KR20180044706A - Method for preparing corn silk fermentation product enhanced gamma-aminobutyric acid contents - Google Patents

Abstract

Provided is a method for producing fermented corn silk, including a step of producing the fermented corn silk by inoculating a microorganism belonging to the genus Lactobacillus into a corn silk extract and then fermenting the same thereafter. According to the method for producing the fermented corn silk, it is possible to produce the fermented corn silk having high content of gamma-aminobutyric acid (GABA) by inoculating Lactobacillus plantarum LAB459 to the corn silk extract and culturing the same.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for preparing a corn steep fermented product containing a large amount of GABA,

The present invention relates to a method for producing a fermented product of corn bean containing a large amount of gamma-aminobutyric acid (GABA) using specific lactic acid bacteria.

Gamma-aminobutyric acid (GABA) is an inhibitory neurotransmitter that is involved in neurotransmission in the central nervous system of the human body. It suppresses the increase of blood pressure, has the effect of improving the visual acuity and calms the anxiety and nervousness. .

In addition, GABA is widely distributed in animal brain, heart, lung, and kidney. It is reported that GABA concentration in the brain and blood is low in modern people, examinees and alcohol-consuming people suffering from stress, Seizures, convulsions, and epilepsy.

As described above, since the functionality of GABA is widely known, there is a growing interest in a method for ingesting GABA as a drug as well as a functional food material.

However, the above-mentioned GABA is contained in brown rice, green tea, malt, cabbage and the like, but its content is low and it is difficult to expect the effect of increasing the physiological activity to the human body by only ingesting the natural product itself containing it. Technological development of methods is needed.

Korean Patent Laid-Open No. 10-2011-0128259 (published on November 11, 2011) Korean Patent Publication No. 10-2014-0020470 (Publication date: 2014.02.19) Korean Patent Publication No. 10-2014-0051543 (published on 2014.05.02) Korean Patent Publication No. 10-2008-0045320 (published on May 23, 2008)

The inventors of the present invention have found that when fermenting a corn steep liquor with lactic acid bacteria having excellent β-glucosidase activity, it is possible to produce a fermented corn steep liquor having an increased GABA content I found the fact.

Accordingly, it is an object of the present invention to provide a technique for producing a fermented corn steep liquor containing a large amount of GABA, which is a physiologically active substance, by fermenting corn musth extract with a specific lactic acid bacterium.

To achieve these and other advantages and in accordance with the purpose of the present invention, as embodied and broadly described herein, there is provided a method for preparing a fermented corn steep lacquer, comprising the step of inoculating a microorganism belonging to the genus Lactobacillus into a corn steep liquor, to provide.

The microorganism belonging to the genus Lactobacillus is Lactobacillus plantarum LAB459 containing 16s rRNA represented by SEQ ID NO: 1.

Further, the LAB459 is inoculated into the corn beard extract and then cultured for 36 to 72 hours.

The corn steep liquor fermented product prepared by inoculating Lactobacillus plantarum LAB459 is characterized by containing gamma-aminobutyric acid at a concentration of 900 to 1000 ppm / mL.

The present invention also provides a functional food selected from the group consisting of tea, jelly, gum, candy, and beverages comprising the fermented corn steep state product prepared using the above-described method.

According to the method for preparing the fermented corn steep liquor according to the present invention, the fermented corn steep liquor having a high gamma-aminobutyric acid content can be prepared by inoculating and culturing the LAB459 with LAB459.

The fermented corn steep liquor prepared as described above has a high content of GABA, and thus can be used for the production of functional foods such as tea, jelly, gum, candy or beverage.

FIG. 1 shows results of hydrolysis of Escherichia coli for isolating lactic acid bacteria strains according to the examples.
2 is a systematic diagram showing the results of the phylogenetic analysis of the lactic acid bacteria strain according to the embodiment.
Figure 3 shows the detection peaks of 358 (a) GABA standard peaks (280 nm) and (b) GABA produced in the fermentation to detect the GABA produced in the corn steep fermented product prepared by the method according to the example nm).
FIG. 4 is a TLC analysis result for the qualitative analysis of GABA produced in the corn steep liquor fermented by the method according to the example.

Hereinafter, the present invention will be described in detail.

The present invention provides a method for producing a fermented corn steep lacquer comprising the step of inoculating a microorganism belonging to the genus Lactobacillus into a corn bean extract, followed by fermentation to produce a corn steep ferment.

The corn beard extract may be prepared by a conventional method such as hot water extraction or ethanol extraction, and preferably, a corn steep hot water extract prepared using a hot water extraction method may be used. You can use unrestricted common corn beets or dried corn beets without restriction.

For example, the hot water extraction is performed by adding 2 wt% of the corn beard to water heated to 90 DEG C or higher and heating the corn steep liquor for 30 to 120 minutes or longer to prepare a corn steep liquor hot water extract, A corn steep hot-water extract may be used.

The microorganism belonging to the genus Lactobacillus may be Lactobacillus plantarum LAB459 containing 16s rRNA represented by SEQ ID NO: 1 below.

[SEQ ID NO: 1]

gggggggtaacgtgtcggattattgggcgtaagcgagcgcaggcggttttttaagtctgat 60

gtgaaagccttcggctcaaccgaagaagtgcatcggaaactgggaaacttgagtgcagaa 120

gaggacagtggaactccatgtgtagcggtgaaatgcgtagatatatggaagaacaccagt 180

ggcgaaggcggctgtctggtctgtaactgacgctgaggctcgaaagtatgggtagcaaac 240

aggattagataccctggtagtccataccgtaaacgatgaatgctaagtgttggagggttt 300

ccgcccttcagtgctgcagctaacgcattaagcattccgcctggggagtacggccgcaag 360

gctgaaactcaaaggaattgacgggggcccgcacaagcggtggagcatgtggtttaattc 420

gaagctacgcgaagaaccttaccaggtcttgacatactatgcaaatctaagagattagac 480

gttcccttcggggacatggatacaggtggtgcatggttgtcgtcagctcgtgtcgtgaga 540

tgttgggttaagtcccgcaacgagcgcaacccttattatcagttgccagcattaagttgg 600

gcactctggtgagactgccggtgacaaaccggaggaaggtggggatgacgtcaaatcatc 660

atgccccttatgacctgggctacacacgtgctacaatggatggtacaacgagttgcgaac 720

tcgcgagagtaagctaatctcttaaagccattctcagttcggattgtaggctgcaactcg 780

cctacatgaagtcggaatcgctagtaatcgcggatcagcatgccgcgggtgaatacgttc 840

ccgggccttgtacacaccgcccgtcacaccatgagagtttgtaacacccaaagtcggtgg 900

ggtaaccttttaggaaccagccgcctaaggtgggacagatgattagggtgaagtcgtaca 960

ggggggaaccccttaaaatgttttttttttta    992

The Lactobacillus plantarum LAB459 is obtained by purely isolating a strain of a lactic acid bacterium cultured in a lactic acid bacteria culture medium such as Lactobacilli MRS broth or MRS agar by a conventional method to prepare esculin Glucosidase activity of the strain may be high.

In the present invention, a microorganism belonging to the genus Lactobacillus may be inoculated into a corn steep liquor and then fermented to produce a corn steep liquor having a high content of GABA.

For example, when Lactobacillus plantarum LAB459 is used as a microorganism belonging to the genus Lactobacillus , the Lactobacillus plantarum LAB459 is inoculated into the cornstarch extract, and then incubated at a temperature of 30 to 40 DEG C for 36 to 120 hours Fermentation can be used to produce corn steep fermented products.

When the fermentation time is less than 36 hours, there may be a problem that the amount of GABA is lowered, and when the fermentation time exceeds 120 hours, the number of lactic acid bacteria is decreased. Preferably 48 to 72 hours, to produce a fermented corn steep state containing a large amount of GABA.

In particular, 2% by weight of corn beard is added to water heated to 90 DEG C or more, and the mixture is heated for 30 to 120 minutes or more. The corn steep liquor is inoculated with the LAB459 strain at 37 DEG C for 72 hours , The fermented product of corn steep liquor containing GABA at a concentration of 900 to 1000 ppm / mL has a characteristic that the content of GABA is remarkably improved.

In addition, in the present invention, the fermented corn steep liquor prepared as described above can be concentrated by a method such as concentration under reduced pressure to produce a fermented corn steep liquor which has a lower moisture content, while further increasing the content of GABA, Any method of enrichment of the fermentation product can be used without limitation.

According to the method for preparing the fermented corn steep liquor according to the present invention as described above, the fermented corn steep liquor having a high content of gamma-aminobutyric acid can be prepared by inoculating and culturing the LAB459 with LAB459.

The present invention also provides a functional food selected from the group consisting of tea, jelly, gum, candy, and beverages comprising the fermented corn steep state product prepared using the above-described method.

The functional food may be in the form of tea, jelly, gum, candy, beverage, vitamin complex, etc. in the form of powders, granules, tablets, capsules and the like, but is not limited thereto. The functional food may exhibit various physiological activities due to GABA contained in a large amount of corn steep liquor fermented product, exhibits inhibitory neurotransmitter function, and exhibits various physiological activities such as inhibition of blood pressure increase, visual acuity enhancement, sedation and the like.

At this time, the functional food may contain the fermented corn steep liquor at a concentration of 0.1 mg / mL to 10 mg / mL or a concentration of 0.1 mg / g to 10 mg / g, and the fermented corn steep liquor may contain 0.1 mg / mL or less than 0.1 mg / g, it is difficult to expect the effect of GABA on the physiological activity due to the low content of GABA, and when the concentration exceeds 10 mg / mL or 10 mg / g, So that it can be configured to be included in the range described above.

The functional food may be prepared by mixing the fermented corn steep liquor with at least one selected from the group consisting of carbohydrates, nutrients, vitamins, minerals, flavors, colorants, enhancers, pectic acids, alginic acid, citric acid, sodium citrate, organic acids, thickeners, pH adjusters, stabilizers, , A carbonating agent, and the like may be further mixed to prepare tea, jelly, gum, candy, beverage, vitamin complex, and the like.

Specifically, natural flavors such as tau martin and stevia extract can be used as the flavor, and synthetic flavors such as saccharin and aspartame can be used. Examples of the carbohydrate include saccharides such as glucose, fructose, maltose, sucrose, dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.

The above components may be blended according to the purpose of formulation or use, and the amount thereof may be included within a range that does not impair the objects and effects of the present invention.

Hereinafter, the present invention will be described in more detail with reference to examples.

The embodiments presented are only a concrete example of the present invention and are not intended to limit the scope of the present invention.

<Examples>

(1) Preparation of hot water extract of corn beard

2% (w / v) of corn beard was added to hot water at 100 ° C and reacted in a high pressure sterilizer for 1 hour to prepare hot water extract of corn beard. The prepared hot-water extract solution was passed through a filter paper, subjected to primary filtration, secondary filtered with a syringe filter having a pore size of 0.45 μm, and secondary filtrate was sterilized to prepare a corn hog hydrothermal extract.

(2) Isolation and identification of lactic acid bacteria

In order to isolate the lactic acid bacteria, Lactobacillus MRS broth or MRS agar prepared by adding 0.05% L-cysteine to the MRS agar was inoculated with the lactic acid bacteria and incubated at 37 ° C for 24 hours Lt; / RTI &gt; under anaerobic conditions.

In addition, 25 g of the fermented food sample was mixed with 225 mL of 0.1% peptone water, homogenized using a stomacher, decalcified by decalculation, and spread on MRS agar. And cultured for 72 hours. The morphologically different colonies were selected from the colonies formed through the cultivation, picked up and inoculated in the MRS agar, and the pure strains were isolated by culturing the selected lactic acid bacteria.

Four strains (0082, 0088, 0101 and 0459) isolated from each other were inoculated into esculin agar in order to confirm the activity of the β-glucosidase of the strain. Thereafter, the lactic acid bacterial strain (459) having the best ability to hydrolyze esculin and discolor the medium to dark brown was isolated as a strain producing β-glucosidase (see FIG. 1).

The isolated β-glucosidase-producing strains were cultured in MRS medium, centrifuged in 1 mL of the culture, and rinsed with 0.8% sterile physiological saline. The DNA of β-glucosidase-producing strains was isolated using a genomic DNA kit and the 16s rRNA sequence analysis of each of the strains isolated using the extracted DNA as the template DNA for PCR Respectively.

For 16s rRNA sequencing, PCR was performed using 785F (GGATTAGATACCCTGGTA) and 907R (CCGTCAATTCMTTTRAGTTT) universal primers for bacterial 16s rRNA, and amplification products were confirmed by electrophoresis after PCR And purified using a QIAquick PCR purification kit.

The 16S rRNA sequencing of β-glucosidase-producing strains was performed using a Dye Terminator Cycle Sequencing Ready Reaction Kit and an ABI 3700 sequencer. The same primers as in PCR were used As a result, it can be confirmed that it has the 16S rRNA of the base sequence shown in SEQ ID NO: 1 below.

[SEQ ID NO: 1]

gggggggtaacgtgtcggattattgggcgtaagcgagcgcaggcggttttttaagtctgat 60

gtgaaagccttcggctcaaccgaagaagtgcatcggaaactgggaaacttgagtgcagaa 120

gaggacagtggaactccatgtgtagcggtgaaatgcgtagatatatggaagaacaccagt 180

ggcgaaggcggctgtctggtctgtaactgacgctgaggctcgaaagtatgggtagcaaac 240

aggattagataccctggtagtccataccgtaaacgatgaatgctaagtgttggagggttt 300

ccgcccttcagtgctgcagctaacgcattaagcattccgcctggggagtacggccgcaag 360

gctgaaactcaaaggaattgacgggggcccgcacaagcggtggagcatgtggtttaattc 420

gaagctacgcgaagaaccttaccaggtcttgacatactatgcaaatctaagagattagac 480

gttcccttcggggacatggatacaggtggtgcatggttgtcgtcagctcgtgtcgtgaga 540

tgttgggttaagtcccgcaacgagcgcaacccttattatcagttgccagcattaagttgg 600

gcactctggtgagactgccggtgacaaaccggaggaaggtggggatgacgtcaaatcatc 660

atgccccttatgacctgggctacacacgtgctacaatggatggtacaacgagttgcgaac 720

tcgcgagagtaagctaatctcttaaagccattctcagttcggattgtaggctgcaactcg 780

cctacatgaagtcggaatcgctagtaatcgcggatcagcatgccgcgggtgaatacgttc 840

ccgggccttgtacacaccgcccgtcacaccatgagagtttgtaacacccaaagtcggtgg 900

ggtaaccttttaggaaccagccgcctaaggtgggacagatgattagggtgaagtcgtaca 960

ggggggaaccccttaaaatgttttttttttta 992

In addition, the analysis of homologous sequences of 16S rRNA sequences was performed using the BLAST search program (BLAST) of the National Center for Biotechnology Information (NCBI) The results are shown in Table 1 below.

In addition, phylogenetic analysis (Clustal X, BioEdit, MEGA 4) of the 16S rRNA sequence of β-glucosidase producing strain (LAB459) confirmed the genetic distance and phylogenetic tree between the nucleotide sequences, Is shown in Fig.

As described above, the strain was named LAB459 ( Lactobacillus plantarum LAB459) through the 16S rRNA nucleotide sequence, homology and phylogenetic analysis results of the strain producing β-glucosidase.

(3) Preparation of fermented corn beard

The culture of the isolated LAB459 strain was centrifuged, and the precipitate was washed with sterilized water. The washed strain was taken, 5 volume% of skim milk, 3 volume% of monosodium glutamate, and the remaining corn steep liquor hydrothermal extract And cultured at 37 ° C for 12 to 72 hours, respectively, to prepare a fermentation broth of corn steep liquor over time.

The prepared corn steep fermentation broth was taken and centrifuged at a speed of 8,000 rpm for 10 minutes to obtain a supernatant. The resulting supernatant was filtered and sterilized by a syringe filter to prepare a corn steep fermented product.

<Experimental Example> Analysis of GABA production ability of isolated strains

(1) HPLC analysis

In order to analyze GABA production ability of LAB459 strain, high performance liquid chromatography (HPLC) was performed under HPLC conditions as shown below. The results are shown in FIG. 3, and as shown in Table 2 Mobile phase A and mobile phase B were developed.

[HPLC conditions]

Column: Agilent HC-C18 (2) reverse phase Column

Column temperature: 40 캜

Flow rate: 1.5 mL / min

HPLC detection Wave length: 358 nm

Injection volume: 10 μL

Mobile phase - A: Mixture containing 40 mM sodium phosphate dibasic and 0.1% phosphoric acid

Mobile phase - B: Mixture containing acetonitrile, methanol and water in a volume ratio of 45: 45: 10

In order to detect the GABA produced in the corn steep liquor fermentation of Fig. 3 (a), the fermentation using the LAB459 strain was compared with the peak of the GABA standard (280 nm) detected at a wavelength of 280 nm, As a result of the detection of GABA, as shown in FIG. 3 (b), the peak of GABA was confirmed in the fermented corn steep so that GABA was produced in the fermented corn steep.

(2) TLC analysis (qualitative analysis)

In order to analyze the ability of LAB459 to produce GABA, each of the fermented corn steep liquor prepared by fermentation for 12 to 72 hours was divided into thin-layer chromatography (TLC) plate, ), Acetic acid and distilled water at a volume ratio of 4: 1: 1 were developed as a developing solvent. To the TLC plate in which the fermentation broth of the corn steep liquor was developed, 0.2% of ninhydrin (ninhydrin) to induce the color-development reaction, and the GABA spot produced and the spot of the glutamic acid as the substrate were identified. The result was shown in FIG. 4, which shows the ability of the strain producing β-glucosidase to be isolated. For reference, the TLC analysis of FIG. 4 shows GABA spots and glutamate spots of each of the corn beets prepared by fermentation for 12, 18, 24, 30, 36, 42, 48, 54, 60, 66 and 72 hours.

As shown in FIG. 4, the isolated LAB459 strain showed a gradual increase in the content of GABA from the fermentation time of 48 hours or more, and when the fermentation was conducted for 72 hours, the GABA spot became more dense and the content of GABA was remarkably increased .

(3) Gabase analysis (quantitative analysis)

The content of GABA contained in the fermented corn steep liquor fermented for 72 hours was quantitatively analyzed by Gabase analysis using the enzyme reaction of gabase and GABA.

As a result, it was confirmed that the content of GABA contained in the corn steep liquor fermented by fermentation for 72 hours was contained at a concentration of 992 ppm / mL. As a result, it was confirmed that the corn steep liquor hydrothermal extract When the fermentation was carried out, it was confirmed that a fermented product of corn bean having a remarkably high GABA content could be produced.

Claims (5)

A method for producing a fermented corn steep lacquer comprising the step of inoculating a microorganism belonging to the genus Lactobacillus into a corn musth extract, followed by fermentation to prepare a fermented corn steep liquor. The method according to claim 1,
Wherein the microorganism belonging to the genus Lactobacillus is Lactobacillus plantarum LAB459 comprising 16s rRNA represented by SEQ ID NO: 1. 3. The method of claim 2,
Wherein the lactobacillus plantarum LAB459 is inoculated to the corn beard extract and then cultured for 36 to 72 hours. The method according to claim 1,
Wherein the fermented corn steep lobate prepared by inoculating the lactobacillus plantarum LAB459 contains gamma-aminobutyric acid at a concentration of 900 to 1000 ppm / mL. A functional food selected from the group consisting of tea, jelly, gum, candies and beverages comprising corn steep fermented product prepared using the method of any one of claims 1 to 4.

Images