KR20180077997A - Novel flavonoid compound from Stauntonia hexaphyll leaf extract and composition for anti-inflammatory, and improvement of bone tissue generation or cartilage tissue generation - Google Patents

Abstract

The present invention relates a novel flavonoid compound separated from Stauntonia hexaphylla leaves and a pharmaceutical or a food composition for promotion of bone tissue or cartilage tissue generation or prevention, alleviation, or treatment of a disease of bone tissue or cartilage tissue destruction such as rheumatic arthritis having the same as an active ingredient, and more specifically, to a pharmaceutical or a food composition having the effects of promotion of bone tissue or cartilage tissue generation or prevention, alleviation, or treatment of a disease of bone tissue or cartilage tissue destruction by inhibition of osteoclast differentiation and promotion of the expression and production of type II collagen and aggrecan and comprising a compound of chemical formula 1 as an active ingredient.

Description

TECHNICAL FIELD The present invention relates to a novel flavonoid compound isolated from a mulberry leaf extract, and a pharmaceutical composition comprising the same as an active ingredient, and a composition for promoting bone formation or promotion of cartilage tissue formation. cartilage tissue generation}

The invention meolkkul the novel flavonoid compound isolated from the leaf extract and it relates to a composition for anti-inflammation, bone tissue or cartilage tissue generated generation promoting comprising as an active ingredient, and more particularly to a dry meolkkul (Stauntonia hexaphylla leaves with a solvent selected from organic solvents including lower alcohols having 1 to 4 carbon atoms such as methanol, ethanol, and butanol or a mixed solvent thereof to obtain fractions thereof, which are then purified through chromatography or the like A novel method for producing a flavonoid compound, and a composition for promoting anti-inflammation or bone formation or promoting cartilage formation of a novel flavonoid compound which can be prepared by the above method.

Bone tissue usually consists of a hard bone with a hard surface, and both ends of the center or long bone are associated with spongy bone quality like a mesh of bone. Most bones initially develop as cartilage in connective tissue, which later translates into bone tissue, some of which are made directly from connective tissue. At the tip of the bone, there is a joint surface in contact with the neighboring bone, and its surface is covered with articular cartilage, which is supernatural bone (vitreous cartilage). The marine spoil (sponge small pillar) in the spongy is characterized by a constant arrangement. The large intestine of the caudal trunk is continuous with a small lumen of spongy soju and is filled with bone marrow. The hematopoietic bone marrow is reddish and red marrow. The bone structure is composed of a corrugated layer with a thickness of 5 to 12 μm in both dense quality and spongy matter. In the dense layer, a plurality of concentric corrugated laminae (laminae) are arranged in various directions. There is ha bus pipe, and blood vessel runs. The osteocytes are arranged between the stratum corneum and are connected to other adjacent osteoclasts by protruding protrusions with irregular star shape. There is a rigid connective tissue periosteum on the surface of the bones, and nerve and blood vessels are distributed to protect and nourish the bones. If the periosteum is lost, it is difficult to survive, start and regenerate the bone. The bone is composed of 20% moisture, 35% organic and 35% inorganic, because the elasticity of the bone is organic. As age increases, minerals (mainly calcium phosphate) increase and bone hardness increases.

Although the precise cause and mechanism of rheumatoid arthritis, a chronic inflammation, is not well known yet, one of the possible causes of the disease has been osteoblast that produces bone and osteoclast that destroys bone ) Is known to be caused by the collapse of the homeostasis of the bones due to the numerical imbalance. In normal state, osteoclasts are differentiated from monocytes and macrophages, destroying old bone or removing damaged bone. However, osteoclast patterns found in rheumatoid patients are caused by osteoclastogenesis, Survival and excessive activity are identified, leading to a pathologic form in which bone is severely impaired. Osteoclasts produce a variety of enzymes to break down bone, including tartrate-resistant acid phosphatase (TRAP), an acid phosphatase that oxidizes and degrade bone, and matrix metallopeptidase- 9), and collagen-degrading cathepsin K. These enzymes are used as a special marker of mature osteoclasts. When RANKL is administered to macrophages, which are precursors of osteoclasts, activation of NF-κB and MAPK kinase is shown to produce inflammatory mediators.

Recently, it has been known that the progress of the inflammatory reaction in the body is related to COX (cyclooxygenase) enzyme activity. The COX enzyme is a major enzyme involved in the biosynthesis of prostaglandin present in vivo (Smith et al., J. Biol. Chem., 271, 33157 (1996)), and two kinds of isozyme enzymes COX-1 and COX -2 is known to exist. The COX-1 is constantly present in tissues such as the stomach or kidney and is involved in maintaining normal homeostasis, while the COX-2 is involved in mitogen or cytokines in inflammation or other immune responses. Is a transient and rapidly expressed enzyme in the cell. Another strong inflammatory mediator, nitric oxide (NO), is produced from L-arginine by NO synthase (NOS), and is produced by a variety of substances, such as UV, external stress, endotoxin or cytokines Lt; / RTI > cells. These inflammatory stimuli increase the expression of inducible NOS (iNOS) in the cells, thereby inducing NO production in the cells and activating the macrophages to cause an inflammatory reaction. Therefore, in order to effectively alleviate inflammation, researches on a substance capable of inhibiting the production of NO are under way.

However, some side effects of anti-inflammatory substances developed by these studies are problematic. For example, non-steroidal anti-inflammatory drugs used in the treatment of acute inflammatory diseases or chronic inflammatory diseases are known to exhibit side effects such as gastrointestinal disorders by inhibiting COX-2 enzyme as well as inhibiting COX-1 enzyme. Recently, the mechanism of treatment for gastritis is mainly H2 inhibitors (H2-Blockers), which inhibit the second histamine receptor (H2 receptor) and decrease the secretion of gastric acid in the gastric wall cells. Reduced gastric acid prevents further damage to already damaged gastric cells (eg, gastric ulcer). Because these H2 inhibitors interfere with the metabolism of other drugs in the liver (potent inhibitors of P-450), they should be used with caution when taken with other medicines, have anti-androgen effects and may cause gynecomastia ), Impotence, and decreased sexual desire. In addition, the placenta and the cerebrovascular barrier to the pregnant women and the elderly because it may be more dangerous side effects, headaches, confusion, dizziness and can cause dizziness.

Therefore, it is possible to effectively inhibit the production of NO, inhibit the expression of iNOS and TNF-α , and effectively inhibit the activity of COX-2 enzyme, thereby providing an anti-inflammatory effect, osteoblast ALP activity, Development of osteoblast differentiation, inhibition of osteoclast differentiation, and formation of bone or cartilage tissue, as well as the development of a substance derived from a natural substance which has no risk of such side effects or cytotoxicity, Is required.

Mullen ( Stauntonia hexaphylla ) is an evergreen vine plant with a native habitat of the southern coastal region. It grows up to 15 m tall. White flowers bloom in mid-April to mid-May. In fall, Is a plant that hangs. The name is known as 'sweet like honey'. The fruit is known to be delicious fruit, but it has a lot of thick seeds and few fruits. Leaves can be wintered in the southern part of the country, are thick in meat, have a high coronary value, and are used for gardening, pergolas, etc., and accordingly plant production is increasing.

Under this background, The present inventors isolated and purified novel flavonoid compounds while studying to find a substance having physiological activity from mullen. They were identified through their physicochemical and spectral analyzes, and were found to have anti-inflammatory, Confirming its activity, thus completing the present invention.

Related prior arts include a method of separating a high purity flavonoid component from ginseng leaves (Korean Patent Laid-open Publication No. 1992-0005995), a method of extracting and purifying a flavonoid compound from ginkgo leaf containing various herbal ingredients 1994-0006596) and a method for producing safflower leaf tea by extracting a substance containing flavonoids from safflower leaves (Korean Patent No. 0465778). In addition, studies on various pharmaceutical compositions containing flavonoids have been actively carried out. As prior arts therefor, anti-atherosclerotic compositions containing flavonoids capable of inhibiting the progress of arteriosclerosis (Korean Patent Laid- 2004-0108265), compositions containing antioxidative activity for antioxidative activity in the prevention and treatment of various diseases caused by oxidative stress and compositions containing flavonoid compounds separated therefrom (Korean Patent No. 0514916) and flavonoids isolated from Crassulaceae extract (Korean Patent Laid-open Publication No. 2005-0074753) for the prevention and treatment of hypertension. [Patent Document 1] Korean Patent Publication No. 1992-0005995 [Patent Document 2] Korean Patent Publication No. 1994-0006596 [Patent Document 3] Korean Patent Publication No. 0465778 [Patent Document 4] Korean Patent Publication No. 2004-0108265 [Patent Document 5] Korean Patent Publication No. 0514916 [Patent Document 6] Korean Patent Publication No. 2005-0074753 [Patent Document 7] Korean Patent Publication No. 10-2010-0043882 [Patent Document 8] Korean Patent Publication No. 10-0930927

Under the above circumstances, it is an object of the present invention to provide a pharmaceutical composition for promoting anti-inflammation, bone tissue or cartilage tissue formation containing a novel active ingredient derived from mulberry, a natural product.

It is still another object of the present invention to provide a pharmaceutical composition for preventing or treating a disease that destroys bone tissue or cartilage tissue containing a novel active ingredient derived from mulberry.

It is also an object of the present invention to provide a food composition for promoting antiinflammatory, osseous or cartilage tissue formation containing a novel effective ingredient derived from mulberry.

It is still another object of the present invention to provide a food composition for preventing or ameliorating a disease that destroys bone tissue or cartilage tissue containing a novel active ingredient derived from mulberry.

In one aspect, the present invention provides a novel flavonoid compound of formula 1, an isomer thereof, a pharmaceutically acceptable salt, or a solvate thereof, isolated from a mulberry leaf extract.

Wherein R is H or OH.

In a preferred embodiment, the compound of Formula 1 is a compound of Formula 2 (7 - (((2,3,4,5,6) -4,5-dihydroxy-6-methyl- (2,3,4,5) -3,4,5-trihydroxytetrahydro-2H-pyran-2-yl) oxy) tetrahydro-2H- pyran- 2- yl) oxy) -2- (3,4- dihydroxyphenyl) 5-hydroxy-4H-chromen-4-one) or a compound of formula 3 (7 - (((2,3,4,5,6) -4,5- dihydroxy- 2,3,4,5) -3,4,5-trihydroxytetrahydro-2H-pyran-2-yl) oxy) tetrahydro-2H-pyran-2-yl) oxy) -5-hydroxy-2- (4- ) -4H-chromen-4-one.

The compounds of Formulas 1 to 3 are provided for the first time by the present inventors.

The present invention also provides a salt, preferably a pharmaceutically acceptable salt, of the flavonoid compound represented by any one of formulas (1) to (3). Means a salt suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc. within the purview of pure medical judgment. Such pharmaceutically acceptable salts are well known in the art. For example, in S. M. Berge et al., J. Parmaceutical Sciences, 66, 1, 1977. Salts may be prepared in situ during the final isolation and purification of the compounds of the present invention or may be prepared by reaction with an inorganic base or an organic base separately. Suitable base addition salt forms include, for example, alkali and alkaline earth metal salts such as ammonium salts, salts of lithium, sodium, potassium, magnesium, calcium and the like, salts with organic bases such as primary, secondary and tertiary Aliphatic and aromatic amines such as methylamine, ethylamine, propylamine, isopropylamine, 4-butylamine isomers, dimethylamine, diethylamine, diethanolamine, dipropylamine, diisopropylamine, di- -Butylamine, pyrrolidine, piperidine, morpholine, trimethylamine, triethylamine, tripropylamine, quinuclidine, pyridine, quinoline and isoquinoline, benzathine, N-methyl- -Amino-2- (hydroxymethyl) -1,3-propanediol, hydrabamine salt, and salts with amino acids such as arginine and lysine.

In addition, the present invention may include a hydrate of the flavonoid compound represented by any one of Chemical Formulas 1 to 3 or a derivative compound such as a glycoside in which a compound such as glucose is bound to each side chain.

The flavonoid compounds according to the present invention can be prepared by chemical synthesis of flavonoid compounds isolated from nature or known in the art.

Preferably, the flavonoid compounds of the present invention can be isolated and purified from natural plants. That is, it can be obtained from plants or parts of plants using methods of extracting and separating conventional materials. Preferably, the raw plant (herbal medicine) for producing the flavonoid compound of any one of formulas (1) to (3) of the present invention is mulberry, and the whole plant may be used or a part thereof may be used. Such a raw plant may be suitably dried and macerated or simply dried to obtain the desired extract, and an appropriate solvent, for example, water such as purified water and an organic solvent having 1 to 4 carbon atoms may be used. The organic solvent may be, for example, but not limited to, lower alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propanol, isopropanol, and butanol, acetone, ether, chloroform, ethyl acetate, methylene chloride, hexane, , Chloroform and petroleum ether may be used alone or in combination. The extraction method used in the present invention may be any method generally used for extracting plants or herbal medicines without limitation, and may be, for example, cold-rolling, room temperature extraction, hot water extraction, ultrasonic extraction, percolation, , But is not limited thereto. The extraction process may be single, but may be repeated two or more times if necessary.

In addition, the desired extract may further be subjected to a fractional step such as addition, in order to separate the compound of any one of formulas (1) to (3) of the present invention. And may be purified using purification methods known to those skilled in the art to which the present invention belongs. Such purification methods include, for example, reverse phase partition chromatography, normal phase adsorption chromatography, ion exchange chromatography, size exclusion chromatography size exclusion chromatography), or a combination of one or more thereof. As the chromatography, column chromatography and high performance liquid chromatography (HPLC) packed with various synthetic resins such as silica gel and activated alumina can be used alone or in combination. However, the method of extracting and separating and purifying the compound is not necessarily limited to the above-mentioned method.

In one embodiment of the present invention, a flavonoid compound represented by any one of formulas (1) to (3) according to the present invention is extracted from mulberry leaves using water and separated and purified.

The flavonoid compound of any one of Chemical Formulas 1 to 3, its isomer, pharmaceutically acceptable salt or solvate thereof increases the activity of ALP to increase osteoblast differentiation and activity, inhibits osteoclast TRAP activity, Promoting the production of bone tissue by inhibiting differentiation of cells and promoting the production of aggercan, collagen type II (collagen II), which is a factor related to generation or differentiation of cartilage cells through inhibition of inflammatory cytokine, It also promotes the formation of tissues and has the anti-inflammatory effect and thus has the ability to stimulate bone formation and cartilage tissue formation, thereby protecting it from various diseases that destroy or damage joints or cartilage.

Accordingly, in another aspect, the present invention provides a pharmaceutical composition comprising a flavonoid compound represented by any one of formulas (1) to (3), an isomer thereof, a pharmaceutically acceptable salt or solvate thereof as an active ingredient, To a pharmaceutical composition.

The flavonoid compound of any one of formulas (1) to (3) as an active ingredient in the composition according to the present invention can be appropriately controlled depending on the mode and purpose of use, patient condition, symptom type and hardness, and is 0.000001 to 50 %, Preferably 0.0001 to 40% by weight. However, it is not limited to the above range because it can be increased or decreased according to the needs of the medicinal person, and it can be appropriately increased or decreased according to various factors such as the dietary life, nutritional status, degree of damage of bone tissue or cartilage tissue.

The compositions according to the present invention can be administered to mammals, including humans, in a variety of routes. The mode of administration may be any manner conventionally used and may be administered by routes such as, for example, oral or parenteral (e.g., skin, intravenous, intramuscular, subcutaneous), and preferably administered orally have. The compositions of the present invention may be formulated into tablets, capsules, granules, pillars, LEMONADES, AROMATIC WATERS, and the like, respectively, POWDERS, SYRUPS, DECOCTIONS, INFUSIONS, LIQUIDS AND SOLUTIONS, ELIXIRS, FLUIDEXTRACTS, EMULSIONS, SUSPESIONS, Oral preparations such as TROCHES, TINCTURES and SPIRITS or oral preparations such as transdermal preparations, PLASTERS, LPTIONS, LINIMENTS, (OPTHALMIC OINTMENTS), AEROSOLS, OINTMENTS, EMULSIONS, SUSPESIONS, OPHTHALMIC SOLUTIONS, SUPPOSITIORIES, INJECTIONS, CATAPLSMA, Parenteral formulations in the form of creams (CREAMS), pasta (PASTES), and the like.

In addition to the above-mentioned mixed extract, the composition of the present invention may further comprise pharmaceutically acceptable and physiologically acceptable carriers, excipients and diluents. For example, in the case of oral preparations, formulations can be prepared using excipients, binders, disintegrants, lubricants, solubilizers, suspending agents, preservatives or extenders.

The dose of the pharmaceutical composition of the present invention can be determined by a specialist according to various factors such as the condition of the patient, age, body weight, degree of cartilage damage, progress of disease, and the like. Also, the daily dosage of the pharmaceutical composition per unit dosage form, or a half, 1/3 or 1/4 dose thereof, may be contained, and may be administered 1 to 6 times per day.

In another aspect, the present invention relates to a method for preventing or treating a disease that destroys bone tissue or cartilage tissue, comprising a flavonoid compound represented by any of Formulas 1 to 3, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof as an active ingredient ≪ / RTI >

Diseases that destroy or damage the bone or cartilage tissue include, but are not limited to, arthritis, joint destruction due to autoimmune disease, multiple mycoses, ankylosing spondylitis, systemic lupus erythematosus, multiple myelitis, rheumatoid arthritis Polymyalgia rheumatica, osteoporosis, bone cancer or Paget's disease. The arthritis may also include, but is not limited to, various forms of arthritis such as osteoarthritis, rheumatoid arthritis, degenerative arthritis, psoriatic arthritis, reactive arthritis, and the like. Preferably rheumatoid arthritis. The contents of the compound of formula (1) contained in the composition, the formulation, the route of administration, the adjuvant, and the like may be applied to the composition for promoting bone formation or cartilage formation.

In another aspect, the present invention provides a method of promoting the production of bone tissue or cartilage tissue, destroying bone tissue or cartilage tissue, comprising the flavone compound of any one of formulas 1 to 3, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof, And to a food composition for improving the disease. The food is not limited to a health supplement food, a health functional food, a functional food, and the like. The flavonoid compound of the present invention, its isomer, its pharmaceutically acceptable salt or solvent Including the addition of cargo. The food composition of the present invention can be used as it is or in combination with other food or food compositions, and can be suitably used according to conventional methods. The amount of the active ingredient to be mixed can be suitably determined according to the purpose of use thereof. In general, the flavonoid compound of any one of formulas 1 to 3 of the present invention, its isomer, pharmacologically acceptable salt or solvate is used in an amount of 0.000001 to 5 mg, 50% by weight. The effective dose of a flavonoid compound of any one of formulas (1) to (3), an isomer thereof, a pharmaceutically acceptable salt or a solvate thereof may be used in accordance with the effective dose of the pharmaceutical composition, In the case of long-term ingestion for improvement or maintenance, it may be less than the above range, and since the active ingredient has no problem in terms of safety, it may be used in an amount exceeding the above range. In addition, the food composition may further comprise at least one flavonoid compound selected from the group consisting of an organic acid, a phosphate, an antioxidant, a lactose casein, a dextrin, a glucose, a sugar and a sorbitol in addition to a flavonoid compound represented by any one of formulas 1 to 3, an isomer thereof, a pharmaceutically acceptable salt or a solvate thereof Lt; RTI ID = 0.0 > additive < / RTI >

There is no particular limitation on the kind of the food. The food composition comprising the flavonoid compound of any one of the above formulas (1) to (3), an isomer thereof, a pharmaceutically acceptable salt or a solvate thereof may be in the form of a beverage such as tablets, hard or soft capsules, granules, powders, , Which may be used in admissible conventional carriers such as excipients, binders, disintegrants, lubricants, solubilizers, suspending agents, preservatives or preservatives in the case of preparations for oral administration, An extender, and the like. Examples of the food to which the flavonoid compound of any one of Chemical Formulas 1 to 3, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof can be added include meat, sausage, bread, chocolates, candies, snacks, confectionery, , Other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages and vitamins, and other nutrients, but are not limited to these kinds of foods.

As described above, the compounds of the present invention are novel flavonoid compounds separated and purified for the first time in the natural world by the present inventors. They exhibit excellent anti-inflammatory, bone-forming or promoting effect on cartilage formation, It is very useful as a preventive, ameliorative or therapeutic agent for various diseases such as rheumatoid arthritis associated with destruction.

1 is a chemical structural formula of a flavonoid compound of Formula 2 according to the present invention:
2 shows the results of ¹ H-NMR spectrum analysis of the flavonoid compound of Formula 2 of the present invention isolated from mullah:
3 shows the results of ¹³ C-NMR spectrum analysis of the flavonoid compound of formula (2) of the present invention isolated from mullah:
FIG. 4 shows the spectral analysis of the flavonoid compound DEPT 135 of formula 2 of the present invention isolated from mullah:
Figure 5 shows the results of HOMO COZY spectrum analysis of the flavonoid compound of formula (2) of the present invention isolated from mullah:
FIG. 6 is a spectrum analysis result of a flavonoid compound HMQC of Formula 2 of the present invention isolated from mullah:
FIG. 7 shows the results of analysis of the flavonoid compound HMBC of Formula 2 of the present invention isolated from mullah:
8 shows the results of MS spectral analysis of a flavonoid compound of formula 2 of the present invention isolated from mullah:
9 is a chemical structural formula of Formula 3 according to the present invention:
10 is a ¹ H-NMR spectral analysis result of the flavonoid compound of Formula 3 of the present invention isolated from mullah:
11 shows the results of ¹³ C-NMR spectrum analysis of the flavonoid compound of Formula 3 of the present invention isolated from mullah:
FIG. 12 shows the results of HOMO COZY spectrum analysis of the flavonoid compound of Formula 3 of the present invention isolated from mulberry:
FIG. 13 is a spectrum analysis result of the flavonoid compound HMQC of Formula 3 of the present invention isolated from mullah:
14 shows the results of analysis of the flavonoid compound HMBC of formula 3 of the present invention isolated from mullah:
15 shows the results of MS spectral analysis of the flavonoid compound of formula (3) of the present invention isolated from mullin:
FIG. 16 is a graph showing the effect of the flavonoid compound of formula 1 of the present invention isolated from mulberry on the activity of TRAP on osteoclast;
17 is a graph showing the osteoclast differentiation staining results of the flavonoid compound of Formula 1 of the present invention isolated from mullah;
18 is a graph showing the effect of ALP extract on the ALP activity on osteoblast (C2C12) of formula (3)
19 is a graph showing the result of ALP activity staining for osteoblast (C2C12) of formula (3) derived from mulberry leaf extract:
FIG. 20 is a graph showing the effect of ALP extract on osteoblast (MG-63) of formula (3) on ALP activity;
21 is a graph showing the result of ALP activity staining for osteoblast (MG-63) of formula (3) derived from mulberry leaf extract:
FIG. 22 is a graph showing the effect of the flavonoid compound of formula (I) of the present invention isolated from mullah on collagen type II and aggrecan expression on chondrocyte differentiation (production).

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Reference Example 1: Analytical instrument

NMR spectra were recorded on a Brucker MHz FT-NMR spectrometer using tetramethylsilane as an internal standard. HRMS was performed on the instrument (UPLC / Quttro Micro spectrometer) and HPLC analysis was performed on the instrument (Agilent) using UV / VIS detector (G4212B), pump (G1311C).

Example 1: Separation of new compounds from mulberry leaf extract

1-1. Extraction and fractionation from mulberry

The process of extracting 4 kg of leaf of mulberry ( Stauntonia hexaphylla ) from Jeollanamdo Natural Resources Research Institute was repeated twice with 40 ℓ of water. The obtained extract was concentrated under reduced pressure to obtain 225 g of an extract. The extract was suspended in water, and 179 g of an extract was sequentially obtained from a 1000 ml volume of n-butanol fraction.

1-2. Purification of compounds

Silica gel column chromatography (200-400 mesh ASTM, Merck) was performed on the n-hexane fraction, the chloroform fraction, the ethyl acetate fraction and the n-butanol fraction obtained in Example 1 (179 g). The mixture ratio of chloroform to methanol was determined by concentration gradient chromatography in which methanol was gradually increased to 0, 10, 30, 50, 70 and 100% The obtained fractions (f1-f6) were collected and concentrated under reduced pressure. As a result, six aliquots of f1 6 g, f2 8 g, f3 7.5 g, f4 7.5 g, f5 7.5 g and f6 8.5 g were obtained and 7.5 g of the f3 aliquot was subjected to Lichoprep RP18 column chromatography 15 mg of the compound represented by Formula 2 and 7.5 g of f4 aliquot were subjected to Lichoprep RP18 column chromatography to separate 20 mg of the compound represented by Formula 3 above. At this time, the eluent was mixed with methanol and water at a ratio of 1: 3, and concentration gradient chromatography was performed.

1-3. Identification of Compound (1)

IR spectrum, NMR analysis and HRMS mass spectrometry were carried out in the following manner to identify the structure of the compound separated and purified in Example 1.

≪ 1-3-1 > The compound of formula (2)

Appearance: Yellow crystals (methanol),

Molecular formula: C ₂₆ H ₂₈ O ₁₄

MP: 258-260 ° C

¹ H and ¹³ C NMR spectra: Table 2

HRMS (30 V, rel. Int.,%): M / z 565 [M] ⁺

The analysis showed that the UV spectrum in methanol showed maximum absorption at 268, 293 and 394 nm. ^{The 1} H-NMR spectra were obtained from six olefinic (δ 6.35, 6.72, 6.76, 6.89, 7.42 and 7.46), two anomeric (δ 5.00 and 5.20) and one methylproton signal Respectively. Based on the binding constants of the anomeric proton signals of the ¹ H-NMR spectrum, the arrangement of the anomeric sites was determined to be in the beta form. ^{In the 13} C-NMR spectrum, the chemical shifts of the two anomeric carbons were indicated at δ 100.5 and 105.3. β- L-rhamphyranose anomeric proton signal has proton signal at δ 5.00 (H-1 ") and δ 164.0 (C-7), and α- L-arabinopyranose anomeric proton signal is δ 7 and C-2 " positions by the correlation between the carbon signal at 5.20 (H-1 ''') and the carbon signal at? 68.3 (C-2 "). The analysis results of these data are shown in Table 1.

NMR chemical transfer and association of compounds of formula (2) No. 隆_H δ _C HMBC
¹ H? ¹³ C 2 - 145.0 - 3 6.76 (s) 135.7 - 4 - 175.8 - 5 - 161.0 - 6 6.35 (d, J = 2.0 Hz) 98.2 - 7 - 164.0 - 8 6.72 (d, J = 2.0 Hz) 93.3 - 9 - 156.1 - 10 - 103.0 - One' - 121.9 - 2' 7.42 dd ( J = 8.5, 2.0 Hz) 115.0 C-2 ', 6' 3 ' 6.89 d ( J = 8.5 Hz) 115.6 C-2 ' 4' - 147.0 - 5 ' - 148.0 - 6 ' 7.46 d ( J = 2.0 Hz) 120.0 C-6 ' 5-OH 13.65 (s) - - Rha-1 " 5.0 (d, J = 4.5 Hz) 100.5 C-7 Rha -2 " 68.3 - Rha -3 " 70.4 - Rha -4 " 71.8 - Rha -5 " 66.0 - Rha -6 " 1.2 (d, J = 6.4 Hz) 18.0 C-5 " Ara-1 5.20 d (7.2) 105.3 C-2 " Dec -2 75.4 - Dec -3 77.6 - Dec -4 70.4 - Dec -5 4.29 66.0 -

(2, 3, 4, 5, 6) -4,5-dihydroxy-6-methyl-3 - (((2,3,4,5) 2H-pyran-2-yl) oxy) -2- (3,4-dihydroxyphenyl) -5-hydroxy-4H-chromen- 4-one, which was named YJ-002 as a novel flavonoid compound, which was first isolated from nature, which has not yet been reported.

≪ 1-3-2 >

Appearance: Yellow crystals (methanol),

Molecular formula: C ₂₆ H ₂₈ O ₁₃

MP: 254-258 ° C

¹ H and ¹³ C NMR spectra: Table 3

HRMS (30 V, rel. Int.,%): M / z 569 [M] ⁺

The analysis showed that the UV spectrum in methanol showed maximum absorption at 268, 293 and 394 nm. ^{The 1} H-NMR spectrum showed five olefinic (δ 6.36, 6.77, 6.79, 6.95 and 7.96), two anomeric (δ 5.00 and 5.20) and one methylproton signal (δ 1.23) . Based on the binding constants of the anomeric proton signals of the ¹ H-NMR spectrum, the arrangement of the anomeric sites was determined to be in the beta form. ^{In the 13} C-NMR spectrum, the chemical shifts of the two anomeric carbons were indicated at δ 100.5 and 105.3. β- L-rhamphyranose anomeric proton signal has proton signal at δ 5.00 (H-1 ") and δ 164.0 (C-7), and α- L-arabinopyranose anomeric proton signal is δ 7 and C-2 " positions by the correlation between the carbon signal at 5.20 (H-1 ''') and the carbon signal at? 68.3 (C-2 "). The analysis results of these data are shown in Table 2.

NMR chemical transfer and association of compounds of formula (III) No. 隆_H δ _C HMBC
¹ H? ¹³ C 2 - 162.3 - 3 6.77 (s) 103.0 - 4 - 181.9 - 5 - 161.0 - 6 6.35 (d, J = 2.0 Hz) 98.2 - 7 - 164.2 - 8 6.72 (d, J = 2.0 Hz) 94.2 - 9 - 156.9 - 10 - 103.0 - One' - 120.9 - 2' 7.42 dd ( J = 8.5, 2.0 Hz) 115.9 C-6 ' 3 ' 6.79 d ( J = 8.5 Hz) 128.5 C-5 ' 4' - 147.0 - 5 ' 6.79 d ( J = 8.5 Hz) 128.5 C-3 ' 6 ' 7.42 d ( J = 8.5, 2.0 Hz) 115.9 C-2 ' 5-OH 12.9 (s) - - Rha-1 " 5.0 (d, J = 4.5 Hz) 100.5 C-7 Rha -2 " 68.3 - Rha -3 " 70.4 - Rha -4 " 71.8 - Rha -5 " 66.0 - Rha -6 " 1.2 (d, J = 6.4 Hz) 18.0 C-5 " Ara-1 5.2 (d, J = 7.2 Hz) 105.3 C-2 " Dec -2 75.4 - Dec -3 77.6 - Dec -4 70.4 - Dec -5 4.29 66.0 -

(3,3,4,5,6) -4,5-dihydroxy-6-methyl-3 - (((2,3,4,5) 2H-pyran-2-yl) oxy) -5-hydroxy-2- (4-hydroxyphenyl) -4H- one, a novel flavonoid compound initially isolated from nature that has not yet been reported, designated YJ-003.

Example 2: Isolation of bone marrow cells and osteoclast differentiation

Tibia of 4-5 week-old ICR mice were excised, the both ends were cut, the bone marrow cells were collected through α-MEM essential medium, treated with 50 ng / mL macrophage-colony stimulation factor (M-CSF) And cultured for 24 hours. Untreated cells were washed with α-MEM and subcultured to 48 × 10 ⁵ cells / well and cultured in α-MEM medium supplemented with 50 ng / mL M-CSF for 3 days. After that, 50 ng / mL of MCSF and 100 ng / mL of RANKL (Receptor Activator for Nuclear Factor κB Ligand) were treated together and treated for 4 days.

Example  3: Mellow  From leaf extract Derived  TRAP activity measurement of osteoclast by the compound of formula 2 or 3

The osteoclasts have a tartrate-resistant acid phosphatase (TRAP), an acid phosphatase that is resistant to tartrate, and is used as a cytochemical labeling enzyme for osteoclasts that can distinguish it from other bone cells (Minkin, C., Calcif. Tissue Int., 34: 285-290, 1982). Therefore, the TRAP activity of the osteoclast by the compounds of Formulas 2 and 3 derived from the mulberry leaf extract of the present invention was tested as follows. As described in [Example 2], cells were inoculated to 48-wells at 5 × 10 ⁵ cells / well, treated with differentiation factors (RANKL, MCSF) and samples and cultured for 4 days. TRAP activity was measured using the TRAP acivity assay kit (AK04F, COSMO BIO CO., LTD). After incubation for 4 days, 30 ul / well of culture supernatant was dispensed into a new 96-well plate, and 170 μl / well of Chromogenic substrate / Tartrate-containing buffer was added to the kit. After incubation at 37 ° C. for 30 minutes to 3 hours, Absorbance is measured. TRAP activity was expressed as a percentage of the absorbance of the control in the absorbance of the sample.

The osteoclasts were treated with 0.1, 1, 10, and 100 ug / ml of each of the compounds of Formulas 2 and 3 obtained in Example 1 for 4 days, and then the osteoclast TRAP activity (TRAP activity, And the results are shown in FIG. 16 as a graph. As shown in FIG. From FIG. 24, it was confirmed that the compounds of formulas (2) and (3) of the present invention inhibited the activity of osteoclasts in a concentration dependent manner (0.1, 1, 10, and 100 ug / ml).

Example  4: Mellow  From leaf extract Derived  Inhibition of osteoclast differentiation by the compounds of formulas 2 and 3

As described in Example 2, cells were inoculated to 48-wells at 5 × 10 ⁵ cells / well, treated with differentiation factors (RANKL, MCSF) and the compounds of Formulas 2 and 3 of the present invention and cultured for 4 days . The cells were washed with PBS and fixed with 10% formaldehyde. 100 μL of substrate solution (1.36 mg / mL 4-nitrophenyl phosphate disodium salt, 10 mM tartrate, 50 mM citrate buffer pH 4.6) Lt; / RTI > Subsequently, the medium was removed, washed with PBS, and fixed with 10% formaldehyde for 15 minutes. Cells were washed 3 times with PBS. TRAP staining was performed by adding 1 mg / mL naphtol AS-MX phosphate and 100 μL of N, N-dimethylformamide to 10 mL of 50 mM sodium acetate buffer containing 50 mM tartrate acid, and then staining with 10% formaldehyde 45 占 퐇 of the staining solution was dispensed and stained at 37 占 폚 for 30 minutes, and observed with a microscope. The results are shown in Fig.

As can be seen from FIG. 17, TRAP-positive polynuclear osteoclasts were formed in the control cells, but in the experimental group treated with the compounds of Formulas 2 and 3 derived from the mulberry leaf extract of the present invention, concentrations (0.1, 1, 10, 100 [mu] g / ml), the osteoclast differentiation was suppressed. From the above results, it was confirmed that the compounds of formulas (2) and (3) of the present invention inhibit osteoclast differentiation in a concentration-dependent manner.

Example  5: Mellow  From leaf extract Derived  Measurement of ALP (alkaline phosphatase) activity of osteoblasts by the compound of formula (3)

Since osteoblasts exhibit ALP activity, the effect of the compound of formula (3) derived from the mulberry leaf extract according to the present invention on ALP activity in osteoblasts was measured. Specifically, C2C12 cells (ATCC® CRL-1772) and MG-63 cells (ATCC® CRL-1427), which are osteoblasts, were divided into 48 wells at 5 × 10 ⁴ cells / Cells were cultured in α-MEM essential medium containing 0.1% p / s for 3 days. After 3 days, α-MEM essential medium containing 1% horse serum and 0.1% p / s was exchanged to induce osteoblast differentiation. The osteoblast C2C12 cells and MG-63 cells were treated with the compound of Chemical Formula 3 derived from the mulberry leaf extract obtained in Example 1 at concentrations of 0.5, 5 and 10 ug / ml, respectively, and cultured for 5 days. The cells were then treated with an AP assay buffer (kit) containing 0.01% Triton X and centrifuged at 1000 xg for 5 minutes to obtain a sample required for ALP activity detection.

ALP activity was measured using the change in absorbance at 405 nm using ALP decomposition of p-nitrophenylphosphate into p-nitrophenol and phosphate. Protein concentrations were determined using a BioRad protein assay kit. ALP activity was expressed as PNP uM / min / mg protein.

In order to measure the degree of osteoblast differentiation, osteoblast differentiation of C2C12 cell and MG-63 cell was measured by ALP activity site staining using NBT / BCIP substrate Respectively. Specifically, after the culture for 5 days has been completed, the cells are washed with 1xPBS. The cells are fixed with 10% formalin solution for 15 minutes at room temperature, and the cells are washed with 1 × PBS for 3 times to remove residual formalin. Cells were washed again with 1x alkaline phosphaste solution, and ALP active sites were stained with NBT / BCIP substrate solution.

The results of ALP activity and ALP activity site staining using C2C12 cells are shown in FIG. 18 and FIG. 19, respectively, and ALP activity and ALP activity site staining results using MG-63 cell are shown in FIGS. 20 and 21, respectively .

As shown in FIG. 18, in the case of the osteoblast C2C12 cell, in the case of the test group treated with the compound of Formula 3 (0.5, 5, 10 ug / ml) derived from the mulberry leaf extract, The activity of ALP was increased. Specifically, the positive control group treated with BMP-2 (50 ng / ml) showed an increase in ALP activity (pNP 72.4 μM; 313.4%) compared with the normal group. ALP activities were 168.5% (pNP 38.9 μM), 135.9% (pNP 31.4 μM) and 163.2% (pNP 37.7 μM), respectively, when the compound of the formula 3 (0.5, 5 and 10 ug / uM). As shown in FIG. 19, the positive control group treated with BMP-2 alone showed more ALP activity site staining due to NBT / BCIP than the normal group, that is, osteoblast differentiation was confirmed. In the case of the group treated with the compound of formula (3) (0.5, 5, 10 ug / ml) derived from the hot water extract of mulberry leaf, the NBT / BCIP induced cell staining was higher than that of the normal group.

In the case of the osteoblast MG-63 cell, as shown in FIG. 20, in the case of the test group treated with the compound of Formula 3 (0.5, 5, 10 ug / ml) derived from the mulberry leaf extract, ALP activity was observed to increase. Specifically, in the positive control group treated with BMP-2 (50 ng / ml), ALP activity was increased (pNP 71.3 μM; 215.9%) as compared with the normal group. (PNP 43.6 uM), 126.1% (pNP 41.6 uM), and 138.5 (pNP 41.6 uM), respectively, when the compounds of formula 3 (0.5, 5 and 10 ug / ml) % (pNP 45.7 uM). As shown in FIG. 21, osteoblast differentiation was observed in the positive control group treated with BMP-2 alone, that is, the NBT / BCIP-induced ALP activity site cell staining was higher than that in the normal group. In the case of the group treated with the compound of formula (3) (0.5, 5, 10 ug / ml) derived from the hot water extract of mulberry leaf, the NBT / BCIP induced cell staining was higher than that of the normal group.

Since ALP is an enzyme released by osteoblast differentiation and activity increase, the increase of the activity of ALP is directly related to the osteoblast activity and increase. Therefore, the increase of ALP activity by the compound of formula 3 derived from the alfalfa leaf extract of the present invention Demonstrate the effect of promoting bone formation by direct osteoblast differentiation and increased activity.

Example  6: Mellow  From leaf extract Derived  The chondrocyte differentiation (generation) by the compounds of formulas 2 and 3 Biomarker Aghrecane ( aggercan ), Collagen type II (collagen II) mRNA expression

High-density culture was used to obtain chondrocyte primary cells. Specifically, 1 cm above and below the knee of a 5-day old rat is cut and the knee cartilage is stored in a 50 ml conical tube containing 1 × PBS (containing 20% P / S). After washing three times for 15 minutes at room temperature with 1 × PBS (containing 20% P / S), 400 μl of 1% Collagenase D (or H), Trypsin 400 and 1.2 ml of serum free media (DMEM F-12) And incubated for 1 hour with stirring. After the incubation time, the cells were washed 3 times with 1 × PBS (containing 20% P / S) at room temperature. Then, the cartilage was excised and placed into a new 50 ml conical tube. 600 μl of collagenase, media (10% FBS, 1% P / ) Were added and incubated at 37 ° C for 6 hours with stirring. After culturing, the mixture was filtered through a mesh and seeded to a number of cells of 1.5 (or 2.0) × 10 in a 12-well microplate and cultured at 37 ° C. for 24 hours. After 24 hours of culture, medium was replaced with media (10% FBS, 1% P / S) and cultured at 37 ° C for 24 hours. After 24 hours of culture, the medium was mixed with DMEM F-12 media (10% FBS, 1% P / S) and DMEM F-12 media (10% ITS, 1% P / S) Incubate at 37 ° C for 24 hours. After 24 hours, replace with DMEM F-12 media (10% ITS, 1% P / S) and incubate at 37 ° C for 24 hours. After 24 hours of incubation, the cells were replaced with serum free media (DMEM F-12) and incubated at 37 ° C for 24 hours. After culturing for 24 hours, 100 ug / ml of BMP-2 or BMP-7, 10 ug / ml of IL-1β and 50 ug / ml of the compound of formula 1 according to the present invention were treated and cultured at 37 ° C for 24 hours. After 24 hours of culture, RNA was isolated from each cell. Isolation of the RNA was carried out in the following manner. Specifically, the cultured cells were lysed with a GIT solution (easy BLUE Total RNA extraction kit, manufactured by Intron Biotechnology), centrifuged at 10,000 rpm for 5 minutes at room temperature, the supernatant was removed, (pellet). To the pellet, 1 ml of 0.1% DEPC solution (Sigma) was added and centrifuged again at 12,000 rpm for 2 minutes to remove the supernatant, and pellets were obtained. 0.5 ml of guanidinium was added to the obtained pellet, followed by vortexing. Further, 0.5 ml of a mixed solution of phenol / chloroform / iso-amylalchol (25: 24: 1) was added, vortexed, and centrifuged at 12,000 rpm for 3 minutes to obtain a supernatant. Isopropyl alcohol (iso-propylalcol) in the same amount as the supernatant was added, mixed well, and left at -20 ° C for 30 minutes. Thereafter, the supernatant was removed by centrifugation at 12,000 rpm for 10 minutes, and the pellet was washed with 70% aqueous ethanol solution and dried under vacuum to separate the RNA. The separated RNA was dissolved in 1 ml of 0.1% DEPC solution and used to measure the mRNA content of collagen II (Col II) and aggrecan, which are chondrocyte markers. GAPDH was used as a house keeping gene Respectively. The mRNA content of collagen II (Col II) and aggrecan, which are chondrocyte biomarkers, was measured by the following method. Superscript II reverse transcriptase (Invitrogen, USA) was added to 3 μg of the separated RNA, incubated at 42 ° C for 1 hour 45 minutes, and then incubated at 70 ° C for 15 minutes to obtain cDNA. The cDNA thus obtained was quantified by real-time PCR. The primer sequence and experimental conditions for performing the real-time PCR are shown in Table 3 below.

MRNA to be identified Primer sequence Annealing Tm (° C) Col II sense TGGCATCGACATGTCAGCCTTTGC 60 anti-sense TGCAGAAGACTTTCATGGCGTCCA Aggrecan sense ACAGTGAGCTCAGGCTTGCCTGTA 62 anti-sense GTGACATCCTCTACACCTGAAGCA GAPDH sense TGGTGCTGAGTATGTCGTGGAGTC 60 anti-sense AGACAACCTGGTCCTCAGTGTAGC

The real-time PCR result was photographed in comparison with the GAPDH content and is shown in FIG.

As shown in FIG. 22, the negative control group treated with IL-1 beta (10 ng / ml) showed that the amount of mRNA expression of collagen II (Col II) and aggrecan, which are biomarkers associated with chondrocytes, Lt; / RTI > than the normal group without treatment with < RTI ID = 0.0 > On the other hand, the positive control treated with BMP-2 (100 ng / ml) showed that the amount of mRNA expression of collagen II (Col II) and aggrecan, which are biomarkers related to cartilage cells, Which is significantly higher than that of the normal group. In the experimental group treated with the compounds of formulas 2 and 3 at a concentration of 50 ug / ml, the mRNA expression of collagen II (Col II) and aggrecan, which are biomarkers related to cartilage cells, And that the amount increased. This indicates that the expression of type II collagen (Col II), which is a major component of the extracellular matrix (ECM), important for the production (synthesis) of chondrocytes, and the expression of sulfated proteoglycan which promotes the synthesis of aggrecan.

<110> Yung jin pharm. co., ltd.          Jeonnam bioindustry foundation <120> Novel flavonoid compound from Stauntonia hexaphyll leaf          extract and composition for anti-inflammatory, and improvement of          bone tissue generation or cartilage tissue generation <130> DPP20165145KR <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Col II sense primer <400> 1 tggcatcgac atgtcagcct ttgc 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Col II antisense primer <400> 2 tgcagaagac tttcatggcg tcca 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Aggrecan sense primer <400> 3 acagtgagct caggcttgcc tgta 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Aggrecan antisense primer <400> 4 gtgacatcct ctacacctga agca 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH sense primer <400> 5 tggtgctgag tatgtcgtgg agtc 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH antisense primer <400> 6 agacaacctg gtcctcagtg tagc 24

Claims (21)

Stauntonia hexaphylla ) leaf extract of Formula 1, an isomer thereof, a pharmaceutically acceptable salt, or a solvate thereof:

[Chemical Formula 1]

Wherein R is H or OH. The flavonoid compound of claim 1, wherein the flavonoid compound is represented by the following formula (2): (7 - (((2,3,4,5,6) -4,5-dihydroxy-6-methyl- (2,3,4,5) -3,4,5-trihydroxytetrahydro-2H-pyran-2-yl) oxy) tetrahydro-2H- pyran- 2- yl) oxy) -2- (3,4- dihydroxyphenyl) 5-hydroxy-4H-chromen-4-one) or a compound of formula 3 (7 - (((2,3,4,5,6) -4,5- dihydroxy- 2,3,4,5) -3,4,5-trihydroxytetrahydro-2H-pyran-2-yl) oxy) tetrahydro-2H-pyran-2-yl) oxy) -5-hydroxy-2- (4- ) -4H-chromen-4-one), an isomer thereof, a pharmaceutically acceptable salt, or a solvate thereof.

(2)

(3)

.
A pharmaceutical composition for promoting anti-inflammatory, osseous or cartilage tissue production, comprising a flavonoid compound according to claim 1 or 2, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof. 4. The pharmaceutical composition according to claim 3, wherein the composition has the ability to promote the production or differentiation of osteoblasts, the ability to inhibit osteoclast formation or differentiation, or the ability to produce type II collagen or aggrecan. A pharmaceutical composition for preventing or treating a disease which destroys bone tissue or cartilage tissue, comprising a flavonoid compound according to claim 1 or 2, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof. 6. The method of claim 5, wherein the disease that destroys the bone or cartilage tissue is selected from the group consisting of arthritis, joint destruction caused by autoimmune diseases, multiple myositis, ankylosing spondylitis, systemic lupus erythematosus, multiple myositis, polymyalgia rheumatica, osteoporosis, bone cancer, and Paget's disease. The pharmaceutical composition according to claim 6, wherein the arthritis is any one selected from the group consisting of osteoarthritis, rheumatoid arthritis, degenerative arthritis, psoriatic arthritis and reactive arthritis. 6. The flavonoid compound according to claim 5, wherein the flavonoid compound, its isomer, pharmaceutically acceptable salt or solvate thereof according to claim 1 or 2 is contained in an amount of 0.000001 to 50% by weight, A pharmaceutical composition. 6. The composition of claim 5, wherein the composition is selected from the group consisting of PLASTERS, GRANULES, LPTIONS, LINIMENTS, LEMONADES, AROMATIC WATERS, POWDERS, ), Syrups (SYRUPS), OPHTALMIC OINTMENTS, LIQUIDS AND SOLUTIONS, AEROSOLS, EXTRACTS, ELIXIRS, OINTMENTS, FLUIDEXTRACTS, EMULSIONS, SUSPESIONS, DECOCTIONS, INFUSIONS, OPHTHALMIC SOLUTIONS, TABLETS, SUPPOSITIORIES, INJECTIONS, SPIRITS, KAATA, The composition may be any one selected from the group consisting of CATAPLSMA, CAPSULES, CREAMS, TROCHES, TINCTURES, PASTES, PILLS, &Lt; / RTI &gt; or a pharmaceutically acceptable salt thereof. 6. The pharmaceutical composition according to claim 5, wherein the composition has the ability to inhibit the production or differentiation of osteoclasts or the ability to produce type II collagen or aggrecan. A food composition for promoting anti-inflammatory, bone or cartilaginous tissue production, comprising the flavonoid compound according to claim 1, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof. 12. The food composition according to claim 11, wherein the composition has the ability to promote the production or differentiation of osteoblasts, the ability to inhibit the production or differentiation of osteoclasts, or the ability to produce type II collagen or aggrecan. A food composition for preventing or ameliorating a disease which destroys bone tissue or cartilage tissue, comprising a flavonoid compound according to claim 1 or 2, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof. 14. The method of claim 13, wherein the disease that destroys the bone or cartilage tissue is selected from the group consisting of arthritis, joint destruction caused by autoimmune diseases, multiple myositis, ankylosing spondylitis, systemic lupus erythematosus, multiple myositis, polymyalgia rheumatica, osteoporosis, bone cancer and Paget's disease. 15. The food composition according to claim 14, wherein the arthritis is any one selected from the group consisting of osteoarthritis, rheumatoid arthritis, degenerative arthritis, psoriatic arthritis and reactive arthritis. 14. The flavonoid compound according to claim 13, wherein the flavonoid compound, its isomer, pharmaceutically acceptable salt or solvate thereof according to claim 1 or 2 is contained in an amount of 0.000001 to 50% by weight, Food composition. The food composition according to claim 13, further comprising at least one additive selected from the group consisting of organic acids, phosphates, antioxidants, lactose casein, dextrin, glucose, sugar and sorbitol. 14. The food composition of claim 13, wherein the composition is a functional food, a health supplement, or a health functional food. 14. The food composition of claim 13, wherein the composition is in the form of tablets, hard or soft capsules, granules, powders or beverages. A pharmaceutical composition for promoting antiinflammatory, osteogenic or cartilaginous tissue formation, comprising a leaf extract of Stauntonia hexaphylla comprising a flavonoid compound represented by the following formula (1):
[Chemical Formula 1]

Wherein R is H or OH. A food composition for preventing or ameliorating a disease which destroys bone tissue or cartilage tissue, comprising a leaf extract of Stauntonia hexaphylla comprising a flavonoid compound represented by the following formula (1):
[Chemical Formula 1]

Wherein R is H or OH.

Images