KR20180054018A - Glyphosate specific DNA aptamer and Uses Thereof - Google Patents

Abstract

The present invention relates to a glyphosate-specific binding aptamer and a use thereof. The DNA aptamer of the present invention specifically binds to a glyphosate compound which is a herbicide component. The DNA aptamer can be used for detection of glyphosate and can also be applied in various industrial fields as an aptamer capable of being removed and collected.

Description

Glyphosate specific binding aptamers and their uses {Glyphosate specific DNA aptamer and Uses Thereof}

The present invention relates to glyphosate-specific binding aptamers and uses thereof.

Glyphosate is one of the aminophosphonate-type non-selective germination herbicides and has been widely used in the United States and other countries since its development in 1970 in Monsanto. This is because competitive phosphoenolpyruvate binds to the substrate of the 5-enolpyruvylshikimate-3-phosphate (EPSP) enzyme that is not present in mammals, including humans, It acts as an inhibitor and inhibits the synthesis of aromatic amino acids such as tyrosine, tryptophan, and phenylalanine synthesized in plants, thereby inhibiting plant metabolism.

In addition, when spraying medicine, contact area is not obstructed by metabolism but absorbed into all plants including leaves, stems and roots, and inhibits metabolism and growth of whole plant. Since glyphosate is not an optional herbicide, all plants including crops are killed, but when recombinant EPSP enzyme gene which shows glyphosate resistance in crops has an enzyme that can not work even if glyphosate penetrates, The amino acid synthesis is normal and can survive without any abnormality in metabolism.

Glyphosate is a herbicide that has little toxicity to mammals, and as mentioned above, can be effectively used to kill plants and is widely used. Especially, the climate is changed all over the world and herbicides are being used in large quantities due to the transfer of plants other than crops and other rapid growth and propagation. However, large amounts of glyphosate remain in soil and soil runoff and groundwater, causing environmental pollution. Glyphosate and its intermediate metabolite, aminomethylphosphonic acid (AMPA), are highly adsorbed on the soil and can remain in the soil or water environment because of the very slow photodegradation, making them harmful to microorganisms and plants in the environment. . Furthermore, it can affect the animals and ecosystems inhabiting the environment.

Recent studies have also shown that mammals, including humans, can be adversely affected. Studies have found that glyphosate has been detected in the air, water, crops, and agricultural workers' blood and urine in the sprayed area, and in the breast milk of pregnant women. This shows the possibility of absorption of glyphosate into the body, and it is possible that long-term ingestion or exposure to various cancers such as blood cancer, or DNA and chromosome aberration, autism, liver and kidney toxicity, pneumonia and long term ingestion of glyphosate Which may cause birth defects and miscarriages. In March 2015, the World Health Organization (WHO) classified glyphosate as a carcinogen.

Although there are such influences, systematic management methods such as use restriction and residual standard for glyphosate have not been established in many countries including Korea. Therefore, there is a need for new material development and environmental monitoring technology for managing glyphosate by measuring residual level and contamination of soil environment and glyphosate in water environment.

Conventional glyphosate detection methods include analytical instruments such as HPLC or experiments requiring expertise such as ELISA or Western Blot. HPLC is performed by adding water and chloroform to the sample, centrifuging after high-speed grinding and extracting a part of the aqueous supernatant, concentrating it under reduced pressure, and purifying it using strongly acidic cation-exchange chromatography. The eluate is concentrated under reduced pressure and reacted with 9-fluorenylmethyl chloroformate (FMOCl) in borate buffer to produce a fluorescent derivative, which is analyzed by HPLC / FLD. The conventional detection method can not confirm the presence of glyphosate on the spot because it is easy to use because it is easy to use in the field. It has a disadvantage that the test method according to the sample is not enough and troublesome to prepare each test solution, There is a disadvantage that loss of sate is a concern.

Korean Patent Registration No. 10-1050421 Korean Patent Registration No. 10-1569442

In order to solve and secure the above problems of the glyphosate detection technique, the inventors of the present invention have found that a diagnostic material capable of quickly and easily detecting glyphosate can be produced by using an aptamer material stable in environment such as temperature and pH And completed the present invention.

Accordingly, an object of the present invention is to provide a DNA aptamer that specifically binds to glyphosate, which comprises any one of the nucleotide sequences of SEQ ID NOS: 1 to 8.

It is also an object of the present invention to provide a composition for detecting, recovering or removing glyphosate comprising the DNA aptamer.

It is another object of the present invention to provide a kit for detecting or removing glyphosate comprising the DNA aptamer.

It is another object of the present invention to provide a substrate on which at least one DNA aptamer among DNA aptamers having polynucleotides of SEQ ID NOS: 1 to 8 is immobilized.

It is another object of the present invention to provide a column system in which a glyphosate-linked DNA aptamer having any one selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 8 specifically binding to glyphosate is immobilized .

It is also an object of the present invention to provide a method for the detection of glyphosate, comprising the steps of: (a) contacting a sample suspected of containing glyphosate with the DNA aptamer of claim 1; And (b) determining whether the glyphosate and the DNA aptamer are bound to each other, and a method for detecting glyphosate.

Also, an object of the present invention is to provide a method for preparing a glyphosate-DNA aptamer comprising: (a) contacting a sample suspected of containing glyphosate with the DNA aptamer of claim 1 to form a complex of glyphosate and DNA aptamer; And (b) removing the complex. The present invention also provides a method for removing glyphosate.

(B) selecting the ssDNA using the asymmetric PCR technique for the amplified DNA library; (c) selecting the ssDNA using the asymmetric PCR technique; (c) Preparing a sensor chip; And (d) separating the DNA aptamer binding to the glyphosate through SELEX (Systemic Evolution of Ligand by Exponential Enrichment) technique using the sensor chip. And to provide a method of manufacturing a tamer.

In order to achieve the above object, the present invention provides a DNA aptamer that specifically binds to glyphosate, which comprises any one of the nucleotide sequences of SEQ ID NOS: 1 to 8.

In one embodiment of the present invention, the DNA aptamer may further comprise a labeling substance.

In one embodiment of the present invention, the labeling substance is a labeling substance selected from the group consisting of a fluorescent substance, biotin, streptavidin, an amine group, biotin and a thiol group, 3 ' terminal.

In one embodiment of the present invention, the DNA aptamer is selected from the group consisting of a hydrogen atom, fluorine atom, -OR, -COOR, and amino group in the hydroxy group of the ribose 2 'position of one or more nucleotides constituting the DNA aptamer One can be substituted.

The present invention also provides a composition for detecting, recovering or removing glyphosate comprising the DNA aptamer.

The present invention also provides a kit for detecting or removing glyphosate comprising the DNA aptamer.

The present invention also provides a substrate on which at least one DNA aptamer among the DNA aptamers having the polynucleotides of SEQ ID NOS: 1 to 8 is immobilized.

In an embodiment of the present invention, the substrate may be a microtiter plate, a bead, a membrane, or a chip.

Also, the present invention provides a column system in which a glyphosate-linked DNA aptamer having any one selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 8 specifically binding to glyphosate is immobilized do.

The present invention also relates to a method for screening a glycoprotein comprising: (a) contacting a sample suspected of containing glyphosate with the DNA aptamer of claim 1; And (b) determining whether the glyphosate and the DNA aptamer are bound to each other.

(A) contacting a sample suspected of containing glyphosate with the DNA aptamer of claim 1 to form a complex of glyphosate and DNA aptamer; And (b) removing the complex. ≪ Desc / Clms Page number 5 >

The present invention also provides a method of amplifying a DNA library comprising the steps of: (a) generating a DNA library through PCR amplification; (b) selecting ssDNA using the asymmetric PCR technique; (c) preparing a sensor chip to which the glyphosate is immobilized; And (d) separating the DNA aptamer binding to the glyphosate through SELEX (Systemic Evolution of Ligand by Exponential Enrichment) technique using the sensor chip. A method of manufacturing a tamer is provided.

The DNA aptamer of the present invention has a property of specifically binding to a compound glyphosate as a herbicide component. The DNA aptamer of the present invention can be utilized in the detection of glyphosate and further can be removed and recovered.

FIG. 1 is a schematic diagram showing a SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process for selecting a glyphosate-specific aptamer.
FIG. 2 is a photograph of the result of electrophoresis in a single-stranded DNA aptamer production process. The dsDNA and ssDNA obtained during the fabrication process were developed on 12% PAGE gel, stained with ethidium bromide (EtBr) and observed under UV.
Lane M: 100 bp DNA ladder (elpis).
Lane 1: PCR products
Lane 2: PCR purified product
Lane 3: Asymmetric PCR products
Lane 4: ssDNA secured by streptavidin treatment, PCI treatment and ethanol precipitation
FIG. 3 is a bar graph showing recovery values of DNA recovered per round after a total of 9 SELEX rounds measured using a microspectrophotometer. During the round after the negative selection, rounds with a high rate of recovery of the app tamer were indicated by star figures.
Figure 4 is a representation of an Aptamer-antibody sandwich ELISA technique. A biotinylated aptamer was immobilized on a plate coated with streptavidin. Chicken extract glyphosate target antibody bound to the glyphosate bound thereto, and the rabbit-extracted chicken target antibody bound thereto. (TMB, Biolegend, US), a substrate of HRP (horseradish peroxidase) attached to the secondary antibody, reacts to color, indicating a color reaction after addition of sulfuric acid as a stop solution.
FIG. 5 shows the result of predicting the three-dimensional structure of the aptamer using the DNA mfold program provided by the Rensselear polytechnic institute.
FIG. 6 is a bar graph showing the quantitation of coloration of eight aptamers exhibiting high color through the aptamer-antibody sandwich ELISA technique among a total of 32 types of aptamer candidates. As a comparative example, an aptamer immobilized on a substrate was treated with chicken extract glyphosate target antibody and rabbit-extracted chicken target antibody.
FIG. 7 is a bar graph showing the affinity between the glyphosate and the comparative subject obtained by the SPR technique.
FIG. 8 shows affinity of Gly 8, which is a final glyphosate-specific binding aptamer, and glyphosate concentration as a dissociation constant by using SPR technique, and is shown by a bar graph.

DNA aptamers that specifically bind to glyphosate molecules

The present invention relates to a DNA oligonucleotide that specifically binds to a glyphosate molecule.

The term "DNA aptamer" as used herein refers to a DNA nucleic acid molecule capable of binding with high affinity and specificity to a specific molecule. In the present specification, "DNA aptamer" is used in combination with "DNA oligonucleotide".

The term "oligonucleotide" as used herein generally refers to a nucleotide polymer having less than about 200 lengths, including DNA and RNA, preferably DNA nucleotide molecules. The nucleotide can be any substrate that can be introduced into the polymer by deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or by DNA or RNA polymerases or by synthetic reactions. If a modification to the nucleotide structure is present, such modification may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be terminated by a non-nucleotide component. The oligonucleotides can be further modified after synthesis, for example by binding with a label.

The DNA aptamers of the present invention are typically obtained by in vitro selection for binding of the target molecule. Methods for selecting an aptamer that specifically binds to a target molecule are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on a cell surface, ions, metals, salts, polysaccharides can be suitable target molecules for separating aptamers that can specifically bind to each ligand . Selection of the aptamer can utilize in vivo or in vitro selection techniques known by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al. , Science 249, 505-10, 1990). Specific methods for screening and manufacturing the aptamer are described in U.S. Patent 5,582,981, WO 00/20040, U.S. Patent 5,270,163, Lorsch and Szostak, Biochemistry, 33: 973 (1994), Mannironi et al., Biochemistry 36: 9726 Blind, Proc. Natl. Acad. Sci. USA 96: 3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34: 656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 and U.S. Patent 5,756,291, Are incorporated herein by reference.

The DNA aptamer specifically binding to the glyphosate of the present invention is preferably an oligonucleotide having a nucleotide sequence as set forth in any one of Sequence Listing Nos. 1 to 8. On the other hand, the DNA aptamers of the first to eighth sequences of the present invention are presumed to form the secondary structure shown in Fig. 5 herein.

In addition, the DNA aptamer specifically binding to the glyphosate molecule of the present invention has substantially the same identity with the nucleotide sequence of any one of SEQ ID NOS: 1 to 8 while retaining the property of binding to the glyphosate molecule But also oligonucleotides having the nucleotide sequences shown therein.

The above-mentioned substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and using an algorithm commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2: 482 Hewgins and Sharp, Gene 73: 237-44 (1988), pp. 243-47 (1988); Hewlett-Packard et al. ; Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc Acids Res. 16: 10881-90 (1988); Huang et al., Comp. (At least 90 identical, more preferably at least 95 identical, more preferably at least 95 identical, , And most preferably at least 98 nucleotides in length.

Glyphosate and  Specifically binding AppTamer  Utilized Glyphosate  detection

The present invention provides compositions and methods for glyphosate detection based on DNA aptamers that specifically bind to glyphosate molecules. The glyphosate detection of the present invention is based on a method for detecting a complex of a DNA aptamer that specifically binds to a glyphosate molecule. To facilitate detection of the complex, a DNA aptamer that specifically binds to the glyphosate molecule of the present invention may be conjugated to a fluorophore such as fulorescein Cy3 or Cy5, a radioactive material or a chemical, A nucleotide labeled with biotin or modified with a primary amine.

The DNA aptamer that specifically binds to the glyphosate molecule of the present invention can detect glyphosate using, for example, a microarray including a substrate on which a DNA aptamer is immobilized. As used herein, the term microarray refers to an array in which dielectric material is attached at a high density to a particular region of the substrate. As used herein, the term "substrate" of a microarray refers to a support having suitable rigid or semi-rigid properties, such as glass, slides, filters, chips, wafers, fibers, tacky beads or non-magnetic beads, membranes, plates, polymers, microparticles, and capillaries. The DNA aptamers of the present invention are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, DNA oligonucleotides can be attached to glass surfaces modified to include epoxy compounds or aldehyde groups, and can also be bound by UV on polylysine coating surfaces. In addition, the DNA oligonucleotide may be bound to the substrate through an ethylene glycol oligomer and a diamine.

In the present invention, the composition for detecting glyphosate may be provided in the form of a kit. In the present invention, the kit comprises the base sequence disclosed in any one of SEQ ID NOS: 1-8, or a DNA oligonucleotide having a base sequence having 90% or more identity with this sequence as an active ingredient. The kit in the present invention may further include a manual or label for using the glyphosate molecule detection kit in the sample.

Glyphosate  Molecule-specific binding AppTamer  Utilized Glyphosate  Detection and removal

Glyphosate detection and analysis in a sample can provide useful information for detection for glyphosate monitoring in soil and groundwater environments.

Therefore, by confirming the qualitative and quantitative determination of glyphosate from a sample using a DNA aptamer that specifically binds to a glyphosate molecule, it is possible to detect a glyphosate residual value abnormality or to check the pollution scale of prognostic soil and groundwater environment have.

In addition, the present invention relates to a method for detecting glyphosate molecules by binding a glyphosate molecule with a DNA aptamer that specifically binds to a glyphosate molecule of the present invention from an environmental sample to provide information necessary for glyphosate detection diagnosis, Is detected. The term "environmental sample" may include soil release water, groundwater, and the like.

The present invention also relates to a method for preparing a complex of glyphosate and DNA aptamer by contacting a sample suspected of containing glyphosate with a DNA aptamer prepared by the method of the present invention to form a complex of glyphosate and DNA aptamer, The present invention provides a method for efficiently removing glyphosate molecules remaining in a water environment.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1>

DNA Of app tamer  making

<1-1> DNA random library with arbitrary nucleotide sequence

100 bp template DNA (5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-I) containing 40 consecutive random nucleotides (dA: dG: dC: dT = 1.5: 1.15: 1.25: 1) for the production of glyphosate- AGATAGTA AGTGCAATCT-3 '; SEQ ID NO: 9) and three primers capable of amplifying it by 100 bp were prepared from bionan (forward primer: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3' Reverse primer: 5'-AGATTGCACTTACTATCT-3 '(Sequence Listing 11 sequence), biotinylated reverse primer: 5'-biotin-AGATTGCACTTACTATCT-3' (Sequence Listing 12 sequence). In the above, N40 means 40 consecutive random nucleotides.

<1-2> PCR  DNA using the technique Aptamer  Pool amplification and purification

The 100 bp DNA library having an arbitrary sequence of 40 bp was amplified using the PCR technique. The PCR reaction composition for amplification was 1 μl of template DNA, 5 μl of 10 × PCR buffer, 4 μl of each 2.5 mM dNTP mixture, 2 μl of 25 μM forward primer, 2 μl of 25 μM biotinylated reverse primer, 5 μl of Ex Taq polymerase Takara, Japan), and 35.75 μl of distilled water.

The PCR reaction conditions were denaturation at 95 ° C for 5 minutes, reaction at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds, 12 cycles at 15 ° C, followed by extension at 72 ° C for 5 minutes Respectively. After the PCR reaction, 4 μl was taken and 2% agarose gel electrophoresis was performed to confirm whether the band appeared at 100 bp. The DNA library obtained by PCR was purified using a PCR purification kit (Qiagen, USA) and recovered using 50 μl of distilled water.

The recovered aptamer was used as a template for asymmetric PCR. Asymmetric PCR was performed using 1 μl of template DNA, 10 μl of 10 × PCR buffer, 8 μl of each 2.5 mM dNTP mixture, 10 μl of 25 μM forward primer, 2 μl of biotinylated reverse primer, 0.5 μl (1 unit / μl) of Ex Taq polymerase (Takara, Japan) and 68.5 μl of distilled water. The PCR reaction conditions were denaturation at 95 ° C for 5 minutes, 15 cycles of reaction at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes .

<1-3> Utilizing heating-cooling techniques ssDNA  making

50 μl of distilled water was added to 50 μl of the DNA library recovered using the PCR technique and the PCR purification kit, and the volume was adjusted to 100 μl. Then, dsDNA was denatured with ssDNA using a heating-cooling technique ). Specifically, the dsDNA obtained using the PCR technique and the PCR purification kit was reacted for 85 minutes at 85 ° C. to denature the dsDNA with ssDNA, and immediately after completion of the reaction, the reaction solution was cooled to 4 to secure the ssDNA .

<1-4> ssDNA Screening and recovery

In order to remove biotin-bound ssDNA and primer from the ssDNA product obtained using the heating-cooling technique and to ensure pure ssDNA only in the forward direction, 100 μl of reaction solution (Streptavidin agarose resin, Thermo Scientific, USA) was added to the wells and reacted at room temperature for 1 hour. The reaction solution was centrifuged (4 ° C, 13,000 rpm) for 10 minutes, and then only the supernatant was recovered and treated with the same volume of PCI (phenol: chloroform: isoamylalcohol = 25: 24: 1) 4 ° C, 13,000 rpm) to collect only the supernatant. To the supernatant, 1/100 volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added and reacted at -70 ° C for 4 hours or more. After the reaction, only ssDNA was recovered by centrifugation (4 ° C, 13,000 rpm) for 30 minutes. The recovered ssDNA was dried at 65 ° C and dissolved in 50 μl of distilled water. The concentration of the recovered ssDNA was confirmed by Nano Drop.

10 μl of double stranded DNA and single strand DNA aptamer obtained through PCR, purification, asymmetric PCR, etc. of Examples <1-2>, <1-3> and <1-4> The progress was observed through polyacrylamide gel electrophoresis (PAGE) (see FIG. 2).

< Example  2>

SELEX  Technique Glyphosate  Specific binding DNA Aptamer  Selection

<2-1> SELEX The composition of each solution used in

The name and composition of each solution used in SELEX for selective aptamer binding to glyphosate are as follows.

Carboxyl group active buffer solution of glyphosate: 10 mM HEPES buffer solution

Aptamer structure preparation solution: 2 X TBS buffer (300 mM NaCl, 100 mM Tris-HCl, pH 7.9)

Bead washing solution: 1 X TBS buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5)

DNA aptamer elution solution: 1 X TE buffer (10 mM Tris, 1 mM EDTA, pH 7.5)

<2-2> SELEX DNA to be used for Aptamer  Structure Production

100 μl of the aptamer structure-forming solution was added to ssDNA (32450 ng / 100 μl) prepared through the above Example <1-4>, the total reaction volume was adjusted to 200 μl, followed by denaturation by boiling at 85 ° C for 5 minutes , And slowly cooled at room temperature to form a stable three-dimensional structure of ssDNA aptamer.

<2-3> Glyphosate  Specific binding DNA Aptamer  For screening Glyphosate  Combined latex (Latex) Bead  Production and SELEX  Method Glyphosate  Specific binding DNA Of app tamer  Selection

For the production of glyphosate-conjugated latex beads, the carboxyl group of glyphosate (Sigma Co., hereinafter all glyphosate) and the amine of fluorescent latex beads (Sigma Co.) whose surface was modified with an amine group Covalent bonds of amine groups were used. To form covalent bonds between the two reactors, 50 μl of 0.01 mg / ml glyphosate and 50 μl of latex beads were added to 100 μl of the carboxyl group-active buffer solution, and reacted for 1 hour. The latex beads bound to glyphosate were recovered by centrifugation (4 ° C, 13,000 rpm) for 15 minutes, mixed with the ssDNA aptamer paste obtained in Example <2-2>, and reacted at room temperature for 4 hours or more. Then, the supernatant was removed by centrifugation (4 ° C, 13,000 rpm) for 15 minutes to remove the aptamer not bound to glyphosate.

Then, washing with 200 μl of washing solution was repeated 3 times to remove ssDNA aptamer having weak binding force with glyphosate. To elute the DNA aptamer attached to the bead-bound glyphosate, 200 μl of the DNA aptamer elution solution was added and heated at 85 ° C for 5 minutes. After heating, the mixture was vortexed and vortexed for 15 minutes at 4 ° C rpm) to obtain an eluting solution of the upper layer except for the beads. The above procedure was repeated one more time to obtain the eluting solution of the upper layer.

To remove impurities such as glyphosate and beads in the supernatant, the same volume of PCI solution as the eluting solution was treated and only the supernatant was recovered by centrifugation (4 ° C, 13,000 rpm) for 15 minutes. Then, the recovered supernatant was mixed with 1/100 volume of tRNA and 3 volumes of 100% ethanol, and the mixture was reacted at -70 ° C. for 2 hours or longer. The reaction solution was centrifuged (4 ° C., 13,000 rpm) for 30 minutes. Thus, only DNA aptamers that specifically bind glyphosate molecules were recovered. The recovered DNA aptamer was dried at 65 ° C and ethanol was evaporated and dissolved in 50 μl of distilled water.

<2-4> Nonspecific DNA Aptamer  For removal Negative  Negative selection

Negative selection was performed between 6 times and 7 times of SELEX for the removal of nonspecific DNA aptamer bound to non-glyphosate latex beads. After the DNA aptamer solution was bound with only latex beads without glyphosate molecular binding, an aptamer upper layer solution not bound with beads was recovered. Then, SELEX was recovered to a total of 9 times . The binding conditions of SELEX were to obtain an aptamer that more specifically binds to the target molecule glyphosate by increasing the stringency of the reaction conditions as the number of times is increased.

< Example  3>

Glyphosate and  Specific binding DNA Aptamer  For screening SELEX  Round selection

<3-1> Nano drop ( Nano  Drop) to confirm the affinity of each round

After 9 rounds of SELEX, the concentration of ssDNA eluted in each round was measured using Nano drop (Micro spectrophotometer) to confirm the progress of SELEX and the affinity of ssDNA aptamer recovered in each round, Recovery rate versus addition amount. The concentration of ssDNA aptamer recovered in each round was measured by nano-drop and the result was shown as recovery rate. As a result, it was confirmed that the recovery rate of 8 rounds was the highest at 47.6 after negative selection. As a result, after the negative screening round, it was found that the optimal aptamer pool that most specifically binds to glyphosate molecules was an 8 round pool (see FIG. 3).

<3-2> Real time PCR  Optimal Round Identification Using Technique

After completion of the SELEX 10 times, real-time PCR was performed to quantitatively confirm the progress of SELEX and the affinity of DNA aptamer recovered in each round.

First, the ssDNA aptamers eluted in the 7th, 8th, and 9th rounds after the initial DNA library and negative selection were amplified by PCR, and ssDNA was secured using the heat-cooling technique. 3 &gt;.

Each of the obtained ssDNAs was diluted to 10 &lt; ⁰ &gt; and 10 &lt;&quot; ¹ &gt; Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad, USA). The real-time PCR conditions were 95 ° C for 20 sec, 55 ° C for 20 sec, and 72 ° C for 20 min. The reaction was repeated for 40 cycles, followed by extension at 72 ° C for 5 minutes. Real-time PCR results could be obtained the results from the experiments with the samples diluted to 10 ^-1 to the template DNA.

Real-time PCR Ct values were 11.82, 3.63, and 8.63 in the 7th, 8th and 9th rounds, respectively, and the 8th round Ct value was the lowest. It was confirmed that 8 rounds of ssDNA aptamers were full of a higher concentration of aptamer than 7th and 9th rounds and confirmed that SELEX was no longer necessary. It was also confirmed that the recovery rate of the aptamer recovered in each round was confirmed by using nano drop. From the results of nano-drop and real-time PCR, it was confirmed that the 8-round aptamer pool has the highest binding efficiency with glyphosate molecules.

< Example  4>

Glyphosate  DNA and specific binding DNA Aptamer  Secure candidate

<4-1> T-vector Cloning  through Glyphosate  Specific binding Aptamer  Securing candidate sequence

5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3 '(SEQ ID NO: 10) and reverse primer: 5'-GGTAATACGACTCACTATAGGGAGATACCAGATTATTCAATT-3' (SEQ ID NO: 10) and 8 'primers for 8 rounds of ssDNA aptamer pool which were judged to have the highest affinity for glyphosate through nano- -AGATTGCACTTACTATCT-3 &apos; (SEQ ID NO: 11) to obtain dsDNA.

The dsDNA thus obtained was cloned using a T-blunt cloning kit (SolGent, Korea). For cloning, 1 μl of T-vector (10 ng / μl), 4 μl of PCR product (20 ng / μl) and 1 μl of 6 × T-blunt buffer were mixed and reacted at 25 ° C for 5 minutes. 6 μl of the T-blunt cloning reaction mixture was mixed with 100 μl of DH5α, heat shocked at 42 ° C for 30 seconds, and reacted on ice for 2 minutes.

SOC (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 20 mM MgCl ₂ , 20 mM glucose) was added to 900 μl of the medium and incubated at 37 ° C for 40 minutes. Then, 200 μl of the culture was taken and cultured in LB containing ampicillin (50 μg / ml), kanamycin (50 μg / ml), X-gal (50 μg / ml) and IPTG After spreading on a LB plate and culturing for more than 16 hours at 37 ° C, only the white colonies were selected to obtain the nucleotide sequence of each colony (Solgent, Korea). Through sequence analysis, glyphosate 32 kinds of glyphosate-linked DNA aptamers having high affinity with molecules could be obtained.

<4-2> Aptamer - Antibody sandwich ELISA Glyphosate  Specific binding end Aptamer  Selection

The Aptamer-antibody sandwich ELISA method was used to detect the best binding aptamer among 32 candidate aptamer candidates obtained through T-vector cloning.

Antitrypsate polyclonal antibodies extracted from streptavidin-coated plates (clear, 96-well, Thermo SCIENTIFIC, USA) and primary antibody chickens were used for the Aptamer-antibody sandwich ELISA And HRP modified anti-chicken IgG polyclonal antibody (Acris, USA) extracted from rabbit secondary antibody were ordered.

First, for the streptavidin activity of the plate, 100 μl of the washing solution was added to the plate, the reaction was carried out for 15 minutes on the orbital shaker, and then the plate was removed two more times. To fix the aptamer, 100 μl of each aptamer (10000 ng / 100 μl) was added to the plate and reacted. The washing procedure was repeated three times, and 100 μl of glyphosate was added The reaction was repeated three times. After the addition of 100 μl of the primary antibody and the secondary antibody, the reaction and washing were carried out three times. Next, 100 μl of a secondary antibody substrate, Tetramethylbenzidine (TMB, Biolegend, US) was added, and the reaction was stopped by adding 1 N sulfuric acid.

To wash the plate, 100 μl of a washing solution containing 0.05% Tween in 1 X TBS buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5) was added and stirred for 15 minutes in an orbital shaker. All reactions except washing and TMB reaction and observation after addition of sulfuric acid were stirred for 1 hour in an orbital shaker.

In order to quantitatively express the color, Plate was inserted into SpectraMax M2 (Molecule Devices), and the numbers were expressed. There were 8 kinds of aptamers in which 32 kinds of aptamers had a relatively high color development reaction.

Table 1 below shows the sequence of 8 glyphosate-linked DNA aptamer candidates obtained using the glyphosate-specific DNA aptamer selection SELEX technique.

number Clone
designation SEQ ID NO: Selected sequence order
size
(bp) One Gly1 SEQ ID NO: 1 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTCGGTAATACTAGTTGGTCTTTCCCCGTTCCATTCTGTGGAGATAGTAAGTGCAATCT 100 4 Gly2 SEQ ID NO: 2 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTCGGATGCGGGTAATTGAATTAGTACGGTTTGCCTCTTGTGAGATAGTAAGTGCAATCT 100 22 Gly3 SEQ ID NO: 3 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTGCTTGTAAAGTCGTCTCCCAGTGACGCCGTAGTCTTTCGAGATAGTAAGTGCAATCT 100 29 Gly4 SEQ ID NO: 4 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTGCCAACAATCTGTAAGCTCGTGAAGGTTTGCTAATATCCGAGATAGTAAGTGCAATCT 100 34 Gly5 SEQ ID NO: 5 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTCGGATGCGGGTAATTGAATTAGTGCGGTTTGCCCCTTGTGAGATAGTAAGTGCAATCT 100 37 Gly6 SEQ ID NO: 6 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTGGAATGACCTGGATTGACCCGTGAGTGTAGCATTTGTCCGAGATAGTAAGTGCAATCT 100 39 Gly7 SEQ ID NO: 7 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACGACTAACGTCGCTCCGGGTACTTCTCCATCGAGATAGTAAGTGCAATCT 100 41 Gly8 SEQ ID NO: 8 GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTCTTCTAGTAATTGGACTCTGCAGTAGAGCTGTCTAGGTGGAGATAGTAAGTGCAATCT 100

< Example  5>

Glyphosate  Molecular-binding DNA Aptamer  Decision of candidate groups

The structure of the glyphosate specific binding DNA aptamer final candidate group was based on a DNA mfold program (Rensselear polytechnic institute), which provides a three-dimensional structural model based on the aptamer sequence. The model with the lowest ΔG value among the proposed models was selected as the structure of the candidate group (see FIG. 5).

< Example  6>

SPR through Of app tamer  Affinity and selectivity evaluation

<6-1> Glyphosate and  Combine Aptamer  Eight affinity and selectivity evaluation

Surface plasmon resonance (SPR) technique was used to quantify the final affinity of eight selected glyphosate-specific binding DNA aptamers. The SPR device used was BIAcore 3000 (GE healthcare, UK) and a sensor chip SA (GE Healthcare, UK) coated with streptavidin was used. The glyphosate-specific binding final aptamer was prepared in the form of single-stranded DNA in the form of 5-terminal attachment of biotin. Each sample was prepared in a concentration of 200 ng / μl in 1 × TBS buffer. Glyphosate and the glyphosate intermediate metabolites aminomethylphosphonic acid (AMPA) and glycine (Glycine) were used, and each aqueous solution was prepared at 0.5 mM.

Aptamer prepared for immobilization of the aptamer using streptavidin immobilized on the sensor chip SA and biotin at the 5-terminal of the aptamer was incubated for 6 minutes at 10 μl / min in one of the two channels of the sensor chip Regeneration buffer solution (1 M sodium chloride, 50 mM sodium hydroxide, 50% isopropanol) was flowed into the two channels at a rate of 10 μl / min for 5 minutes to observe the disappearance of the aptamer.

As a result, it was confirmed that the aptamer was fixed at 900 RU or more on the chip. In order to measure affinity between glyphosate and glyphosate and selectivity of glyphosate, a glyphosate aqueous solution, an aqueous solution of aminomethylphosphonic acid and an aqueous solution of glycine were added to both the aptamer-immobilized and non-fixed two channels, And the RU value was measured by flowing at a rate of / / min for 7 minutes. The above experiments were conducted for the final candidate groups of eight aptamers, and the results were analyzed by BIAevolution software.

As a result of the analysis, we obtained the dissociation constant (Kd, a numerical value of the affinity between the aptamer and the glyphosate and the comparator) (see Table 2), and the glyphosate and affinity The highest aptamer was found to be Gly8 (see FIG. 7).

<6-2> Glyphosate  Specific binding Of app tamer By concentration  Affinity measurement

In order to measure the glyphosate concentration of Gly8 obtained by the above experiment, the aptamer was fixed to the sensor chip SA in the same manner as in Example <6-1>, and the aptamer of 1200 RU or more was fixed.

Then, glyphosate was prepared at a concentration of 0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, and 10 ppm on the HBS-EP buffer solution at a rate of 10 μl / min on the chip. The results obtained through the experiments were analyzed by BIAevolution software. As a result, the affinity was measured from the glyphosate concentration of 0.005 ppm (see FIG. 8).

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Chungbuk National University Industry Academic Cooperation Foundation <120> Glyphosate specific DNA aptamer and Uses Thereof <130> PN1610-357 <160> 12 <170> KoPatentin 3.0 <210> 1 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly1 <400> 1 ggtaatacga ctcactatag ggagatacca gcttattcaa tttcggtaat actagttggt 60 ctttccccgt tccattctgt ggagatagta agtgcaatct 100 <210> 2 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly2 <400> 2 ggtaatacga ctcactatag ggagatacca gcttattcaa ttcggatgcg ggtaattgaa 60 ttagtacggt ttgcctcttg tgagatagta agtgcaatct 100 <210> 3 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly3 <400> 3 ggtaatacga ctcactatag ggagatacca gcttattcaa tttgcttgta aagtcgtctc 60 ccagtgacgc cgtagtcttt cgagatagta agtgcaatct 100 <210> 4 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly4 <400> 4 ggtaatacga ctcactatag ggagatacca gcttattcaa ttgccaacaa tctgtaagct 60 cgtgaaggtt tgctaatatc cgagatagta agtgcaatct 100 <210> 5 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly5 <400> 5 ggtaatacga ctcactatag ggagatacca gcttattcaa ttcggatgcg ggtaattgaa 60 ttagtgcggt ttgccccttg tgagatagta agtgcaatct 100 <210> 6 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly6 <400> 6 ggtaatacga ctcactatag ggagatacca gcttattcaa ttggaatgac ctggattgac 60 ccgtgagtgt agcatttgtc cgagatagta agtgcaatct 100 <210> 7 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly7 <400> 7 ggtaatacga ctcactatag ggagatacca gcttattcaa ttttacagaa cgactaacgt 60 cgctccgggt acttctccat cgagatagta agtgcaatct 100 <210> 8 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer Gly8 <400> 8 ggtaatacga ctcactatag ggagatacca gcttattcaa ttcttctagt aattggactc 60 tgcagtagag ctgtctaggt ggagatagta agtgcaatct 100 <210> 9 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> template DNA <400> 9 ggtaatacga ctcactatag ggagatacca gcttattcaa ttnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnagatagta agtgcaatct 100 <210> 10 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 10 ggtaatacga ctcactatag ggagatacca gcttattcaa tt 42 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 11 agattgcact tactatct 18 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer_bitinylated <400> 12 agattgcact tactatct 18

Claims (12)

A DNA aptamer that specifically binds to glyphosate, comprising any one of the nucleotide sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 8. The method according to claim 1,
Wherein the DNA aptamer further comprises a labeling substance. 3. The method of claim 2,
Wherein the labeling substance is labeled at the 5'end or 3'end of the DNA aptamer, wherein the labeling substance is selected from the group consisting of a fluorescent substance, biotin, streptavidin, an amine group, biotin and a thiol group The DNA aptamer. The method according to claim 1,
Wherein the DNA aptamer is a DNA aptamer wherein the hydroxy group at the 2 'position of the ribosome of the at least one nucleotide constituting the DNA aptamer is substituted with any one selected from the group consisting of a hydrogen atom, a fluorine atom, -OR, -COOR and an amino group Tamer. A composition for the detection, recovery or removal of glyphosate comprising the DNA aptamer of claim 1. A kit for detecting or removing glyphosate comprising the DNA aptamer of claim 1. Wherein at least one DNA aptamer among DNA aptamers having polynucleotides represented by SEQ ID NOS: 1 to 8 is immobilized. 8. The method of claim 7,
Wherein the substrate is a microtiter plate, a bead, a membrane, or a chip. A column system in which a glyphosate-linked DNA aptamer having any one selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 8 specifically binding to glyphosate is immobilized. (a) contacting a sample suspected of containing glyphosate with the DNA aptamer of claim 1; And
(b) determining whether glyphosate is bound to a DNA aptamer. (a) contacting a sample suspected of containing glyphosate with the DNA aptamer of claim 1 to form a complex of glyphosate and DNA aptamer; And
(b) removing the complex. (a) generating a DNA library through PCR amplification;
(b) selecting ssDNA using the asymmetric PCR technique for the amplified DNA library;
(c) preparing a sensor chip to which the glyphosate is immobilized; And
(d) isolating a DNA aptamer that binds to glyphosate through a SELEX (Systemic Evolution of Ligand by Exponential Enrichment) technique using the sensor chip, wherein the DNA aptamer specifically binding to glyphosate &Lt; / RTI &gt;

Images