CN108430477B - Pharmaceutical composition comprising glucocorticoid compound for treating lung cancer - Google Patents

Pharmaceutical composition comprising glucocorticoid compound for treating lung cancer Download PDF

Info

Publication number
CN108430477B
CN108430477B CN201680064090.8A CN201680064090A CN108430477B CN 108430477 B CN108430477 B CN 108430477B CN 201680064090 A CN201680064090 A CN 201680064090A CN 108430477 B CN108430477 B CN 108430477B
Authority
CN
China
Prior art keywords
lung cancer
acetate
nrf2
keap1
propionate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201680064090.8A
Other languages
Chinese (zh)
Other versions
CN108430477A (en
Inventor
全相玟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ajou University Industry Academic Cooperation Foundation
Original Assignee
Ajou University Industry Academic Cooperation Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ajou University Industry Academic Cooperation Foundation filed Critical Ajou University Industry Academic Cooperation Foundation
Priority claimed from PCT/KR2016/012534 external-priority patent/WO2017078405A1/en
Publication of CN108430477A publication Critical patent/CN108430477A/en
Application granted granted Critical
Publication of CN108430477B publication Critical patent/CN108430477B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308—Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a composition for treating or improving lung cancer, which comprises, as active ingredients, a glucocorticoid-like compound and an mTOR inhibitor, or a glucocorticoid-like compound and an AMPK inhibitor, wherein the glucocorticoid-like compound inhibits growth of cancer cells by inhibiting NRF2 in KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer, and exhibits a stronger anticancer effect when used in combination with the mTOR inhibitor, and thus can be effectively used as an anticancer agent for mutant lung cancer. Also, since the low nutritional environment, which is one of the characteristics of the tumor microenvironment, induces the activation of NRF2 and AMPK in KEAP1 and LKB1 normal lung cancer, the glucocorticoid compound exhibits a strong anticancer synergistic effect in a low nutritional state when treated in combination with an AMPK inhibitor in KEAP1 and LKB1 normal lung cancer, and thus can be effectively used as an anticancer agent for KEAP1 normal lung cancer.

Description

Pharmaceutical composition comprising glucocorticoid compound for treating lung cancer
Technical Field
The invention relates to a composition for treating lung cancer.
Background
Lung cancer (lung cancer) as the second most common cancer in men and women accounts for 15% of all cancers. According to 2011 American cancer society, over 22 million patients are diagnosed with lung cancer each year, with about 70% of deaths accounting for 27% of all cancer deaths.
Among these lung cancers, non-small cell lung cancer (non-small cell lung cancer) refers to all epithelial lung cancers (epithelial lung cancer) of non-small cell lung cancer (small cell lung cancer) as a malignant epithelial tumor (carcinoma) and accounts for about 85% to 90% of all lung cancers. Symptoms of non-small cell lung cancer include persistent cough, chest pain, weight loss, nail damage, joint pain, shortness of breath (short of breath), etc., but since non-small cell lung cancer generally progresses slowly, symptoms hardly appear at an early stage, so that early detection and treatment are difficult, and there is a high possibility that the symptoms are found only after metastasis to the whole body such as bone, liver, small intestine, and brain.
Non-small cell lung cancer, which is relatively insensitive to chemotherapy (chemotherapy) compared to small cell lung cancer, can be classified into cancer stages based on the TNM classification as follows: the size of the tumor (the size of tumor), the extent of spread of the cancer to regional lymph nodes (regional lymph nodes), and whether the cancer metastasizes.
Early non-metastatic (non-small cell) lung cancer among non-small cell lung cancers is often associated with adjuvant chemotherapy (adjuvant chemotherapy) and surgery in association with cisplatin (cissplatin) containing platinum due to its very low sensitivity to chemotherapy and radiation therapy. In contrast, in the case of metastatic non-small cell lung cancer that develops after an early stage, various chemo-and radiotherapy treatments are performed.
Non-small cell lung cancer is classified into adenocarcinoma (adenocarinoma), squamous cell carcinoma (squamous cell carcinoma), large cell carcinoma (large cell carcinoma), and the like, typically according to the size, shape, and chemical composition of cancer cells. Adenocarcinoma, the most common lung cancer accounting for over 40% of all lung cancers, is found in the outer region of the lung (outer region) and has a tendency to progress slower than other lung cancers, but exhibits a higher propensity for metastasis and resistance to radioactivity at an early stage. Squamous cell carcinoma, a non-small cell lung cancer that accounts for 25% to 30% of all lung cancers, occurs in early stages of airway (air) cells, with the cancer occurring at a higher rate primarily in smokers. In addition, large cell carcinoma, which accounts for about 10% to 15% of all lung cancers, can develop at any part of the lung and its development speed is as fast as small cell lung cancer (small cell lung cancer). However, despite the high morbidity and mortality, no drug or treatment has been developed to date that can overcome non-small cell lung cancer.
In addition, since the first discovery of tumor-inducing and tumor-suppressing genes in the 70 to 80 th century, new tumor-specific mutant genes and targeted anticancer therapies targeting signaling pathways therethrough have been sought, and recently, large-scale tumor genome projects (TCGA, ICGC, CGP) centered around the united states and the uk have been developed as a link to the strategy of targeted anticancer therapy. As a result, Epidermal Growth Factor Receptor (EGFR) targeting specific signaling process, vascular Epidermal growth factor (vegf (r)), rapamycin mechanism target (mTOR: mechanistic target of rapamycin) inhibitor, etc. have been attracting much attention and developed, but the expected effects have not been obtained, which are expected to be due to mutations having diversity and heterogeneity determined by tumor genome project and diversity and heterogeneity of aberrant signaling pathway therethrough.
Recently, to overcome the limitations of this targeted anti-cancer therapeutic strategy, a number of attempts have been made to develop effective combination chemotherapy. For this reason, studies for identifying a combination of gene mutations frequently found in cancer are being conducted, and recent reports have revealed that a mutation in the kelch-like ECH-associated protein 1(KEAP 1: kelch-like ECH-associated protein 1) gene and a mutation in Liver kinase B1(LKB 1: Liver kinase B1) frequently occur together in non-small cell lung cancer. Reports indicate that the KEAP1 mutation induces Nuclear factor (erythroid-2) -like 2(NRF 2: Nuclear factor (erythroid-derived 2) -like2) activation, effectively inhibiting the growth of cancer cells when inhibiting NRF2 expression in KEAP1 mutant lung cancer, and thus there is a great need to develop NRF2 inhibitors. However, although reports indicate that several NRF2 inhibitors were found by screening natural products, their effects were weak and not consistent, and thus there was no drug in clinical development so far. In addition, LKB1 mutation induces mTORC1 activation, and various drugs including rapamycin, which is an inhibitor of mTORC1, are currently being developed. Therefore, a combined anticancer strategy that inhibits both NRF2 and mTORC1 activated in non-small cell lung cancer that both KEAP1 and LKB1 mutate together is expected to be very effective, however, its research has not been specifically carried out.
Disclosure of Invention
Technical problem
The present invention aims to provide a pharmaceutical composition for treating lung cancer which inhibits the activity of NRF2, which is frequently activated in lung cancer.
The invention aims to provide a health-care functional food composition for improving lung cancer, which inhibits the activity of frequently activated NRF2 in lung cancer.
Technical scheme
To achieve the above object, the present invention provides a pharmaceutical composition for treating lung cancer, comprising one or more glucocorticoids selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
The present invention also provides a pharmaceutical composition for treating lung cancer, comprising an mTOR inhibitor and one or more glucocorticoids selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
The present invention also provides a pharmaceutical composition for treating lung cancer, comprising an AMPK inhibitor and one or more glucocorticoid compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
To achieve the above-mentioned another object, the present invention provides a functional health food composition for improving lung cancer, comprising one or more glucocorticoid compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
The present invention also provides a health functional food composition for improving lung cancer, comprising an mTOR inhibitor and one or more glucocorticoids selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
In addition, the present invention provides a health functional food composition for improving lung cancer, comprising an AMPK inhibitor and one or more glucocorticoid compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
Advantageous effects
According to the present invention, the compound is selected from the group consisting of clobetasol propionate (clobetasol propionate), amcinonide (amcinonide), betamethasone valerate (betamethasone valerate), hydrocortisone valerate (hydrocortisone valerate), flunisolide (flunisolide), budesonide (desonide), desonide (desonide), beclomethasone dipropionate (beclomethasone dipropionate), triamcinolone acetonide (triamcinolone acetonide), budesonide (budesonide), mometasone furoate (mometasone furoate), desoxymethasone (desoxyymethosone), fludroxycortolone (sodium piperadinonate), Prednisolone succinate (prednisone hydrochloride), triamcinolone acetate (sodium dehydroacetate), triamcinolone acetate (sodium dehydroxysone acetate), triamcinolone acetonide (sodium acetate (sodium benzoate), triamcinolone acetate (sodium dehydroxysone acetate (sodium benzoate), triamcinolone acetate (sodium benzoate, triamcinolone acetate), triamcinolone acetate (sodium benzoate) and triamcinolone acetate (sodium benzoate) as, One or more glucocorticoid compounds selected from the group consisting of rimexolone (rimexolone), isoflupredone acetate (isoflurandrone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 α (methylprednisone 6-one), hydrocortisone base (hydrocortisone base), fluorometholone (fluoronootholone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate) exhibit potent anti-cancer effects including inhibition of cell growth by inhibiting f2 in KEAP1 or LKB1 mutant lung cancer, and are more effective as inhibitors of mTOR and thus can be used as anticancer agents, including anticancer agents. In addition, in the normal lung cancer with KEAP1 and LKB1 genes, if they are in a low nutrient environment which is one of the characteristics of the tumor microenvironment, it was confirmed that NRF2 is activated and AMPK is also activated with LKB1, and in such lung cancer, glucocorticoid compounds exhibit synergistic anticancer effects when used in combination with AMPK inhibitors, and therefore, they can be effectively used for the treatment or amelioration of KEAP1 normal lung cancer.
Drawings
Figure 1 demonstrates the accuracy and effectiveness of luciferase activity assay systems for NRF2 inhibitor screening.
Fig. 2 and 3 show the results of screening compounds having NRF2 inhibitory effect in KEAP1 mutant lung cancer cell line using 1887 clinical compound library.
FIGS. 4 and 5 confirm the NRF2 inhibition mechanism using clobetasol propionate, which is most effective among glucocorticoid (Glucocorticoids, GCs) series drugs in KEAP 1-mutant lung cancer cell lines.
Figure 6 confirms the inhibitory effect of clobetasol propionate on NRF2 target expression and thus the reactive oxygen species increasing effect of KEAP1 mutant cell line.
Fig. 7 and 8 are graphs in which the synergistic anticancer effects against the KEAP1 mutation or KEAP1 mutation/LKB 1 mutant lung cancer cell line treated with clobetasol propionate alone and in combination with rapamycin as an mTOR inhibitor were confirmed in vitro and in vivo.
Fig. 9 confirms in vitro the synergistic anticancer effect of NRF2 activated together with AMPK (AMP-activated protein kinase) in the nutrient deficient state of KEAP 1-normal/LKB 1-normal lung cancer cell line, which is one of the characteristics of a tumor microenvironment, and by combined treatment of clobetasol propionate and sunitinib (sunitinib) as an AMPK inhibitor when the lung cancer cell line was cultured in vitro in a low nutrient state.
Best mode for carrying out the invention
The present inventors established anticancer strategies for simultaneous inhibition of mTOR (rapamycin mechanistic target of rapamycin) and NRF2 (Nuclear factor (erythrocyte-derived 2) -like2, Nuclear factor (Nuclear factor-2) known as signal transduction targets activated by LKB1/KEAP1 mutations, based on the results of previous studies (unpublished) and the results of combinations of genes mutated in actual lung Cancer investigated in well-known studies (J Thorac Oncol, 2014, Jun; 9 (6): 794-804; Cancer Discov, 2015, Aug; 5 (8): 860-77) and the results of frequent co-mutation of kelch-like ECH-associated protein 1(KEAP 1) with Liver kinase B1(LKB1, Liver kinase B1). Furthermore, in the KEAP1/LKB1 gene normal lung cancer cell, it was confirmed that NRF2 was activated in a state of nutrient deficiency, which is one of characteristics of a tumor microenvironment, and AMPK (AMP-activated protein kinase) was also activated by LKB1, thereby establishing an anticancer strategy of inhibiting both NRF2 and AMPK.
Therefore, 13 glucocorticoid compounds having an inhibitory effect of 50% or more were discovered by screening drugs having an inhibitory effect of NRF2 from the 1887 clinical compound library received from korean compound bank, and anticancer effects were confirmed using clobetasol propionate, which is the most effective of them. First, it was confirmed that the cell growth inhibitory effect was exhibited in the KEAP1 mutant lung cancer cell, and particularly, that the synergistic anticancer effect was exhibited when rapamycin (rapamycin) as an mTOR inhibitor was used in combination with the KEAP1/LKB1 mutant lung cancer cell. In addition, it was confirmed that when normal lung cancer cells of the KEAP1/LKB1 gene were cultured in a low-nutrition state, a synergistic anticancer effect was exhibited by the combined treatment of clobetasol propionate and sunitinib (sunitinib), which is an AMPK inhibitor, and thus the present invention was completed.
The KEAP1 is present in E3ubiquitin ligase complex (E3ubiquitin ligase complex), and induces degradation by binding to NRF2 protein as a transcription factor, thereby inhibiting its function. If the KEAP1 gene is mutated in cancer cells (accounting for 20-30% in lung cancer), increasing the amount of NRF2 protein increases, thereby increasing the transcription of target genes, and thus the activity of enzymes mainly associated with anti-oxidation as NRF2 targets increases.
LKB1 is also known as Serine/Threonine Kinase 11(STK 11: Serine/Threonine Kinase 11), frequently mutated or inhibited in lung cancer (20% to 30%) and uterine and colorectal cancers to become dysfunctional, and is known as a tumor suppressor. There are currently 12 known LKB1 mechanisms. And wherein inhibition of the signal transduction pathway by activation of mTORC1 of AMPK is believed to embody the tumor suppression function of LKB 1. However, activation of AMPK by LKB1 plays a very important role in maintaining cell energy homeostasis, since it is critical for cancer cell survival in tumor microenvironments in a state of insufficient nutrition and thus also exhibits tumor promoting function. Therefore, the LKB1-AMPK pathway is known to exert tumor-inhibiting and tumor-promoting functions depending on the situation.
Accordingly, the present invention provides a pharmaceutical composition for treating lung cancer comprising a glucocorticoid-like compound, wherein the glucocorticoid-like compound comprises one or more selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
In this case, the lung cancer may be KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer.
Also, the lung cancer may be non-small cell lung cancer.
Also, the pharmaceutical composition according to the invention may further comprise an inhibitor of mTOR as a target for activation by mutated KEAP1/LKB1 signalling.
Accordingly, the present invention provides a pharmaceutical composition for the treatment of lung cancer comprising a glucocorticoid compound and an mTOR inhibitor, comprising one or more glucocorticoid compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
In this case, the mTOR inhibitor may be one or more selected from the group consisting of: rapamycin (rapamycin), temsirolimus (temsirolimus), Everolimus (Everolimus), Ridaforolimus (Ridaforolimus), AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226, and PF-04691502, with rapamycin being more preferred, but not limited thereto.
Also, the lung cancer may be KEAP1 mutant lung cancer or KEAP1 and LKB1 mutant lung cancer.
Also, the lung cancer may be non-small cell lung cancer.
The pharmaceutical composition may comprise 1-50 wt% of the glucocorticoid compound and 50-99 wt% of the mTOR inhibitor, and in this range, NRF2 and mTOR can be inhibited most effectively to exhibit the therapeutic effect on lung cancer, which is most preferable.
Also, the pharmaceutical compositions of the invention may further comprise inhibitors of AMPK as targets that are activated during signaling by KEAP1/LKB1 normal lung cancer cells.
That is, the present invention provides a pharmaceutical composition for treating lung cancer comprising a glucocorticoid-based compound and an AMPK inhibitor, comprising one or more glucocorticoid-based compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
In this case, the AMPK inhibitor is one or more selected from the group consisting of: sunitinib (sunitinib) and dorsomorphin (compound c), and more preferably, sunitinib, but not limited thereto.
The lung cancer may be a normal lung cancer of KEAP1 and LKB1, in which the pharmaceutical composition according to the invention is able to show the most excellent therapeutic effect.
Also, the lung cancer may be non-small cell lung cancer.
The pharmaceutical composition comprises 1-50 wt% of glucocorticoid compounds and 50-99 wt% of AMPK inhibitors, and in the range, the pharmaceutical composition can inhibit AMPK most effectively to show the treatment effect of lung cancer, so that the pharmaceutical composition is preferable.
The pharmaceutical composition may comprise, in addition to the glucocorticoid compound, mTOR inhibitor, and AMPK inhibitor, a suitable carrier, excipient, or diluent conventionally used in the manufacture of pharmaceutical compositions.
The carrier, excipient or diluent that can be used in the present invention may be lactose (lactose), glucose (dextrose), sucrose (sucrose), sorbitol (sorbitol), mannitol (manitol), xylitol (xylitol), erythritol (erythritol), maltitol (maltitol), starch, acacia (acacia) gum, alginate (alginate), gelatin (gelatin), calcium phosphate (calcium phosphate), calcium silicate (calcium silicate), cellulose (cellulose), methyl cellulose (methylcellulose), microcrystalline cellulose, polyvinylpyrrolidone (polyvinylpyrrolidone), water, methyl hydroxybenzoate (methyl hydroxybenzoate), propyl hydroxybenzoate (propyl hydroxybenzoate), talc (talc), magnesium stearate (magnesium stearate), mineral oil, or the like.
The pharmaceutical composition according to the present invention can be used in the form of powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and other oral preparations, external use drugs, suppositories, and sterile injection solutions according to conventional methods.
In the case of preparation, the composition is produced by using a diluent or excipient such as a filler, an expander, a binder, a wetting agent, a disintegrant, or a surfactant, which is generally used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid preparations may be manufactured by doping the compound with at least one excipient, such as starch, calcium carbonate (calcium carbonate), sucrose (sucrose) or lactose (lactose), gelatin and the like.
In addition to simple excipients, lubricants such as magnesium stearate, talc (talc), and the like are used. Liquid preparations for oral administration correspond to suspensions, solvents, emulsions, syrups and the like, and may include various excipients such as wetting agents, sweeteners, flavors, preservatives and the like, in addition to water, Liquid paraffin (Liquid paraffin) which is a commonly used simple diluent.
Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories. As the nonaqueous solvent or suspending agent, propylene glycol (propylene glycol), polyethylene glycol (polyethylene glycol), vegetable oil such as olive oil, and injectable ester such as ethyl oleate can be used. As the base of the suppository, witepsol, polyethylene glycol (macrogol), tween 61, cacao butter (cacao butter), lauric acid glyceride (laurin), glycerin gelatin (glycocoltin), or the like can be used.
The amount of the glucocorticoid compound or the compound with the mTOR inhibitor used as the active ingredient of the pharmaceutical composition according to the present invention may vary depending on the age, sex, body weight, and disease of the patient, and may be 0.001 to 100mg/kg, preferably 0.01 to 10mg/kg, administered once to several times per day.
The dose of the pharmaceutical composition according to the present invention may be increased or decreased depending on the administration route, the degree of disease, sex, body weight, age, and the like. Thus, the amount administered is not intended to limit the scope of the invention in any way.
The pharmaceutical composition can be administered to mammals such as mice, livestock, humans, and the like, by various routes. All modes of administration are contemplated, for example, administration may be by oral, rectal or intravenous, intramuscular, subcutaneous, inhalational intrabronchial, intrauterine, dural or intracerebroventricular (intracerbroontricular) injection.
Also, the present invention provides a health functional food composition for improving lung cancer comprising a glucocorticoid-based compound, comprising one or more glucocorticoid-based compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
The present invention also provides a functional health food composition for improving lung cancer, comprising a glucocorticoid compound and an mTOR inhibitor, wherein the functional health food composition comprises one or more glucocorticoid compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
In this case, the mTOR inhibitor may be one or more selected from the group consisting of: rapamycin (rapamycin), temsirolimus (temsirolimus), Everolimus (Everolimus), Ridaforolimus (Ridaforolimus), AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226, and PF-04691502, and more preferably rapamycin, but not limited thereto.
The present invention also provides a health functional food composition for improving lung cancer comprising a glucocorticoid compound and an AMPK inhibitor, comprising one or more glucocorticoid compounds selected from the group consisting of: clobetasol propionate, amcinonide, betamethasone valerate, hydrocortisone valerate, flunisolide, fludroxydolide, flumethasone propionate, flumethasone dipropionate, budesonide, mometasone furoate, desoximetasone propionate, dimedroxycortolone acetate, triamcinolone acetonide, hydrocortisone butyrate, triamcinolone acetonide acetate, triamcinolone acetonide acetate, and the like, Rimexolone (rimexolone), isoflupredone acetate (isoflupredone acetate), betamethasone (betamethasone), dessememeton acetate (dexamethasone acetate), melengestrol acetate (melengestrol acetate), fluticasone propionate (fluticasone propionate), prednisolone (prednisone), methylprednisolone-6 alpha (methylprednisone 6-alpha), hydrocortisone base (hydrocortisone base), fluorometholone (fluoromonomer ketone), finasteride (finasteride), fluocinonide (fluocinonide), and cortisol acetate (corticosterol acetate).
In this case, the AMPK inhibitor is one or more selected from the group consisting of: sunitinib (sunitinib) and dorsomorphin (compound c), and more preferably, sunitinib, but not limited thereto.
The health functional food may be provided in the form of powder, granules, tablets, capsules, syrup or beverage, may be used together with other foods or food additives in addition to the glucocorticoid compound, mTOR inhibitor or AMPK inhibitor as an active ingredient, and may be suitably used according to a general method. The mixing amount of the effective ingredients may be appropriately determined depending on the purpose of use thereof, for example, for health care or treatment.
The effective amount of the glucocorticoid compound in combination with the mTOR inhibitor or in combination with the AMPK inhibitor contained in the health functional food may be used in accordance with the effective amount of the pharmaceutical composition, but may be below the range in the case of long-term ingestion for the purpose of health care and health preservation or for the purpose of health regulation, and the effective ingredient does not have any problem in safety and thus can be used beyond the range.
The type of the health functional food is not particularly limited, and examples thereof include meat, sausage, bread, chocolate, candy, snack, biscuit, pizza, stretched noodles, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complex.
Detailed Description
Hereinafter, examples will be described in detail to facilitate understanding of the present invention. The following examples are merely illustrative of the present invention and are not intended to limit the scope thereof, and are provided to more fully illustrate the invention to those having ordinary skill in the art.
< preparation example 1>
For use in the experiments, H1299(KEAP 1-Normal, LKB 1-Normal) as a genetically normal non-small Cell lung cancer Cell Line (NSCLC) and a non-small Cell lung cancer Cell Line (H2228(KEAP 1-mutant, LK 1-normal), A549(KEAP 1-mutant, LKB 1-mutant), H460(KEAP 1-mutant, LKB 1-mutant) as a KEAP1 mutation were purchased from Korean Cell Line Bank (Korean Cell Line Bank) and cultured in Dulbecco's modified Eagle medium (DMEM, HyClone Laboratories, USA) supplemented with 10% fetal bovine serum (FBS, Invitron), 1% penicillin-streptomycin, 1% HEPES at 5% CO2Incubated at 37 ℃. Also, in the subsequent experiments, for screening, after inoculating A549-ARE cells at high density in 96-well platesTreatment 1887 clinical compound library (Korea Chemical Bank)). Clobetasol Propionate (CP) was purchased from Sigma-Aldrich (st. louis, USA). In addition, the substances required for the other experiments were purchased from Sigma (CT99021, GSK3 inhibitor), EMD Millipore (MG132), lclaborides (rapamycin), and antibodies used in immunoblotting (Western-blot) were purchased from GeneTex (ME1, IDH1, G6PD, PGD, GCLM, GCR, NRF2), Cell Signaling Technology (NRF2, LKB1, p-AMPK, pGSK-3, GSK3, p-p70S6K, p70S6K, alpha-tubulin (tubulin)), Sigma (KEAP1), Proteintech (SRXN 1).
< example 1> NRF2 inhibitor screening
(1) Establishment of ARE-luciferase cell line for determination of NRF2 Activity
To screen for effective NRF2 inhibitors, a Luciferase/Green Fluorescent Protein (GFP) double anti-oxidation reaction element (ARE) DNA base sequence (caccgtgaactcagcaagcattx 3) system (Luciferase/GFP dual ARE-receptor single line system) capable of monitoring NRF2 activity was established in a549(LKB1 normal/KEAP 1 mutant) non-small cell lung cancer cells in which NRF2 activity was high as shown in fig. 1 a.
To demonstrate that luciferase and GFP signals, which exhibit high activity in a549 cell line, are specific to NRF2 activity, three doxycycline-inducible NRF2-shRNA having sequences different from each other were prepared as shown in table 1 below. To establish the Tet-inducible shRNA expression system, an A549-ARE cell line expressing doxycycline-inducible NRF2-shRNA was established by transduction after inserting the following shRNA into a Tet-pLKO-pyro vector (Dnitri Widerschain: Addge plasma # 21915).
Thereafter, to induce NRF2-shRNA expression, 0.2. mu.l/mL of doxycycline (DOX; Clontech) was treated every two days in the medium. Thereafter, the NRF2 expression inhibition efficiency was verified by immunoblotting, luciferase activity assay, and GFP expression assay using a fluorescence microscope.
[ TABLE 1 ]
Figure GDA0001647871080000171
Specifically, for immunoblotting, a549 cells expressing Tet-pLKO-NCshRNA (negative control group) and three Tet-pLKO-NRF2shRNA were treated with doxycycline for 3 days and 6 days, and then the proteins were isolated. After 10. mu.g of each of the separated proteins was applied to 8% acrylamide gel (acrylamide gel) to perform electrophoresis, it was transferred to a Nitrocellulose (NC: Nitrocellulose) membrane, and NRF2 antibody (Cell signaling, 1: 1000) and actin (actin) antibody (SCBT, 1: 1000) were diluted in Tris buffer (TBST: Tris-Buffered Saline with Tween 20) containing Tween20 containing 5% skim milk (ski), followed by overnight reaction at 4 ℃. Then, the secondary antibody was reacted for one hour and washed with TBST, and then the protein expression level was measured by Enhanced Chemiluminescence (ECL).
Also, A549-ARE cells were first dispensed in 96-well plates at 5X 10 per well3Each clinical compound was treated at concentration (1 μm or 5 μm) after 24 hours. After treatment and 24 hours, 30 Lysis buffer (Lysis buffer) was added and dissolved at 4 ℃ for 40 minutes using a Rocker (Rocker). The resultant after the dissolution was put in a 96-well white plate (96well white plate) in 20. mu.l portions, and 100. mu.l of a Luciferase substrate buffer (Luciferase substrate buffer) having the following composition was added thereto, and Luciferase activity was measured using a plate reader.
●Buffer for Substrate (Buffer for Substrate)
1. Buffer A (buffer A)
1mM D-fluorescein (D-Luciferin, pH 6.1-6.4, (yellow light) -20 ℃ storage)
2. Buffer B (buffer B)
40mM Tricin (Tricin MW179.2)
2.14mM(MgCO3)4Mg(OH)25H2O(MW 485.7)
5.34mM MgSO4 7H2O(MW 246.48)
66.6mM dithiothreitol (DTT, MW 1542)
1.06mM Adenosine triphosphate (Adenosine triphosphate, ATP, MW 551)
0.54mM Coenzyme (Coenzyme, MW 767.5)
0.2mM ethylenediaminetetraacetic acid (EDTA) ethylenediaminetetraacetic acid (EDTA, 0.5M EDTA, pH7.8, stored at-20 ℃ C.)
3. The prepared Assay Mixture (Make a Assay mix, 1: 1) ═ substrate buffer
Lysis buffer (lysine buffer)
0.1M potassium phosphate buffer (potassium phosphate buffer), pH7.8
(1M K2HPO4,1M KH2PO4)
1% Polyoxyethylene octyl phenyl ether (1% Triton X-100)
1mM DTT
2mM EDTA
The remaining lysate was diluted five-fold with Distilled Water (DW) and the protein concentration (protein concentration) was determined by Bradford assay (Bradford assay, BioRad). Specifically, 200. mu.l of a solution obtained by diluting a stock solution of Bradford reagent (Kumasi Brilliant Blue G-250) with distilled water by five times was reacted with 5. mu.l of the remaining dissolution product, and then the absorbance was measured at 595 nM. The protein concentration of the dissolution product was calculated by the same experiment using the BSA solution as a standard protein. The luciferase value determined above was divided by the protein concentration determined accordingly to correct the luciferase value.
As a result, as shown in fig. 1b, 1c and 1d, NRF2sh-2 most effectively inhibited the expression of NRF2 protein, luciferase activity and GFP signal, and thus it was found that luciferase activity and GFP signal highly expressed in a549 were specific to NRF 2.
(2) Screening Using 1887 clinical Compound library
As shown in FIG. 2a, compounds having NRF2 inhibitory effect were screened from the 1887 clinical compound library received from Korean Compound Bank (Korea Chemical Bank) using the luciferase/GFP double ARE-receptor cell line system. That is, luciferase assay was performed using A438-ARE cells according to the method performed in the example 1.
As a result, as shown in fig. 2b, among clinical compounds, Glucocorticoid (GCs) type drugs showed NRF2 inhibitory effect, and most GCs type drugs showed superior inhibitory effect of more than 50% after being treated for 24 hours at a concentration of 1 μ M.
(3) NRF2 inhibiting effect of glucocorticoid drugs
Among the results obtained above, 13 GCs series drugs having excellent effects were selected, and luciferase assay was performed according to the method carried out above, thereby comparing the NRF2 inhibitory effects according to the concentrations of the 13 GCs series drugs.
As a result, as shown in fig. 3, most showed excellent inhibitory effects starting from a 10nM level, especially for Clobetasol propionate (Clobetasol propionate), excellent inhibitory effects starting from 1nM and the most excellent inhibitory effect at 1 μm.
< example 2> confirmation of the mechanism of inhibition of NRF2 by clobetasol propionate
(1) Confirmation of the mechanism of inhibition of clobetasol propionate
Glucocorticoids act as ligands (ligands) of the nuclear receptor subfamily 3 (group C, member1), which is well known as the glucocorticoid receptor (GC receptor, GCR). If glucocorticoids bind to GCR, GCR induces transcription promotion or transcription repression of diverse genes associated with multiple functions in the body, such as inflammation or metabolism. Based on these known facts, in order to confirm whether the NRF2 inhibitory effect of glucocorticoid, that is, clobetasol propionate, is related to GCR, immunoblotting and luciferase assay were performed after GCR-shRNA was used to inhibit GCR expression.
Transduced a549-tet-on cells were first established using carriers including GCR-shRNA, treated with doxycycline and clobetasol propionate, and then in order to perform immunoblotting, protein extracts were prepared by hemolysis using Cell hemolysis buffer (Cell signaling technology) supplemented with protease inhibitor cocktail (EMD millipore). Immunoblotting was then performed as performed in example 1. At this time, Bradford assay was performed to determine the concentration of protein according to the method performed in example 1. And, luciferase assay was performed according to the method performed in the example 1.
As a result, as shown in fig. 4a and 4b, inhibition of GCR expression completely prevented NRF2 inhibition by clobetasol propionate. That is, clobetasol propionate significantly reduced the level and activity of NRF2 protein, which was blocked by the expression inhibition of GCR. This fact clearly indicates that the inhibitory effect of clobetasol propionate, a glucocorticoid, on NRF2 is related to GCR.
(2) Effect of Clobetasol propionate concentrations
In order to clearly confirm the effect of clobetasol propionate according to the concentration, luciferase assay was performed by the method performed in example 1 with respect to cells after 8 hours, 24 hours, and 48 hours after treatment with 100nM or 1 μm clobetasol propionate, and the activity of NRF2 was measured.
As a result, as shown in fig. 4c and 4d, inhibition of NRF2 activity by clobetasol propionate was maintained at a concentration of 100nM for at least 48 hours, and the results were consistent with a decreased amount of NRF2 protein. This means that glucocorticoids inhibit NRF2 by reducing their protein expression.
(3) Measurement of the Effect on the degradation of NRF2mRNA and protein
According to the results of studies accumulated so far, NRF2 protein levels can be regulated by mRNA transcription or proteasome-related breakdown. Therefore, in order to confirm whether NRF2 was inhibited by mRNA transcription inhibition and NRF2 was inhibited by promoting proteasome-associated decomposition, immunoblotting was performed in the same manner as performed in example 1 after performing real-time polymerase chain reaction (real-time PCR) on the cells and treating with MG132 as a proteasome inhibitor.
Specifically, for Real-time PCR, TRizol (Invitrogen) was used to extract whole RNA from A549 cells. After that, 1. mu.g of whole RNA was placed, and Reverse-transcribed into cDNA using dT primer and SuperScript II Reverse Transcriptase (SuperScript II Reverse Transcriptase), according to the manufacturer's instructions (Invitrogen). Thereafter, PCR was performed using the HotStart-IT SYBR Green qPCR Master Mix according to the manufacturer's instructions (Affymetrix). Primers for NRF2 and β -actin used in PCR are shown in < table 2> below.
< Table 2>
Figure GDA0001647871080000211
As a result, as shown in fig. 4e and 4f, clobetasol propionate did not affect the mRNA level itself of NRF2, but instead, the amount of NRF2 protein inhibited by clobetasol propionate was restored after MG132 treatment. That is, based on these results, it was found that the clobetasol propionate compound induces GCR-dependent proteasome-related degradation and further inhibits NRF 2.
(4) Confirmation of the mechanism of NRF2 proteolysis
Generally, proteasomal breakdown of the NRF2 protein is composed of two pathways, shown in figure 5a, namely the pathway through KEAP1 and the pathway through GSK3- β -TrCP. Based on the results obtained above, in order to confirm which of the two pathways is regulated by the glucocorticoid compound to inhibit NRF2, KEAP1 mutant a549 cells prepared in the preparation example were provided with a GSK3 inhibitor and clobetasol propionate, and the luciferase assay and immunoblotting performed in the example 1 were performed. After the transduced a549-tet-on cells were established using carriers containing β -TrCP shRNA, the same immunoblotting and luciferase assay were performed using cells in which the β -TrCP gene was knocked out using doxycycline as a target.
As a result, as shown in fig. 5b and 5c, clobetasol propionate-induced NRF2 proteolysis and activity inhibition were inhibited by treatment with GSK3 inhibitor. Also, as shown in fig. 5d, clobetasol propionate-induced proteolysis of NRF2 was also inhibited when β -TrC was knocked out. That is, such a result means that the glucocorticoid compound decomposes the NRF2 protein by the pathway of GSK 3-p-TrCP.
Further, GSK3 inhibits the movement of NRF2 to the nucleus, as known so far. To demonstrate this, immunoblotting was performed after dividing cells treated with GSK3 inhibitor and clobetasol propionate under MG132 treatment into nucleus and cytoplasm.
As a result, as shown in fig. 5e, the movement of NRF2 to the nucleus was inhibited by clobetasol propionate treatment, and the effect was completely blocked by GSK3 inhibitor. These results, as shown in fig. 5f and 5g, support the results that inhibition of NRF2 proteolysis by MG132 treatment or β -TrCP knockout alone cannot restore glucocorticoid inhibition of NRF2 activity. That is, it means that the glucocorticoid compound inhibits NRF2 not only by activating GSK3 to decompose NRF2 but also by inhibiting NRF2 from migrating to the nucleus.
Therefore, as shown in fig. 5h, it is understood that glucocorticoid inhibits NRF2 by inhibiting NRF2 from migrating to the nucleus and activating GSK3 which promotes β -TrCP-dependent decomposition.
< example 3> confirmation of inhibition of expression of NRF2 target protein and increase of active oxygen by clobetasol propionate
(1) Determination of NRF2 expression levels in Lung cancer cell lines
It is known that generally NRF2 is more expressed in KEAP1 mutant cells and protein kinase (p-AMPK) is less expressed in LKB1 mutant cells. To confirm this, immunoblotting was performed on four cells. Specifically, in order to verify whether H2228(KEAP 1-mutant, LK 1-normal), a549(KEAP 1-mutant, LKB 1-mutant), H460(KEAP 1-mutant, LKB 1-mutant) as KEAP1 mutant cells and KEAP1 and LKB 1(KEAP 1-normal, LKB 1-normal) as H1299(KEAP 1-normal, LKB 1-normal) as normal gene cells were mutated, immunoblotting was performed by the same method as that performed in example 1, and the degree of expression of NRF2 and p-AMPK was confirmed.
As a result, as shown in fig. 6a, NRF2 was highly expressed in H2228, a549, and H460 cell lines, and thus, the mutation KEAP1 was confirmed, whereas the LKB1 mutation was confirmed based on low AMPK activity in a549 and H460 cell lines.
(2) Confirmation of the Effect of Clobetasol propionate
To confirm the effect of glucocorticoids on cells with high NRF2 activity, KEAP1 mutant cells (a549 and H2228) were treated with clobetasol propionate for 2, 4 or 5 days and the expression of the major NRF2 target protein (G6PD, PGD, ME1, GCLM, AKR1B10, AKR1C3) associated with redox regulation was determined by the immunoblotting method performed above. As a control group, cells in which NRF2-shRNA was transformed in the H2228 cell line to inhibit the expression of NRF2 were used.
As a result, as shown in fig. 6b, it was confirmed that the expression of the NRF2 target protein, which mainly functions as an antioxidant, was effectively inhibited in all cases of the control group in which NRF2-shRNA was transformed into a neutral state in the H2228 cell line and the treatment with clobetasol propionate. Likewise, as shown in fig. 6c, NRF2 target protein expression was also effectively inhibited for the case of treatment with clobetasol propionate in a549 cell line.
The ME1 and GCLM proteins are proteins that act as hydrogen peroxide detoxification, and in order to determine the change, the amount of hydrogen peroxide after treatment with the clobetasol propionate was measured as follows: after the A549 and H2228 cell lines were cultured in 5 μm CMH2DCF-DA (Invitrogen) for 30 minutes, the cultured cells were washed twice with phosphate buffered saline (phosphate buffered saline) and incubated in 90% Dimethyl sulfoxide (DMSO: Dimethyl sulfoxide) and 10% Phosphate Buffered Saline (PBS) in the dark for 40 minutes to release the fluorescent dye. After the culture, the supernatant of the culture solution was dispensed into a 96-well plate, and the amount of fluorescence was measured at 480/530 nm. To normalize the amount of fluorescence measured, the cells remaining after removal of the supernatant and washing with PBS were stained with Crystal violet (Crystal violet) solution (20% methanol and 0.5% Crystal violet) at room temperature for 10 minutes. After washing 3 times and incubation for solubility in a 1% SDS solution, the absorbance at a wavelength of 570nm was measured.
As a result, as shown in fig. 6d, when a549 and H2228 were treated with clobetasol propionate, it was confirmed that the active oxygen was significantly increased. That is, glucocorticoids such as clobetasol propionate were shown to be effective in inhibiting the antioxidant function of NRF 2.
< example 4> confirmation of anticancer Effect of Clobetasol propionate alone and synergistic anticancer Effect of Clobetasol propionate in combination with rapamycin
(1) In vitro (in vitro) assay
The synergistic effect of anticancer was confirmed by soft agar assay (soft agar assay) on H1299 as LKB1/KEAP1 normal lung cancer cell line, H2228 as KEAP1 mutant cell line, a549 as LKB1/KEAP1 mutant lung cancer cell line, and H460 when treated with clobetasol propionate alone or in combination with rapamycin as mTOR inhibitor. Also, in order to confirm whether the tumor-inhibiting effect of clobetasol propionate was due to NRF2 inhibition, the tumor-inhibiting effect was compared using NRF2-shRNA-2 used in the example 2 with that of a lung cancer cell line that knocks out NRF 2.
Specifically, after 50. mu.l of DMEM medium containing 0.7% agar was added to a 12-well plate and solidified (bottom agar), 300. mu.l of DMEM medium containing 3X 10 agar was added3DMEM medium of individual cells and 0.35% agar was placed on solidified agar medium and solidified (top agar +/-Doxycycline). After total solidification, 250. mu.l DMEM medium (+/-Doxycycline) was added and measured at CO2The number of colonies (colony) formed after 2 weeks of culture in the incubator is shown in FIG. 7.
As a result, as shown in fig. 7a and 7b, although the cell growth was strongly inhibited by clobetasol propionate treatment and NRF2 knockout for a549 and H2228, which are KEAP1 mutant cell lines, the cell growth was not greatly affected by clobetasol propionate treatment and NRF2 knockout for H1299, which is a KEAP1 normal cell line. Such results indicate that the antitumor effect of glucocorticoids is dependent on inhibition of NRF 2.
(2) Effect of Clobetasol propionate and rapamycin on LKB1 mutant cell line H460
In contrast to the above results, the H460 cell line, as shown in fig. 7a and 7b, although being the KEAP1 mutant cell line, had a weak inhibitory effect on cell growth by clobetasol propionate treatment and NRF2 knockout. According to recent studies, it was shown that most of the KEAP1 mutations commonly occur with LKB1 mutations, and that (a549, H460 cell line) LKB1 mutations induce growth of cancer cells by activating mTORC 1. Therefore, based on these existing research results and the results, as shown in fig. 7c, it is assumed that the reason why the effect of clobetasol propionate is reduced in the H460 cell line is that the H460 cell line has a KEAP1 mutation together with a LKB1 mutation, so that NRF2 and mTORC1 are activated together, and if NRF2 and mTORC1 can all be inhibited, an anticancer synergistic effect is exhibited.
First, to compare the activation of mTORC1 in H460 cell lines with H460 cell lines expressing LKB1-cDNA by transduction, cells were seeded on plates coated with poly-hydroxyethyl methacrylate (poly-HEMA) (Sigma-Aldrich, st. louis, USA) followed by CO2Immunoblotting was performed in the same manner as in example 1 described above after 24 hours of suspension culture in an incubator, and the activity of mTORC1 was measured.
As a result, as shown in fig. 7d, in the case of H460 cells cultured in suspension, it was confirmed that phosphorylation of p70S6K as a substrate of mTORC1 was increased in the absence of expression of LKB1 as compared to the state in which LKB1 was expressed. That is, it was found that the mTORC1 activity of H460 cells was high.
Then, it was confirmed whether or not a synergistic anticancer effect was exhibited when treated with clobetasol propionate and rapamycin at the same time, or treated with rapamycin after NRF2 was knocked out using NRF 2-shRNA.
As a result, as shown in fig. 7e, the combination of clobetasol propionate and rapamycin inhibited the growth of NRF2, and the combination of clobetasol propionate and rapamycin strongly inhibited the growth of H460 cells.
(3) In vivo (in vivo) assay
In addition, xenograft assays (xenograf assays) were performed using the a549 cell line. Specifically, Balb/C-nu mice (6-8 weeks old, OrientBio, City south, Korea) were prepared for tumor xenografting, and A549-luc-C8 cells (Perkin Elmer, 5.0X 10 cells)6Head) was injected subcutaneously into the mice. After two weeks, when the tumor reaches 50-100 mm3When mice were divided into six groups, i.e., a control group to which only vehicle (vehcle; 200. mu.l of PBS containing 1.2% DMSO, 0.25% PEG 400, and 0.25% tween 80) was administered, and a vehicle (vehcle; PBS) was administeredThe group administered with 0.5mg/kg of clobetasol propionate, the group administered with 1mg/kg of rapamycin, the combined use 1(CP 0.5mg/kg + rapamycin 1mg/kg) and the combined use 2(CP 1mg/kg + rapamycin 1 mg/kg). On the following 40 days, the vehicle and rapamycin were injected intraperitoneally daily (5 days per week) and clobetasol propionate was injected intraperitoneally 2 days (3 days per week).
The size and weight of primary tumor are measured by caliper (caliper) and balance (balance) every 3-4 days, respectively, and the volume of tumor is measured by V (mm)3)＝(A×B2) The/2 (V is volume, a is long diameter, and B is short diameter) formula.
Thereafter, mice were treated at 7.5% CO2The chamber was sacrificed and the tumor was harvested for further analysis. This study was approved by the institute of national cancer center, the institute of laboratory Animal Care and Use Committee, IACUC.
As a result, as shown in fig. 8a to 8c, it was confirmed that treatment with clobetasol propionate (0.5mpk, 1mpk) and rapamycin (1mpk) alone exhibited a significant anticancer effect, and particularly, a very strong anticancer synergistic effect showing disappearance of tumor was observed when the treatment was carried out in combination. In contrast, as shown in FIG. 8d, since the body weight of the mice did not change significantly, no significant side effects were observed.
Therefore, it could be confirmed in vivo that the combined therapy of rapamycin and clobetasol propionate in lung cancer cell lines with the LKB1/KEAP1 mutation combination showed strong anticancer synergistic effect without side effects.
< example 5> confirmation of anticancer synergistic Effect of Clobetasol propionate in Low Nutrition State and sunitinib
(1) Measurement of expression level of NRF2 in Normal cells under Low glucose conditions
In said example 3, it was confirmed that normal cells of KEAP1 (H1299) maintained NRF2 expression very low, typically when the cells were cultured, i.e. in a state of sufficient nutrition (fig. 6 a). Therefore, in order to confirm how the change is in the nutrient deficient state (low glucose state) which is one of the representative characteristics of the actual tumor microenvironment, immunoblotting and luciferase experiments were performed in the same manner as the method performed in example 1.
As a result, as shown in fig. 9a and 9b, it was confirmed that the expression and activity of NRF2 were also increased in normal KEAP1 cells.
(2) Inhibitory effects on expression of NRF2 and AMPK in Low glucose State
As shown in fig. 9a, since normal cells of LKB1 are known to activate AMPK in a low-nutrition state (increased phosphorylation of ACC, which is a substrate of AMPK), and activation of AMPK increases survival of cancer cells in a low-nutrition state, a strong anticancer synergistic effect is expected when NRF2 is inhibited together with AMPK. To confirm this, a colony (colony) formation experiment was performed in a low nutrient state (glucose 2mM) after the H1299 cell line was established to transduce a cell line of tet-on carriers including shRNA against AMPK and NRF 2. That is, after the cells were seeded in a 12-well plate at a very low concentration and cultured in a medium containing 2mM glucose for 2 weeks, the degree of colony formation was observed by Crystal violet (Crystal violet) staining performed in example 3 described above, and the anticancer effect was confirmed.
As a result, as shown in fig. 9c, it was confirmed that AMPK and NRF2 were simultaneously suppressed to exhibit a very strong anticancer synergistic effect.
(3) Combined effect of clobetasol propionate and sunitinib in low-glucose state
Although there is no AMPK inhibitor in clinical use so far, recent studies have shown that the off-target (off target) effect of Sunitinib (Sunitinib), which is a tyrosine kinase inhibitor used in the treatment of gastrointestinal stromal tumors (mainly VEGFR), inhibits AMPK. Therefore, in this experiment, the same colony formation experiment as the experiment was performed in a low nutrient state (glucose 2mM) by treating sunitinib with clobetasol propionate, and the anticancer effect was observed.
As a result, as shown in fig. 9d, it was confirmed that sunitinib and clobetasol propionate were used in combination to exhibit a strong anticancer synergistic effect.
Thus, as shown in figure 9e, the results indicate that both NRF2 and AMPK are activated in the actual tumor microenvironment, which is a low trophic state, in all normal cells of KEAP1 and LKB1, and thus the combined administration of clobetasol propionate, a glucocorticoid, and an AMPK inhibitor is a very effective therapeutic approach.
In order to describe the specific details of the present invention in detail, it should be clear to those skilled in the art that the specific techniques are only preferred embodiments and do not limit the scope of the present invention. That is, the actual scope of the invention should be defined as the appended claims and equivalents thereof.
Figure IDA0001725179360000011
Figure IDA0001725179360000021
Figure IDA0001725179360000031

Claims (5)

1. Use of clobetasol propionate for the preparation of a pharmaceutical composition for the treatment of lung cancer having a high NRF2 activity.
2. A pharmaceutical composition for treating lung cancer with high NRF2 activity and high mTORC1 activity, comprising an mTOR inhibitor and clobetasol propionate,
wherein the mTOR inhibitor is one or more selected from the group consisting of: rapamycin, temsirolimus, everolimus, ridaforolimus, AZD-8055, AZD-2014, OSI-027, INK128, PP242, NVP-BEZ235, XL765, BGT226, and PF-04691502.
3. The pharmaceutical composition for use in treating lung cancer that is high in NRF2 activity and mTORC1 activity of claim 2,
the pharmaceutical composition comprises 1-50 wt% of clobetasol propionate and 50-99 wt% of mTOR inhibitor.
4. A pharmaceutical composition for treating lung cancer with NRF2 activity and high AMPK activity, comprising an AMPK inhibitor and clobetasol propionate,
wherein the AMPK inhibitor is one or more selected from the group consisting of sunitinib and Dorsomorphin.
5. The pharmaceutical composition of claim 4 for the treatment of lung cancer that has high NRF2 activity and high AMPK activity,
the pharmaceutical composition comprises 1-50 wt% of clobetasol propionate and 50-99 wt% of an AMPK inhibitor.
CN201680064090.8A 2015-11-02 2016-11-02 Pharmaceutical composition comprising glucocorticoid compound for treating lung cancer Active CN108430477B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
KR10-2015-0153296 2015-11-02
KR20150153296 2015-11-02
KR10-2016-0135006 2016-10-18
KR1020160135006A KR101892908B1 (en) 2015-11-02 2016-10-18 Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
PCT/KR2016/012534 WO2017078405A1 (en) 2015-11-02 2016-11-02 Pharmaceutical composition for treatment of lung cancer comprising glucocorticoid-based compound

Publications (2)

Publication Number Publication Date
CN108430477A CN108430477A (en) 2018-08-21
CN108430477B true CN108430477B (en) 2021-05-14

Family

ID=58742041

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201680064090.8A Active CN108430477B (en) 2015-11-02 2016-11-02 Pharmaceutical composition comprising glucocorticoid compound for treating lung cancer

Country Status (2)

Country Link
KR (4) KR101892908B1 (en)
CN (1) CN108430477B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110996687A (en) * 2017-05-26 2020-04-10 墨卡托医疗系统公司 Combination therapy for the treatment of restenosis
CN109528743A (en) * 2018-12-14 2019-03-29 青岛大学 The drug and its screening technique sensitive to non-small cell lung cancer tumor suppressor gene STK11 mutation
CN111789952B (en) * 2020-05-21 2022-12-23 上海市第六人民医院 Pharmaceutical composition for treating renal clear cell carcinoma and application thereof
KR102571432B1 (en) * 2023-02-08 2023-08-29 주식회사 에스씨엘테라퓨틱스 Composition for treating cancer containing indazolyl ester and amide derivative

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100931976B1 (en) 2006-08-23 2009-12-15 한국생명공학연구원 A pharmaceutical composition for treating cholangiocarcinoma, a method for inhibiting growth or invasion of cholangiocarcinoma and a method for treating cholangiocarcinoma
CN103705922B (en) * 2012-10-08 2018-07-17 天津金耀集团有限公司 Using glucocorticoid as the externally-applied medicinal composition of active constituent
KR101743344B1 (en) * 2015-02-27 2017-06-07 이화여자대학교 산학협력단 Pharmaceutical composition for preventing or treating a cancer comprising mometasone

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Honma等.Vesnarinone and glucocorticoids cooperatively induce G1 arrest and have an anti-tumour effect on human nonsmall cell lung carcinoma cells grown in nude mice.《British Journal of Cancer》.1999,第80卷(第1/2期),第96-103页. *
The potential Role of Mtor inhibitors in Non-Small Cell Lung Cancer;Gridelli等;《the Oncologist》;20081231;第13卷;第139-147页 *
Vesnarinone and glucocorticoids cooperatively induce G1 arrest and have an anti-tumour effect on human nonsmall cell lung carcinoma cells grown in nude mice;Honma等;《British Journal of Cancer》;19991231;第80卷(第1/2期);第96-103页 *

Also Published As

Publication number Publication date
KR101978629B1 (en) 2019-05-15
KR101892908B1 (en) 2018-08-29
KR20180098191A (en) 2018-09-03
KR102000425B1 (en) 2019-07-16
KR20190038507A (en) 2019-04-08
KR102000424B1 (en) 2019-07-16
CN108430477A (en) 2018-08-21
KR20190038506A (en) 2019-04-08
KR20170051261A (en) 2017-05-11

Similar Documents

Publication Publication Date Title
KR102000425B1 (en) Pharmaceutical Composition for Treating Non-small Cell lung Cancer Comprising Glucocorticoids
Panda et al. Mechanism of autophagic regulation in carcinogenesis and cancer therapeutics
US11260062B2 (en) Pharmaceutical composition for treatment of lung cancer comprising glucocorticoid-based compound
Kausar et al. Berry anthocyanidins synergistically suppress growth and invasive potential of human non-small-cell lung cancer cells
Chien et al. Activation of protein phosphatase 2A tumor suppressor as potential treatment of pancreatic cancer
EP3079475B1 (en) Glucocorticoid inhibitors for treatment of prostate cancer
JP2019507754A (en) Dietary products lacking at least two nonessential amino acids
Abe et al. Harmol induces autophagy and subsequent apoptosis in U251MG human glioma cells through the downregulation of survivin
Hall et al. Jadomycins inhibit type II topoisomerases and promote DNA damage and apoptosis in multidrug-resistant triple-negative breast cancer cells
Xue et al. Grape seed procyanidin extract against lung cancer: the role of microrna-106b, bioavailability, and bioactivity
Kayabasi et al. PI3K/mTOR dual-inhibition with VS-5584 enhances anti-leukemic efficacy of ponatinib in blasts and Ph-negative LSCs of chronic myeloid leukemia
US20220288130A1 (en) Compositions and methods for diagnosis and treatment of metabolic diseases and disorders
Huang et al. Novel oral histone deacetylase inhibitor, MPT0E028, displays potent growth-inhibitory activity against human B-cell lymphoma in vitro and in vivo
Sun et al. Simvastatin induces apoptosis of nasopharyngeal carcinoma cells through NF-κB signaling pathway.
Wang et al. Chemotherapy-elicited extracellular vesicle CXCL1 from dying cells promotes triple-negative breast cancer metastasis by activating TAM/PD-L1 signaling
Han et al. Liujunzi decoction exerts potent antitumor activity in oesophageal squamous cell carcinoma by inhibiting miR-34a/STAT3/IL-6R feedback loop, and modifies antitumor immunity
ES2408730B1 (en) ROMERO EXTRACT COMPOSITIONS FOR CANCER TREATMENT
CN115461461A (en) MiRNA-193a for promoting immunogenic cell death
JP2019077657A (en) SIMULTANEOUS INHIBITOR OF mTOR SIGNAL TRANSDUCTION PATHWAY AND MAPK SIGNAL TRANSDUCTION PATHWAY WHICH COMPRISE RESVERATROL DIMER
Wang ROR1 Targeted Therapy in Small Cell Lung Cancer
Wang et al. Dying cell-released exosomal CXCL1 promotes breast cancer metastasis by activating TAM/PD-L1 signaling
Ndreshkjana Combination therapy as a promising strategy to overcome drug resistance in colorectal cancer
Isac Characterisation of the unfolded protein response in prostate cancer, and investigation of the ATF6 interactome using a modified mammalian expression system.
Tamayo The immune-modulatory and anti-carcinogenic mechanisms of the flavonoid apigenin
WO2023183164A1 (en) Method of treating pancreatic cancer

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20180821

Assignee: Aier Treatment Company in Aisi City

Assignor: AJOU University INDUSTRY ACADEMIC COOPERATION FOUNDATION

Contract record no.: X2023990000875

Denomination of invention: Pharmaceutical compositions for the treatment of lung cancer, including glucocorticoid compounds

Granted publication date: 20210514

License type: Exclusive License

Record date: 20231017

EE01 Entry into force of recordation of patent licensing contract