KR102038108B1 - Novel caffeic acid compound from Stauntonia hexaphyll leaf extract and composition for anti-inflammatory, and improvement of bone tissue generation or cartilage tissue generation - Google Patents

Abstract

The invention meolkkul (Stauntonia hexaphylla) novel cafe isolated from leaves a phosphate compound, and this active ingredient to the bone or cartilage for tissue production-accelerating, or prevention of bone or cartilage destruction disease such as rheumatoid arthritis, improving or treating a pharmaceutical or on the food composition for the In more detail, the above formula having inhibition of osteoclast differentiation and collagen type II, aggrecan expression and production to promote bone tissue or cartilage tissue production, or to prevent, improve or treat bone tissue or cartilage tissue destruction diseases. It relates to a pharmaceutical or food composition comprising the compound of 1 as an active ingredient.

Description

Novel caffeic acid compound from Stauntonia hexaphyll leaf extract and composition for anti-inflammatory, and improvement of bone tissue generation or cartilage tissue generation}

The invention meolkkul novel caffeic acid compound separated from the leaf extract and it relates to an anti-inflammation, bone tissue or cartilage tissue produced generating composition for promoting comprising as an active ingredient, specifically, dry meolkkul than (Stauntonia hexaphylla ) from the leaves and extracted with a solvent selected from organic solvents, such as water, methanol, ethanol, butanol, and lower alcohols having 1 to 4 carbon atoms, or a mixed solvent thereof, to obtain the fractions and purified again by chromatography and the like It relates to a method for producing a new novel caffeic acid compound and a composition for promoting anti-inflammatory or bone tissue production or cartilage tissue production of the novel caffeic acid compound can be produced by the method.

Bone tissue is generally made of dense bone with a strong surface of the bone, the center or both ends of the long bone (長 骨) is composed of the spongy bone associated with the bone like bone mesh (海綿 骨質). Most bones initially develop as cartilage in connective tissue, which later turns into bone tissue, some of which are made directly from connective tissue. In the epiphysis, the joint surface is in contact with the neighboring bone, and the surface is covered with the articular cartilage, which is a supernatural bone. Sea sponge shochu in the sponge is characterized by a certain arrangement. The wide course of the bony stem is continuous with the small lumen of sponge shochu and all are filled with bone marrow. Hematopoietic bone marrow has a lot of blood vessels distributed in red color, called red bone marrow. In the structure of bone, dense and spongy bones are overlapped with corrugated plates with a thickness of 5 to 12 μm. In dense material, several layers of concentric layers (harbor layer) are arranged in various directions, and in the center of each layer There is a harbor tube and blood vessels go through. Bone cells are arranged between the bone lamina plates and are connected to other bone cells adjacent to each other by a protoplasma that leads to an irregular star shape. On the surface of the bone is a tough connective tissue periosteum, and nerves and blood vessels are distributed to protect and nourish the bone. Defects of the periosteum make it difficult to survive, develop, and regenerate bones. The bone components are 20% moisture, 35% organic matter including cells, 45% minerals, because the constant elasticity of bone is organic. As age increases, minerals (mainly calcium phosphate) increase and bone hardness also increases.

The exact cause and mechanism of chronic inflammation of rheumatoid arthritis is not well known yet, but one of the leading causes of the pathogenesis has been to identify osteoblasts that produce bone and osteoclasts that destroy bone. It is known that it is caused by bone homeostasis due to numerical imbalance of). While osteoclasts in normal state differentiate from monocytes and macrophages to destroy old bones or remove damaged bones, the pattern of osteoclasts found in rheumatoid patients is characterized by an increase in the number of osteoclasts and the sustained growth of osteoclasts. Survival and excessive activity are identified, resulting in a pathological form in which the bone is significantly damaged. Osteoclasts produce a variety of enzymes to break down bone.Tartrate-resistant acid phosphatase (TRAP), which oxidizes and breaks down bone, and matrix metallopeptidase- (MMP-9), which breaks down the cell support tissue of bone and cartilage. 9) Cathepsin K, which breaks down collagen, is known as the main enzyme, which is used as a special marker for mature osteoclasts. When RANKL was treated to macrophages, precursors of osteoclasts, NF-κB and MAPK kinase were activated to produce inflammatory mediators.

Recently, it is known that the progression of the inflammatory response in the body is related to the enzyme activity of cyclooxygenase (COX). The COX enzyme is a major enzyme involved in the biosynthesis of prostaglandin present in vivo (Smith et al., J. Biol. Chem., 271, 33157 (1996)), and two types of isozymes COX-1 and COX -2 is known to exist. The COX-1 is constantly present in tissues such as the stomach and kidneys, and is involved in maintaining normal homeostasis, whereas the COX-2 is involved in mitogen or cytokines during inflammation or other immune responses. Is an enzyme that is transiently and rapidly expressed in cells. Another powerful inflammatory mediator, nitric oxide (NO), is produced from L-arginine by NO synthetase (NOS), and can be produced by many types of substances, such as external stresses such as UV, or substances such as endotoxins or cytokines. Produced in cells. Such inflammatory stimuli can increase the expression of inducible NOS (iNOS) in the cell, thereby inducing NO production in the cell, thereby inducing an inflammatory response by activating macrophages. Therefore, in order to effectively alleviate inflammation, studies on substances capable of inhibiting NO production have been conducted.

However, some side effects are problematic for anti-inflammatory substances developed by these studies. For example, nonsteroidal anti-inflammatory drugs used in the treatment of acute or chronic inflammatory diseases are known to exhibit side effects such as gastrointestinal disorders by inhibiting COX-2 enzyme as well as COX-1 enzyme. In addition, the mechanism of treatment related to gastritis is mainly based on H2-blockers, which block the second histamine receptor (H2 receptor) to reduce the secretion of gastric acid in gastric wall cells. Reduced gastric acid prevents further damage to already damaged gastric parietal cells (such as stomach ulcers). These H2 inhibitors interfere with the metabolism of other drugs in the liver (potent inhibitors of P-450), so they must be used with other drugs and have anti-Androgen effects, resulting in male gynecomastia. ), Side effects such as impotence and decreased libido may occur. In addition, because it passes through the placenta and cerebrovascular barrier, side effects may be more dangerous for pregnant women and the elderly, and may cause headaches, confusion, confusion, and dizziness.

Therefore, it is possible to effectively inhibit the production of NO as a natural material-derived substance, iNOS and anti-inflammatory effect, osteoblasts ALP active TNF-α expression also can be suppressed, it is possible to effectively suppress the activity of a COX-2 enzyme, and In addition to promoting osteoblast differentiation, inhibiting osteoclast differentiation and producing bone or cartilage tissue, the development of a substance derived from natural substances with little or no risk of side effects or cytotoxicity, and thus limiting the amount of its use. It is required.

Honey ( Stauntonia hexaphylla ) is an evergreen vine that grows up to 15 m tall in the southern coastal area, along with wild vines, and grows to white flowers in mid-April to mid-May. Is a hanging plant. The fruit is known as a delicious fruit as its name is derived from the meaning of 'sweet as honey', but the fruit is not commercialized due to the large number of coarse seeds and little flesh. Leaves can be wintered in the southern region, thick flesh, high ornamental value, and is increasingly used for gardening and pergola, and accordingly, seedling production is increasing .

Under this background, The inventor of the present invention, while researching to find a substance having physiological activity from honey, isolated and purified novel flavonoids and caffeic acid compounds, identified through their physicochemical and spectral analysis, anti-inflammatory, bone tissue production or cartilage The present invention was completed by confirming the tissue production promoting activity.

Related prior art is a composition for preventing or treating gout containing caffeic acid phenethyl ester as an active ingredient (Korean Patent Publication No. 10-2016-0047665), a food composition for preventing obesity containing caffeic acid phenethyl ester or A pharmaceutical composition for treating obesity (Korean Patent Publication No. 10-2011-0021252), an antithrombotic agent containing caffeic acid and chlorogenic acid as active ingredients to increase the production of cAMP and cGMP (Korean Patent Publication No. 10-2010- 0079786). [Patent Document 1] Republic of Korea Patent Publication No. 10-2016-0047665 [Patent Document 2] Republic of Korea Patent Publication No. 10-2011-0021252 [Patent Document 3] Korean Patent Publication No. 10-2010-0079786

Under the above background, an object of the present invention is to provide a pharmaceutical composition for promoting the production of anti-inflammatory, bone tissue or cartilage tissue comprising a novel active ingredient derived from natural honey.

Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of diseases that destroy bone tissue or cartilage tissue comprising the novel active ingredient derived from the honey.

It is also an object of the present invention to provide a food composition for promoting the production of anti-inflammatory, bone tissue or cartilage tissue comprising a novel active ingredient derived from the honey.

Still another object of the present invention is to provide a food composition for preventing or ameliorating a disease that destroys bone tissue or cartilage tissue including a novel active ingredient derived from the honey.

As one aspect for achieving the above object, the present invention provides a novel caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt, or solvate isolated from the honey leaf extract.

The compound of Formula 1 is provided for the first time by the present inventors.

The present invention also provides salts of the caffeic acid compound represented by the formula (1), preferably pharmaceutically acceptable salts. The term “pharmaceutically acceptable salts” means salts suitable for use in contact with tissues of humans and lower animals without causing excessive toxicity, irritation, allergic reactions, etc. within the scope of pure medical judgment. Such pharmaceutically acceptable salts are well known in the art. See, eg, S.M. Berge et al., J. Parmaceutical Sciences, 66, 1, 1977. Salts can be prepared in situ during the final separation and purification of the compounds of the invention or separately by reaction with inorganic or organic bases. Suitable base addition salt forms are, for example, alkali salts such as ammonium salts, lithium, sodium, potassium, magnesium, calcium and the like and salts with alkaline earth metal salts, organic bases, for example primary, secondary and tertiary Aliphatic and aromatic amines such as methylamine, ethylamine, propylamine, isopropylamine, four butylamine isomers, dimethylamine, diethylamine, diethanolamine, dipropylamine, diisopropylamine, di-n -Butylamine, pyrrolidine, piperidine, morpholine, trimethylamine, triethylamine, tripropylamine, quinuclidin, pyridine, quinoline and isoquinoline, benzatin, N-methyl-D-glucamine, 2 -Amino-2- (hydroxymethyl) -1,3-propanediol, hydravamin salts, and salts with amino acids such as arginine and lysine.

In addition, the present invention may include a derivative compound such as a glycoside in which a compound such as a sugar is bonded to a hydrate or a side chain of each of the caffeic acid compound represented by Formula 1 above.

Caffeic acid compounds according to the present invention can be isolated from nature or prepared by chemical synthesis of caffeic acid compounds known in the art.

Preferably the caffeic acid compound of the present invention can be isolated and purified from natural plants. That is, it can be obtained from a plant or part of a plant using a method of extracting and separating conventional materials. Preferably, the raw material plants (medicinal herbs) for preparing the caffeic acid compound of the formula (1) of the present invention are honey, which may use the whole plant or a part of the site, and a preferred usable site is a leaf. Such raw plants can be dried and macerated appropriately to obtain the desired extracts or only dried to use a suitable solvent, for example water such as purified water, organic solvents having from 1 to 4 carbon atoms. The organic solvent is, for example, but not limited to, lower alcohol having 1 to 4 carbon atoms such as methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane , Various solvents such as chloroform and petroleum ether may be used alone or in combination. Extraction methods used in the present invention can be used without limitation, all methods commonly used for the extraction of plants or herbal medicine, for example, may be cold extraction, room temperature extraction, hot water extraction, ultrasonic extraction, percolation method or reflux cooling extraction method It is not limited to this. The extraction process may be single, but may be repeated two or more times as necessary.

In addition, the desired extract may be further subjected to a step such as a fraction for the separation of the compound of the formula (1) of the present invention, wherein the fraction solvent used may be used without limitation the extraction solvent. Purification may also be carried out using purification methods known to those skilled in the art. As such purification methods, for example, reverse phase partition chromatography, normal phase adsorption chromatography, ion exchange chromatography, size exclusion chromatography ( size exclusion chromatography) or an additional purification method consisting of one or more combinations thereof may be separated and purified by concentration gradient chromatography, respectively. As the chromatography, column chromatography filled with various synthetic resins such as silica gel or activated alumina, high performance liquid chromatography (HPLC), etc. may be used alone or in combination. However, extraction and separation and purification of the compounds are not necessarily limited to the above-described methods.

In one embodiment of the present invention, the caffeic acid compound of formula 1 according to the present invention was extracted by using water from honey leaves, separated and purified it was prepared.

The caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof suppresses TRAP activity of osteoclasts and inhibits the differentiation of osteoclasts to promote the production of bone tissue, and through the inhibition of inflammatory cytokines. Promotes the production of aggrecan and collagen type II, which are factors related to the production or differentiation of chondrocytes, also promotes the generation of cartilage tissue and has anti-inflammatory effect, thereby promoting bone tissue production and cartilage tissue production. This protects against various diseases that destroy or damage joints or cartilage.

Therefore, as another aspect, the present invention provides a pharmaceutical composition for promoting anti-inflammatory, bone tissue production or cartilage tissue production, comprising a caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate as an active ingredient. It is about.

The caffeic acid compound of the formula (1) as an active ingredient in the composition according to the present invention can be appropriately adjusted according to the use form and purpose, patient condition, type of symptom and the severity, etc. May be 0.0001 to 40% by weight. However, this may be increased or decreased according to the needs of the doser, and may be appropriately increased or decreased depending on various factors such as dietary status, nutritional status, degree of damage of bone tissue or cartilage tissue, and the like, but is not limited thereto.

The composition according to the invention can be administered to a mammal, including humans, by various routes. The mode of administration can be any of the routinely used methods, for example, can be administered orally or parenterally (eg, skin, vein, intramuscular, subcutaneous) and the like, preferably orally. have. The composition of the present invention is a capsule, such as tablets, soft or hard capsules (CAPSULES), granules (GRANULES), pills (PILLS), limonades (LEMONADES), aromatherapy (AROMATIC WATERS), respectively, according to a conventional method. , POWDERS, SYRUPS, DECOCTIONS, INFUSIONS, LIQUIDS AND SOLUTIONS, ELIXIRS, FLUIDEXTRACTS, EMULSIONS, SUSPENSIONS ), Oral dosage forms such as troches, tinctures, and spirits, or transdermals, warning agents, lotions, lintings, ointments (OPHTALMIC OINTMENTS), aerosol (AEROSOLS), ointment (OINTMENTS), emulsion (EMULSIONS), suspension (SUSPESIONS), eye drops (OPHTHALMIC SOLUTIONS), suppository (SUPPOSITIORIES), injection (INJECTIONS), cataplasmas (CATAPLSMA) It may be formulated into a parenteral formulation in the form of a cream (CREAMS), pasta (PASTES) and the like.

The composition of the present invention may further contain an adjuvant such as a pharmaceutically suitable and physiologically acceptable carrier, excipient and diluent in addition to the mixed extract. For example, in the case of an oral preparation, an excipient, a binder, a disintegrant, a lubricant, a solubilizer, a suspending agent, a preservative, an extender, or the like may be formulated.

The dosage of the pharmaceutical composition of the present invention may be determined by a specialist according to various factors such as the patient's condition, age, weight, degree of cartilage damage, disease progression, and the like. In addition, it is intended to contain a daily dose or 1/2, 1/3 or 1/4 dose thereof of the pharmaceutical composition per unit dosage form, and may be administered 1 to 6 times a day.

In another embodiment, the present invention comprises a caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate as an active ingredient, a pharmaceutical composition for the prevention or treatment of diseases that destroy bone tissue or cartilage tissue It is about.

The disease that destroys or damages the bone tissue or cartilage tissue, but is not limited thereto, arthritis, destruction of the joint due to autoimmune diseases, multiple myositis, ankylosing spondylitis, systemic lupus erythematosus, multiple myositis, rheumatoid bundle Myalgia (polymyalgia rheumatica), osteoporosis, bone metastasis cancer or Paget's disease. In addition, the arthritis may include various types of arthritis, such as osteoarthritis, rheumatoid arthritis, degenerative arthritis, psoriatic arthritis, and reactive arthritis, but are not limited thereto. Preferably rheumatoid arthritis. The content of the compound of Formula 1 contained in such a composition, the formulation, the route of administration, the auxiliary, etc. can be applied to the matters of the bone tissue or cartilage tissue creation promoting composition as it is.

As another aspect, the present invention is a disease that promotes the production of bone tissue or cartilage or destroys or damages bone tissue or cartilage tissue, including the caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof. It relates to a food composition for improvement. The food is not limited to, but not limited to, health supplements, health functional foods, functional foods, and the like, natural foods, processed foods, general food materials, etc. Caffeic acid compound of the formula (1), isomers, pharmaceutically acceptable salts thereof Addition of solvates is also included. The food composition of the present invention may be added as it is or used with other food or food compositions, and may be suitably used according to a conventional method. The mixed amount of the active ingredient can be suitably determined according to the purpose of use thereof. In general, the caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof of the present invention is added in an amount of 0.000001 to 50% by weight relative to the total weight of the raw material of the food or beverage in preparing the food or beverage. Can be. An effective dose of the caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof may be used in accordance with the effective dose of the pharmaceutical composition, but may be used to improve or maintain anti-inflammatory, bone or cartilage tissue damage. In the case of prolonged ingestion for this may be below the above range, the active ingredient may be used in an amount above the above range because there is no problem in terms of safety. In addition, the food composition is selected from the group consisting of organic acids, phosphates, antioxidants, lactose casein, dextrin, glucose, sugar and sorbitol, in addition to the caffeic acid compound of formula 1, isomers, pharmaceutically acceptable salts or solvates thereof It may further comprise one or more additives.

There is no particular limitation on the kind of food. A food composition comprising the caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate thereof is for oral administration in the form of a beverage such as tablets, hard or soft capsules, granules, powders, solutions, suspensions, and the like. They may be used in the form of food, and these preparations may be used in the form of an acceptable conventional carrier, for example, for oral preparations, excipients, binders, disintegrants, lubricants, solubilizers, suspending agents, preservatives or extenders, and the like. Can be prepared. Examples of the food to which the caffeic acid compound of Formula 1, an isomer thereof, a pharmaceutically acceptable salt or solvate may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, Dairy products including gums and ice creams, various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, and other nutritional agents, but are not limited to these types of food.

As discussed above, the compounds of the present invention are novel caffeic acid compounds that have been isolated and purified for the first time in nature by the present inventors, and they exhibit excellent anti-inflammatory, bone tissue or cartilage tissue-promoting effects, such as bone tissue or cartilage. It is very useful as a prophylactic, ameliorating or therapeutic agent for various diseases such as rheumatoid arthritis associated with tissue destruction.

1 is a chemical structural formula of Formula 1;
2 is a caffeic acid compound of formula 1 ¹ H-NMR spectrum analysis of the present invention isolated from honey;
3 is a caffeine acid compound ¹³ C-NMR spectrum analysis of the compound of the present invention isolated from honey;
4 is a spectral analysis result of the caffeic acid compound DEPT 135 of Chemical Formula 1 of the present invention isolated from honey;
5 is a result of HOMO COSY spectrum analysis of the caffeic acid compound of Formula 1 of the present invention isolated from honey;
6 is a result of HMQC spectrum analysis of the caffeic acid compound of formula 1 of the present invention isolated from honey;
7 is a result of HMBC spectrum analysis of the caffeic acid compound of Formula 1 of the present invention isolated from honey;
8 is a result of MS spectrum analysis of the caffeic acid compound of Formula 1 of the present invention isolated from honey;
9 is a graph showing the effect on the TRAP activity of osteoclasts of the caffeic acid compound of formula 1 of the present invention isolated from honey;
10 is a graph showing the osteoclast differentiation staining results of the caffeic acid compound of Formula 1 of the present invention isolated from honey;
Figure 11 is a graph showing the effect on collagen type II, aggercan expression on chondrocyte differentiation (generation) of the caffeic acid compound of Formula 1 of the present invention isolated from honey.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Reference Example 1: Analytical Instrument

NMR spectra were recorded on an instrument (Brucker MHz FT-NMR spectrometer) using tetramethylsilane as an internal standard. HRMS was performed on an instrument (UPLC / Quttro Micro spectrometer) and HPLC analysis was performed on an instrument (Agilent) using a UV / VIS detector (G4212B) and a pump (G1311C).

Example  One: Honeybee  Isolation of New Compounds from Extracts

1-1. Extraction and fractionation from honey

The process of extracting 4 kg of leaves from Stauntonia hexaphylla , which was provided by the Jeollanam-do Institute of Natural Resources, with 40 liters of water was repeated twice. The obtained extract was concentrated under reduced pressure to obtain 225 g of the extract, which was suspended in water and sequentially obtained 179 g of the extract in a volume of 1000 ml of n-butanol fraction.

1-2. Purification of the Compound

Silica gel column chromatography (200-400 mesh ASTM, Merck) was performed on 179 g of the n-butanol fraction in the n-hexane fraction, chloroform fraction, ethyl acetate fraction and n-butanol fraction obtained in Example 1. In this case, a mixed solvent of chloroform and methanol was used as the eluent, and the mixing ratio of chloroform and methanol was performed by performing gradient gradient chromatography, in which methanol was gradually increased to 0, 10, 30, 50, 70, and 100%. The obtained fractions (f1-f6) were recovered and concentrated under reduced pressure. As a result, six aliquots of f1 6 g, f2 8 g, f3 7.5 g, f4 7.5 g, f5 7.5 g and f6 8.5 g were obtained, of which Lichoprep RP18 column chromatography was again performed on 7.5 g of f5 aliquot. 10 mg of the compound represented by Chemical Formula 1 was isolated. At this time, the eluent was used in a mixture of methanol and water in a ratio of 1: 3, and concentration gradient chromatography was performed.

1-3. Identification of Compounds of Formula 1

In order to identify the structure of the compound separated and purified in Example 1, IR spectrum, NMR analysis and HRMS mass spectrometry were performed in the following manner.

<1-3-1> Analysis Result of Compound of Chemical Formula 1

Appearance: White crystals (methanol),

Molecular Formula: C ₂₃ H ₂₆ O ₁₁

MP: 285-288 ℃

¹ H and ¹³ C NMR spectra: Table 1

HRMS (30 V, rel. Int.,%): M / z 479 [M] ⁺

As a result, the ¹ H-NMR spectrum showed eight olefinic (δ 6.26, 6.44, 6.72, 6.76, 7.04, 7.38, 7.46, and 7.52) and one anmeric (δ 5.1). Based on the binding constant of the anomeric proton signal of the ¹ H-NMR spectrum, the arrangement of the anomeric positions was determined to be in β form. ^{In the 13} C-NMR spectrum, the chemical shift of one anomeric carbon is indicated at δ 102.9. The β -D-glucose anomeric proton signal is located at the C-15 and C-1 ′ positions by the correlation between the proton signal at δ 5.1 (H-1 ′) and the δ 144.8 (C-15) and carbon signals, respectively. The connection became clear. The analysis results of these data are shown in Table 1.

No. δ _H δ _C HMBC
¹ H → ¹³ C One - 125.4 2 7.46 121.3 C-6 3 - 148.3 C-2 4 - 145.2 5 7.04 115.7 6 7.38 114.7 C-2,5 7 7.52 145.4 8 6.26 113.7 9 - 166.5 10 3.67 69.9 C-11 11 2.64 35.1 C-10 12 - 129.1 13 6.76 116.2 C-14,17 14 6.44 119.4 C-13 15 - 144.8 C-1 ′ 16 - 143.4 C-17 17 6.72 115.3 C-13 Glc-1 ′ 5.1 (brs) 102.9 C-15 Glc-2 ′ - 73.2 - Glc-3 ′ - 73.4 - Glc-4 ′ - 70.1 - Glc-5 ′ - 76.4 - Glc-6 ′ - 63.5 C-5 ′

Based on the above results, the compound of Formula 1 was prepared as 3-hydroxy-4-(((3,4,5,6) -3,4,5-trihydroxy-6- (hydroxymethyl) tetrahydro-2H-pyran-2- It was identified as yl) oxy) phenethyl 3- (3,4-dihydroxyphenyl) acrylate, which was identified as a new caffeic acid compound isolated from nature for the first time.

Example 2 Isolation and Osteoclast Differentiation of Bone Marrow Cells

Tibia were extracted from 4-5 week old ICR mice, and both ends were cut and bone marrow cells were collected by passing through α-MEM essential medium and treated with 50 ng / mL macrophage-colony stimulation factor (M-CSF). Incubated for 24 hours. Unattached cells were washed with α-MEM, and then divided into 48 wells at 5 × 10 ⁵ cells / well and incubated in α-MEM medium to which 50 ng / mL of M-CSF was added for 3 days. Thereafter, 50 ng / mL of MCSF and 100 ng / mL of RANKL (Receptor Activator for Nuclear Factor κB Ligand) were treated together, and the samples were treated by concentration and incubated for 4 days.

Example  3: Honey  From leaf extract Derived  Measurement of TRAP Activity of Osteoclasts by Compounds of Formula 1

Osteoclasts have tartrate-resistant acid phosphatase (TRAP), an acid phosphatase that is characteristically resistant to tartrate, and is used as a cytochemical marker of osteoclasts to distinguish them from other bone tissue cells. (Minkin, C., Calcif. Tissue Int., 34: 285-290, 1982). Therefore, TRAP activity of osteoclasts by the compound of formula 1 derived from the honey leaf extract of the present invention was tested as follows. As described in [Example 2], the cells were seeded at 5 × 10 ⁵ cells / well in the 48-well, and treated with differentiation factors (RANKL, MCSF) and the samples and incubated for 4 days. TRAP activity was measured using a TRAP acivity assay kit (AK04F, COSMO BIO CO., LTD). Specifically, after 4 days of incubation, 30ul / well of the culture supernatant was dispensed into a new 96 plate, and the chromogenic substrate / Tartrate-containing buffer 170ul / well of the prepared kit was added and reacted at 37 ° C. for 30 minutes to 3 hours, and then at 540 nm. Measure the absorbance. TRAP activity expressed the absorbance of the sample as a percentage of the absorbance of the control.

Compounds of Formula 1 obtained in Example 1, respectively, concentration, that is, 0.1, 1, 10, and 100ug / ml of the compound of Formula 1 derived from the honey leaf extract each treated with osteoclasts, and cultured for 4 days and then the osteoclasts The effect on TRAP activity (TRAP activity means acidic phosphatase activity that is resistant to tartrate) was measured and the results are shown graphically in FIG. 9. From Figure 9 it was confirmed that the compound of formula 1 of the present invention has an inhibitory activity of osteoclasts depending on the concentration (0.1, 1, 10, and 100ug / ml), respectively.

Example  4: Honey  From leaf extract Derived  Inhibiting osteoclast differentiation by the compound of formula 1

As described in Example 2, the cells were inoculated to 5 × 10 ⁵ cells / well in 48-well and treated with differentiation factors (RANKL, MCSF) and the compound of Formula 1 of the present invention for 4 days. Remove the medium and wash with PBS, and then dissolve 100 μL of substrate solution (1.36 mg / mL 4-nitrophenyl phosphate disodium salt, 10 mM tartrate, 50 mM citrate buffer pH 4.6) in a cell fixed with 10% formaldehyde. The reaction was carried out for a minute. Then, the medium was removed, washed with PBS, and the cells were fixed for 15 minutes with 10% formaldehyde. The cells were washed three times with PBS. TRAP staining was performed by adding 1 mg / mL naphtol AS-MX phosphate and 100 μL of N, N-dimethylformamide to 10 mL of 50 mM sodium acetate buffer containing 50 mM tartrate acid, and then staining the cells with 10% formaldehyde. 45 μL of the staining solution was dispensed and stained at 37 ° C. for 30 minutes and observed under a microscope. The results are shown in FIG. 10.

As can be seen in Figure 10, TRAP positive multinuclear osteoclasts were formed in the control cells, but in the experimental group treated with the compound of formula 1 derived from the honey leaf extract of the present invention concentration (0.1, 1, 10, and 100ug /, respectively) ml) It can be seen that the differentiation of osteoclasts was suppressed dependently. From the above results, it was confirmed that the compound of formula 1 of the present invention has a concentration-dependent inhibition of the differentiation of osteoclasts.

Example  5: Honey  From leaf extract Derived  Chondrocyte Differentiation (Generation) by Compound of Formula 1 Biomarkers Agrecan ( aggercan ), Collagen type II mRNA  Expression (production) measurement

High density culture was used to obtain chondrocyte primary cells. Specifically, 1cm above and below the knee of 5 days old rats are cut and the knee cartilage is stored in a 50ml conical tube containing 1X PBS (containing 20% P / S). After washing 3 times with 1X PBS (containing 20% P / S) for 15 minutes at room temperature, add 400 ml of 1% Collagenase D (or H), Trypsin 400, and 1.2 ml of serum free media (DMEM F-12) at 37 ° C. Incubate with stirring for 1 hour. After the incubation time, washed three times with 1X PBS (containing 20% P / S) at room temperature, and then excised only the cartilage and put it in a new 50ml conical tube, which was then prepared into collagenase 600 ul, media (10% FBS, 1% P / S) ) 1.4 ml was added and stirred at 37 ° C. for 6 hours. After incubation, the strain was filtered through a mesh, and seeded in a 12 well micro plate so that the number of cells was 1.5 (or 2.0) X 10 and incubated at 37 ° C. for 24 hours. After 24 hours of incubation, the medium was replaced with Media (10% FBS, 1% P / S) and incubated for 24 hours at 37 ° C. After 24 hours of incubation, mix DMEM F-12 media (10% FBS, 1% P / S) and DMEM F-12 media (10% ITS, 1% P / S) in a 1: 1 ratio to exchange media. Incubate at 37 ° C. for 24 hours. After 24 hours, replace with DMEM F-12 media (10% ITS, 1% P / S) and incubate at 37 ° C. for 24 hours. After 24 hours of incubation, serum free media (DMEM F-12) was replaced and incubated at 37 ° C for 24 hours. After 24 hours of incubation, 100 ng / ml of BMP-2 or BMP-7, 10 ng / ml of IL-1β, and 50 ug / ml of the compound of Formula 1 according to the present invention were treated and incubated at 37 ° C. for 24 hours. RNA was isolated from each cell after 24 h incubation. Isolation of the RNA was carried out in the following manner. Specifically, the cultured cells are lysed with GIT solution (easy BLUE Total RNA extraction kit, Intron Biotechnology Co., Ltd.), centrifuged at 10,000 rpm at room temperature for 5 minutes, and then the supernatant is removed and pelleted. (pellet) was obtained. 1 ml of 0.1% DEPC solution (Sigma) was added to the pellet, followed by centrifugation at 12,000 rpm for 2 minutes to remove the supernatant, and then pellets were obtained. 0.5 ml of guanidinium was added to the obtained pellets, followed by vortexing. Further, 0.5 ml of a phenol / chloroform / iso-amylalchol mixed solution (25: 24: 1) was added, vortexed, and centrifuged at 12,000 rpm for 3 minutes to obtain a supernatant. The supernatant and the same amount of isopropyl alcohol (iso-propylalcol) was added and mixed well, and left to stand at -20 ° C for 30 minutes. Thereafter, the supernatant was removed by centrifugation at 12,000 rpm for 10 minutes, and then the pellet was washed with 70% aqueous ethanol solution and dried under vacuum to separate RNA. The isolated RNA was dissolved in 1 ml of 0.1% DEPC solution and used to measure mRNA contents of collagen II (agolcan) and aggrecan, which are chondrocyte markers, and GAPDH as a house keeping gene. Used. The mRNA content of collagen II (Col II) and agrecan (aggrecan), which are the chondrocyte biomarkers, was measured by the following method. Superscript II reverse transcriptase (Invitrogen, USA) was added to 3 μg of the isolated RNA, incubated at 42 ° C. for 1 hour and 45 minutes, and then incubated at 70 ° C. for 15 minutes to obtain cDNA. The obtained cDNA was quantified by real-time PCR. The sequence and experimental conditions of the primer for performing the real-time PCR are described in Table 2 below.

Target mRNA Primer sequence Annealing Tm (℃) Col ii sense TGGCATCGACATGTCAGCCTTTGC 60 anti-sense TGCAGAAGACTTTCATGGCGTCCA Aggrecan sense ACAGTGAGCTCAGGCTTGCCTGTA 62 anti-sense GTGACATCCTCTACACCTGAAGCA GAPDH sense TGGTGCTGAGTATGTCGTGGAGTC 60 anti-sense AGACAACCTGGTCCTCAGTGTAGC

The real-time PCR results are shown in FIG. 11 as a result of photographing by comparing with the GAPDH content.

As shown in FIG. 11, the negative control group treated with IL-1β (10 ng / ml) was expressed in the amount of mRNA expressed by collagen II (Col II) and agrecan, which are biomarkers related to chondrocytes. It was confirmed that a significant decrease compared to the normal group not treated with -1β. On the other hand, in the positive control group treated with BMP-2 (100 ng / ml), mRNA expression levels of collagen II and agrecan, which are biomarkers related to chondrocytes, were treated with IL-1β. It was confirmed that significantly increased than the normal group did not. In the experimental group treated with a compound of Formula 1 at a concentration of 50 ug / ml, mRNA expression of collagen II (Col II) and agrecan, which are biomarkers related to chondrocytes, was increased compared to the normal group. It was confirmed that. This is because the compound of formula 1 according to the present invention expresses type II collagen (Col II) and sulfated proteoglycan (aggrecan), which is a major component of extracellular matrix (ECM), which is important for the production (synthesis) of chondrocytes. It is confirmed that the synthesis of) is promoted.

<110> Yung jin pharm. co., ltd.          Jeonnam bioindustry foundation <120> Novel caffeic acid compound from Stauntonia hexaphyll leaf          extract and composition for anti-inflammatory, and improvement of          bone tissue generation or cartilage tissue generation <130> DPP20165146KR <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Col II sense primer <400> 1 tggcatcgac atgtcagcct ttgc 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Col II antisense primer <400> 2 tgcagaagac tttcatggcg tcca 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Aggrecan sense primer <400> 3 acagtgagct caggcttgcc tgta 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Aggrecan antisense primer <400> 4 gtgacatcct ctacacctga agca 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH sense primer <400> 5 tggtgctgag tatgtcgtgg agtc 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH antisense primer <400> 6 agacaacctg gtcctcagtg tagc 24

Claims (20)

3-hydroxy-4-(((3,4,5,6) -3,4,5-trihydroxy-6- (hydroxymethyl) of formula 1, isolated from Stauntonia hexaphylla leaf extract ) Tetrahydro-2H-pyran-2-yl) oxy) phenethyl 3- (3,4-dihydroxyphenyl) acrylate compound, a pharmaceutically acceptable salt, or solvate thereof:

[Formula 1]

A pharmaceutical composition for anti-salt, comprising a compound of formula 1 according to claim 1, a pharmaceutically acceptable salt or solvate thereof. delete Arthritis, disruptive diseases of the joints caused by autoimmune diseases, multiple myositis, ankylosing spondylitis, systemic lupus erythematosus, comprising the compound of formula 1 according to claim 1, a pharmaceutically acceptable salt or solvate thereof A pharmaceutical composition for preventing or treating any one disease selected from the group consisting of polymyalitis, polymyalgia rheumatica, osteoporosis, bone metastasis cancer and Paget's disease. delete The pharmaceutical composition of claim 4, wherein the arthritis is any one selected from the group consisting of osteoarthritis, rheumatoid arthritis, degenerative arthritis, psoriatic arthritis, and reactive arthritis. The pharmaceutical composition according to claim 4, wherein the compound of Formula 1, a pharmaceutically acceptable salt or solvate thereof is included at 0.000001 to 50% by weight based on the total weight of the composition. The composition of claim 4, wherein the composition comprises PLASTERS, GRANULES, LOTION, LPINIS, LINIMENTS, LIMONADES, AROMATIC WATERS, and POWDERS. ), SYRUPS, OPHTALMIC OINTMENTS, LIQUIDS AND SOLUTIONS, AEROSOLS, EXTRACTS, ELIXIRS, OINTMENTS, FLUIDEXTRACTS , EMULSIONS, SUSPENSIONS, DECOCTIONS, INFUSIONS, OPHTHALMIC SOLUTIONS, TABLETS, Suppositories (SUPPOSITIORIES), INJECTIONS, SPIRITS, CATATARS Any one selected from the group consisting of plasma (CATAPLSMA), capsules (CAPSULES), creams (CREAMS), troches, tinctures (TINCTURES), pastas (PASTES), pills (PILLS) and transdermal agents Having a formulation. delete A food composition for anti-salt, comprising a compound of formula 1 according to claim 1, a pharmaceutically acceptable salt or solvate thereof. delete Arthritis, disruptive diseases of the joints caused by autoimmune diseases, multiple myositis, ankylosing spondylitis, systemic lupus erythematosus, comprising the compound of formula 1 according to claim 1, a pharmaceutically acceptable salt or solvate thereof Food composition for the prevention or amelioration of any one disease selected from the group consisting of polymyalitis, polymyalgia rheumatica, osteoporosis, bone metastasis cancer and Paget's disease. delete The food composition of claim 12, wherein the arthritis is any one selected from the group consisting of osteoarthritis, rheumatoid arthritis, degenerative arthritis, psoriatic arthritis, and reactive arthritis. The food composition of claim 12, wherein the compound of Formula 1, a pharmaceutically acceptable salt or solvate thereof is included in an amount of 0.000001 to 50% by weight based on the total weight of the composition. The food composition of claim 12, further comprising one or more additives selected from the group consisting of organic acids, phosphates, antioxidants, lactose casein, dextrins, glucose, sugars and sorbitol. The food composition of claim 12, wherein the composition is a functional food, dietary supplement or dietary supplement. The food composition of claim 12, wherein the composition is in the form of a tablet, hard or soft capsule, granule, powder or beverage. delete delete

Images