KR102000425B1 - Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids - Google Patents

Abstract

The present invention relates to a composition for treating or improving lung cancer, comprising a glucocorticoid compound, a glucocorticoid compound and an mTOR inhibitor, or a glucocorticoid compound and an AMPK inhibitor as an active ingredient, wherein the glucocorticoid compound is KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancers inhibit the growth of cancer cells through inhibition of NRF2 and exhibit a more potent anticancer effect when used in combination with the mTOR inhibitor. Therefore, they can be effectively used as anticancer drugs for mutant lung cancer. In addition, one of the features of tumor microenvironment, low nutrient environment, induces activation of NRF2 and AMPK in KEAP1 and LKB1 normal lung cancer, and the glucocorticoids are in a low nutritional state in combination with AMPK inhibitor in KEAP1 and LKB1 normal lung cancer Because of its strong anticancer synergy, it can also be used as an anticancer agent for KEAP1 normal lung cancer.

Description

Pharmaceutical Composition for Treating Non-small Cell Lung Cancer Comprising Glucocorticoids containing a glucocorticoid compound

The present invention relates to a composition for the treatment of lung cancer.

Lung cancer is the second most common cancer in both sexes, accounting for 15% of all cancers. According to a report by the American Cancer Society in 2011, more than 220,000 patients are diagnosed with lung cancer a year, and about 70% of them die, accounting for 27% of all cancer deaths.

Among these lung cancers, non-small lung cancer is a type of carcinoma and refers to all epithelial lung cancers, not small lung cancer. It accounts for 85% to 90%. Symptoms of non-small cell lung cancer include persistent cough, chest pain, weight loss, nail damage, joint pain, and shortness of breath. It is hardly present, so it is difficult to detect and treat early, and it is highly likely to be detected only after metastasis to the whole body such as bone, liver, small intestine, and brain.

Non-small cell lung cancer, which is relatively less sensitive to chemotherapy than small cell lung cancer, can be divided into the following stages of cancer based on the TNM classification: the size of tumor, regional lymph nodes. The extent of cancer spread to lymph nodes and the presence or absence of metastasis.

In the case of early non-metastatic non-small cell lung cancer among non-small cell lung cancer. Because the sensitivity to chemotherapy and radiation is very low, surgery is usually performed in conjunction with ancillary chemotherapy involving cisplatin containing platinum. On the other hand, in the case of developing metastatic non-small cell lung cancer past the initial stage, various chemotherapy and radiation treatments are performed.

In addition, non-small cell lung cancer is divided into several sub-types according to the size, shape, and chemical composition of cancer cells, and representatively, adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. have. Adenocarcinoma is lung cancer that occurs with the highest frequency, accounting for more than 40% of all lung cancers, and is found in the outer region of the lungs and tends to progress more slowly than other lung cancers, but shows a high tendency to metastasize and radioactive resistance in the early stages. . Squamous cell carcinoma is a type of non-small cell lung cancer that accounts for 25% to 30% of all lung cancers, and it starts in the early version of cells that make up the airway, and the cancer has a high incidence mainly in smokers. Show. In addition, large cell cancer, which accounts for 10% to 15% of all lung cancers, can develop in any part of the lung, and its progress is fast enough to be similar to that of small cell lung cancer. However, despite such high incidence and mortality, no drugs or treatment methods have been developed to overcome non-small cell lung cancer.

On the other hand, since the first discovery of tumor inducing and suppressing genes in the 1970s to 1980s, the discovery of new tumor-specific mutant genes and targeted anti-cancer treatments targeting the signaling pathways through the discovery have been actively attempted. As part of the strategy, large-scale tumor genome projects (TCGA, ICGC, CGP) have been carried out, mainly in the United States and the United Kingdom. As a result, epidermal growth factor receptor (EGFR), vascular endothelia growth factor (VEGF(R)), mTOR (mechanical target of rapamycin, Mechanistic target of rapamycin) inhibitors, etc., have been developed with high expectations, but did not produce as much effect as expected. The cause is likely due to the diversity and heterogeneity of various and heterogeneous mutations identified through the tumor genome project and abnormal signaling pathways through them. I'm expecting.

Recently, many attempts have been made to develop effective combination chemotherapy in order to overcome the limitations of such targeted anticancer treatment strategies. To this end, research has been conducted to identify the combination of gene mutations commonly found in cancer, and in a recent study, the KEAP1 (Kelch-like ECH-associated protein 1, kelch-like ECH-associated protein 1) gene has been studied. It has been reported that mutations and LKB1 (liver kinase B1) mutations often occur together. The KEAP1 mutation induces the activation of NRF2 (nuclear factor (erythroid 2)-like factor 2, nuclear factor (erythroid-derived 2)-like 2), and when the expression of NRF2 is suppressed in KEAP1 mutant lung cancer, the growth of cancer cells is increased. It has been reported that it is effectively inhibited, and there is a great demand for the development of NFR2 inhibitors. However, although several NRF2 inhibitors discovered through natural product screening have been reported, the effect is insignificant and inconsistent, so there are no drugs under clinical development yet. Meanwhile, LKB1 mutation induces the activation of mTORC1, and various drugs, including rapamycin, have been developed as inhibitors of mTORC1. Therefore, it is expected that a combination anticancer strategy that simultaneously inhibits NRF2 and mTORC1, which are activated in non-small cell lung cancer in which KEAP1 and LKB1 are mutated together, will be very effective, but studies on this have not been done in detail.

1. Korean Patent Publication No. 10-2008-0018150.

It is an object of the present invention to provide a pharmaceutical composition for treating lung cancer that inhibits NRF2 activity, which is commonly activated in lung cancer.

It is an object of the present invention to provide a health functional food composition for improving lung cancer that inhibits NRF2 activity, which is commonly activated in lung cancer.

In order to achieve the above object, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide ), flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide (budesonide), mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate butyrate), betamethasone sodium phosphate, hydrocortisone, diflorasone diacatate, Prednisolone sodium phosphate, prednisolone sodium phosphate, prednicalone, triamcinone , Methylprednisolone sodium succinate, triamcinolone diacetate, rimexolone, isoflupredone acetate, betamethasone, dexamethasone, dexamethasone, dexamethasone Melengestrol acetate, fluticasone propionate (f luticasone propionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate It provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of (cortisol acetate).

In addition, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of an mTOR inhibitor.

In addition, the present invention relates to clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

In order to achieve the above other objects, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide ( flunisolide), flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budeso Budesonide, mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate hydrocortisone butyrate), betamethasone sodium phosphate, hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednisolone mcinolone sodium phosphate, prednicalone triarbate, triamcinorbate ), methylprednisolone sodium succinate, triamcinolone diacetate, rimexolone, isoflupredone acetate, betamethasone, betamethasone, dexamethasone acetate, methamethasone Melengestrol acetate, fluticasone propione Fluticasone propionate, prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and It provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of cortisol acetate.

In addition, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and mTOR inhibitor.

Furthermore, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

According to the present invention, clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone p ropionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate), at least one glucocorticoid compound selected from the group consisting of KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer inhibits cell growth through NRF2 inhibition, and exhibits a stronger anticancer effect when used in combination with mTOR inhibitors. It can be usefully used in the treatment or amelioration of lung cancer including mutations. In addition, in normal lung cancer of the KEAP1 and LKB1 genes, it was confirmed that NRF2 is activated when undernourished, one of the characteristics of the tumor microenvironment, while AMPK is also activated by LKB1. In this lung cancer, glucocorticoid compounds are used in combination with AMPK inhibitors. Since it exhibits an anticancer synergistic effect, KEAP1 can be usefully used in the treatment or improvement of normal lung cancer.

1 is a verification of the accuracy and effectiveness of a luciferase activity measurement system for NRF2 inhibitor screening.
2 and 3 show the results of screening a compound having an NRF2 inhibitory effect in the KEAP1-mutant lung cancer cell line using the 1887 clinical compound library.
Figures 4 and 5 confirm the mechanism of inhibition of NRF2 by clobetasol propionate, which is the most effective among glucocorticoids (GCs) series drugs in KEAP1-mutant lung cancer cell lines.
6 shows the effect of inhibiting the expression of NRF2 target by clobetasol propionate in the KEAP1-mutant cell line and the effect of increasing active oxygen therefrom.
7 and 8 are KEAP1-mutant or KEAP1-mutant/LKB1-mutant lung cancer cell lines, confirmed in vitro and in vivo anticancer synergistic effects that appear when treated in combination with clobetazole propionate alone and rapamycin, an mTOR inhibitor, respectively. will be.
9 shows that NRF2 and AMPK (AMP-activated protein kinase) are activated together in a nutrient deficiency state, which is one of the characteristics of the tumor microenvironment, in KEAP1-normal/LKB1-normal lung cancer cell lines, and this lung cancer cell line The anticancer synergistic effect of clobetasol propionate and sunitinib, an AMPK inhibitor, was confirmed in vitro when cultured in a low nutrient state.

The inventors of the present invention have previously conducted studies (not published) and previously known studies (J Thorac Oncol, 2014, Jun;9(6):794-804; Cancer Discov, 2015, Aug;5(8): 860-77), and KEAP1 (Kelch-like ECH-associated protein 1, kelch-like ECH-associated protein 1) and LKB1 (liver kinase B1, Liver kinase B1) are often combined. Based on the results reported as being mutated, mTOR (mechanistic target of rapamycin) and NRF2 (nuclear factor (erythroid 2)-like factors known as signaling targets activated by the LKB1/KEAP1 mutation) 2, an anti-cancer strategy was established to simultaneously inhibit nuclear factor (erythroid-derived 2)-like 2). In addition, in normal lung cancer cells of the KEAP1/LKB1 gene, NRF2 is activated when under nutrient deficiency, which is one of the characteristics of the tumor microenvironment, while AMPK (AMP-activated protein kinase) is also activated by LKB1. , An anti-cancer strategy to simultaneously inhibit NRF2 and AMPK was also established.

To this end, 13 kinds of glucocorticoid compounds with an inhibitory effect of more than 50% were discovered by screening drugs with NRF2 inhibitory effect among 1887 clinical compound libraries provided by the Korea Chemicals Bank. Of these, clobetasol propio Anticancer effect was confirmed using Nate. First, the effect of inhibiting cell growth in KEAP1 mutant lung cancer cells was confirmed, and in particular, it was confirmed that the anticancer synergistic effect appeared when combined with rapamycin, an mTOR inhibitor, in lung cancer cells in which KEAP1/LKB1 was mutated together. In addition, when KEAP1/LKB1 gene normal lung cancer cells were cultured in a low nutritional state, it was confirmed that the anticancer synergistic effect appeared when clobetasol propionate and sunitinib, an AMPK inhibitor, were co-treated, thereby completing the present invention. .

The KEAP1 is present in the E3 ubiquitin ligase complex and inhibits its function by binding to the transcription factor NRF2 protein and inducing degradation. If the KEAP1 gene is mutated in cancer cells (20-30% in lung cancer), the amount of NRF2 protein increases to increase the transcription of the target gene, thereby increasing the activity of antioxidant-related enzymes, which are mainly targets of NRF2.

The LKB1 is a serine/threonine kinase, also known as STK11 (Serine/Threonine Kinase 11), and is a tumor suppressor gene that is commonly mutated or inhibited from expression in lung cancer (20-30%), uterine cancer, and colon cancer. Is known. Currently, 12 kinds of substrates for LKB1 have been identified. Among them, the mTORC1 inhibitory signaling pathway through AMPK activation has been suggested to represent the tumor suppressor function of LKB1. However, activation of AMPK by LKB1 plays a very important role in maintaining the energy homeostasis of cells, and this is very important for the survival of cancer cells in the tumor microenvironment, which is in a nutrient-deficient state, so it also exhibits a tumor promoting function. Therefore, the LKB1-AMPK pathway is known to perform both tumor suppression and tumor promotion functions depending on the situation.

Accordingly, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of.

In this case, the lung cancer may be KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer.

In addition, the lung cancer may be non-small cell lung cancer.

In addition, the pharmaceutical composition according to the present invention may further include an inhibitor of mTOR, which is a target activated by mutated KEAP1/LKB1 signaling.

Accordingly, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of an mTOR inhibitor.

At this time, the mTOR inhibitor is rapamycin, temsirolimus, everolimus, ridaforolimus, AZD-8055, AZD-2014, OSI-027, INK128, PP242, It may be one or more selected from the group consisting of NVP-BEZ235, XL765, BGT226 and PF-04691502, more preferably rapamycin, but is not limited thereto.

In addition, the lung cancer may be KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer.

Moreover, the lung cancer may be non-small cell lung cancer.

The pharmaceutical composition is preferable because it can contain 1 to 50% by weight of a glucocorticoid compound and 50 to 99% by weight of an mTOR inhibitor, and can most effectively inhibit NRF2 and mTOR within this range to exhibit the therapeutic effect of lung cancer. .

Moreover, the pharmaceutical composition of the present invention may further include an inhibitor of AMPK, which is a target activated in the signal transduction process of KEAP1/LKB1 normal lung cancer cells.

That is, the present invention is clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pro pionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a pharmaceutical composition for treating lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

In this case, the AMPK inhibitor may be one or more selected from the group consisting of sunitinib and dorsomorphin (compound C), more preferably sunitinib, but is not limited thereto.

The lung cancer may be KEAP1 and LKB1 normal lung cancer, and the pharmaceutical composition according to the present invention may exhibit the most excellent therapeutic effect in such lung cancer.

In addition, the lung cancer may be non-small cell lung cancer.

On the other hand, the pharmaceutical composition may contain 1 to 50% by weight of a glucocorticoid-based compound and 50 to 99% by weight of an AMPK inhibitor, and it is preferable because it can show the therapeutic effect of lung cancer by most effectively inhibiting AMPK within this range. .

In addition to the glucocorticoid-based compound, mTOR inhibitor, and AMPK inhibitor, the pharmaceutical composition may further include a suitable carrier, excipient, or diluent commonly used in the manufacture of pharmaceutical compositions.

Carriers, excipients or diluents usable in the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil.

The pharmaceutical composition according to the present invention is formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods. I can.

In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient, such as starch, calcium carbonate, and sucrose ( sucrose), lactose, or gelatin.

In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. .

Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The amount of the glucocorticoid compound or the mTOR inhibitor mixture, which is an active ingredient of the pharmaceutical composition according to the present invention, may vary depending on the patient's age, sex, weight, and disease, but is 0.001 to 100 mg/kg, preferably 0.01 to 10 mg/kg may be administered once to several times a day.

In addition, the dosage of the pharmaceutical composition according to the present invention may be increased or decreased depending on the route of administration, the degree of disease, sex, weight, age, and the like. Therefore, the above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition may be administered to mammals such as rats, mice, livestock, and humans by various routes. All modes of administration can be expected, for example, oral, rectal or intravenous, intramuscular, subcutaneous, intrabronchial inhalation, intrauterine dura mater or by intracerebroventricular injection.

In addition, the present invention relates to clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of.

In addition, the present invention provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandronola Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mometa Mometasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium phosphate (betamethasone sodium phosphate), hydrocortisone, diflorasone diacatate, prednisolone sodium phosphate, prednicarbate, triamcinolone, methylprednisolone, methylprednisolone (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, melengestrol acetate , Fluticasone propionate (fluticasone pro pionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and mTOR inhibitor.

At this time, the mTOR inhibitor is rapamycin, temsirolimus, everolimus, ridaforolimus, AZD-8055, AZD-2014, OSI-027, INK128, PP242, It may be one or more selected from the group consisting of NVP-BEZ235, XL765, BGT226 and PF-04691502, more preferably rapamycin, but is not limited thereto.

The present invention also provides clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo Metasone furoate, desoxymetasone, clocortolone pivalate, prednisolone hemisuccinate, hydrocortisone butyrate, betamethasone sodium Phosphate (betamethasone sodium phosphate), hydrocortisone (hydrocortisone), diflorasone diacatate (diflorasone diacatate), prednisolone sodium phosphate, prednicarbate (prednicarbate), triamcinolone sodium, methyl triamcinolone Nate (methylprednisolone sodium succinate), triamcinolone diacetate, rimexolone, isoflurredone acetate, betamethasone, dexamethasone acetate, merengestrol ), fluticasone propionate (fluticasone pr opionate), prednisolone, methylprednisolone 6-alpha, hydrocortisone base, fluorometholone, finasteride, fluocinonide and cortisol acetate cortisol acetate) provides a health functional food composition for improving lung cancer comprising at least one glucocorticoid-based compound selected from the group consisting of and an AMPK inhibitor.

At this time, the AMPK inhibitor may be at least one selected from the group consisting of sunitinib and dorsomorphin (compound C), and most preferably sunitinib, but is not limited thereto.

The health functional food may be provided in the form of powder, granule, tablet, capsule, syrup, or beverage, and the health functional food is an active ingredient such as a glucocorticoid compound, mTOR inhibitor, or AMPK inhibitor, along with other foods or food additives. Used, and can be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use, for example, health or therapeutic treatment.

The effective dose of the glucocorticoid compound, the mTOR inhibitor mixture, or the AMPK inhibitor mixture contained in the health functional food can be used in accordance with the effective dose of the pharmaceutical composition, but for health and hygiene purposes or for health control purposes. In the case of long-term intake, it may be less than the above range, and since there is no problem in terms of safety, the active ingredient can be used in an amount greater than the above range.

There are no particular restrictions on the types of health functional foods, examples of which include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea. , Drinks, alcoholic beverages, and vitamin complexes.

In addition, the present invention relates to clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, flurandro Flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budesonide, mo In vitro NRF2 It provides a reagent composition for inhibiting the activity of nuclear factor (erythroid 2)-like factor 2).

In addition, in animals other than humans, the present invention relates to clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide ( flunisolide), flurandrenolide, flumethasone, desonide, beclomethasone dipropionate, triamcinolone acetonide, budeso NRF2 (nuclear) comprising the step of treating at least one glucocorticoid-based compound selected from the group consisting of budesonide, mometasone furoate, and desoxymetasone and an AMPK inhibitor. A method of inhibiting the activity of factor (erythroid 2)-like factor 2) is provided.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are only illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples, and is provided to more completely describe the present invention to those with average knowledge in the art. will be.

< Preparation example 1>

For use in the experiment, H1299 (KEAP1-normal, LKB1-normal), a genetic normal non-small-cell lung carcinoma (NSCLC), and non-small cell lung cancer cell lines (H2228 (KEAP1-mutant, LKB1-normal)) and KEAP1 mutation LKB1-normal), A549 (KEAP1-mutation, LKB1-mutation), H460 (KEAP1-mutation, LKB1-mutation)) were purchased from Korea Cell Line Bank, 10% fetal bovine serum (FBS, Invitrogen), 1% penicillin -Incubated in Dulbecco's Modified Eagle's medium (DMEM, HyClone Laboratories, USA) supplemented with streptomycin and 1% HEPES at 5% CO ₂ , 37°C. In addition, for screening in subsequent experiments, A549-ARE cells were seeded at a high density in a 96-well plate, and then a 1887 clinical compound library (Korea Chemical Bank) was processed. Clobetasol propionate (CP) was purchased from Sigma-Aldrich (St. Louis, USA). In addition, materials necessary for other experiments were purchased from Sigma (CT99021, GSK3 inhibitor), EMD Millipore (MG132), and LC laboratories (rapamycin), and antibodies to be used in Western blot were GeneTex (ME1, IDH1, G6PD, PGD, GCLM, GCR). , NRF2), Cell Signaling Technology (NRF2, LKB1, p-AMPK, AMPK, pGSK-3, GSK3, p-p70S6K, p70S6K, α-tubulin), Sigma (KEAP1), Proteintech (SRXN1).

< Example 1> NRF2 Inhibitor screening

(1) Establishment of ARE-luciferase cell line for measuring NRF2 activity

In order to screen for effective NRF2 inhibitors, luciferase/green fluorescent protein (GFP) dual antioxidant responsive element (ARE)-DNA nucleotide sequence capable of monitoring NRF2 activity as shown in FIG. 1A ( The CACCGTGACTCAGCAATTx3) system (Luciferase/GFP dual ARE-receptor cell line system) was established in A549 (LKB1 normal/KEAP1 mutation) non-small cell lung cancer cells with high NRF2 activity.

To prove that luciferase and GFP signals showing high activity in the A549 cell line are specific for NRF2 activity, three doxycyclin-inducible NRF2-shRNAs having different sequences as shown in Table 1 below were constructed. I did. To construct a Tet-inducible shRNA expression system, the following shRNAs were inserted into a tet-pLKO-pyro vector (Dmitri Wiederschain: Addgene plasmide #21915), and then A549-expressing doxycycline-inducible NRF2-shRNA through transduction. ARE cell line was established.

Thereafter, 0.2 µg/mL of doxycycline (DOX; Clontech) was treated in the medium every 2 days to induce NRF2-shRNA expression. Thereafter, the efficiency of inhibition of NRF2 expression was verified through Western blot, luciferase activity measurement, and GFP expression measurement using a fluorescence microscope.

shRNA order Sequence number NRF2sh-1 CCGGAGTTGAGCTTCATTGAACTGCCTCGAGGCAGTTCAATGAAGCTCAACTTTTTTG One NRF2sh-2 CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTTG 2 NRF2sh-3 CCGGAGAGCAAGATTTAGATCATTTCTCGAGAAATGATCTAAATCTTGCTCTTTTTTG 3

Specifically, for western blot, proteins were isolated after treatment with doxycycline for 3 and 6 days in A549 cells expressing Tet-pLKO-NCshRNA (negative control) and three types of Tet-pLKO-NRF2 shRNA. Each 10 μg of the separated protein was loaded onto an 8% acrylamide gel and subjected to electrophoresis, and then transferred to a nitrocellulose (NC) membrane, followed by NRF2 antibody (Cell signaling, 1:1000) and actin. ) Antibody (SCBT, 1:1000) was diluted in TBST (Tris-Buffered Saline with tween 20) buffer containing 5% skim milk and reacted overnight at 4°C. Thereafter, the secondary antibody was reacted for 1 hour, washed with TBST, and the protein expression level was measured using ECL (Enhanced chemiluminescence).

In addition, first, A549-ARE cells were dispensed into a 96-well plate at 5×10 ³ cells per well, and after 24 hours, each clinical compound was treated by concentration (1 μm or 5 μm). After 24 hours of treatment, 30 µl of a Lysis buffer was added and dissolved at 4°C using a rocker for 40 minutes. 20 µl of the dissolved product was added to a 96 well white plate, 100 µl of a luciferase substrate buffer as shown in the following composition was added, and luciferase activity was measured using a plate reader. It was measured.

* Buffer for Substrate

1.Buffer A

1mM D-Luciferin (D-Luciferin, pH 6.1-6.4 (yellow light) stored at -20℃)

2. Buffer B

40 mM Tricine (Tricin, MW 179.2)

2.14 mM (MgCO₃)₄Mg(OH)₂5H₂O(MW 485.7)

5.34 mM MgSO₄7H₂O (MW 246.48)

66.6 mM dithiothreitol (DTT, MW 1542)

1.06 mM adenosine triphosphate (ATP, MW 551)

0.54 mM coenzyme (Coenzyme, MW 767.5)

0.2 mM ethylenediaminetetraacetic acid (EDTA) ethylenediaminetetraacetic acid (EDTA, stock 0.5M EDTA, pH 7.8, stored at -20℃)

3. Make a Assay Mixture (1:1) = substrate buffer

-Lysis Buffer

0.1M potassium phosphate buffer, pH 7.8

(1M K₂HPO₄, 1M KH₂PO₄)

1% Triton X-100

1 mM DTT

2 mM EDTA

The remaining dissolved product was diluted 5 times with distilled water (DW), and the protein concentration was measured by the Bradford assay (BioRad) method. Specifically, 200 ul of a solution obtained by diluting the stock solution of Bradford's reagent (Kumashi Brilliant Blue G-250) 5-fold with distilled water was reacted with 5 ul of the remaining dissolved product, and the absorbance was measured at 595 nM. The protein concentration of the lysed product was calculated in the same manner using the BSA solution as a standard protein. The luciferase value was corrected by dividing the luciferase value measured above by the measured protein concentration.

As a result, as shown in Figs. 1b, 1c and 1d, NRF2sh-2 most effectively inhibited NRF2 protein expression, luciferase activity, and GFP signal, from which the luciferase activity and GFP signal high in A549 were NRF2. It was found that it was specific to

(2) Screening using 1887 clinical compound library

As shown in Figure 2a, the luciferase/GFP dual ARE-receptor cell line system was used to screen for compounds having an NRF2 inhibitory effect among 1887 clinical compound libraries provided by the Korea Chemicals Bank. That is, the luciferase assay was performed using A438-ARE cells in the same manner as in Example 1 above.

As a result, as shown in Fig. 2b, glucocorticoid (GCs)-based drugs among clinical compounds showed an NRF2 inhibitory effect, and most GCs-based drugs were excellently inhibited by more than 50% by 24 hours treatment at 1 μm concentration. Had an effect.

(3) NRF2 inhibitory effect of glucocorticoid drugs

From the results obtained above, 13 types of GCs-based drugs having excellent effects were selected, and luciferase assay was performed according to the method described above to compare the NRF2 inhibitory effect by concentration of the 13 types of GCs-based drugs.

As a result, as shown in Figure 3, most of the excellent inhibitory effect was exhibited from the 10 nM level, in particular, in the case of clobetasol propionate (Clobetasol propionate) showed an excellent effect from 1 nM, the most excellent inhibition even at 1 ㎛ Showed the effect.

<Example 2> Confirmation of the mechanism of inhibition of NRF2 by clobetasol propionate

(1) Confirmation of the mechanism of inhibition of clobetasol propionate

Glucocorticoids act as ligands of the nuclear receptor subfamily 3. group C, member 1 known as the glucocorticoid receptor (GC receptor, GCR). When glucocorticoid binds to GCR, GCR induces transcriptional promotion or transcriptional inhibition of many genes involved in various functions in vivo such as inflammation and metabolism. Based on these facts, in order to confirm whether the NRF2 inhibitory effect of glucocorticoid, that is, clobetazole propionate, is related to GCR, GCR-shRNA was used to inhibit GCR expression, and then the western blot and lucifer. Raase assay was performed.

First, A549-tet-on cells transduced using a vector containing GCR-shRNA were established, treated with doxycycline and clobetasol propionate, and then supplemented with a protease inhibitor cocktail (EMD millipore) to perform western blot. The protein extract was prepared by hemolysis using the cell signaling technology. Thereafter, Western blot was performed according to the method performed in Example 1. At this time, the concentration of the protein was determined by performing the Bradford assay according to the method carried out in Example 1. In addition, the luciferase assay was performed according to the method performed in Example 1.

As a result, as shown in Figs. 4a and 4b, inhibition of GCR expression completely prevented NRF2 inhibition by clobetasol propionate. That is, clobetasol propionate significantly reduces the level and activity of the NRF2 protein, which was blocked by inhibition of the expression of GCR. This fact clearly shows that the NRF2 inhibitory effect of clobetasol propionate, ie glucocorticoid, is related to GCR.

(2) Effect of clobetasol propionate by concentration

In addition, in order to clearly confirm the effect of clobetasol propionate according to the concentration, the cells were treated with 100 nM or 1 μm of clobetasol propionate, and the cells after 8 hours, 24 hours, and 48 hours were treated as Example 1 The luciferase assay was performed according to the method performed in, and the activity of NRF2 was measured.

As a result, as shown in Figs. 4c and 4d, the inhibition of NRF2 activity by clobetasol propionate was maintained for at least 48 hours at a concentration of 100 nM, and this result was consistent with the decreased amount of NRF2 protein. This means that glucocorticoid inhibits NRF2 by reducing its protein expression.

(3) Measurement of effects on NRF2 mRNA and protein degradation

Studies accumulated to date show that NRF2 protein levels can be regulated by mRNA transcription or proteasome-related degradation. Therefore, in order to confirm whether NRF2 is inhibited through mRNA transcriptional inhibition or NRF2 is inhibited by promoting proteasome-related degradation, real-time PCR was performed on the cells, and the proteasome inhibitor MG132 was treated. Thereafter, Western blot was performed in the same manner as in Example 1.

Specifically, for real-time PCR, total RNA was extracted from A549 cells using TRizol (Invitrogen). Thereafter, 1 μg of total RNA was raised and reverse transcribed into cDNA using dT primers and SuperScript II Reverse Transcriptase according to the manufacturer's instructions (Invitrogen). After that, PCR is HotStart-ITIt was performed according to the manufacturer's instructions (Affymetrix) using SYBR Green qPCR Master Mix. The primers for NRF2 and β-actin used in PCR were shown in Table 2 below.

gene Kinds order Sequence number NRF2 Forward direction CGGTATGCAACAGGACATTG 4 Reverse ACTGGTTGGGGTCTTCTGTG 5 β-actin Forward direction TGCCATCCTAAAAGCCAC 6 Reverse TCAACTGGTCTCAAGTCAGTG 7

As a result, as shown in Figs. 4e to 4f, clobetasol propionate did not affect the mRNA level of NRF2 itself, but when MG132 was treated on the contrary, the amount of NRF2 protein inhibited by clobetazole propionate was recovered. Became. That is, based on these results, it was found that the clobetasol propionate compound inhibits NRF2 by inducing GCR-dependent proteasome-related degradation.

(4) Confirmation of NRF2 protein degradation mechanism

In general, the proteasome decomposition of the NRF2 protein consists of two major pathways, namely, a pathway by KEAP1 and a pathway via GSK3-β-TrCP, as shown in FIG. 5A. Based on the results obtained above, in order to confirm which pathway of the glucocorticoid compound inhibits NRF2 by regulating the two pathways, the GSK3 inhibitor and clobetasol propionate were administered to the KEAP1 mutant A549 cells prepared in the above preparation example. The luciferase assay and Western blot performed in Example 1 were performed. In addition, after establishing A549-tet-on cells transduced using a vector containing β-TrCP shRNA, Western blot and luciferase assays were performed in the same manner for cells knocked down the β-TrCP gene with doxycycline. Performed.

As a result, as shown in Figs. 5b and 5c, clobetasol propionate-induced NRF2 protein degradation and inhibition of activity were inhibited by GSK3 inhibitor treatment. In addition, as shown in Fig. 5d, even when β-TrCP was knocked down, clobetasol propionate-induced protein degradation of NRF2 was suppressed. That is, these results indicate that the glucocorticoid compound degrades the NRF2 protein using a pathway through GSK3-β-TrCP.

Moreover, it is known to date that GSK3 inhibits the migration of NRF2 to the nucleus. To prove this, cells treated with a GSK3 inhibitor and clobetasol propionate were fractionated into nuclei and cytoplasm under MG132 treatment, and then Western blot was performed.

As a result, as shown in Fig. 5e, the migration of NRF2 to the nucleus was inhibited by clobetasol propionate treatment, and this effect was completely blocked by the GSK3 inhibitor. These results, as shown in Figs. 5f and 5g, support the result that inhibition of NRF2 proteolysis alone by MG132 treatment or β-TrCP knockdown does not restore the inhibition of NRF2 activity by glucocorticoids. That is, the glucocorticoid compound not only decomposes NRF2 by activating GSK3, but also inhibits NRF2 by inhibiting the migration of NRF2 to the nucleus.

Therefore, when the above results are summarized, it can be seen that as shown in FIG. 5h, glucocorticoid inhibits NRF2 through GSK3 activation, which inhibits the migration of NRF2 to the nucleus and promotes β-TrCP-dependent degradation.

<Example 3> Inhibition of expression of NRF2 target protein by clobetasol propionate and confirmation of increase in active oxygen

(1) Measurement of NRF2 expression level in non-small cell lung cancer cell lines

In general, it is known that NRF2 is highly expressed in KEAP1 mutant cells, and p-AMPK is low in expression in LKB1 mutant cells. To confirm this, Western blot was performed on four cells. Specifically, KEAP1 mutant cells H2228 (KEAP1-mutant, LKB1-normal), A549 (KEAP1-mutant, LKB1-mutant), H460 (KEAP1-mutant, LKB1-mutant), and normal gene cells H1299 (KEAP1-normal, To verify the presence or absence of KEAP1 and LKB1 mutations in LKB1-normal), Western blot was performed in the same manner as in Example 1 to confirm the expression levels of NRF2 and p-AMPK.

As a result, as shown in FIG. 6A, since the H2228, A549, and H460 cell lines had high NRF2 expression levels, it was confirmed that they had the KEAP1 mutation, and based on the low AMPK activity of the A549 and H460 cell lines, they had the LKB1 mutation. Was confirmed.

(2) Confirmation of the effect of clobetasol propionate

In order to confirm the effect of glucocorticoid on cells having high NRF2 activity, KEAP1 mutant cells (A549 and H2228) were treated with clobetazole propionate for 2, 4 or 5 days, and the above was performed. By Western blot method, expression of major NRF2 target proteins (G6PD, PGD, ME1, GCLM, AKR1B10, AKR1C3) related to redox regulation was measured. As a control, cells in which NRF2 expression was suppressed by transforming the H2228 cell line with NRF2-shRNA were used.

As a result, as shown in Figure 6b, it can be confirmed that both the control group transformed with NRF2-shRNA in the H2228 cell line and the case where clobetazole propionate was treated effectively inhibited the expression of the NRF2 target protein, which mainly has an antioxidant action. there was. Likewise, as shown in Fig. 6c, when the A549 cell line was treated with clobetasol propionate, the NRF2 target protein expression was also effectively suppressed.

In addition, since ME1 and GCLM proteins are proteins that detoxify hydrogen peroxide, the amount of hydrogen peroxide after treatment with clobetasol propionate was measured as follows to confirm the change thereof: The A549 and H2228 cell lines were 5 After incubating for 30 minutes with ㎛ CMH2DCF-DA (Invitrogen), the cultured cells were washed twice with phosphate buffered saline and 90% dimethyl sulfoxide (DMSO) and 10% PBS for 40 minutes in the dark. During incubation, the fluorescent die was released. After cultivation, the supernatant of the culture solution was dispensed into a 96-well plate and the amount of fluorescence was measured at 480/530 nm. In order to standardize the measured fluorescence amount, the cells remaining after removal of the supernatant and washing with PBS were stained with a crystal violet solution (20% methanol and 0.5% crystal violet) for 10 minutes at room temperature. After washing three times and incubating for solubilization in 1% SDS solution, absorbance at a wavelength of 570 nm was measured.

As a result, as shown in FIG. 6D, it was confirmed that active oxygen was significantly increased when clobetasol propionate was treated with A549 and H2228. In other words, it proves that glucocorticoids such as clobetasol propionate can effectively inhibit the antioxidant function of NRF2.

<Example 4> Clobetasol propionate alone anticancer effect and combination with rapamycin anticancer synergistic effect confirmed

(1) in vitro experiment

LKB1/KEAP1 normal lung cancer cell line H1299, KEAP1 mutant cell line H2228, LKB1/KEAP1 mutant lung cancer cell line A549, H460 were treated with clobetazole propionate alone or in combination with mTOR inhibitor rapamycin. It was confirmed through a soft agar assay. In addition, in order to confirm whether the tumor inhibitory effect of clobetasol propionate is due to NRF2 inhibition, it was compared with the tumor inhibitory effect in the lung cancer cell line knocked down NRF2 using NRF2-shRNA-2 used in Example 2 above. .

Specifically, 50 µl of DMEM medium containing 0.7% agar was added to a 12 well plate and hardened (bottome agar), and then 3×10 ³ cells and 300 µl of DMEM medium containing 0.35% agar was put on the hardened agar medium and solidified (top agar+/- Docycucline). After solidification, 250 µl of DMEM medium (+/- Doxyxycline) was added _{and the number of colonies formed after 2 weeks incubation in a CO 2} incubator was determined, and the results are shown in FIGS. 7 and 8.

As a result, as shown in Figures 7a and 7b, KEAP1 mutant cell lines A549 and H2228 strongly inhibited cell growth by treatment with clobetasol propionate and NRF2 knockdown, but clobetasol propio in KEAP1 normal cell line H1299. Nate treatment and NRF2 knockdown did not significantly affect cell growth. These results show that the antitumor effect of glucocorticoid is inhibitory-dependent of NRF2.

(2) Effect of clobetasol propionate and rapamycin on LKB1 mutant cell line H460

Unlike the above results, the H460 cell line, as shown in Figs. 7a and 7b, had insignificant effect on cell growth inhibition by clobetasol propionate treatment and NRF2 knockdown, despite being a KEAP1 mutant cell line. Recent studies have reported that most KEAP1 mutations usually appear with LKB1 mutations (A549, H460 cell lines) and that LKB1 mutations induce cancer cell growth through activation of mTORC1. Therefore, based on these conventional research results and the above results, as shown in Fig. 7c, the reason that the effect of clobetasol propionate in the H460 cell line is lowered is that the H460 cell line has the KEAP1 mutation and the LKB1 mutation, so that NRF2 and mTORC1 are It was hypothesized that they were active together, and if both NRF2 and mTORC1 could be inhibited, an anticancer synergistic effect would occur.

First, in order to compare the activation of mTORC1 in H460 cell line and H460 cell line transduced with LKB1-cDNA, cells were seeded on a plate coated with poly-HEMA (Sigma-Aldrich, St. Louis, USA), and then CO ₂ After suspension culture in an incubator for 24 hours, Western blot was performed in the same manner as in Example 1 to measure the activity of mTORC1.

As a result, as shown in FIG. 7D, it was confirmed that the phosphorylation of p70S6K, a substrate of mTORC1, was increased in a state in which LKB1 expression was not present than in a state in which LKB1 expression was expressed in the suspension culture of H460 cells. In other words, it was found that the mTORC1 activity of H460 cells was high.

Thereafter, clobetasol propinonate and rapamycin were treated at the same time, or NRF2 was knocked down using NRF2-shRNA, and then it was confirmed whether an anticancer synergistic effect appeared when rapamycin was treated.

As a result, as shown in Fig. 7e, both the combination treatment of clobetasol propionate and rapamycin or treatment of rapamycin and suppression of NRF2 expression strongly inhibited the growth of H460 cells.

(3) in vivo experiment

Meanwhile, a xenograft assay was performed using the A549 cell line. Specifically, Balb/c-nu mice (6-8 weeks old, Orient Bio, Seongnam, Korea) were prepared to perform tumor xenograft, and A549-luc-C8 cells (Perkin Elmer, 5.0 x 10 ⁶ /head) Was injected subcutaneously in the mouse. When the tumor size ^{reached 50-100 mm 3} after 2 weeks, mice were administered only in 6 groups, i.e., vehicles (vehcle; 200 μl of PBS containing 1.2% DMSO, 0.25% PEG400 and 0.25% tween 80). One control group, the group receiving clobetasol propionate 0.5 mg/kg, the group receiving clobetasol propionate 1 mg/kg, the group receiving rapamycin 1 mg/kg, and combination 1 (CP 0.5 mg/kg) kg + rapamycin 1 mg/kg) group and combination 2 (CP 1 mg/kg + rapamycin 1 mg/kg) group. For the next 40 days, vehicle and rapamycin (n = 5 per group) were injected intraperitoneally every day (5 days per week), and clobetasol propionate was injected intraperitoneally once every 2 days (3 days per week). .

The primary tumor size and weight were measured every 3-4 days through a caliper and a balance, respectively, and the volume of the tumor was V(mm ³ )=(A×B ² )/2 (V is the volume , A is the long diameter, B is the short diameter).

Thereafter, mice were _{sacrificed in a 7.5% CO 2} chamber and tumors were acquired for further analysis. These studies were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute.

As a result, as shown in Figs. 8A to 8C, it was confirmed that clobetasol propionate (0.5 mpk, 1 mpk) and rapamycin (1 mpk) alone had a distinct anticancer effect, and in particular, tumors in combination treatment It could be observed that the disappearing very strong anticancer synergistic effect appeared. On the other hand, as shown in Fig. 8d, there was no significant change in the weight of the mouse, and it was found that there were no obvious side effects.

Therefore, it was confirmed in vivo that the combination therapy of rapamycin and clobetazole propionate produced a strong anticancer synergistic effect without side effects in the lung cancer cell line of the LKB1/KEAP1 mutant combination.

< Example 5> in a low nutrient state Clobetasol With propionate With Sunitinib Combination anti-cancer synergy effect confirmed

(One) Low glucose Of normal cells in the state NRF2 Expression level measurement

In Example 3, it was confirmed that normal KEAP1 cells (H1299) maintained very low NRF2 expression during cell culture, that is, in a state of sufficient nutrition (FIG. 6A). Accordingly, Western blot and luciferase experiments were performed in the same manner as in Example 1 in order to determine what changes are in the nutrient deficiency state (low glucose state), which is one of the representative characteristics of the actual tumor microenvironment. .

As a result, it was confirmed that the expression and activity of NRF2 increased even in KEAP1 normal cells as shown in FIGS. 9A and 9B.

(2) Low glucose State NRF2 And AMPK Expression inhibitory effect

As shown in Fig. 9a, it is known that normal LKB1 cells activate AMPK in a hypotrophic state (increased phosphorylation of ACC, a substrate of AMPK), and activation of AMPK increases the survival of cancer cells in a hypotrophic state, so NRF2 and AMPK When suppressed together, a strong anticancer synergistic effect was expected. To confirm this, a cell line transfected with a tet-on vector including shRNA for AMPKa and NRF2 was established in the H1299 cell line, and then colony formation experiments were performed in a low nutrient state (2 mM glucose). That is, after seeding the cells at a very low concentration in a 12-well plate, the cells were cultured in a medium containing 2mM glucose for 2 weeks, and then the degree of colony formation was observed by the crystal violet staining method performed in Example 3 to confirm the anticancer effect. .

As a result, as shown in Fig. 9c, it was confirmed that a very strong anticancer synergistic effect appeared when simultaneously inhibiting the expression of AMPK and NRF2.

(3) Low glucose State Clobetasol Propionate And Sunitinib Combination effect

Although there are no clinically used AMPK inhibitors to date, recent studies have shown that AMPK is inhibited by the off-target effect of Sunitinib, a tyrosine kinase inhibitor (mainly inhibiting VEGFR), which is used to treat gastrointestinal stromal tumors. It turned out. Therefore, in this experiment, the same colony formation experiment as the above experiment was performed in a low nutrient state (glucose 2 mM) by treating sunitinib and clobetasol propionate together to observe the anticancer effect.

As a result, as shown in FIG. 9D, it was confirmed that a strong anticancer synergistic effect appeared when sunitinib and clobetasol propinonate were used in combination.

Therefore, as shown in FIG. 9e, through the above results, both NRF2 and AMPK are activated in the actual tumor microenvironment where both KEAP1 and LKB1 are in a low-nutritional state in normal cells. It was found that co-administration with an inhibitor is a very effective treatment method.

As described above, a specific part of the present invention has been described in detail, and for those of ordinary skill in the art, it is obvious that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. That is, the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Pharmaceutical Composition for Treating Non-small Cell Lung Cancer Comprising Glucocorticoids <130> ADP-2019-0143 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 1 ccggagttga gcttcattga actgcctcga ggcagttcaa tgaagctcaa cttttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 2 ccgggctcct actgtgatgt gaaatctcga gatttcacat cacagtagga gctttttg 58 <210> 3 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 3 ccggagagca agatttagat catttctcga gaaatgatct aaatcttgct cttttttg 58 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 4 cggtatgcaa caggacattg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 5 actggttggg gtcttctgtg 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 6 tgccatccta aaagccac 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 7 tcaactggtc tcaagtcagt g 21

Claims (6)

A pharmaceutical composition for the treatment of lung cancer, which comprises clobetasol propionate and sunitinib. delete The pharmaceutical composition for treating lung cancer according to claim 1, wherein the lung cancer is KEAP1 and LKB1 normal lung cancer. The pharmaceutical composition for treating lung cancer according to claim 1, wherein the pharmaceutical composition comprises 1 to 50% by weight of clobetasol propionate and 50 to 99% by weight of suinitinib. A health functional food composition for improving lung cancer, which comprises clobetasol propionate and sunitinib. delete

Images