KR20180033112A - Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them - Google Patents
Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them Download PDFInfo
- Publication number
- KR20180033112A KR20180033112A KR1020170137449A KR20170137449A KR20180033112A KR 20180033112 A KR20180033112 A KR 20180033112A KR 1020170137449 A KR1020170137449 A KR 1020170137449A KR 20170137449 A KR20170137449 A KR 20170137449A KR 20180033112 A KR20180033112 A KR 20180033112A
- Authority
- KR
- South Korea
- Prior art keywords
- probe
- region
- vancomycin
- resistant
- detecting
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
- C12Q2565/10—Detection mode being characterised by the assay principle
- C12Q2565/125—Electrophoretic separation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
약물 내성 그람 양성 병원균 검출용 프로브, 프로브 세트 및 이를 이용한 약물 내성 그람 양성 병원균 검출 방법에 관한 것이다. It relates to a probe for detecting drug-resistant Gram-positive pathogens, a probe set, and a method for detecting drug-resistant Gram-positive pathogens using the same.
패혈증(sepsis)은 중환자실 사망의 1위를 차지하는 질환으로, 미국 통계에 따르면 매년 75만 명이 발병하고, 그중 21만 명이 사망하는 한 해 사망 원인 중 10위 (전체 사망자의 6%)에 해당하는 질환이다. 1970년대 초반과 비교하여 현재의 발병률은 3배가 증가하였고 매년 1.5%씩 증가하는 추세에 있다. 앞으로도 인구의 노령화에 따른 고위험 처치의 증가 및 치료 사용의 증가 등에 따라 2020년에는 패혈증으로 인한 사망자가 연간 110만 명에 이르게 될 것으로 예상되고 있다. 우리나라는 패혈증에 의한 연간 사망자 수가 8,000여 명에 이르며, 2008년을 기준으로 계속된 증가 추세에 있다. Sepsis is a disease that accounts for the
그람 양성 병원균(Gram-positive bacteria)은 패혈증의 가장 일반적으로 원인이 되는 유기체이다. 주요 약물 내성 그람 양성 병원균에는 Staphylococcus aureus, Enterococcus faecium, Streptococcus pneumoniae 등이 존재하며, 상기 균중에 약물에 내성을 가진 Methicillin-resistant Staphylococcus aureus , Vancomycin-resistant Enterococci francium 등이 있다. 상기 약물 내성 그람 양성 병원균들은 약물 내성에 의한 감염성 질병의 치료에 중요하다. Gram-positive bacteria are the most common causes of sepsis. Major drug-resistant Gram-positive pathogens include Staphylococcus aureus and Enterococcus. faecium , Streptococcus pneumoniae And the like exist, and among the bacteria, there are Methicillin-resistant Staphylococcus aureus and Vancomycin-resistant Enterococci francium , which are resistant to drugs. The drug-resistant Gram-positive pathogens are important for the treatment of infectious diseases caused by drug resistance.
패혈증 환자의 혈액으로부터 약물 내성의 박테리아 병원균을 조기에 발견하는 것은 임상 결과를 증진하는데 중요하다. 그러기 위해, 약물 내성 그람 양성 병원균(dug resistant gram-positive pathogens)의 빠르고 민감한 검출은 중요하다. 그러나 기존의 세포 배양의 기초한 방법은 약물 내성 병원균을 식별하기 위해 상대적으로 많은 시간이 소요된다. 전체적인 검출 시간이 길어진다는 단점이 있다. 이러한 방법을 대신하기 위해, PCR을 사용하는 분자 생물학적 진단방법이 두 가지가 있다. 하나는 다중 증폭(Multiplex PCR) 이고, 또 다른 하나는 실시간 유전자 증폭(real-time PCR)이다. 두 가지 기술 모두 장단점이 있다. 다중 증폭(Multiplex PCR)은 같은 검체에서 다수의 병원균을 검출할 수 있어, 다중의 후보 병원균의 효과적인 스크리닝을 가능케 한다. 그러나 다중 검출은 여러 종류의 프라이머 세트가 genomic DNA에 붙어 비특이적 혼성화를 형성하여 검출하려고 하는 증폭산물 외의 다른 산물들을 증폭시켜 결과 분석에 오류를 나타낼 수 있다. 따라서 실시간 유전자 증폭(real-time PCR)보다는 특이도가 낮다. 실시간 유전자 증폭(real-time PCR)은 상대적으로 정확한 결과를 제공하지만, 제한된 다중 검출 기능을 가지고 있다. Early detection of drug-resistant bacterial pathogens from the blood of sepsis patients is important in improving clinical outcomes. To that end, rapid and sensitive detection of drug resistant gram-positive pathogens is important. However, conventional cell culture-based methods take a relatively long time to identify drug-resistant pathogens. There is a disadvantage in that the overall detection time is lengthened. To replace this method, there are two molecular biological diagnostic methods using PCR. One is multiplex PCR, and the other is real-time PCR. Both technologies have advantages and disadvantages. Multiplex PCR can detect multiple pathogens in the same sample, enabling effective screening of multiple candidate pathogens. However, in multiple detection, several types of primer sets attach to genomic DNA to form non-specific hybridization and amplify products other than the amplification product to be detected, resulting in an error in the analysis of the results. Therefore, the specificity is lower than that of real-time PCR. Real-time PCR provides relatively accurate results, but has limited multiplex detection capabilities.
MLPA(multiplex ligation-dependent probe amplification)는 DNA의 특정 염기서열만을 검출하는 방법으로 높은 특이도를 가지고 한 번의 실험으로 변이체의 다중 검출이 가능한 분자 생물학적 진단방법이다. MLPA (multiplex ligation-dependent probe amplification) is a molecular biological diagnostic method capable of detecting multiple variants in one experiment with high specificity as a method of detecting only a specific nucleotide sequence of DNA.
MLPA에 있어서는 타겟 시료에 혼성 결합하는 서열과 프라이머 서열을 포함하는 2개의 프로브를 사용한다. 상기 2개의 프로브가 각각 타겟 유전자와 혼성 결합하고, 혼성 결합한 2개의 프로브 사이가 라이게이션(ligation)되어 프로브 어셈블리(probe assembly)를 형성하여야만 이후 증폭 반응에서 2개의 프로브 각각이 포함하는 프라이머에 의해 프로브 어셈블리(probe assembly)를 주형으로 한 증폭 반응이 가능해진다. 따라서, 프로브가 타겟 유전자에 혼성 결합하고 라이게이션(ligation)되어 얻어진 프로브 어셈블리(probe assembly)의 양에 따라 증폭량 및 이에 대한 검출량이 달라지므로 특정 유전자를 검출할 수 있게 되는 것이다. 기존의 MLPA의 경우 CE(capillary electrophoresis)를 사용하여 검출하기 때문에, 검출을 위한 프로브 디자인(probe design)과정에서 길이의 차이를 가질 수 있도록 디자인한 스터퍼 서열(stuffer sequence)가 존재한다. 스터퍼 서열(stuffer sequence)이란 단순히 길이의 차이를 가질 수 있도록 디자인된 서열로써, 다른 프로브의 혼성화 서열(hybridization sequence), 다른 프로브의 스터퍼 서열(stuffer sequence) 또는 DNA의 다른 염기서열과 결합(binding)을 하지 않는 염기서열이다. 하지만 이 스터퍼 서열(stuffer sequence)의 경우 위에서 설명한 바와 같이 다른 염기서열과 어떠한 상호작용도 없어야 하므로 그 디자인 자체가 매우 어렵다는 단점을 가진다. 또한, 스터퍼 서열(stuffer sequence)을 위한 염기서열을 디자인하더라도 최대 400nt정도의 길이를 가지는 스터퍼 서열(stuffer sequence)로 인해 프로브 간의 길이 차이가 증가하게 되고, 이로 인하여 전체 산물의 증폭 효율이 달라져 정확한 검출이 어렵다는 단점을 가지게 된다.In MLPA, two probes including a sequence that hybridizes to a target sample and a primer sequence are used. The two probes must be hybridized with the target gene, and the two probes hybridized must be ligated to form a probe assembly. An amplification reaction using probe assembly as a template becomes possible. Accordingly, the amplification amount and the amount of detection thereof vary according to the amount of the probe assembly obtained by hybridization and ligation of the probe to the target gene, so that a specific gene can be detected. In the case of conventional MLPA, since detection is performed using capillary electrophoresis (CE), there is a stuffer sequence designed to have a difference in length in the process of probe design for detection. A stuffer sequence is simply a sequence designed to have a difference in length, and is combined with a hybridization sequence of another probe, a stuffer sequence of another probe, or another nucleotide sequence of DNA ( It is a base sequence that does not bind). However, in the case of this stuffer sequence, as described above, it has a disadvantage that the design itself is very difficult because it must not have any interaction with other base sequences. In addition, even if the nucleotide sequence for the stuffer sequence is designed, the difference in length between the probes increases due to the stuffer sequence having a length of up to 400 nt, thereby changing the amplification efficiency of the entire product. It has the disadvantage that accurate detection is difficult.
이러한 단점을 해결하기 위해 본 발명에서는 스터퍼 서열(stuffer sequence)이 없는 스터퍼 프리(stuffer free) MLPA를 사용함으로써 프로브의 디자인 과정이 쉽고, 일정한 증폭효율을 가지게 됨으로써 정확한 검출이 가능하게 된다는 장점이 있게 된다.In order to solve these shortcomings, in the present invention, by using a stuffer free MLPA without a stuffer sequence, the design process of the probe is easy, and since it has a constant amplification efficiency, accurate detection is possible. There will be.
길이의 차이가 없는 스터퍼 프리(stuffer free) MLPA의 프로브를 검출하기 위해 본 발명에서는 CE-SSCP(capillary electrophoresis single strand conformation polymorphism)를 적용하여 길이의 차이가 아닌 염기서열의 차이를 사용하여 프로브 검출을 수행한다. 스터퍼 프리(stuffer free) MLPA-CE-SSCP 방법으로 균주를 검출하는 과정을 도 1에 개략적으로 나타내었다. 도 1에서 보는 바와 같이 MLPA 방법은 샘플을 변성(denaturation)시키고, 타겟 유전자에 2개의 프로브를 혼성 결합하는 단계, 상기 2개의 프로브를 라이게이션(ligation)시키는 단계, 라이게이션(ligation)된 프로브를 PCR 증폭시키는 단계 및 증폭 산물을 검출하는 단계로 구성된다.In order to detect a probe of stuffer free MLPA without a difference in length, in the present invention, CE-SSCP (capillary electrophoresis single strand conformation polymorphism) is applied to detect the probe using a difference in base sequence rather than a difference in length. Perform. The process of detecting the strain by the stuffer free MLPA-CE-SSCP method is schematically shown in FIG. 1. As shown in Fig. 1, the MLPA method includes denaturing a sample, hybridizing two probes to a target gene, ligating the two probes, and ligating the ligated probe. It consists of a step of PCR amplification and a step of detecting the amplification product.
하지만, 스터퍼 프리(stuffer free) MLPA-CE-SSCP 방법을 기반으로 한 약물 내성 그람 양성 병원균의 검출 방법은 아직 개발되지 않았습니다. 따라서, 스터퍼 프리(stuffer free) MLPA-CE-SSCP 방법을 기반으로 약물 내성 그람 양성 병원균의 빠르고 정확한 검출 방법을 개발하는 것이 필요한 실정이다. However, a method for detection of drug-resistant Gram-positive pathogens based on the stuffer free MLPA-CE-SSCP method has not yet been developed. Therefore, it is necessary to develop a fast and accurate detection method of drug-resistant Gram-positive pathogens based on the stuffer free MLPA-CE-SSCP method.
본 발명은 상기와 같은 종래 기술의 문제점을 해결하기 위하여 MLPA 방법에 의하여 약물 내성 그람 양성 병원균(drug resistant gram-positive pathogens) 검출을 수행하기 위한 스터퍼 서열(Stuffer sequence)을 가지지 않는 스터퍼 프리(Stuffer free) 약물 내성 그람 양성 병원균(drug resistant gram-positive pathogens) 프로브, 프로브 세트 및 이의 검출방법을 제공하는 것을 목적으로 한다. The present invention is a stuffer free that does not have a stuffer sequence for detecting drug resistant gram-positive pathogens by the MLPA method in order to solve the problems of the prior art as described above ( It is an object of the present invention to provide a probe, a probe set, and a detection method thereof (stuffer free) drug resistant gram-positive pathogens.
본 발명은 또한, 상기 약물 내성 그람 양성 병원균 프로브, 프로브 세트를 이용하여 혼성화 시간을 최적화하여 검출시간을 단축하게 하고, 약물 내성 그람 양성 병원균의 특이적 서열을 예비 증폭함으로써 검출의 민감도를 상승시키는 것을 목적으로 한다. In addition, the present invention is to shorten the detection time by optimizing the hybridization time using the drug-resistant Gram-positive pathogen probe and probe set, and to increase the sensitivity of detection by pre-amplifying the specific sequence of the drug-resistant Gram-positive pathogen. The purpose.
본 발명은 상기와 같은 과제를 해결하기 위하여,The present invention in order to solve the above problems,
정방향 프라이머 결합 영역, 및 표적 서열의 제1 영역에 특이적으로 혼성화하는 LHS(left hybridization sequence) 영역을 포함하는 LPO(left probe oligonucleotide); 및A left probe oligonucleotide (LPO) including a forward primer binding region and a left hybridization sequence (LHS) region that specifically hybridizes to the first region of the target sequence; And
상기 표적 서열의 상기 제1 영역과 연속으로 연결된 제2 영역에 특이적으로 혼성화하는 RHS(righthybridization sequence) 및 역방향 프라이머 결합 영역을 포함하는 RPO(right probe oligonucleotide);로 구성되고,Consisting of; RPO (right probe oligonucleotide) including a reverse primer binding region and a right hybridization sequence (RHS) that specifically hybridizes to a second region continuously connected to the first region of the target sequence,
상기 LHS(left hybridization sequence) 및 상기 RHS(right hybridization sequence)가 서열 변호 1 및 서열번호 2인 제1 프로브, 서열번호 3 및 서열번호 4인 제2 프로브, 서열번호 5 및 서열번호 6인 제3 프로브, 서열번호 7 및 서열번호 8인 제4 프로브 및 서열번호 9 및 서열번호 10인 제5 프로브로 이루어진 그룹에서 선택되는 어느 하나인 것인 패혈증에 관여하는 그람 양성 병원균 검출용 프로브를 제공한다. The left hybridization sequence (LHS) and the right hybridization sequence (RHS) are the first probe of SEQ ID NO: 1 and SEQ ID NO: 2, the second probe of SEQ ID NO: 3 and SEQ ID NO: 4, the third probe of SEQ ID NO: 5 and SEQ ID NO: 6 Probe, any one selected from the group consisting of a fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8, and a fifth probe of SEQ ID NO: 9 and SEQ ID NO: 10 provides a probe for detecting gram-positive pathogens involved in sepsis.
본 발명에 있어서, 상기 그람 양성 병원균은 황색포도상구균(Staphylococcus aureus), 메티실린 내성 포도 구균(Methicillin-resistant Staphylococcus aureus), 엔테로코커스 패시움 (Enterococcus faecium), 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium ) 및 폐렴연쇄상구균 (Streptococcus pneumonia) 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 한다. In the present invention, the Gram-positive pathogen is Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus , Enterococcus faecium faecium ), Vancomycin-resistant Enterococci faecium ) and streptococcus pneumonia (Streptococcus pneumonia) .
본 발명은 또한, 상기 서열 변호 1 및 서열 번호 2인 제1 프로브는 황색포도상구균(Staphylococcus aureus)의 유전자 nuc의 서열 번호 11에 특이적으로 혼성 결합하고,In the present invention, the first probe of SEQ ID NO: 1 and SEQ ID NO: 2 specifically hybridizes to SEQ ID NO: 11 of the gene nuc of Staphylococcus aureus,
상기 서열번호 3 및 서열번호 4인 제2 프로브는 메티실린 내성 포도 구균(Methicillin-resistant Staphylococcus aureus)의 유전자 mecA의 서열번호 12에 특이적으로 혼성 결합하고,The second probe of SEQ ID NO: 3 and SEQ ID NO: 4 hybridizes specifically to SEQ ID NO: 12 of the gene mecA of methicillin-resistant Staphylococcus aureus,
상기 서열번호 5 및 서열번호 6인 제3 프로브는 엔테로코커스 패시움 (Enterococcus faecium)의 유전자 sodA의 서열 번호 13에 특이적으로 혼성 결합하고,The third probe of SEQ ID NO: 5 and SEQ ID NO: 6 hybridizes specifically to SEQ ID NO: 13 of the gene sodA of Enterococcus faecium,
상기 서열번호 7 및 서열번호 8인 제4 프로브는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium )의 유전자 vanA의 서열 번호 14에 특이적으로 혼성 결합하고,The fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8 is Vancomycin-resistant Enterococci faecium (Vancomycin-resistant Enterococci faecium ) hybridized specifically to SEQ ID NO: 14 of the gene vanA,
상기 서열번호 9 및 서열번호 10인 제5 프로브는 폐렴연쇄상구균 (Streptococcus pneumonia)의 유전자 lytA의 서열 번호 15에 특이적으로 혼성 결합 것을 특징으로 한다. The fifth probe of SEQ ID NO: 9 and SEQ ID NO: 10 is characterized in that it hybridizes specifically to SEQ ID NO: 15 of the gene lytA of Streptococcus pneumonia.
본 발명은 또한, 본 발명에 의한 패혈증에 관여하는 그람 양성 병원균 검출용 프로브를 2개 내지 5개 포함하는 패혈증에 관여하는 그람 양성 병원균 검출용 프로브 세트를 제공한다. The present invention also provides a probe set for detecting gram-positive pathogens involved in sepsis, comprising 2 to 5 probes for detecting gram-positive pathogens involved in sepsis according to the present invention.
본 발명은 또한, 본 발명에 의한 패혈증에 관여하는 그람 양성 병원균 검출용 프로브, 또는 본 발명에 의한 프로브 세트를 포함하는 패혈증에 관여하는 그람 양성 병원균 검출용 키트를 제공한다. The present invention also provides a probe for detecting gram-positive pathogens involved in sepsis according to the present invention, or a kit for detecting gram-positive pathogens involved in sepsis, including the probe set according to the present invention.
본 발명은 또한, 하기 단계를 포함하는 패혈증에 관여하는 그람 양성 병원균의 존재를 검출하는 방법을 제공한다. The present invention also provides a method for detecting the presence of Gram-positive pathogens involved in sepsis, comprising the following steps.
(1) 시료를 예비 증폭시키는 단계;(1) pre-amplifying the sample;
(2) 예비 증폭된 시료를 본 발명에 의한 패혈증에 관여하는 그람 양성 병원균 검출용 프로브 세트와 접촉시켜 혼성화시키는 단계;(2) hybridizing the pre-amplified sample by contacting it with a probe set for detecting Gram-positive pathogens involved in sepsis according to the present invention;
(3) 상기 시료와 혼성화된 프로브를 라이게이션(ligation)하여 프로브 어셈블리(probe assembly)를 형성시키는 단계;(3) forming a probe assembly by ligating the probe hybridized with the sample;
(4) 상기 형성된 프로브 어셈블리(probe assembly)를 주형으로 하여 PCR 증폭시키는 단계;(4) PCR amplifying the formed probe assembly as a template;
(5) 상기 증폭 산물을 분리 및 검출하는 단계; 및(5) separating and detecting the amplification product; And
(6) 상기 증폭 산물이 분리, 검출되는 경우 상기 시료 내에 상기 증폭된 프로브 어셈블리(probe assembly)를 구성하는 프로브가 상보적으로 결합하는 패혈증에 관여하는 그람 양성 병원균이 존재하는 것으로 판단하는 단계.(6) When the amplification product is separated and detected, determining that there is a Gram-positive pathogen involved in sepsis in which the probe constituting the amplified probe assembly complementarily binds to the sample.
본 발명에 있어서, 상기 (1) 단계의 시료를 예비 증폭시키는 단계에서는 제1 프라이머 세트 내지 제5 프라이머 세트를 이용하여 시료 내의 균주의 표적 서열의 제1 영역 및 상기 제1 영역과 연속으로 연결된 제2 영역을 증폭시키는 것을 특징으로 한다. In the present invention, in the step of preamplifying the sample of step (1), the first region of the target sequence of the strain in the sample and the first region of the target sequence in the sample are continuously connected by using a first primer set to a fifth primer set. It is characterized by amplifying two regions.
본 발명에 있어서, 상기 서열 변호 16 및 서열 번호 17인 제1 프라이머 세트는 황색포도상구균(Staphylococcus aureus)의 유전자 nuc의 제1 영역 및 제2 영역을 증폭하고,In the present invention, the first primer set of SEQ ID NO: 16 and SEQ ID NO: 17 amplifies the first region and the second region of the gene nuc of Staphylococcus aureus,
상기 서열번호 18 및 서열번호 19인 제2 프라이머 세트는 메티실린 내성 포도 구균(Methicillin-resistant Staphylococcus aureus)의 유전자 mecA의 제1 영역 및 제2 영역을 증폭하고,The second primer set of SEQ ID NO: 18 and SEQ ID NO: 19 amplifies the first region and the second region of the gene mecA of Methicillin-resistant Staphylococcus aureus,
상기 서열번호 20 및 서열번호 21인 제3 프라이머 세트는 엔테로코커스 패시움 (Enterococcus faecium)의 유전자 sodA의 제1 영역 및 제2 영역을 증폭하고,The third primer set of SEQ ID NO: 20 and SEQ ID NO: 21 amplifies the first region and the second region of the gene sodA of Enterococcus faecium,
상기 서열번호 22 및 서열번호 23인 제4 프라이머 세트는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 유전자 vanA의 제1 영역 및 제2 영역을 증폭하고,The fourth primer set of SEQ ID NO: 22 and SEQ ID NO: 23 is Vancomycin-resistant Enterococci (Vancomycin-resistant Enterococci faecium ) amplifying the first region and the second region of the gene vanA,
상기 서열번호 24 및 서열번호 25인 제5 프라이머 세트는 폐렴연쇄상구균 (Streptococcus pneumonia)의 유전자 lytA의 제1 영역 및 제2 영역을 증폭하는 것을 특징으로 한다. The fifth primer set of SEQ ID NO: 24 and SEQ ID NO: 25 is characterized by amplifying the first region and the second region of the gene lytA of Streptococcus pneumonia.
본 발명은 또한, 상기 (2) 단계에서, 상기 시료의 표적 서열 제1 영역과 상기 LPO 프로브의 LHS가 혼성화되고, 상기 시료의 표적 서열 제2 영역과 상기 RPO 프로브의 RHS 가 혼성화되는 것을 특징으로 한다. In the present invention, in the step (2), the first region of the target sequence of the sample and the LHS of the LPO probe are hybridized, and the second region of the target sequence of the sample and the RHS of the RPO probe are hybridized. do.
본 발명은 또한, 상기 (2) 단계에서 4시간 내지 20시간, 바람직하게는 4시간 내지 16시간 더욱 바람직하게는 8시간 내지 16 시간 동안 혼성화될 수 있고, 가장 바람직하게는 8시간 동안 혼성화될 수 있다. The present invention may also be hybridized for 4 hours to 20 hours, preferably 4 to 16 hours, more preferably 8 to 16 hours, and most preferably for 8 hours in step (2). have.
본 발명은 또한, 상기 (3) 단계에서, 상기 시료의 제1 영역과 혼성 결합된 LPO의 LHS의 말단과 상기 시료의 제2 영역과 혼성 결합된 RPO의 RHS의 말단을 라이게이션(ligation)하여 정방향 프라이머 결합 영역-LHS-RHS-역방향 프라이머 결합 영역으로 구성된 프로브 어셈블리(probe assembly)를 형성하는 것을 특징으로 한다. In the present invention, in step (3), the end of the LHS of the LPO hybridized with the first region of the sample and the end of the RHS of the RPO hybridized with the second region of the sample are ligated to A probe assembly composed of a forward primer binding region-LHS-RHS-reverse primer binding region is formed.
본 발명은 또한, 상기 (4) 단계에서, 상기 프로브 어셈블리(probe assembly)를 구성하는 LPO(left probe oligonucleotide)가 포함하는 정방향 프라이머 결합 영역, 및 RPO(right probe oligonucleotide)가 포함하는 역방향 프라이머 결합 영역에 상보적으로 결합하는 프라이머 세트를 사용하여 상기 형성된 프로브 어셈블리(probe assembly)가 PCR 증폭되는 것을 특징으로 한다. In the present invention, in step (4), a forward primer binding region included in a left probe oligonucleotide (LPO) constituting the probe assembly, and a reverse primer binding region included in a right probe oligonucleotide (RPO) It characterized in that the formed probe assembly (probe assembly) is amplified by PCR using a primer set complementary to bind to.
본 발명은 또한, 상기 (5) 단계에서, 프로브 어셈블리(probe assembly)를 주형으로 하여 PCR 증폭된 정도를 CE-SSCP(Capillary Electrophoresis-Single strand conformation polymorphism)를 이용하여 분리 및 검출하는 것을 특징으로 한다. In the present invention, in step (5), the degree of PCR amplification using a probe assembly as a template is separated and detected using CE-SSCP (Capillary Electrophoresis-Single strand conformation polymorphism). .
본 발명은 또한, 상기 (2) 단계에서, 본 발명에 의한 패혈증에 관여하는 그람 양성 병원균 검출용 프로브 세트를 사용하여 복수의 그람 양성 병원균의 존재를 한 번에 검출하는 것을 특징으로 한다. The present invention is also characterized in that in step (2), the presence of a plurality of Gram-positive pathogens is detected at once by using the probe set for detecting Gram-positive pathogens involved in sepsis according to the present invention.
본 발명은 또한, 상기 방법 중 어느 하나의 방법을 이용하여 패혈증 진단을 위한 정보제공 방법을 제공한다. The present invention also provides a method of providing information for diagnosing sepsis by using any one of the above methods.
본 발명에 있어서, 정방향 프라이머 결합 영역, 및 표적 서열의 제1 영역에 특이적으로 혼성화하는 LHS(left hybridization sequence) 영역을 포함하는 LPO(left probe oligonucleotide); 및In the present invention, LPO (left probe oligonucleotide) including a forward primer binding region and a left hybridization sequence (LHS) region that specifically hybridizes to the first region of the target sequence; And
상기 표적 서열의 상기 제1 영역과 연속으로 연결된 제2 영역에 특이적으로 혼성화하는 RHS(righthybridization sequence) 및 역방향 프라이머 결합 영역을 포함하는 RPO(right probe oligonucleotide);로 구성되고,Consisting of; RPO (right probe oligonucleotide) including a reverse primer binding region and a right hybridization sequence (RHS) that specifically hybridizes to a second region continuously connected to the first region of the target sequence,
상기 LHS(left hybridization sequence) 및 상기 RHS(right hybridization sequence)가 서열번호 3 및 서열번호 4인 제2 프로브 및 서열번호 7 및 서열번호 8인 제4 프로브로 이루어진 그룹에서 선택되는 어느 하나인 것인 패혈증에 관여하는 약물 내성 그람 양성 병원균 검출용 프로브를 제공한다. The left hybridization sequence (LHS) and the right hybridization sequence (RHS) are any one selected from the group consisting of a second probe of SEQ ID NO: 3 and SEQ ID NO: 4, and a fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8 It provides a probe for detecting drug-resistant Gram-positive pathogens involved in sepsis.
본 발명은 또한, 상기 약물 내성 그람 양성 병원균은 메티실린 내성 포도 구균(Methicillin-resistant Staphylococcus aureus) 및 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium )로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 한다. In the present invention, the drug-resistant Gram-positive pathogen is Methicillin-resistant Staphylococcus aureus and Vancomycin-resistant Enterococci faecium (Vancomycin-resistant Enterococci). faecium ) as It is characterized in that at least one selected from the group consisting of.
본 발명은 또한, 상기 서열번호 3 및 서열번호 4인 제2 프로브는 메티실린 내성 포도 구균(Methicillin-resistant Staphylococcus aureus)의 유전자 mecA의 서열번호 12에 특이적으로 혼성 결합하고,In the present invention, the second probe of SEQ ID NO: 3 and SEQ ID NO: 4 specifically hybridizes to SEQ ID NO: 12 of the gene mecA of methicillin-resistant Staphylococcus aureus,
상기 서열번호 7 및 서열번호 8인 제4 프로브는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium )의 유전자 vanA의 서열 번호 14에 특이적으로 혼성 결합 하는 것을 특징으로 한다. The fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8 is Vancomycin-resistant Enterococci faecium (Vancomycin-resistant Enterococci faecium ) is characterized in that it hybridizes specifically to SEQ ID NO: 14 of the gene vanA.
본 발명은 또한, 본 발명에 의한 패혈증에 관여하는 약물 내성 그람 양성 병원균 검출용 프로브 2개를 포함하는 패혈증에 관여하는 약물 내성 그람 양성 병원균 검출용 프로브 세트를 제공한다. The present invention also provides a probe set for detecting drug-resistant Gram-positive pathogens involved in sepsis, including two probes for detecting drug-resistant Gram-positive pathogens involved in sepsis according to the present invention.
본 발명은 또한, 본 발명에 의한 패혈증에 관여하는 약물 내성 그람 양성 병원균 검출용 프로브, 또는 제19항의 프로브 세트를 포함하는 패혈증에 관여하는 약물 내성 그람 양성 병원균 검출용 키트를 제공한다. The present invention also provides a probe for detecting drug-resistant Gram-positive pathogens involved in sepsis according to the present invention, or a kit for detecting drug-resistant Gram-positive pathogens involved in sepsis, comprising the probe set of claim 19.
본 발명에 있어서, 하기 단계를 포함하는 패혈증에 관여하는 약물 내성 그람 양성 병원균의 존재를 검출하는 방법을 제공한다. In the present invention, it provides a method for detecting the presence of drug-resistant Gram-positive pathogens involved in sepsis, comprising the following steps.
(1) 시료를 예비 증폭시키는 단계;(1) pre-amplifying the sample;
(2) 예비 증폭된 시료를 제1항의 패혈증에 관여하는 약물 내성 그람 양성 병원균 프로브 세트와 접촉시켜 혼성화시키는 단계;(2) hybridizing the pre-amplified sample by contacting it with the set of drug-resistant Gram-positive pathogen probes involved in sepsis of
(3) 상기 시료와 혼성화된 프로브를 라이게이션(ligation)하여 프로브 어셈블리(probe assembly)를 형성시키는 단계;(3) forming a probe assembly by ligating the probe hybridized with the sample;
(4) 상기 형성된 프로브 어셈블리(probe assembly)를 주형으로 하여 PCR 증폭시키는 단계;(4) PCR amplifying the formed probe assembly as a template;
(5) 상기 증폭 산물을 분리 및 검출하는 단계; 및(5) separating and detecting the amplification product; And
(6) 상기 증폭 산물이 분리, 검출되는 경우 상기 시료 내에 상기 증폭된 프로브 어셈블리(probe assembly)를 구성하는 프로브가 상보적으로 결합하는 패혈증에 관여하는 약물 내성 그람 양성 병원균이 존재하는 것으로 판단하는 단계.(6) determining that a drug-resistant Gram-positive pathogen involved in sepsis to which the probes constituting the amplified probe assembly complementarily bind exists in the sample when the amplification product is separated and detected .
본 발명은 또한, 상기 (1) 단계의 시료를 예비 증폭시키는 단계에서는 제2 프라이머 세트 및 제4 프라이머 세트를 이용하여 시료 내의 균주의 표적 서열의 제1 영역 및 상기 제1 영역과 연속으로 연결된 제2 영역을 증폭시키는 것을 특징으로 하는 패혈증에 관여하는 약물 내성 그람 양성 병원균의 존재를 검출하는 방법.In the present invention, in the step of pre-amplifying the sample of step (1), the first region of the target sequence of the strain in the sample and the first region are continuously connected by using a second primer set and a fourth primer set. A method for detecting the presence of drug-resistant Gram-positive pathogens involved in sepsis, characterized in that amplification of two regions.
본 발명은 또한, 상기 서열번호 18 및 서열번호 19인 제2 프라이머 세트는 메티실린 내성 포도 구균(Methicillin-resistant Staphylococcus aureus)의 유전자 mecA의 제1 영역 및 제2 영역을 증폭하고,In the present invention, the second primer set of SEQ ID NO: 18 and SEQ ID NO: 19 amplifies the first region and the second region of the gene mecA of Methicillin-resistant Staphylococcus aureus,
상기 서열번호 22 및 서열번호 23인 제4 프라이머 세트는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 유전자 vanA의 제1 영역 및 제2 영역을 증폭하는 것을 특징으로 한다. The fourth primer set of SEQ ID NO: 22 and SEQ ID NO: 23 is Vancomycin-resistant Enterococci (Vancomycin-resistant Enterococci faecium ) gene vanA , characterized by amplifying the first region and the second region.
본 발명은 또한, 상기 (2) 단계에서, 상기 시료의 표적 서열 제1 영역과 상기 LPO 프로브의 LHS가 혼성화되고, 상기 시료의 표적 서열 제2 영역과 상기 RPO 프로브의 RHS 가 혼성화되는 것을 특징으로 한다. In the present invention, in the step (2), the first region of the target sequence of the sample and the LHS of the LPO probe are hybridized, and the second region of the target sequence of the sample and the RHS of the RPO probe are hybridized. do.
본 발명은 또한, 상기 (2) 단계에서 4시간 내지 20시간 동안, 바람직하게는 4시간 내지 16시간 더욱 바람직하게는 8시간 내지 16시간 동안 혼성화될 수 있고, 가장 바람직하게는 8시간 동안 혼성화 될 수 있다. The present invention may also be hybridized for 4 hours to 20 hours, preferably 4 to 16 hours, more preferably 8 to 16 hours, and most preferably for 8 hours in step (2). I can.
본 발명은 또한, 상기 (3) 단계에서, 상기 시료의 제1 영역과 혼성 결합된 LPO의 LHS의 말단과 상기 시료의 제2 영역과 혼성 결합된 RPO의 RHS의 말단을 라이게이션(ligation)하여 정방향 프라이머 결합 영역-LHS-RHS-역방향 프라이머 결합 영역으로 구성된 프로브 어셈블리(probe assembly)를 형성하는 것을 특징으로 한다. In the present invention, in step (3), the end of the LHS of the LPO hybridized with the first region of the sample and the end of the RHS of the RPO hybridized with the second region of the sample are ligated to A probe assembly composed of a forward primer binding region-LHS-RHS-reverse primer binding region is formed.
본 발명은 또한, 상기 (4) 단계에서, 상기 프로브 어셈블리(probe assembly)를 구성하는 LPO(left probe oligonucleotide)가 포함하는 정방향 프라이머 결합 영역, 및 RPO(right probe oligonucleotide)가 포함하는 역방향 프라이머 결합 영역에 상보적으로 결합하는 프라이머 세트를 사용하여 상기 형성된 프로브 어셈블리(probe assembly)가 PCR 증폭되는 것을 특징으로 한다. In the present invention, in step (4), a forward primer binding region included in a left probe oligonucleotide (LPO) constituting the probe assembly, and a reverse primer binding region included in a right probe oligonucleotide (RPO) It characterized in that the formed probe assembly (probe assembly) is amplified by PCR using a primer set complementary to bind to.
본 발명은 또한, 상기 (5) 단계에서, 프로브 어셈블리(probe assembly)를 주형으로 하여 PCR 증폭된 정도를 CE-SSCP(Capillary Electrophoresis-Single strand conformation polymorphism)를 이용하여 분리 및 검출하는 것을 특징으로 한다. In the present invention, in step (5), the degree of PCR amplification using a probe assembly as a template is separated and detected using CE-SSCP (Capillary Electrophoresis-Single strand conformation polymorphism). .
본 발명은 또한, 상기 (2) 단계에서, 제19항에 의한 패혈증에 관여하는 약물 내성 그람 양성 병원균 검출용 프로브 세트를 사용하여 복수의 약물 내성 그람 양성 병원균의 존재를 한 번에 검출하는 것을 특징으로 한다. In addition, the present invention is characterized in that in step (2), the presence of a plurality of drug-resistant Gram-positive pathogens is detected at once by using the probe set for detecting drug-resistant Gram-positive pathogens involved in sepsis according to item 19. It is done.
본 발명은 또한, 상기 방법 중 어느 한 항의 방법을 이용하여, 약물 내성을 나타내는 패혈증 진단을 위한 정보제공 방법을 제공한다. The present invention also provides a method of providing information for diagnosing sepsis showing drug resistance by using the method of any one of the above methods.
본 발명에 의한 상기 약물 내성 그람 양성 병원균 프로브, 프로브 세트 및 이를 이용한 약물 내성 그람 양성 병원균 검출 방법은 혼성화 시간을 최적화하여 종래 검출시간보다 검출시간을 단축되고, 약물 내성 그람 양성 병원균의 특이적 서열을 예비 증폭함으로써 검출의 민감도를 상승시켜, 더 효율적으로 약물 내성 그람 양성 병원균에 대해 정확한 다중 검출이 가능하다. The drug-resistant Gram-positive pathogen probe, probe set, and drug-resistant Gram-positive pathogen detection method using the same according to the present invention optimize the hybridization time to shorten the detection time compared to the conventional detection time, and determine the specific sequence of the drug-resistant Gram-positive pathogen. Preliminary amplification increases the sensitivity of detection, enabling accurate multiplex detection of drug-resistant Gram-positive pathogens more efficiently.
도 1은 본 발명에 의한 스터퍼 프리(stuffer free) MLPA 방법을 개략적으로 나타낸 흐름도이다.
도 2는 본 발명에 의한 스터퍼 서열(stuffer sequence)을 가지지 않는 약물 내성 그람 양성 병원균 검출용 프로브의 구조를 나타내는 도면이다.
도 3는 본 발명의 일 실시예에 의하여 약물 내성 그람 양성 병원균 검출용 프로브를 사용하여 MLPA를 수행하고, CE-SSCP를 이용하여 분석한 결과를 나타낸 도면이다.
도 4는 본 발명의 일 실시예에 의하여 임상에서 분리한 60종의 병원균을 본 발명의 약물 내성 그람 양성 병원균 검출용 프로브를 사용하여 MLPA를 수행하고, CE-SSCP를 이용하여 검출한 결과를 정리한 도면이다.
도 5는 본 발명의 일 실시예에 약물 내성 그람 양성 병원균 검출용 프라이머를 사용하여 실시예 3에서 준비된 균주로부터 분리된 Genomic DNA의 농도를 100 pg, 10pg, 1pg, 100fg 및 10fg로 희석하여 예비 증폭을 수행한 후, MLPA 및 CE-SSCP를 이용하여 분석한 결과를 나타낸 도면이다.
도 6은 본 발명의 일 실시예에 의하여 약물 내성 그람 양성 병원균 검출용 프라이머를 사용하여 예비 증폭을 수행한 후, MLPA 및 CE-SSCP를 이용하여 분석한 결과를 나타낸 도면이다.1 is a flowchart schematically showing a stuffer free MLPA method according to the present invention.
2 is a diagram showing the structure of a probe for detecting drug-resistant Gram-positive pathogens having no stuffer sequence according to the present invention.
FIG. 3 is a diagram showing results of performing MLPA using a probe for detecting drug-resistant Gram-positive pathogens according to an embodiment of the present invention, and analyzing using CE-SSCP.
FIG. 4 is a summary of the results obtained by performing MLPA using the probe for detecting drug-resistant Gram-positive pathogens of the present invention for 60 pathogens isolated in clinical practice according to an embodiment of the present invention, and using CE-SSCP. It is a drawing.
5 is a preliminary amplification by diluting the concentration of Genomic DNA isolated from the strain prepared in Example 3 to 100 pg, 10 pg, 1 pg, 100 fg and 10 fg using a primer for detecting drug-resistant Gram-positive pathogens in an embodiment of the present invention. After performing, it is a diagram showing the results of analysis using MLPA and CE-SSCP.
6 is a diagram showing the results of preliminary amplification using a primer for detecting drug-resistant Gram-positive pathogens according to an embodiment of the present invention, and analysis using MLPA and CE-SSCP.
이하에서는 본 발명을 실시예에 의하여 더욱 상세히 설명한다. 그러나 본 발명이 이하의 실시예에 의하여 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail by examples. However, the present invention is not limited by the following examples.
<실시예 1> 검출 대상이 되는 약물 내성 그람 양성 병원균 주의 서열 결정<Example 1> Determination of the sequence of drug-resistant Gram-positive pathogen lines to be detected
약물 내성 그람 양성 병원균 주로 널리 알려진 총 5의 균주 Staphylococcus aureus, MRSA (Methicillin resistant staphylococcus aureus), Enterococcus faecium, VREfm (Vancomycin resistant Enterococcous faecium) 및 Streptococcus pneumoniae에 대하여 문헌 조사를 통해 각 균주 유전자의 검출에 사용되는 종 특이적 유전자 또는 서열을 선정하였다.Drug-resistant Gram-positive pathogens Staphylococcus aureus, MRSA (Methicillin resistant staphylococcus aureus ), Enterococcus faecium , VREfm (Vancomycin resistant Enterococcous) faecium ) and Streptococcus pneumoniae were selected species-specific genes or sequences used for detection of the genes of each strain through literature research.
각 균주 유전자 검출에 사용되는 유전자와 염기서열의 확보 후 NCBI blast(basic local alignment search tool)를 사용하여 각각의 균주의 DNA 서열의 데이터베이스와 비교한 후 특이적 염기서열을 결정하였다.After obtaining the gene and nucleotide sequence used for detecting the gene of each strain, a specific nucleotide sequence was determined after comparing it with the database of the DNA sequence of each strain using a basic local alignment search tool (NCBI blast).
각 균주가 공통으로 포함하는 서열 부분을 프로브가 특이적으로 혼성화하는 부분으로 결정하였다. 그 결과는 아래 표 1과 같다. 각 균주의 서열 부분은 LHS (left hybridization sequence)가 특이적으로 혼성화하는 표적 서열의 제1 영역과 이와 연속으로 연결되는 RHS(right hybridization sequence)가 특이적으로 혼성화하는 표적 서열의 제2 영역의 결합이다.A portion of the sequence commonly included in each strain was determined as a portion to be specifically hybridized by the probe. The results are shown in Table 1 below. The sequence part of each strain is the binding of the first region of the target sequence that is specifically hybridized by the left hybridization sequence (LHS) and the second region of the target sequence that is specifically hybridized by the right hybridization sequence (RHS) connected thereto. to be.
<실시예 2> 균주 검출용 프로브 디자인<Example 2> Probe design for strain detection
상기 실시예 1에서 결정된 특이적 서열을 기반으로 약물 내성 그람 양성 병원균 검출용 프로브를 디자인하였다. 상기 선정된 유전자 또는 서열의 특이성(uniqueness)을 BLAST로 확인한 후, 상기 확인한 유전자 또는 서열 안에 라이게이션자리(ligation site)가 들어갈 수 있도록 LHS(left hybridization sequence) 와 RHS(right hybridizationsequence) 서열을 디자인하였다.A probe for detecting drug-resistant Gram-positive pathogens was designed based on the specific sequence determined in Example 1. After confirming the uniqueness of the selected gene or sequence by BLAST, a left hybridization sequence (LHS) and a right hybridization sequence (RHS) sequence were designed so that a ligation site can enter the identified gene or sequence. .
상기 LHS 와 RHS의 서열 길이는 각각 21nt~50nt가 되고, LHS 와 RHS의 Tm 을 각각 70 내지 80℃ 및 GC 함량은 35 내지 65%가 되도록 디자인하였다. 이와 같이 디자인된 LHS 와 RHS 서열의 특이성을 FASTA 또는 BLAST로 확인하였다.The sequence lengths of the LHS and RHS were respectively 21 nt to 50 nt, and the Tm of LHS and RHS was designed to be 70 to 80°C, respectively, and the GC content to be 35 to 65%. The specificity of the thus designed LHS and RHS sequences was confirmed by FASTA or BLAST.
상기 확인된 LHS, RHS의 모든 서열의 상동성을 비교하여 alignment score가 50 이하가 되도록 하고, 확인된 alignment score가 50 이하인 LHS, RHS에 공통 프라이머 결합 서열(common primer binding sequence)을 더하여 LHO(left hybridization oligonucleotide), RHO(right hybridization oligonucleotide)를 만들고 각각의 LHO, RHO의 DG 값이 0 이상이 되도록 하여 약물 내성 그람 양성 병원균 검출용 프로브를 완성하였다. 완성된 약물 내성 그람 양성 병원균 검출용 프로브 다음 표 2와 같다.By comparing the homology of all sequences of the identified LHS and RHS, the alignment score is 50 or less, and a common primer binding sequence is added to the LHS and RHS with the identified alignment score of 50 or less. A hybridization oligonucleotide) and a right hybridization oligonucleotide (RHO) were made, and the DG values of each LHO and RHO were 0 or higher to complete a probe for detecting drug-resistant Gram-positive pathogens. The completed drug-resistant Gram-positive pathogen detection probe is shown in Table 2 below.
<실시예 3> 약물 내성 그람 양성 병원균 검출용 프로브를 이용한 검출 실험<Example 3> Detection experiment using a probe for detecting drug-resistant Gram-positive pathogens
<실시예 3-1> 균주의 DNA 시료 제작<Example 3-1> Preparation of DNA sample of strain
아메리칸 타입 컬쳐 컬렉션 (American Type Collection), 한국 미생물자원센터 (Korean Collection of Type Culture), 덴마크 국립혈청연구소 (Statens Serum Institut) 및 국가병원체자원은행 (National Culture Collection for Pathogens)에서 동정한 Staphylococcus aureus, MRSA (Methicillin resistant staphylococcus aureus), Enterococcus faecium, VREfm (Vancomycin resistant Enterococcous faecium) 및 Streptococcus pneumoniae를 약물 내성 그람 양성 병원균의 검출 방법의 참조 균주로 선정하였다. Staphylococcus aureus , MRSA identified by the American Type Collection, the Korean Collection of Type Culture, the Danish National Serum Institut, and the National Culture Collection for Pathogens (Methicillin resistant staphylococcus aureus ), Enterococcus faecium , VREfm (Vancomycin resistant Enterococcous faecium ) and Streptococcus pneumoniae was selected as a reference strain for detection of drug-resistant Gram-positive pathogens.
질병관리 본부 및 서울성모병원에서 수집한 임상에서 분리된 60개의 그람 양성 병원균을 약물 내성 그람 양성 병원균의 검출 방법의 특이성을 확인하는 데 사용하였다. 60 Gram-positive pathogens isolated from clinical trials collected at the Centers for Disease Control and Prevention and Seoul St. Mary's Hospital were used to confirm the specificity of the detection method for drug-resistant Gram-positive pathogens.
S. pneumonia를 제외한 4종의 균주는 nutrient broth에서, S. pneumonia의 경우 5% sheep blood가 포함된 trypticase soy agar에서 배양 후 GeneAll Cell SV kit (GeneAll biotechnology, Seoul, Korea)를 사용하여 genomic DNA를 추출하였다.Four strains excluding S. pneumonia were cultured in nutrient broth and in trypticase soy agar containing 5% sheep blood in the case of S. pneumonia, and genomic DNA was obtained using GeneAll Cell SV kit (GeneAll biotechnology, Seoul, Korea). Extracted.
<실시예 3-2> MLPA 수행<Example 3-2> MLPA performance
MLPA는 MRC-Holland(www.MLPA.com)에서 Lig-5a kit를 사용하였다.For MLPA, Lig-5a kit from MRC-Holland (www.MLPA.com) was used.
상기 각각의 균주 gDNA 5μL의 시료에 대하여 95℃에서 5분간 변성(denature)시킨 후 MLPA 버퍼(MRC Holland, Netherland) 1.5 μl, 약물 내성 그람 양성 병원균 검출용 프로브 1.5 μL를 넣고 60℃에서 16 시간 동안 반응시켜서 상기 시료의 표적 서열과 LHO, RHO 2개의 프로브를 혼성화시켰다.After denatured samples of 5 μL of each strain gDNA at 95° C. for 5 minutes, 1.5 μl of MLPA buffer (MRC Holland, Netherland) and 1.5 μL of a drug-resistant Gram-positive pathogen detection probe were added, and then at 60° C. for 16 hours. By reacting, the target sequence of the sample and two probes LHO and RHO were hybridized.
16 시간 동안 혼성화 후 시료의 반응온도를 54℃로 낮춘 후 Ligase 65 1μL, Ligase-65 버퍼 A, B를 각각 3μL, 3차 증류수 25μL를 넣은 후 54℃에서 15분간 반응시킴으로써 혼성 결합된 LHO, RHO 2개의 프로브를 라이게이션(ligation)시켜 프로브 어셈블리(probe assembly)가 형성되도록 하였다. 이후, 98℃에서 5분간 효소를 불활성화시켰다.After hybridization for 16 hours, the reaction temperature of the sample was lowered to 54°C, and 1 μL of
상기 형성된 프로브 어셈블리(probe assembly)를 LHO, RHO 2개의 프로브가 포함하는 프라이머 결합 영역에 공통 프라이머를 결합함으로써 PCR 증폭시켰다. 공통 프라이머는 정방향 프라이머(forward primer)로 GGGTTCCCTAAGGGTTGGA, 역방향 프라이머(reverse primer)로 GTGCCAGCAAGATCCAATCTAGA 를 사용하였다.The formed probe assembly was PCR amplified by binding a common primer to a primer binding region included in the two probes LHO and RHO. A common primer was GGGTTCCCTAAGGGTTGGA as a forward primer, and GTGCCAGCAAGATCCAATCTAGA was used as a reverse primer.
상기 형성된 프로브 어셈블리(probe assembly) 4μL와 공통 프라이머인 정방향 프라이머 10mM, 역방향 프라이머 10mM에 3차 증류수를 사용하여 20μL로 조절한 혼합액을 pfu-PCR premix (Bioneer, Daejoen, Korea)를 사용하여 95℃에서 30초, 60℃에서 30초, 72℃에서 30초를 35회 수행하여 라이게이션(ligation) 된 프로브 어셈블리(probe assembly)를 증폭시켰다.A mixture of 4 μL of the formed probe assembly and a common primer of 10 mM forward primer and 10 mM reverse primer and adjusted to 20 μL using tertiary distilled water at 95°C using a pfu-PCR premix (Bioneer, Daejoen, Korea). The ligated probe assembly was amplified by performing 35 times of 30 seconds, 30 seconds at 60°C, and 30 seconds at 72°C.
<실시예 3-3> 증폭 산물의 CE-SSCP를 통한 검출<Example 3-3> Detection of amplification products through CE-SSCP
얻어진 스터퍼 프리(suffer free) MLPA 산물을 3차 증류수를 사용하여 희석 후 시료 1 μL와 size standard(Applied Biosystem, Foster City, CA) 0.3 μL, deionized formamide 8.7 μL를 혼합한 후 95℃에서 5분간, 4℃에서 4분간 반응시켰다. 이 시료를 Genetic analyzer 3130 xl (Applied Biosystem)를 사용하여 CE-SSCP의 결과를 확인하였다.After diluting the obtained stuffer free MLPA product with tertiary distilled water, 1 μL of sample, 0.3 μL of size standard (Applied Biosystem, Foster City, CA), and 8.7 μL of deionized formamide were mixed and then mixed at 95°C for 5 minutes. And reacted at 4° C. for 4 minutes. The result of CE-SSCP was confirmed by using this sample with Genetic analyzer 3130 xl (Applied Biosystem).
도 3은 본 발명의 실시예 3에서 약물 내성 그람 양성 병원균 검출용 프로브를 개별적으로 사용하여 MLPA를 수행하고, 증폭된 프로브 어셈블리(probe assembly)를 CE-SSCP를 이용하여 분석한 결과를 나타낸 도면이다.FIG. 3 is a diagram showing the results of performing MLPA by individually using a probe for detecting drug-resistant Gram-positive pathogens in Example 3 of the present invention, and analyzing the amplified probe assembly using CE-SSCP. .
도 3에서 본 발명에 따른 약물 내성 그람 양성 병원균 검출용 프로브는 각각의 유전자에 대해 특이적인 피크를 나타내는 것을 확인할 수 있다. 또한, 복수의 프로브를 사용하는 경우에도 해당 균주를 독립적으로 동시에 검출할 수 있으며 분석할 수 있음을 확인할 수 있다.In Figure 3, it can be seen that the probe for detecting drug-resistant Gram-positive pathogens according to the present invention exhibits a specific peak for each gene. In addition, it can be seen that even when a plurality of probes are used, the corresponding strain can be independently and simultaneously detected and analyzed.
도 4는 질병관리 본부 및 서울성모병원에서 수집한 임상에서 분리된 60종의 병원균을 약물 내성 그람 양성 병원균의 검출 방법의 특이성을 확인한 결과를 정리한 것이다. 도 4에서 임상에서 분리된 60개의 병원균에서 40종은 그람 양성으로써, 그중 8종은 MRSA, 2종은 MSSA, 8종은 VREfm, 2종은 VSEfm 및 20종은 S. pneumonia인 것으로 확인되었고, 20종은 그람 음성으로써, 그중 1종은 Escherichia coli, 8종은 Klebsiella pnuemoniae , 3종은 Pseudomonas aeruginosa, 및 8 Acinetobacter baumannii인 것으로 확인되었다. 도 4에서 알 수 있듯이, 본 발명의 약물 내성 그람 양성 병원균을 검출하는 프로브가 높은 민감도를 가지는 것을 알 수있었다. 4 is a summary of the results of confirming the specificity of the detection method of drug-resistant Gram-positive pathogens of 60 pathogens isolated in clinical practice collected at the Centers for Disease Control and Prevention and Seoul St. In Figure 4, 40 species were Gram-positive from 60 pathogens isolated in clinical practice, of which 8 were MRSA, 2 were MSSA, 8 were VREfm, 2 were VSEfm, and 20 were S. pneumonia . 20 species are Gram-negative, one of which is Escherichia coli , 8 species Klebsiella pnuemoniae , 3 species Pseudomonas aeruginosa , and 8 Acinetobacter baumannii . As can be seen from Figure 4, it was found that the probe for detecting the drug-resistant Gram-positive pathogen of the present invention has high sensitivity.
<실시예 4> 예비증폭(preamplification) 과정을 첨가한 검출 실험<Example 4> Detection experiment with preamplification process added
<실시예 4-1> 예비 증폭(preamplication)의 수행<Example 4-1> Performing preamplication
상기 명시된 종 특이적 염기서열을 포함한 영역을 예비 증폭하기 위하여 유전자 특이적 프라이머를 'primer3(http://frodo.wi.mit.edu/)'를 사용하여 디자인하였으며, 그 결과를 표 3에 나타내었다.In order to pre-amplify the region including the above-specified species-specific nucleotide sequence, a gene-specific primer was designed using'primer3 (http://frodo.wi.mit.edu/)', and the results are shown in Table 3 I got it.
상기 실시예 3에서 준비된 균주로부터 분리된 시료를 Genomic DNA 5μL와 상기 표 3의 합성된 정방향 프라이머 (forward primer), 역방향 프라이머(reverse primer)를 각 10mM 씩 넣고 3차 증류수를 사용하여 20μL로 조절한 혼합액을 High fidelity DNA polymerase kit (New England Biolabs, DNA using a high-fidelity DNA polymerase kit (New England Biolabs, Ipswich)를 사용하여 98℃ 10초 (initial denaturation) 하고 98℃ 30초 (denaturation), 53℃ 30초 (annealing), 72℃ 60초를 30회 수행하여 프로브 특이적 염기서열을 포함한 영역을 예비 증폭시켰다.5 μL of genomic DNA and 10 mM of the synthesized forward primer and reverse primer of Table 3 were added to the sample isolated from the strain prepared in Example 3, and adjusted to 20 μL using third distilled water. The mixture was mixed with a High fidelity DNA polymerase kit (New England Biolabs, DNA using a high-fidelity DNA polymerase kit (New England Biolabs, Ipswich) at 98℃ for 10 seconds (initial denaturation) and 98℃ for 30 seconds (denaturation), 53℃. The region including the probe-specific nucleotide sequence was pre-amplified by performing 30 seconds (annealing) and 72°C for 60 seconds 30 times.
<실시예 4-2> 희석 농도에 따른 Genomic DNA 예비 증폭(preamplication)의 수행<Example 4-2> Genomic DNA preamplification according to the dilution concentration (preamplication)
약물 내성 그람 양성 병원균 검출용 프로브의 민감도를 측정하기 위해 상기 실시예 3에서 준비된 균주로부터 분리된 Genomic DNA의 농도를 1ng 내지 1fg으로 희석하여 실시예 4-1과 같은 방법으로 프로브 특이적 염기서열을 포함한 영역을 예비 증폭시켰다.In order to measure the sensitivity of the probe for detecting drug-resistant Gram-positive pathogens, the concentration of genomic DNA isolated from the strain prepared in Example 3 was diluted to 1 ng to 1 fg, and a probe-specific nucleotide sequence was prepared in the same manner as in Example 4-1. The included region was pre-amplified.
<실시예 4-3> MLPA 수행<Example 4-3> MLPA performance
MLPA는 MRC-Holland(www.MLPA.com)에서 Lig-5a kit를 사용하였다.For MLPA, Lig-5a kit from MRC-Holland (www.MLPA.com) was used.
상기 예비 증폭된 증폭산물 5 μL 의 시료에 대하여 95℃에서 5분간 변성(denature)시킨 후 MLPA 버퍼(MRCHolland, Netherland) 1.5 μL, 상기 실시예 3에서 제조된 약물 내성 그람 양성 병원균 검출용 프로브 혼합액 1.5 μL를 넣은 후 60℃에서 상기 시료의 표적 서열과 LHO, RHO 2개의 프로브를 1시간, 2시간, 4시간, 8시간, 16시간으로 혼성화 시간을 달리하면서 혼성화시켰다.A sample of 5 μL of the pre-amplified amplification product was denatured at 95°C for 5 minutes, and then 1.5 μL of MLPA buffer (MRCHolland, Netherland), and the probe mixture for detecting drug-resistant Gram-positive pathogens prepared in Example 3 1.5 After adding μL, the target sequence of the sample and two probes of LHO and RHO were hybridized at 60° C. with different hybridization times of 1 hour, 2 hours, 4 hours, 8 hours, and 16 hours.
혼성화 후 시료의 반응온도를 54℃로 낮춘 후 Ligase 65 1μL, Ligase-65 버퍼 A, B를 각각 3μL, 3차 증류수 25μL를 넣은 후 54℃에서 15분간 반응시킴으로써 혼성 결합된 LHO, RHO 2개의 프로브를 라이게이션(ligation)시켜 프로브 어셈블리(probe assembly)가 형성되도록 하였다. 이후, 98℃에서 5분간 효소를 불활성화시켰다.After hybridization, the reaction temperature of the sample was lowered to 54℃, and then 1 μL of
상기 형성된 프로브 어셈블리(probe assembly)를 LHO, RHO 2개의 프로브가 포함하는 프라이머 결합 영역에 공통 프라이머를 결합함으로써 PCR 증폭시켰다. 공통 프라이머는 정방향 프라이머(forward primer)로 GGGTTCCCTAAGGGTTGGA, 역방향 프라이머(reverse primer)로 GTGCCAGCAAGATCCAATCTAGA 를 사용하였다.The formed probe assembly was PCR amplified by binding a common primer to a primer binding region included in the two probes LHO and RHO. A common primer was GGGTTCCCTAAGGGTTGGA as a forward primer, and GTGCCAGCAAGATCCAATCTAGA was used as a reverse primer.
형성된 프로브 어셈블리(probe assembly) 4μL와 공통 프라이머인 정방향 프라이머 10mM, 역방향 프라이머 10mM에 3차 증류수를 사용하여 20ml로 조절한 혼합액을 pfu-PCR premix (Bioneer, Daejoen, Korea)를 사용하여 95℃에서 30초, 60℃에서 30초, 72℃에서 30초를 35회 수행하여 라이게이션(ligation) 된 프로브 어셈블리(probe assembly)를 증폭시켰다.A mixture of 4 μL of the formed probe assembly and a common primer, 10 mM of forward primer and 10 mM of reverse primer, adjusted to 20 ml with tertiary distilled water, was prepared at 95° C. for 30 using pfu-PCR premix (Bioneer, Daejoen, Korea). Second, 30 seconds at 60°C and 30 seconds at 72°C were performed 35 times to amplify the ligated probe assembly.
<실시예 4-4> 증폭 산물의 CE-SSCP를 통한 검출<Example 4-4> Detection of amplification products through CE-SSCP
상기 실시예 4-2 및 4-3에서 얻어진 증폭된 스터퍼 프리(stuffer free) MLPA 산물을 3차 증류수를 사용하여 희석 후 시료 1 μL와 size standard(Applied Biosystem, Foster City, CA) 0.3 μL, deionized formamide 8.7 μL를 혼합한 후 95℃에서 5분간, 4℃에서 4분간 반응시켰다. 이 시료를 Genetic analyzer 3130 xl (Applied Biosystem)를 사용하여 CE-SSCP의 결과를 확인하였다.After diluting the amplified stuffer free MLPA product obtained in Examples 4-2 and 4-3 with tertiary distilled water, 1 μL of sample and 0.3 μL of size standard (Applied Biosystem, Foster City, CA), 8.7 μL of deionized formamide was mixed and reacted at 95°C for 5 minutes and 4°C for 4 minutes. The result of CE-SSCP was confirmed by using this sample with Genetic analyzer 3130 xl (Applied Biosystem).
도 5는 상기 표 3에서의 약물 내성 그람 양성 병원균 검출용 프라이머를 사용하여 실시예 3에서 준비된 균주로부터 분리된 Genomic DNA의 농도를 100pg, 10pg, 1pg, 100fg 및 10fg로 희석하여 예비 증폭하고, 증폭된 영역에 대하여 스터퍼 프리(stuffer free) MLPA-CE-SSCP를 수행하여 분석한 결과이다. 도 5에서 볼 수 있듯이, 실시예 3에서 준비된 균주로부터 분리된 Genomic DNA의 농도를 100 pg, 10 pg, 1 pg, 100 fg 및 10 fg로 희석하여 예비 증폭 후 스터퍼 프리(stuffer free) MLPA를 수행하였을 때에도 상기 실시예 3에서의 도 3와 같이 Genomic DNA의 농도 10pg에서도 검출되는 것을 알 수 있었다. 5 is a preliminary amplification by diluting the concentration of genomic DNA isolated from the strain prepared in Example 3 to 100 pg, 10 pg, 1 pg, 100 fg and 10 fg using the primers for detecting drug-resistant Gram-positive pathogens in Table 3 above, and amplifying This is the result of analysis by performing stuffer free MLPA-CE-SSCP on the area. As can be seen in FIG. 5, the concentration of Genomic DNA isolated from the strain prepared in Example 3 was diluted to 100 pg, 10 pg, 1 pg, 100 fg and 10 fg to prepare a stuffer free MLPA after preliminary amplification. Even when performed, as shown in FIG. 3 in Example 3, it was found that the concentration of genomic DNA was also detected at 10 pg.
도 6은 상기 표 3에서의 약물 내성 그람 양성 병원균 검출용 프라이머를 사용하여 예비 증폭하고, 증폭된 영역에 대하여 스터퍼 프리(stuffer free) MLPA-CE-SSCP를 수행하여 분석한 결과이다. 도 6에서 볼 수 있듯이, 본 발명에 의하여 예비 증폭 후 스터퍼 프리(stuffer free) MLPA를 수행하였을 때에도 상기 실시예 3에서의 도 3과 같이 5개의 균주의 동시 검출이 가능함을 알 수 있으며, 또한 혼성화 시간이 8시간인 경우에도 5개 균주의 동시 검출이 가능함을 확인할 수 있었다.6 is a result of preliminary amplification using the primers for detecting drug-resistant Gram-positive pathogens in Table 3, and analysis of the amplified region by performing stuffer free MLPA-CE-SSCP. As can be seen in FIG. 6, it can be seen that even when stuffer-free MLPA is performed after preliminary amplification according to the present invention, as shown in FIG. 3 in Example 3, simultaneous detection of five strains is possible. Even when the hybridization time was 8 hours, it was confirmed that simultaneous detection of 5 strains was possible.
<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them <130> 1061365 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc LHS <400> 1 caacatcacg aaattcctta catgacctcg 30 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc RHS <400> 2 gtttagttca cagaagccgt gttctcatc 29 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA LHS <400> 3 ggtcaataat gtcccagcta gaatgcagta tgaaa 35 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA RHS <400> 4 aaataacggc tcacagcatg gaacaact 28 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA LHS <400> 5 cctgcttcga ccttcaaaat gcttaatgct ttg 33 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA RHS <400> 6 atcggccttg agcaccataa ggcaac 26 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA LHS <400> 7 ggctcaggta ctgctatcca ccctcaa 27 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA RHS <400> 8 acaggtgaat tattagcact tgtaagcaca cc 32 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA LHS <400> 9 catcctaaaa aaggtgtaga gaaatatggt cct 33 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA RHS <400> 10 gaagcaagtg catttacgaa aaagatggt 29 <210> 11 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus <400> 11 caacatcacg aaattcctta catgacctcg gtttagttca cagaagccgt gttctcatc 59 <210> 12 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> MRSA <400> 12 ggtcaataat gtcccagcta gaatgcagta tgaaaaaata acggctcaca gcatggaaca 60 act 63 <210> 13 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium <400> 13 cctgcttcga ccttcaaaat gcttaatgct ttgatcggcc ttgagcacca taaggcaac 59 <210> 14 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> VREfm <400> 14 ggctcaggta ctgctatcca ccctcaaaca ggtgaattat tagcacttgt aagcacacc 59 <210> 15 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae <400> 15 catcctaaaa aaggtgtaga gaaatatggt cctgaagcaa gtgcatttac gaaaaagatg 60 gt 62 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc Forward <400> 16 tacggcaacc tctttccatc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc Reverse <400> 17 catgcccttc tccctttgta 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA Forward <400> 18 agcggtaaac gatttgttgg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA Reverse <400> 19 gatagacttg gcgcccataa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA Forward <400> 20 agctcagcaa atgcatcaca 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA Reverse <400> 21 agccaagcct tgacgaacta 20 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA Forward <400> 22 ggctatcgtg tcacaatcgt t 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA Reverse <400> 23 tggaacttgt tgagcagagg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA Forward <400> 24 caaatcacag cgcttcaaaa 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA Reverse <400> 25 aaccaacacg cttcacttcc 20 <110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them <130> 1061365 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc LHS <400> 1 caacatcacg aaattcctta catgacctcg 30 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc RHS <400> 2 gtttagttca cagaagccgt gttctcatc 29 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA LHS <400> 3 ggtcaataat gtcccagcta gaatgcagta tgaaa 35 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA RHS <400> 4 aaataacggc tcacagcatg gaacaact 28 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA LHS <400> 5 cctgcttcga ccttcaaaat gcttaatgct ttg 33 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA RHS <400> 6 atcggccttg agcaccataa ggcaac 26 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA LHS <400> 7 ggctcaggta ctgctatcca ccctcaa 27 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA RHS <400> 8 acaggtgaat tattagcact tgtaagcaca cc 32 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA LHS <400> 9 catcctaaaa aaggtgtaga gaaatatggt cct 33 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA RHS <400> 10 gaagcaagtg catttacgaa aaagatggt 29 <210> 11 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus <400> 11 caacatcacg aaattcctta catgacctcg gtttagttca cagaagccgt gttctcatc 59 <210> 12 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> MRSA <400> 12 ggtcaataat gtcccagcta gaatgcagta tgaaaaaata acggctcaca gcatggaaca 60 act 63 <210> 13 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium <400> 13 cctgcttcga ccttcaaaat gcttaatgct ttgatcggcc ttgagcacca taaggcaac 59 <210> 14 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> VREfm <400> 14 ggctcaggta ctgctatcca ccctcaaaca ggtgaattat tagcacttgt aagcacacc 59 <210> 15 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae <400> 15 catcctaaaa aaggtgtaga gaaatatggt cctgaagcaa gtgcatttac gaaaaagatg 60 gt 62 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc Forward <400> 16 tacggcaacc tctttccatc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Staphylococcus aureus nuc Reverse <400> 17 catgcccttc tccctttgta 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA Forward <400> 18 agcggtaaac gatttgttgg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MRSA mecA Reverse <400> 19 gatagacttg gcgcccataa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA Forward <400> 20 agctcagcaa atgcatcaca 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium sodA Reverse <400> 21 agccaagcct tgacgaacta 20 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA Forward <400> 22 ggctatcgtg tcacaatcgt t 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VREfm vanA Reverse <400> 23 tggaacttgt tgagcagagg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA Forward <400> 24 caaatcacag cgcttcaaaa 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus pneumoniae lytA Reverse <400> 25 aaccaacacg cttcacttcc 20
Claims (11)
상기 표적 서열의 상기 제1 영역과 연속으로 연결된 제2 영역에 특이적으로 혼성화하는 RHS(right hybridization sequence) 및 역방향 프라이머 결합 영역을 포함하는 RPO(right probe oligonucleotide);로 구성되고,
상기 LHS(left hybridization sequence) 및 상기 RHS(right hybridization sequence)가 서열번호 7 및 서열번호 8인 제4 프로브인 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium) 검출용 프로브.An LPO (left probe oligonucleotide) comprising a forward primer binding region and a left hybridization sequence (LHS) region that specifically hybridizes to a first region of the target sequence; And
And a right probe oligonucleotide (RPO) comprising a right hybridization sequence (RHS) and a reverse primer binding region that specifically hybridize to a second region continuously connected to the first region of the target sequence,
A probe for detecting vancomycin-resistant Enterococcus faecium in which the LHS (left hybridization sequence) and the RHS (right hybridization sequence) are involved in sepsis, which is a fourth probe of SEQ ID NO: 7 and SEQ ID NO:
상기 서열번호 7 및 서열번호 8인 제4 프로브는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium )의 유전자 vanA의 서열 번호 14에 특이적으로 혼성 결합 하는 것을 특징으로 하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium) 검출용 프로브.3. The method of claim 2,
The fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8 is selected from the group consisting of Vancomycin-resistant Enterococci faecium vanA gene of SEQ ID NO: 14, specific to the hybrid coupling vancomycin-resistant Enterococcus passive help (Vancomycin-resistant Enterococci faecium) detection probe to participate in sepsis, characterized in that a).
(1) 시료를 예비 증폭시키는 단계;
(2) 예비 증폭된 시료를 제1항의 패혈증에 관여하는 약물 내성 그람 양성 병원균 프로브와 접촉시켜 혼성화시키는 단계;
(3) 상기 시료와 혼성화된 프로브를 라이게이션(ligation)하여 프로브 어셈블리(probe assembly)를 형성시키는 단계;
(4) 상기 형성된 프로브 어셈블리(probe assembly)를 주형으로 하여 PCR 증폭시키는 단계;
(5) 상기 증폭 산물을 분리 및 검출하는 단계; 및
(6) 상기 증폭 산물이 분리, 검출되는 경우 상기 시료 내에 상기 증폭된 프로브 어셈블리(probe assembly)를 구성하는 프로브가 상보적으로 결합하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)이 존재하는 것으로 판단하는 단계.CLAIMS What is claimed is: 1. A method for detecting the presence of vancomycin-resistant Enterococci faecium, which is involved in sepsis, comprising the steps of:
(1) pre-amplifying the sample;
(2) hybridizing the preamplified sample with a drug resistant Gram-positive pathogen probe involved in the sepsis of claim 1;
(3) ligation of a probe hybridized with the sample to form a probe assembly;
(4) PCR amplifying the formed probe assembly as a template;
(5) separating and detecting the amplification product; And
(6) When the amplification product is separated and detected, the probe constituting the amplified probe assembly complementarily binds to the sample, and the vancomycin-resistant Enterococcus faecium ) Is present.
상기 (1) 단계의 시료를 예비 증폭시키는 단계에서는 서열번호 22 및 서열번호 23으로 구성되고 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 유전자 vanA의 제1 영역 및 제2 영역을 증폭하는 제 4 프라이머 세트;
를 이용하여 시료 내의 균주의 표적 서열의 제1 영역 및 상기 제1 영역과 연속으로 연결된 제2 영역을 증폭시키는 것을 특징으로 하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium) 존재를 검출하는 방법.5. The method of claim 4,
In the step of preliminarily amplifying the sample of step (1), amplification of the first region and the second region of the gene vanA of Vancomycin-resistant Enterococci faecium, consisting of SEQ ID NO: 22 and SEQ ID NO: 23, A fourth primer set;
Wherein the first region of the target sequence of the strain in the sample and the second region continuously connected to the first region are amplified using the Vancomycin-resistant Enterococci faecium-containing vancomycin-resistant enterococci faecium / RTI >
상기 (2) 단계에서, 상기 시료의 표적 서열 제1 영역과 상기 LPO 프로브의 LHS가 혼성화되고, 상기 시료의 표적 서열 제2 영역과 상기 RPO 프로브의 RHS 가 혼성화되는 것을 특징으로 하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 존재를 검출하는 방법.5. The method of claim 4,
Characterized in that in the step (2), the target sequence first region of the sample and the LHS of the LPO probe are hybridized, and the target sequence second region of the sample and the RHS of the RPO probe are hybridized. A method for detecting the presence of vancomycin-resistant enterococci faecium.
상기 (2) 단계에서 4시간 내지 20시간 동안 혼성화되는 것을 특징으로 하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 존재를 검출하는 방법.5. The method of claim 4,
Wherein the hybridization is carried out for 4 to 20 hours in the step (2). The method for detecting the presence of vancomycin-resistant enterococci faecium.
상기 (3) 단계에서, 상기 시료의 제1 영역과 혼성 결합된 LPO의 LHS의 말단과 상기 시료의 제2 영역과 혼성 결합된 RPO의 RHS의 말단을 라이게이션(ligation)하여 정방향 프라이머 결합 영역-LHS-RHS-역방향 프라이머 결합 영역으로 구성된 프로브 어셈블리(probe assembly)를 형성하는 것을 특징으로 하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 존재를 검출하는 방법.5. The method of claim 4,
In the step (3), the end of the RHS of the RPO hybridized with the end of the LHS of the LPO hybridized with the first region of the sample and the second region of the sample is ligated to form a forward primer binding region- LHS-RHS-reverse primer binding region, wherein the Vancomycin-resistant Enterococcus faecium is associated with sepsis.
상기 (4) 단계에서, 상기 프로브 어셈블리(probe assembly)를 구성하는 LPO(left probe oligonucleotide)가 포함하는 정방향 프라이머 결합 영역, 및 RPO(right probe oligonucleotide)가 포함하는 역방향 프라이머 결합 영역에 상보적으로 결합하는 프라이머 세트를 사용하여 상기 형성된 프로브 어셈블리(probe assembly)가 PCR 증폭되는 것을 특징으로 하는 패혈증에 관여하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 존재를 검출하는 방법.5. The method of claim 4,
In the step (4), the forward primer binding region included in the left probe oligonucleotide (LPO) constituting the probe assembly and the reverse primer binding region included in the right probe oligonucleotide (RPO) Wherein the probe assembly is PCR-amplified using a primer set that is capable of detecting the presence of vancomycin-resistant Enterococcus faecium.
상기 (5) 단계에서, 프로브 어셈블리(probe assembly)를 주형으로 하여 PCR 증폭된 정도를 CE-SSCP(Capillary Electrophoresis-Single strand conformation polymorphism)를 이용하여 분리 및 검출하는 것을 특징으로 하는 반코마이신 내성 엔테로코커스 패시움(Vancomycin-resistant Enterococci faecium)의 존재를 검출하는 방법.5. The method of claim 4,
In the step (5), the degree of PCR amplification is separated and detected using CE-SSCP (Capillary Electrophoresis-Single strand conformation polymorphism) using a probe assembly as a template, and the vancomycin resistant enterococcus pass A method for detecting the presence of Vancomycin-resistant Enterococci faecium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020170137449A KR20180033112A (en) | 2017-10-23 | 2017-10-23 | Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020170137449A KR20180033112A (en) | 2017-10-23 | 2017-10-23 | Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020160122126A Division KR101838614B1 (en) | 2016-09-23 | 2016-09-23 | Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR20180033112A true KR20180033112A (en) | 2018-04-02 |
Family
ID=61976194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020170137449A KR20180033112A (en) | 2017-10-23 | 2017-10-23 | Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR20180033112A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536626A (en) * | 2018-12-29 | 2019-03-29 | 北京卓诚惠生生物科技股份有限公司 | For detecting the nucleic acid reagent, kit, system and method for Gram-negative bacteria and/or Gram-negative bacteria drug resistance |
| CN112852938A (en) * | 2021-03-29 | 2021-05-28 | 中国农业大学 | Primer group for gram-positive bacterium drug-resistant gene high-throughput amplicon sequencing and application |
-
2017
- 2017-10-23 KR KR1020170137449A patent/KR20180033112A/en not_active Application Discontinuation
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536626A (en) * | 2018-12-29 | 2019-03-29 | 北京卓诚惠生生物科技股份有限公司 | For detecting the nucleic acid reagent, kit, system and method for Gram-negative bacteria and/or Gram-negative bacteria drug resistance |
| CN109536626B (en) * | 2018-12-29 | 2021-09-17 | 北京卓诚惠生生物科技股份有限公司 | Nucleic acid reagent, kit, system and method for detecting gram-negative bacteria and/or gram-negative bacteria drug resistance |
| CN112852938A (en) * | 2021-03-29 | 2021-05-28 | 中国农业大学 | Primer group for gram-positive bacterium drug-resistant gene high-throughput amplicon sequencing and application |
| CN112852938B (en) * | 2021-03-29 | 2022-06-21 | 中国农业大学 | Primer group for gram-positive bacterium drug-resistant gene high-throughput amplicon sequencing and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4176146B2 (en) | Specific and universal probes and amplification primers for the rapid detection and identification of common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories | |
| US20100255474A1 (en) | Method for Detecting Bacteria and Fungi | |
| JP5565781B2 (en) | Method for detecting pneumonia-causing bacteria using nucleic acid chromatography | |
| JP2013520186A (en) | Assays and kits for serotyping of Pseudomonas aeruginosa and oligonucleotide sequences useful in such methods and kits | |
| US20110287965A1 (en) | Methods and compositions to detect clostridium difficile | |
| KR20180033112A (en) | Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them | |
| KR101838614B1 (en) | Probe for detecting drug resistant gram-positive pathogens, probe set and a method for detecting drug resitant gram-positive pathogens using them | |
| JP5204466B2 (en) | Method for detecting Mycoplasma pneumoniae | |
| KR101752153B1 (en) | PNA probe for detecting Yersinia pestis having resistance against ciprofloxacin antibiotic and the uses thereof | |
| JP6518110B2 (en) | Primer and method for detecting Klebsiella pneumoniae (Klebsiellapneumoniae) | |
| JP2006508669A (en) | Method for detection of pathogenic Gram-positive bacteria selected from Staphylococcus, Enterococcus, and Streptococcus | |
| US10415096B2 (en) | Method for simultaneous detection of bacteria and fungi in a biological preparation by PCR, primers as well as bacteria and fungi detection kit | |
| KR101373756B1 (en) | Primers for molecular identification of Staphylococcus aureus and method for identifying Staphylococcus aureus using the same | |
| Krawczyk et al. | ADSRRS-fingerprinting and PCR MP techniques for studies of intraspecies genetic relatedness in Staphylococcus aureus | |
| EP3348651A1 (en) | Rapid antimicrobial susceptibility testing and phylogenetic identification | |
| KR101960016B1 (en) | Composition for detecting pathogens of respiratory disease, and using the same | |
| JP2016189726A (en) | Primer for detecting streptococcus uberis, and method | |
| KR20140145789A (en) | probes for detecting respiratory tract infectious pathogens, and a method for detecting respiratory tract infectious pathogen using the same | |
| KR101347735B1 (en) | Probe, Probe Set For Food Borne Pathogens And The Detecting Method Thereof | |
| AU2006315715A1 (en) | Identification of USA300 community-associated methicillin-resistant staphylococcus aureus | |
| JP6661963B2 (en) | How to detect staphylococci | |
| KR101572041B1 (en) | Probe composition for detecting food borne pathogens | |
| JP2007075017A (en) | Method for detecting campylobacter jejuni | |
| JP2005110545A (en) | Method for quickly detecting pathogenic bacteria for respiratory tract infection and kit therefor | |
| Peker | Diagnosis of bloodstream infections from positive blood cultures: recent developments in molecular approaches |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A107 | Divisional application of patent | ||
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E90F | Notification of reason for final refusal | ||
| E601 | Decision to refuse application |