 클로베타졸 프로피오네이트 단독 항암 효과 및 라파마이신과의 병용 항암 시너지 효과 확인<Example 4> Clobetasol propionate alone anticancer effect and combination with rapamycin anticancer synergistic effect confirmed

(1) in vitro 실험(1) in vitro experiment

LKB1/KEAP1 정상 폐암 세포주인 H1299, KEAP1 돌연변이 세포주인 H2228, LKB1/KEAP1 돌연변이 폐암 세포주인 A549, H460에 클로베타졸 프로피오네이트 단독 처리 시 또는 mTOR 억제제인 라파마이신과 병용 처리 시 나타나는 항암 시너지 효과를 소프트 아가 분석(soft agar assay)를 통해 확인하였다. 또한 클로베타졸 프로피오네이트의 종양 억제 효과가 NRF2 억제로 인한 것인지를 확인하기 위하여 상기 실시예 2에서 사용하였던 NRF2-shRNA-2 를 이용하여 NRF2를 넉다운시킨 폐암 세포주에서의 종양 억제 효과와 비교하였다. LKB1/KEAP1 normal lung cancer cell line H1299, KEAP1 mutant cell line H2228, LKB1/KEAP1 mutant lung cancer cell line A549, H460 were treated with clobetazole propionate alone or in combination with mTOR inhibitor rapamycin. It was confirmed through a soft agar assay. In addition, in order to confirm whether the tumor inhibitory effect of clobetasol propionate is due to NRF2 inhibition, it was compared with the tumor inhibitory effect in the lung cancer cell line knocked down NRF2 using NRF2-shRNA-2 used in Example 2 above. .

구체적으로, 12 웰 플레이트에 0.7% 아가를 함유한 DMEM 배지 50 ㎕를 넣고 굳힌 후(bottome agar), 3×103 세포와 0.35% 아가를 함유한 DMEM 배지 300 ㎕를 굳힌 아가 배지 위에 넣고 굳혔다(top agar+/- Docycucline). 다 굳은 후에, DMEM 배지(+/- Doxyxycline) 250 ㎕를 넣고 CO2 배양기에서 2주 정도 배양 후 형성된 콜로니(colony)의 수를 파악하였고, 그 결과를 도 7 및 도 8에 나타내었다.Specifically, 50 µl of DMEM medium containing 0.7% agar was added to a 12 well plate and hardened (bottome agar), and then 3×10 3 cells and 300 µl of DMEM medium containing 0.35% agar was put on the hardened agar medium and solidified (top agar+/- Docycucline). After solidification, 250 µl of DMEM medium (+/- Doxyxycline) was added and the number of colonies formed after 2 weeks incubation in a CO 2 incubator was determined, and the results are shown in FIGS. 7 and 8.

그 결과, 도 7a 및 7b에 나타난 바와 같이, KEAP1 돌연변이 세포주인 A549, H2228은 클로베타졸 프로피오네이트 처리 및 NRF2 넉다운에 의해 세포 성장이 강력히 억제되었지만, KEAP1 정상 세포주인 H1299에서는 클로베타졸 프로피오네이트 처리 및 NRF2 넉다운이 세포 성장에 크게 영향을 미치지 못했다. 이러한 결과는 글루코코르티코이드의 항종양 효과는 NRF2의 억제 의존적이라는 것을 보여준다.As a result, as shown in Figures 7a and 7b, KEAP1 mutant cell lines A549 and H2228 strongly inhibited cell growth by treatment with clobetasol propionate and NRF2 knockdown, but clobetasol propio in KEAP1 normal cell line H1299. Nate treatment and NRF2 knockdown did not significantly affect cell growth. These results show that the antitumor effect of glucocorticoid is inhibitory-dependent of NRF2.

(2) LKB1 돌연변이 세포주 H460에 대한 클로베타졸 프로피오네이트 및 라파마이신의 효과(2) Effect of clobetasol propionate and rapamycin on LKB1 mutant cell line H460

위의 결과와는 달리 H460 세포주는 도 7a, 7b에서 나타난 바와 같이 KEAP1 돌연변이 세포주임에도 불구하고 클로베타졸 프로피오네이트 처리 및 NRF2 넉다운에 의한 세포성장 억제 효과가 미미하였다. 최근 연구에 의하면 대부분의 KEAP1 돌연변이는 보통 LKB1 돌연변이와 함께 나타나며(A549, H460 세포주) LKB1 돌연변이는 mTORC1의 활성화를 통해 암 세포의 성장을 유도한다는 사실을 보고했다. 따라서 이러한 종래의 연구 결과 및 상기 결과를 토대로, 도 7c에 나타난 바와 같이, H460 세포주에서 클로베타졸 프로피오네이트의 효과가 저하된 이유는 H460 세포주가 KEAP1 돌연변이와 LKB1 돌연변이를 가지고 있어서 NRF2 및 mTORC1가 함께 활성화되어 있기 때문이라고 가설을 세웠고, NRF2 및 mTORC1을 모두 억제할 수 있다면 항암 시너지 효과가 날 것이라고 예상하였다.Unlike the above results, the H460 cell line, as shown in Figs. 7a and 7b, had insignificant effect on cell growth inhibition by clobetasol propionate treatment and NRF2 knockdown, despite being a KEAP1 mutant cell line. Recent studies have reported that most KEAP1 mutations usually appear with LKB1 mutations (A549, H460 cell lines) and that LKB1 mutations induce cancer cell growth through activation of mTORC1. Therefore, based on these conventional research results and the above results, as shown in Fig. 7c, the reason that the effect of clobetasol propionate in the H460 cell line is lowered is that the H460 cell line has the KEAP1 mutation and the LKB1 mutation, so that NRF2 and mTORC1 are It was hypothesized that they were active together, and if both NRF2 and mTORC1 could be inhibited, an anticancer synergistic effect would occur.

먼저, H460 세포주와 LKB1-cDNA를 형질도입으로 발현시킨 H460 세포주에서 mTORC1의 활성화를 비교하기 위해 poly-HEMA(Sigma-Aldrich, St.Louis, USA)로 코팅한 플레이트에 세포를 시딩한 후 CO2 인큐베이터에서 24시간 동안 현탁 배양(suspension culture)후 상기 실시예 1과 동일하게 웨스턴 블롯을 수행하여 mTORC1의 활성을 측정하였다.First, in order to compare the activation of mTORC1 in H460 cell line and H460 cell line transduced with LKB1-cDNA, cells were seeded on a plate coated with poly-HEMA (Sigma-Aldrich, St. Louis, USA), and then CO 2 After suspension culture in an incubator for 24 hours, Western blot was performed in the same manner as in Example 1 to measure the activity of mTORC1.

그 결과, 도 7d에 나타난 바와 같이, H460 세포를 현탁 배양할 경우 LKB1 발현을 시킨 상태보다 LKB1 발현이 없는 상태에서 mTORC1의 기질인 p70S6K의 인산화가 증가함을 확인하였다. 즉, 이로부터 H460 세포의 mTORC1 활성이 높음을 알 수 있었다.As a result, as shown in FIG. 7D, it was confirmed that the phosphorylation of p70S6K, a substrate of mTORC1, was increased in a state in which LKB1 expression was not present than in a state in which LKB1 expression was expressed in the suspension culture of H460 cells. In other words, it was found that the mTORC1 activity of H460 cells was high.

이후, 클로베타졸 프로피노네이트와 라파마이신을 동시에 처리하거나, NRF2를 NRF2-shRNA를 이용하여 넉다운시킨 후 라파마이신을 처리했을 때 항암 시너지 효과가 나타는지를 확인하였다.Thereafter, clobetasol propinonate and rapamycin were treated at the same time, or NRF2 was knocked down using NRF2-shRNA, and then it was confirmed whether an anticancer synergistic effect appeared when rapamycin was treated.

그 결과, 도 7e에 나타나 있듯이, 클로베타졸 프로피오네이트와 라파마이신을 병용 처리한 경우 또는 라파마이신을 처리하고 NRF2 발현을 억제한 조합 모두 H460 세포의 성장을 강력하게 억제하였다.As a result, as shown in Fig. 7e, both the combination treatment of clobetasol propionate and rapamycin or treatment of rapamycin and suppression of NRF2 expression strongly inhibited the growth of H460 cells.

(3) in vivo 실험(3) in vivo experiment

한편, A549 세포주를 이용하여 제노그래프트 어세이(xenograft assay)를 수행하였다. 구체적으로, Balb/c-nu 마우스(6-8 주령, Orient Bio, 성남, 한국)가 종양 제노그래프트를 수행하기 위해 준비되었고, A549-luc-C8 세포(Perkin Elmer, 5.0 x 106/head)가 상기 마우스의 피하에 주입되었다. 2주 후 종양의 크기가 50-100 mm3 에 도달했을 때, 마우스들을 6개의 그룹, 즉, 비이클(vehcle; 1.2% DMSO, 0.25% PEG400 및 0.25% tween 80을 포함하는 PBS 200 ㎕)만을 투여한 대조군, 클로베타졸 프로피오네이트 0.5 mg/kg을 투여한 그룹, 클로베타졸 프로피오네이트 1 mg/kg을 투여한 그룹, 라파마이신 1mg/kg을 투여한 그룹 및 병용 1(CP 0.5 mg/kg + rapamycin 1 mg/kg) 그룹 및 병용 2(CP 1 mg/kg + rapamycin 1 mg/kg)그룹으로 나누었다. 이후 40일간 비이클과 라파마이신(n=그룹 당 5)은 매일(1주당 5일) 복강 내에 주사하였고, 클로베타졸 프로피오네이트는 2일에 한 번(1주에 3일) 복강 내에 주사하였다. Meanwhile, a xenograft assay was performed using the A549 cell line. Specifically, Balb/c-nu mice (6-8 weeks old, Orient Bio, Seongnam, Korea) were prepared to perform tumor xenograft, and A549-luc-C8 cells (Perkin Elmer, 5.0 x 10 6 /head) Was injected subcutaneously in the mouse. When the tumor size reached 50-100 mm 3 after 2 weeks, mice were administered only in 6 groups, i.e., vehicles (vehcle; 200 μl of PBS containing 1.2% DMSO, 0.25% PEG400 and 0.25% tween 80). One control group, the group receiving clobetasol propionate 0.5 mg/kg, the group receiving clobetasol propionate 1 mg/kg, the group receiving rapamycin 1 mg/kg, and combination 1 (CP 0.5 mg/kg) kg + rapamycin 1 mg/kg) group and combination 2 (CP 1 mg/kg + rapamycin 1 mg/kg) group. For the next 40 days, vehicle and rapamycin (n = 5 per group) were injected intraperitoneally every day (5 days per week), and clobetasol propionate was injected intraperitoneally once every 2 days (3 days per week). .

일차 종양 크기와 체중은 매 3-4일마다 각각 칼리퍼(caliper)와 발란스(balance)를 통해 측정되었고, 종양의 부피는 V(mm3)=(A×B2)/2(V는 부피, A는 장직경(long diameter), B는 단직경(short diameter)이다)의 식으로 계산되었다.The primary tumor size and weight were measured every 3-4 days through a caliper and a balance, respectively, and the volume of the tumor was V(mm 3 )=(A×B 2 )/2 (V is the volume , A is the long diameter, B is the short diameter).

이후, 마우스들은 7.5%의 CO2 챔버에서 희생되었고, 추가 분석을 위해 종양들을 획득하였다. 이 연구들은 국립 암센터 연구소의 실험동물운영위원회(Institutional Animal Care and Use Committee, IACUC)의 승인을 받았다. Thereafter, mice were sacrificed in a 7.5% CO 2 chamber and tumors were acquired for further analysis. These studies were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute.

그 결과, 도 8a 내지 8c에 나타난 바와 같이, 클로베타졸 프로피오네이트(0.5 mpk, 1 mpk)와 라파마이신(1 mpk) 단독 처리 시에 뚜렷한 항암 효과가 있음을 확인하였고, 특히 병용 처리 시 종양이 사라지는 매우 강력항 항암 시너지 효과가 나타나는 것을 관찰할 수 있었다. 반면에, 도 8d에 나타난 바와 같이 마우스의 체중에는 큰 변화가 없는 것으로 보아, 뚜렷한 부작용은 없는 것으로 파악되었다.As a result, as shown in Figs. 8A to 8C, it was confirmed that clobetasol propionate (0.5 mpk, 1 mpk) and rapamycin (1 mpk) alone had a distinct anticancer effect, and in particular, tumors in combination treatment It could be observed that the disappearing very strong anticancer synergistic effect appeared. On the other hand, as shown in Fig. 8d, there was no significant change in the weight of the mouse, and it was found that there were no obvious side effects.

따라서 LKB1/KEAP1 돌연변이 조합의 폐암 세포주에서 라파마이신과 클로베타졸 프로피오네이트의 병용 요법은 부작용 없이 강한 항암 시너지 효과를 낸다는 것을 in vivo에서 확인할 수 있었다.Therefore, it was confirmed in vivo that the combination therapy of rapamycin and clobetazole propionate produced a strong anticancer synergistic effect without side effects in the lung cancer cell line of the LKB1/KEAP1 mutant combination.

<< 실시예Example 5> 저영양 상태에서 5> in a low nutrient state 클로베타졸Clobetasol 프로피오네이트와With propionate 수니티닙과의With Sunitinib 병용 항암 시너지 효과 확인 Combination anti-cancer synergy effect confirmed

(1) (One) 저포도당Low glucose 상태에서의 정상 세포의 Of normal cells in the state NRF2NRF2 발현량 측정 Expression level measurement

상기 실시예 3에서, 일반적으로 세포 배양 시, 즉 영양이 충분한 상태에서 KEAP1 정상세포(H1299)는 NRF2 발현이 매우 낮게 유지됨을 확인하였다(도 6a). 이에, 실제 종양 미세 환경의 대표적인 특징 중 하나인 영양소 부족 상태(저포도당 상태)에서는 어떤 변화가 있는지를 확인하기 위해 웨스턴 블롯과 루시퍼라아제 실험을 상기 실시예 1에서 수행한 방법과 동일하게 수행하였다.In Example 3, it was confirmed that normal KEAP1 cells (H1299) maintained very low NRF2 expression during cell culture, that is, in a state of sufficient nutrition (FIG. 6A). Accordingly, Western blot and luciferase experiments were performed in the same manner as in Example 1 in order to determine what changes are in the nutrient deficiency state (low glucose state), which is one of the representative characteristics of the actual tumor microenvironment. .

그 결과, 도 9a 및 도 9b에 나타난 바와 같이 KEAP1 정상 세포에서도 NRF2의 발현과 활성이 증가함을 확인하였다.As a result, it was confirmed that the expression and activity of NRF2 increased even in KEAP1 normal cells as shown in FIGS. 9A and 9B.

(2) (2) 저포도당Low glucose 상태에서의 State NRF2NRF2 And AMPKAMPK 발현 억제 효과 Expression inhibitory effect

도 9a에 나타난 바와 같이 LKB1 정상 세포는 저영양 상태에서 AMPK를 활성화시키고(AMPK의 기질인 ACC의 인산화 증가), AMPK의 활성화는 저영양 상태에서 암세포의 생존을 증가시킨다는 것이 알려져 있으므로, NRF2와 AMPK를 함께 억제할 경우 강력한 항암 시너지 효과가 나타날 것으로 예상하였다. 이를 확인하기 위하여 H1299 세포주에 AMPKa 및 NRF2 에 대한 shRNA를 포함한 tet-on 벡터를 형질 도입한 세포주를 확립한 후 저영양 상태(포도당 2mM)에서 콜로니 형성 실험을 수행하였다. 즉, 12웰 플레이트에 세포를 매우 낮은 농도로 시딩 한 후 2주간 2mM 포도당을 함유한 배지로 배양한 후 상기 실시예 3에서 수행했던 크리스탈 바이올렛 염색 방법으로 콜로니 형성 정도를 관찰하여 항암효과를 확인하였다.As shown in Fig. 9a, it is known that normal LKB1 cells activate AMPK in a hypotrophic state (increased phosphorylation of ACC, a substrate of AMPK), and activation of AMPK increases the survival of cancer cells in a hypotrophic state, so NRF2 and AMPK When suppressed together, a strong anticancer synergistic effect was expected. To confirm this, a cell line transfected with a tet-on vector including shRNA for AMPKa and NRF2 was established in the H1299 cell line, and then colony formation experiments were performed in a low nutrient state (2 mM glucose). That is, after seeding the cells at a very low concentration in a 12-well plate, the cells were cultured in a medium containing 2mM glucose for 2 weeks, and then the degree of colony formation was observed by the crystal violet staining method performed in Example 3 to confirm the anticancer effect. .

그 결과, 도 9c에 나타난 바와 같이, AMPK와 NRF2 발현을 동시에 억제하였을 때 매우 강력한 항암 시너지 효과가 나타나는 것을 확인하였다.As a result, as shown in Fig. 9c, it was confirmed that a very strong anticancer synergistic effect appeared when simultaneously inhibiting the expression of AMPK and NRF2.

(3) (3) 저포도당Low glucose 상태에서의 State 클로베타졸Clobetasol 프로피오네이트Propionate And 수니티닙의Sunitinib 병용 효과 Combination effect

현재까지 임상적으로 사용되는 AMPK 억제제는 없지만, 최근 연구에서 위장관 기질 종양 치료에 사용되는 티로신 키나제 억제제(주로 VEGFR 억제)인 수니티닙(Sunitinib)의 오프 타깃(off target) 효과로 AMPK를 억제한다는 것이 밝혀졌다. 따라서 본 실험에서 수니티닙과 클로베타졸 프로피오네이트를 함께 처리하여 저영양 상태(포도당 2mM)에서 상기 실험과 동일한 콜로니 형성 실험을 수행하여 항암효과를 관찰하였다.Although there are no clinically used AMPK inhibitors to date, recent studies have shown that AMPK is inhibited by the off-target effect of Sunitinib, a tyrosine kinase inhibitor (mainly inhibiting VEGFR), which is used to treat gastrointestinal stromal tumors. It turned out. Therefore, in this experiment, the same colony formation experiment as the above experiment was performed in a low nutrient state (glucose 2 mM) by treating sunitinib and clobetasol propionate together to observe the anticancer effect.

그 결과, 도 9d에 나타난 바와 같이, 수니티닙과 클로베타졸 프로피노네이트를 병용한 경우 강한 항암 시너지 효과가 나타나는 것을 확인하였다.As a result, as shown in FIG. 9D, it was confirmed that a strong anticancer synergistic effect appeared when sunitinib and clobetasol propinonate were used in combination.

따라서 도 9e에 나타난 바와 같이, 상기의 결과를 통해 KEAP1과 LKB1 모두 정상인 세포에서 저영양 상태인 실제 종양 미세 환경에서는 NRF2 와 AMPK 둘 다 활성화되는 바, 클로베타졸 프로피오네이트, 즉 글루코코르티코이드와 AMPK 억제제와의 병용 투여는 매우 효과적인 치료 방법임을 알 수 있었다.Therefore, as shown in FIG. 9e, through the above results, both NRF2 and AMPK are activated in the actual tumor microenvironment where both KEAP1 and LKB1 are in a low-nutritional state in normal cells. It was found that co-administration with an inhibitor is a very effective treatment method.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 즉 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.As described above, a specific part of the present invention has been described in detail, and for those of ordinary skill in the art, it is obvious that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. That is, the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Pharmaceutical Composition for Treating Non-small Cell Lung Cancer Comprising Glucocorticoids <130> ADP-2018-0314 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 1 ccggagttga gcttcattga actgcctcga ggcagttcaa tgaagctcaa cttttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 2 ccgggctcct actgtgatgt gaaatctcga gatttcacat cacagtagga gctttttg 58 <210> 3 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 3 ccggagagca agatttagat catttctcga gaaatgatct aaatcttgct cttttttg 58 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 4 cggtatgcaa caggacattg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 5 actggttggg gtcttctgtg 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 6 tgccatccta aaagccac 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 7 tcaactggtc tcaagtcagt g 21 <110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Pharmaceutical Composition for Treating Non-small Cell Lung Cancer Comprising Glucocorticoids <130> ADP-2018-0314 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 1 ccggagttga gcttcattga actgcctcga ggcagttcaa tgaagctcaa cttttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 2 ccgggctcct actgtgatgt gaaatctcga gatttcacat cacagtagga gctttttg 58 <210> 3 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 3 ccggagagca agatttagat catttctcga gaaatgatct aaatcttgct cttttttg 58 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 4 cggtatgcaa caggacattg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 5 actggttggg gtcttctgtg 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 6 tgccatccta aaagccac 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 7 tcaactggtc tcaagtcagt g 21

Claims (12)

암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate) 및 데스옥시메타손(desoxymetasone)으로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물을 포함하는 폐암 치료용 약학 조성물.Aminonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandrenolide, flumethasone, desonide (see, for example, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometasone furoate, and desoxymetasone. Wherein the composition comprises at least one glucocorticoid compound selected from the group consisting of: 제 1 항에 있어서, 상기 조성물은 클로베타졸 프로피오네이트(clobetasol propionate)를 더 포함하는 것을 특징으로 하는 폐암 치료용 약학 조성물.The pharmaceutical composition for treating lung cancer according to claim 1, wherein the composition further comprises clobetasol propionate. 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate) 및 데스옥시메타손(desoxymetasone)으로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물을 포함하는 폐암 개선용 건강기능식품 조성물.Aminonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandrenolide, flumethasone, desonide (see, for example, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometasone furoate, and desoxymetasone. Wherein the composition comprises at least one glucocorticoid compound selected from the group consisting of 제 3항에 있어서, 상기 조성물은 클로베타졸 프로피오네이트(clobetasol propionate)를 더 포함하는 것을 특징으로 하는 폐암 개선용 건강기능식품 조성물.4. The composition of claim 3, wherein the composition further comprises clobetasol propionate. 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate) 및 데스옥시메타손(desoxymetasone)으로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 포함하는 것을 특징으로 하는 폐암 치료용 약학 조성물.But are not limited to, clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandrenolide, Flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometasone fructoate (also known as &lt; RTI ID = 0.0 &gt; mometasone furoate, and desoxymetasone, and an mTOR inhibitor. &lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt; 제 5 항에 있어서, 상기 mTOR 억제제는 라파마이신(rapamycin), 템시로리무스(temsirolimus), 에버롤리무스(Everolimus), 리다포롤리무스(Ridaforolimus), AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226 및 PF-04691502로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 폐암 치료용 약학 조성물.6. The method of claim 5, wherein the mTOR inhibitor is selected from the group consisting of rapamycin, temsirolimus, Everolimus, Ridaforolimus, AZD-8055, AZD-2014, OSI- INK128, PP242, NVP-BEZ235, XL765, BGT226 and PF-04691502. 제 5 항에 있어서, 상기 폐암은 KEAP1 돌연변이 폐암 또는 KEAP1 및 LKB1 돌연변이 폐암인 것을 특징으로 하는 폐암 치료용 약학 조성물.The pharmaceutical composition according to claim 5, wherein the lung cancer is KEAPl mutant lung cancer or KEAPl and LKB1 mutant lung cancer. 제 5 항에 있어서, 상기 약학 조성물은 글루코코르티코이드계 화합물 1 내지 50 중량% 및 mTOR 억제제 50 내지 99 중량%를 포함하는 것을 특징으로 하는 폐암 치료용 약학 조성물.6. The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition comprises 1 to 50% by weight of a glucocorticoid compound and 50 to 99% by weight of an mTOR inhibitor. 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate) 및 데스옥시메타손(desoxymetasone)으로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 포함하는 것을 특징으로 하는 폐암 개선용 건강기능식품 조성물.But are not limited to, clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandrenolide, Flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometasone fructoate (also known as &lt; RTI ID = 0.0 &gt; wherein the composition comprises at least one glucocorticoid compound selected from the group consisting of mometasone furoate and desoxymetasone and an mTOR inhibitor. 제 9 항에 있어서, 상기 mTOR 억제제는 라파마이신(rapamycin), 템시로리무스(temsirolimus), 에버롤리무스(Everolimus), 리다포롤리무스(Ridaforolimus), AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226 및 PF-04691502로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 폐암 개선용 건강기능식품 조성물.10. The method of claim 9, wherein the mTOR inhibitor is selected from the group consisting of rapamycin, temsirolimus, Everolimus, Ridaforolimus, AZD-8055, AZD-2014, OSI- Wherein the composition is at least one selected from the group consisting of INK128, PP242, NVP-BEZ235, XL765, BGT226 and PF-04691502. 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate) 및 데스옥시메타손(desoxymetasone)으로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 유효성분으로 포함하는 것을 특징으로 하는, 인 비트로(In vitro)에서 NRF2(핵 인자(에리트로이드 2)-유사인자 2)의 활성 억제용 시약 조성물.But are not limited to, clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandrenolide, Flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometasone fructoate (also known as &lt; RTI ID = 0.0 &gt; The present invention relates to a pharmaceutical composition containing at least one glucocorticoid compound selected from the group consisting of mometasone furoate and desoxymetasone and an mTOR inhibitor as an active ingredient. 2) -like factor 2). 사람을 제외한 동물에서, 클로베타졸 프로피오네이트(clobetasol propionate), 암시노나이드(amcinonide), 베타메타손 발레레이트(betamethasone valerate), 히드로코르티손 발레레이트(hydrocortisone valerate), 플루니솔라이드(flunisolide), 플루르안드레놀라이드(flurandrenolide), 플루메타손(flumethasone), 데소나이드(desonide), 베클로메타손 디프로피오네이트(beclomethasone dipropionate), 트리암시노론 아세토나이드(triamcinolone acetonide), 부데소나이드(budesonide), 모메타손 퓨로에이트(mometasone furoate) 및 데스옥시메타손(desoxymetasone)으로 이루어진 군에서 선택된 하나 이상의 글루코코르티코이드계 화합물 및 mTOR 억제제를 처리하는 단계를 포함하는 것을 특징으로 하는 NRF2(핵 인자(에리트로이드 2)-유사인자 2)의 활성 억제 방법.In animals other than humans, it is possible to use clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, But are not limited to, flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, Characterized in that it comprises treating at least one glucocorticoid compound selected from the group consisting of mometasone furoate and desoxymetasone and an mTOR inhibitor (nuclear factor (erythroid 2 ) -Like factor 2).
KR1020180098026A 2015-11-02 2018-08-22 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids Active KR101978629B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20150153296 2015-11-02
KR1020150153296 2015-11-02

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020160135006A Division KR101892908B1 (en) 2015-11-02 2016-10-18 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids

Related Child Applications (2)

Application Number Title Priority Date Filing Date
KR1020190035841A Division KR102000425B1 (en) 2015-11-02 2019-03-28 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
KR1020190035840A Division KR102000424B1 (en) 2015-11-02 2019-03-28 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids

Publications (2)

Publication Number Publication Date
KR20180098191A true KR20180098191A (en) 2018-09-03
KR101978629B1 KR101978629B1 (en) 2019-05-15

Family

ID=58742041

Family Applications (4)

Application Number Title Priority Date Filing Date
KR1020160135006A Active KR101892908B1 (en) 2015-11-02 2016-10-18 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
KR1020180098026A Active KR101978629B1 (en) 2015-11-02 2018-08-22 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
KR1020190035840A Active KR102000424B1 (en) 2015-11-02 2019-03-28 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
KR1020190035841A Active KR102000425B1 (en) 2015-11-02 2019-03-28 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids

Family Applications Before (1)

Application Number Title Priority Date Filing Date
KR1020160135006A Active KR101892908B1 (en) 2015-11-02 2016-10-18 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids

Family Applications After (2)

Application Number Title Priority Date Filing Date
KR1020190035840A Active KR102000424B1 (en) 2015-11-02 2019-03-28 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
KR1020190035841A Active KR102000425B1 (en) 2015-11-02 2019-03-28 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids

Country Status (2)

Country Link
KR (4) KR101892908B1 (en)
CN (1) CN108430477B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2018272061A1 (en) * 2017-05-26 2020-01-02 Mercator Medsystems, Inc. Combination therapy for treatment of restenosis
CN109528743A (en) * 2018-12-14 2019-03-29 青岛大学 The drug and its screening technique sensitive to non-small cell lung cancer tumor suppressor gene STK11 mutation
CN111789952B (en) * 2020-05-21 2022-12-23 上海市第六人民医院 A kind of pharmaceutical composition for treating renal clear cell carcinoma and its application
KR102571432B1 (en) * 2023-02-08 2023-08-29 주식회사 에스씨엘테라퓨틱스 Composition for treating cancer containing indazolyl ester and amide derivative

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080018150A (en) 2006-08-23 2008-02-27 한국생명공학연구원 Pharmaceutical composition for the treatment of lung cancer and growth, metastasis inhibition and treatment method of lung cancer using the same
KR20160105668A (en) * 2015-02-27 2016-09-07 이화여자대학교 산학협력단 Pharmaceutical composition for preventing or treating a cancer comprising mometasone

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103705922B (en) * 2012-10-08 2018-07-17 天津金耀集团有限公司 Using glucocorticoid as the externally-applied medicinal composition of active constituent

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080018150A (en) 2006-08-23 2008-02-27 한국생명공학연구원 Pharmaceutical composition for the treatment of lung cancer and growth, metastasis inhibition and treatment method of lung cancer using the same
KR20160105668A (en) * 2015-02-27 2016-09-07 이화여자대학교 산학협력단 Pharmaceutical composition for preventing or treating a cancer comprising mometasone

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Am. J. Respir. Cell Mol. Biol., 2002., Vol.27, pp. 320-328* *
Biochemical Pharmacology., 2014., Vol.90, pp 197-207 *
British Journal of Cancer., 1999., Vol.80., pp 96-103 *
PLoS One., 2012., Vol.7, No.5., e36774 *
The Oncologist., 2008., Vol.13, pp 139-147 *

Also Published As

Publication number Publication date
KR20190038507A (en) 2019-04-08
KR102000425B1 (en) 2019-07-16
KR101978629B1 (en) 2019-05-15
KR20190038506A (en) 2019-04-08
KR20170051261A (en) 2017-05-11
KR101892908B1 (en) 2018-08-29
CN108430477A (en) 2018-08-21
KR102000424B1 (en) 2019-07-16
CN108430477B (en) 2021-05-14

Similar Documents

Publication Publication Date Title
Duan et al. Phenolic compound ellagic acid inhibits mitochondrial respiration and tumor growth in lung cancer
KR102000424B1 (en) Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
EP3204012B1 (en) Cortexolone 17alpha-benzoate for use in the treatment of tumours
US11260062B2 (en) Pharmaceutical composition for treatment of lung cancer comprising glucocorticoid-based compound
AU2024203659B2 (en) Method of liver cancer treatment with safranal-based formulations
Hsin et al. Lipocalin 2, a new GADD153 target gene, as an apoptosis inducer of endoplasmic reticulum stress in lung cancer cells
CN110327324A (en) Contain the leukemia or metastasis of cancer inhibition composition using mono acetyl diacyl glycerol compound as effective component
Feng et al. A novel chrysin thiazole derivative polarizes macrophages to an M1 phenotype via targeting TLR4
Monica et al. Dasatinib modulates sensitivity to pemetrexed in malignant pleural mesothelioma cell lines
Kim et al. Sodium Butyrate Enhances 5‐Fluorouracil Sensitivity Through Thymidylate Synthase Regulation and Cell‐Cycle Modulation in Gastric Cancer
JP2019501959A (en) Use of Akt2 in tumor diagnosis and treatment
EP3541384A1 (en) Treatment of cancer with exon 14 skipping mutation(s) or exon 14 skipping phenotype
KR101207981B1 (en) Pharmaceutical Composition for Preventing or Treating Hormone-refractory Prostate Cancer and Method of Screening the Same
KR20220054174A (en) Composition for preventing or treating liver cancer comprising OSMI-1 and antitumor agent
Tran et al. A Dual CYP17A1/HDAC6 Inhibitor for Targeted Prostate Cancer Therapy
KR102351790B1 (en) Composition for Preventing or Treating Hyperproliferative Vascular Disorders Comprising Derivative of 3-furanyl acrylate
US11273172B2 (en) Synergistic combination of oligonucleotides and chemotherapeutic for treating cancer
KR101078091B1 (en) Composition for preventing and treating of cancer containing chorda filum extract as active ingredient
KR20250095828A (en) Composition for cancer immunotherapy comprising extract of Endolichenic fungus belonging to Phoma sp.
HK40006321B (en) Cortexolone 17alpha-valerate for use in the treatment of tumours
HK40006321A (en) Cortexolone 17alpha-valerate for use in the treatment of tumours
US20180125814A1 (en) Cancer treatment method using ailanthone compounds
Khalaj SREBP Inhibitor, PF429242, Suppresses Proliferation of Prostate Cancer Cell Lines

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
PA0107 Divisional application

Comment text: Divisional Application of Patent

Patent event date: 20180822

Patent event code: PA01071R01D

Filing date: 20161018

Application number text: 1020160135006

PA0201 Request for examination
E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

Comment text: Notification of reason for refusal

Patent event date: 20180903

Patent event code: PE09021S01D

PG1501 Laying open of application
AMND Amendment
E601 Decision to refuse application
PE0601 Decision on rejection of patent

Patent event date: 20181220

Comment text: Decision to Refuse Application

Patent event code: PE06012S01D

Patent event date: 20180903

Comment text: Notification of reason for refusal

Patent event code: PE06011S01I

X091 Application refused [patent]
AMND Amendment
PX0901 Re-examination

Patent event code: PX09011S01I

Patent event date: 20181220

Comment text: Decision to Refuse Application

Patent event code: PX09012R01I

Patent event date: 20181002

Comment text: Amendment to Specification, etc.

E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

Comment text: Notification of reason for refusal

Patent event date: 20190222

Patent event code: PE09021S01D

A107 Divisional application of patent
AMND Amendment
PA0107 Divisional application

Comment text: Divisional Application of Patent

Patent event date: 20190328

Patent event code: PA01071R01D

Filing date: 20161018

Application number text: 1020160135006

PX0701 Decision of registration after re-examination

Patent event date: 20190501

Comment text: Decision to Grant Registration

Patent event code: PX07013S01D

Patent event date: 20190328

Comment text: Amendment to Specification, etc.

Patent event code: PX07012R01I

Patent event date: 20190121

Comment text: Amendment to Specification, etc.

Patent event code: PX07012R01I

Patent event date: 20181220

Comment text: Decision to Refuse Application

Patent event code: PX07011S01I

Patent event date: 20181002

Comment text: Amendment to Specification, etc.

Patent event code: PX07012R01I

X701 Decision to grant (after re-examination)
GRNT Written decision to grant
PR0701 Registration of establishment

Comment text: Registration of Establishment

Patent event date: 20190509

Patent event code: PR07011E01D

PR1002 Payment of registration fee

Payment date: 20190510

End annual number: 3

Start annual number: 1

PG1601 Publication of registration
FPAY Annual fee payment

Payment date: 20220325

Year of fee payment: 4

PR1001 Payment of annual fee

Payment date: 20220325

Start annual number: 4

End annual number: 4

PR1001 Payment of annual fee

Payment date: 20230405

Start annual number: 5

End annual number: 5

PR1001 Payment of annual fee

Payment date: 20240508

Start annual number: 6

End annual number: 6

PR1001 Payment of annual fee

Payment date: 20250415

Start annual number: 7

End annual number: 7