KR20170113239A - Single Nucleotide Polymorphisms Associated With Korean Prostate Cancer And Development Of Genetic Risk Score Using Thereof - Google Patents

Abstract

The present invention relates to a method for detecting the sensitivity of a prostate cancer, comprising at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 < th > base of any one of SEQ ID NOS: 1-11, Or prognostic polynucleotides and their uses.

Description

[0001] The present invention relates to the use of a single nucleotide polymorphism (SNP) associated with prostate cancer,

The present invention relates to single nucleotide polymorphisms (SNPs) associated with prostate cancer and their use, and more particularly to SNPs present at the 8q21-24, 17q12, or 19q13 sites of the human genome, the susceptibility or prognosis of prostate cancer A kit, a microarray, and a method for providing information useful for judging the susceptibility or prognosis of prostate cancer.

Prostate cancer is one of the most common cancers in American men and is the leading cause of cancer-related deaths. The incidence of prostate cancer and the resulting mortality rate vary widely across the globe, with the highest incidence of males in developed countries, and the highest mortality rate among African Americans, while the incidence and mortality rate of Asians is relatively low. This racial difference suggests that the onset of prostate cancer may be due to genetic heterogeneity as well as environmental differences.

A meta-analysis of the level of genomes associated with prostate cancer has identified a number of common susceptibility loci, but genome-wide association studies (GWAS) have been performed mostly on Europeans, Only 10 loci were identified as novel prostate cancer risk loci through large meta-analyzes of East Asian (Japanese and Chinese) groups. Therefore, it is urgently required to develop a new marker that can provide useful information for the susceptibility and prognosis of prostate cancer through the study of genome level, especially in Korean patients.

Korean Patent Publication No. 201-0-822454 ("Single nucleotide polymorphism marker in CDH1 gene useful for judging susceptibility or prognosis of prostate cancer ", Korean Patent Publication No. 2015-0002237 (" Diagnosis of prostate cancer A biomarker for prostate cancer and a diagnosis of prostate cancer using the same), and the like. However, the use of the SNP marker of the present invention (for example, a biomarker and a prostate cancer diagnosis kit containing the same), Korean Patent Publication No. 2011-0042678 Is not known.

It is an object of the present invention to provide a single nucleotide polymorphism (SNP) marker that can be usefully used to determine the susceptibility or prognosis of prostate cancer.

Another object of the present invention is to provide a composition, a kit, and a microarray for determining the susceptibility or prognosis of a prostate cancer including or detecting the SNP.

It is still another object of the present invention to provide a method for providing information through a prostate gland scoring model useful for determining the susceptibility or prognosis of prostate cancer using the SNP marker.

In order to accomplish the above object, one embodiment of the present invention is a method for detecting a nucleotide sequence comprising 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 th base of the nucleotide sequence of any one of SEQ ID NOS: A polynucleotide comprising a complementary base sequence for determining the susceptibility or prognosis of prostate cancer.

The 26th base of SEQ ID NO: 1 is A, the 26th base of SEQ ID NO: 2 is T, the 26th base of SEQ ID NO: 3 is G, the 26th base of SEQ ID NO: The 26th base of SEQ ID NO: 6 is T, the 26th base of SEQ ID NO: 7 is A, the 26th base of SEQ ID NO: 8 is C, the 26th base of SEQ ID NO: Or the 26 th base of SEQ ID NO: 11 may be A.

Another embodiment of the present invention provides a composition for determining the susceptibility or prognosis of a prostate cancer comprising a primer, a probe or an antibody that specifically binds to a polynucleotide for determining the susceptibility or prognosis of the prostate cancer.

Another embodiment of the present invention provides a kit for assessing the susceptibility or prognosis of prostate cancer, comprising a composition for judging the sensitivity or prognosis of the prostate cancer.

In one embodiment, the kit comprises a polynucleotide consisting of at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 < th > base of SEQ ID NO: 1 or a complementary polynucleotide thereof A composition comprising a primer, probe or antibody that binds; A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 2 or a complementary polynucleotide thereof ; A primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 < th > base of SEQ ID NO: 6 or a complementary polynucleotide thereof ; A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 10 or a complementary polynucleotide thereof ; And a primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th base of the nucleotide sequence of SEQ ID NO: 11 or its complementary polynucleotide And a composition comprising the composition.

Another embodiment of the present invention is the use of a polynucleotide for determining the susceptibility or prognosis of said prostate cancer, a polynucleotide that hybridizes with said polynucleotide, a polypeptide specifically encoded by said polynucleotide, an antibody specific thereto, or a prostate cancer comprising cDNA of said polypeptide A microarray for judging susceptibility or prognosis is provided.

In one embodiment, the microarray comprises a polynucleotide consisting of at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 < th > base of SEQ ID NO: 1 or a complementary nucleotide sequence thereof, Lt; / RTI >polynucleotides; A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 2 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 6 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 10 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; And a polynucleotide consisting of 10 or more consecutive nucleotide sequences or a complementary nucleotide sequence thereof containing a SNP (single nucleotide polymorphism) located at the 26th base of the nucleotide sequence of SEQ ID NO: 11 or a polynucleotide which hybridizes with the polynucleotide.

Yet another embodiment of the present invention is a method for detecting a susceptibility of a prostate cancer to a SNP (single nucleotide polymorphism) located in the 26th base of one or more of the nucleotide sequences of SEQ ID NOS: 1-11 with respect to a nucleic acid sample obtained from a subject Or providing information useful for prognostic judgment.

The SNPs of SEQ ID NOS: 1 to 8 (each NCBI refSNP ID is rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 and rs4242384) are present in the 8q21-24 region of human genome, (NCBI refSNP IDs rs4430796 and rs7501939, respectively) are present in the HNF1B gene at the 17q12 site of the human genome and the SNP at position 11 (NCBI refSNP ID is rs2735839) at the 19q13 site of the human genome.

When the genotype of the 26 th base of SEQ ID NO: 1 is "A ", and the genotype of the 26 th base of SEQ ID NO: , The genotype of the 26 th base of SEQ ID NO: 4 is " A ", the genotype of the 26 th base of SEQ ID NO: 5 is " , The genotype of the 26 th base of SEQ ID NO: 7 is " A ", the genotype of the 26 th base of SEQ ID NO: 8 is "C & It can be predicted that the risk of developing prostate cancer is high when the genotype of the 26th base of the number 10 is "T ", or when the 26th base of the SEQ ID NO: 11 is the genotype" A ".

The confirming step may be a step of confirming a SNP (single nucleotide polymorphism) located in the 26th base of the nucleotide sequence of SEQ ID NOS: 1, 2, 6, 10 and 11.

In one embodiment, the method may further comprise performing a genetic risk score analysis for a SNP (single nucleotide polymorphism) located in the 26 th base of the nucleotide sequence of SEQ ID NO: 1, 2, 6, 10 and 11 have.

In addition, the genetic risk score analysis showed that for the five SNPs, homozygous of non-risk alleles were 0, heterozygous of alleles were 1, homozygous of the alleles risk alleles) can be given as a detailed score of 2 and analyzed based on the total cumulative score of each detailed score.

In addition, the subject may be Asian.

The present invention provides information to prevent, predict and prevent early detection of prostate cancer risk by providing a prostate cancer susceptibility locus at the genome level. In addition, the present invention can provide a composition for diagnosing prostate cancer, a diagnostic device, and the like, which can be usefully used for judging the sensitivity or prognosis of prostate cancer.

Figure 1 shows an overall experimental design for a two-step analysis of GRS.
Figure 2 shows an overall experimental design of prostate cancer GWAS using the exome array according to the present invention. The assays were classified into five comparison sub-sets according to the aggressiveness of prostate cancer.
Figure 3 is Manhattan plots at the discovery GWAS stage.
FIG. 4 shows the distribution of SNPs selected for each criterion in order to select 24 SNPs according to an embodiment of the present invention.
Figure 5 shows a QQ plot (Quantile-Quantile plot) showing no overall error in the GWAS step.
Figure 6 shows the aggregate data of Manhattan plots at the discovery GWAS stage.
Figure 7 shows a regional plot with an LD structure for chromosome region 8q24.21.
Figure 8 shows the frequency distribution for the Dielectric Risk Scoring Model (GRS).
Figure 9 shows the multiplication ratio of prostate cancer according to GRS.
Figure 10 shows the ROC curve showing the difference between the experimental group and the control group by the dielectric risk scoring model.

The present invention is characterized by providing a single nucleotide polymorphism (SNP) marker that can be usefully used to determine the susceptibility or prognosis of prostate cancer. In one embodiment of the invention, the SNP comprises eight SNPs (each of the NCBI refSNP IDs rs1512268, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 and rs4242384) present in the 8q21-24 region of the human genome, (NCBI refSNP IDs rs4430796 and rs7501939) present in the HNF1B gene in the 17q12 region of the human genome and one SNP (NCBI refSNP ID is rs2735839) present in the 19q13 region of the human genome. The SNPs are sites corresponding to the 26 th base of the nucleotide sequences of SEQ ID NOS: 1-11, respectively.

According to one aspect of the present invention, the present invention provides a method for the detection of a nucleotide sequence comprising at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 th base of at least one of the nucleotide sequences of SEQ ID NOS: 1-11, A polynucleotide for determining the susceptibility or prognosis of a prostate cancer composed of a sequence. In one embodiment of the present invention, the continuous base sequence is a sequence of 10 or more, preferably 10-100, most preferably 10-50 consecutive nucleotide sequences comprising the SNP (single nucleotide polymorphism) But is not limited thereto.

In the present specification, the SNPs of the present invention represented by the 26th bases of the nucleotide sequences of SEQ ID NOS: 1-11 are referred to as "rs1512268", "rs1016343", "rs13252298", "rs16901979", "rs1447295", "rs7837688" rs4242382 "," rs4242384 "," rs4430796 "," rs7501939 "," rs2735839 " Table 1 below shows the sequence and position of the refSNP ID of NCBI and corresponding SNP for the SNP marker provided in the present invention. Those skilled in the art can easily confirm the position and sequence of the SNP using the refSNP ID. However, the specific sequence of the refSNP ID registered in the NCBI may be partially changed according to the newly reported research result, and such changes should also be interpreted to be within the scope of the present invention.

NCBI refSNP ID order SEQ ID NO: rs1512268 AATGCAGATTGAGTTAAATTTGCAC [A / G] ATCTACAGAAAGGGTTTGCTTCACA One rs1016343 CAAGACCATGTGTTACATTTCCCTC [C / T] CATGATTACTCACAGCTTCACAGTT 2 rs13252298 CACTTGCTGTCTTCTCAGATACAAT [A / G] TCAGAAACTTATAATCCAAGAAAAA 3 rs16901979 GTGTTAATGATTTAGCATTACTTAT [A / C] TCTGGCAAATGGTATTTTTGAGATA 4 rs1447295 AGTGCCATTGGGGAGGTATGTAAAA [A / C] GTGCTATGGAAAAAAAGCAACAGGA 5 rs7837688 catttcccactagagtggtgcattt [G / T] gtacaattgggtctatgttgacacg 6 rs4242382 ATTTTGTCCCTCTAGTTATCTTCCC [A / G] CAGGCCCATCAAGAATCAGGCAGTA 7 rs4242384 AGTCCCATGCTAGAAGCTGCTTTAC [A / C] AACACAGTCAGCTGCTATCTCCACA 8 rs4430796 ATACAGAGAGGCAGCACAGACTGGA [A / G] ATGCTGCATAAAGCTTAAATTGGGC 9 rs7501939 GGTGTAGAGGCTGAAATAGATACAG [C / T] ATTGCAACATAATAAGCAATTTTAT 10 rs2735839 AGGGATCTGGTTCTGTCTTGTGGCC [A / G] AGTGGACCATGGGGCTATCCCAAGA 11

The "A" base in the "rs1512268" SNP (26th base in SEQ ID NO: 1), the "T" base in the "rs1016343" SNP (26th base in SEQ ID NO: 2), the "rs13252298" Quot; A " base in the "rs1447295" SNP (26th base in SEQ ID NO: 5), the "A" base in the "rs16901979" SNP (26th base in SEQ ID NO: , the "T" base in the "rs7837688" SNP (26th base in SEQ ID NO: 6), the "A" base in the "rs4242382" SNP (26th base in SEQ ID NO: 7), the "rs4242384" Quot; base " in the " rs7501939 "SNP (26th base in SEQ ID NO: 10), the" G "base in the" rs4430796 "SNP (26th base in SEQ ID NO: 9) , the frequency of the "A" base in the "rs2735839" SNP (26th base in SEQ ID NO: 11) is particularly high in patients with prostate cancer compared to normal persons, and thus it is judged that the presence of these bases is highly susceptible to prostate cancer . In addition, these bases have a strong correlation with malignant progression of cancer by appearing at a higher frequency in the stage of malignancy in patients with prostate cancer. Therefore, in the presence of the designated base at the SNP, the progression of the prostate cancer to the malignant stage is expected, which can be regarded as a bad prognosis.

The present invention relates to a base mutant at each SNP position in SEQ ID NOS: 1 to 11, but also includes a polynucleotide sequence complementary to the nucleotide sequence when such SNP base mutation is found in double-stranded gDNA (genomic DNA) .

According to another aspect of the present invention, there is provided a composition for determining the susceptibility or prognosis of a prostate cancer comprising the polynucleotide comprising the SNP of the present invention or a complementary polynucleotide thereof. In one embodiment of the present invention, there is provided a composition for judging the susceptibility or prognosis of a prostate cancer comprising a primer, a probe or an antibody that specifically binds to the polynucleotide of the present invention, and a kit comprising the same.

According to another aspect of the present invention, there is provided a kit for determining the susceptibility or prognosis of a prostate cancer comprising a primer, a probe or an antibody that specifically binds to the polynucleotide.

In one embodiment of the present invention, the binding refers to hybridization so that the base at the SNP site present in the polynucleotide sequence of the present invention can be specifically discriminated. In this case, the hybridization condition should be a condition that can be hybridized to only one of the alleles with a significant difference in the hybridization intensity. In one embodiment of the present invention, the primer may serve to amplify a DNA fragment containing a SNP region by hybridizing to a DNA sequence containing a SNP region of the present invention. Thus, it should be sufficiently complementary to hybridize with the template, and its length may generally be comprised of 15 to 30 bases, but is not limited thereto. In one embodiment of the present invention, the antibody refers to an antibody that specifically binds to a polypeptide comprising the SNP marker of the present invention, and the form of the antibody of the present invention is not particularly limited.

In one embodiment, the kit comprises a polynucleotide consisting of at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 < th > base of SEQ ID NO: 1 or a complementary polynucleotide thereof A composition comprising a primer, probe or antibody that binds; A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 2 or a complementary polynucleotide thereof ; A primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 < th > base of SEQ ID NO: 6 or a complementary polynucleotide thereof ; A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 10 or a complementary polynucleotide thereof ; And a primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th base of the nucleotide sequence of SEQ ID NO: 11 or a complementary polynucleotide thereof And a composition comprising the composition.

In accordance with another aspect of the present invention, the present invention provides a method for detecting the sensitivity or prognosis of a prostate cancer comprising the polynucleotide, a polynucleotide that hybridizes with the polynucleotide, a polypeptide specifically encoded by the polynucleotide, a specific antibody or cDNA of the polypeptide Thereby providing a judgment microarray. The microarray may be composed of a conventional microarray except that it contains the polynucleotide of the present invention, a polynucleotide that hybridizes with the polynucleotide of the present invention, a polypeptide specifically encoded thereby, an antibody specific thereto, or a cDNA of the polypeptide. Hybridization of the nucleic acid on the microarray and detection of the result of hybridization can be performed by a generally known method.

In one embodiment, the microarray comprises a polynucleotide consisting of at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 < th > base of SEQ ID NO: 1 or a complementary nucleotide sequence thereof, Lt; / RTI >polynucleotides; A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 2 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 6 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 10 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; And a polynucleotide consisting of 10 or more consecutive nucleotide sequences or a complementary nucleotide sequence thereof containing a SNP (single nucleotide polymorphism) located at the 26th base of the nucleotide sequence of SEQ ID NO: 11 or a polynucleotide which hybridizes with the polynucleotide.

According to another aspect of the present invention, there is provided a method for identifying a SNP (single nucleotide polymorphism) located in the 26th base sequence of any one of SEQ ID NOS: 1 to 11 with respect to a nucleic acid sample obtained from a subject Thereby providing information useful for judging the susceptibility or prognosis of the prostate cancer involved. Specifically, the confirming step may be a step of identifying a SNP (single nucleotide polymorphism) located in the 26 th base of the nucleotide sequence of SEQ ID NOS: 1, 2, 6, 10 and 11.

In one embodiment of the present invention, the nucleic acid sample includes both DNA (gDNA and cDNA) and RNA molecules, and can be obtained from various sources including the blood of a subject who is to determine the susceptibility or prognosis of prostate cancer, (2001); Ausubel, FM et al., Current Protocols in Molecular < RTI ID = 0.0 > Liberty F, et al., Science, 244: 1987, 1987). [0040] 569 (1989)).

In one embodiment of the invention, the SNPs of SEQ ID NOS: 1 to 8 (each NCBI refSNP ID is rs1512268, rs1016343, rs13252298, rs1447295, rs7837688, rs4242382 and rs4242384) are present in the 8q21-24 region of the human genome And the SNPs of SEQ ID NOS: 9 to 10 (the respective NCBI refSNP IDs are rs4430796 and rs7501939) are present in the HNF1B gene in the 17q12 region of the human genome and the SNP of SEQ ID NO: 11 (NCBI refSNP ID is rs2735839) Lt; RTI ID = 0.0 > 19q13 < / RTI >

In one embodiment of the present invention, the method is characterized in that when the genotype of the 26 th base of SEQ ID NO: 1 is "A ", when the genotype of the 26 th base of SEQ ID NO: 2 is & The genotype of the 26 th base of SEQ ID NO: 4 is " A ", the genotype of the 26 base of SEQ ID NO: 5 is " The genotype of the 26th nucleotide of SEQ ID NO: 7 is " A ", the genotype of the 26th nucleotide of SEQ ID NO: 8 is "C " Is predicted to have a high risk of developing prostate cancer when the genotype of the 26th nucleotide of SEQ ID NO: 10 is "T ", or when the 26th nucleotide of SEQ ID NO: 11 is" A " . ≪ / RTI >

In one embodiment of the invention, the method may be performed using a prostate cancer dielectric risk model. For example, the method may further comprise performing a genetic risk score analysis for a SNP (single nucleotide polymorphism) located in the 26 th base of the nucleotide sequence of SEQ ID NO: 1, 2, 6, 10 and 11 .

The prostate cancer risk risk model is a model in which a total of five SNPs (single nucleotide polymorphisms) are selected on the basis of linkage disequilibrium and scored based on the number of mutations of each SNP. Specifically, the genetic risk score analysis showed that for the five SNPs, homozygous of non-risk alleles were 0, heterozygous of alleles were 1, homozygous of alleles the risk alleles) is given by 2 as a detailed score, and is analyzed based on the total cumulative score of each detailed score.

In one embodiment of the present invention, the step of identifying the SNP (single nucleotide polymorphism) may be performed using a generally known nucleotide sequence analysis method. For example, sequencing analysis using an automatic sequencer, PCR-RELP, pyrosequencing, microarray hybridization, TaqMan-PCR, fluorescence in situ hybridization (FISH), PFGE analysis, Southern blot analysis, single- Known methods such as analysis, RNase protection analysis, dot blot analysis, using a protein recognizing a nucleotide mismatch, allele-specific PCR, denaturing gradient gel electrophoresis, and the like can be used.

The present study was based on a study of the genomic level of Korean patients. However, polynucleotides, compositions, kits, microarrays for determining the susceptibility or prognosis of prostate cancer using single base polymorphisms associated with prostate cancer of the present invention, and information providing methods useful for judging the sensitivity or prognosis of prostate cancer, It will be apparent to those skilled in the art that the present invention can be applied to all races including black races.

Preferably, the information providing method useful for judging the sensitivity or prognosis of the prostate cancer of the present invention can be applied to Asian people. In the present invention, "Asian" means a person originating from the mainland people of China, Mongolia, Taiwan, Singapore, Korea, Japan, Vietnam, Cambodia, Laos, Burma, Thailand, Malaysia, Indonesia and the Philippines.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example >

Subjects and Methods

1. Subject

This study was conducted with the two-step design shown in Fig. In Phase I, we used 1,001 PCa samples and 2,641 population controls to find markers related to Koreans and investigate previously identified GWAS SNPs in other ethnic groups. GRS was calculated based on the SNPs validated in step I in step II.

In Phase I, blood samples were taken from 1,001 prostate cancer patients enrolled at Seoul National University Hospital from November 2003 to July 2013. All patients were recorded with serum prostate specific antigen (PSA), clinical stages, biopsies Gleason scores, number of positive cores, and pathologic outcome data Respectively. TRUS-guided multi-core (≥12) transrectal ultrasound-guided multi-core biopsies were obtained from all males using an automatic firing mechanism. The prostate was bilaterally biopsied near the base, mid-gland, and apex and was performed at least six times per side. Thus, 12 baseline biopsy cores were obtained from all males and additional biopsies were performed on suspected lesions if necessary. All biopsy and radical prostatectomy (RP) samples were analyzed by one genitourinary pathologist.

Control participants were selected from the Korean Association Resource (KARE), part of the KoGES (Korean Genome and Epidemiology Study) study. A total of 10,038 participants aged 40-69 years living in Anseong and Ansan started in 2001-2002. Further details are given in the published literature. (Kim et al .. Nat Genet. 43: 990 (2011); Cho et al .. Nat Genet. 41: 527 (2009))

Stage II 516 experimental groups and 548 control groups were recruited from Chungbuk National University Hospital for GRS evaluation. The diagnosis of PCa is the same as described in step I.

2. Determination of traits according to aggressiveness of prostate cancer

In order to investigate the reproducibility between clinical criteria, the aggressiveness-related factors biopsies Gleason scores, initial PSA level, disease risk group, Patients with prostate cancer were screened according to pathologic Gleason score after RP and compared with three times the normal control group of the KARE study.

1) Patients with 583 prostate cancer patients with nonobsingling score ≥ 7 were selected and compared with 1,750 healthy controls.

2) 220 prostate cancer patients whose initial serum PSA levels were higher than 20 ng / ml were selected and compared with 660 normal controls.

3) 344 high risk groups designed by D'amico were selected and compared with 1,050 normal controls. (D'Amico et al .. JAMA 280: 969 (1998))

4) 771 patients with RP postopathologic Gleason score ≥ 7 were selected and compared with 2,320 normal controls. (Fig. 2)

3. Exome chip and quality control at GWAS stage

An exome-based discovery study was performed using the HumanExome BeadChip 12v1-1 system (Illumina, Inc., San Diego, Calif.) And the chip was incubated with protein- and 242,901 probes focused on protein-altering variants (non-synonymous, stop and splice). Details of SNP content and selection strategies can be found on the Exxon array design web page (http://genome.sph.umich.edu/wiki/Exome_Chip_Design). Genotype calling was performed using Illumina's GenTrain version 2.0 clustering algorithm with GenomeStudio software (V2011.1). Cluster boundaries were determined using Illumina's standard cluster file. In order to improve the accuracy of variant calling, manual reclustering and visual inspection for genotypes were performed based on the CHARGE clustering method (Grove et al .. PLoS One 8; e68095 (2013)).

For quality control of genotypes, SNPs with a gene response rate of less than 95% were excluded after genotype analysis. Of the 242,901 attempted markers, 242,186 (99.71%) were successfully genotyped with call rates> 95% (average call rate: 99.98%).

These 242,186 SNPs were analyzed in 988 prostate cancer patients and 2,641 healthy controls.

4. Analysis of genotypes at the replication stage

For further repeating the verification step (replication stage) 24 of leads (lead) SNPs (P <3.7 × 10 - 4) it was selected. Genotyping of the SNPs was performed using Fluidigm 192.24 Dynamic Array (TM) IFC and Biomark HD system. Duplicates and negative controls were included in each 96-well plate for quality control. Genotype analysis was performed by a technician who did not know the sample status. The average concordance rate between duplicate samples was> 99%.

5-1. Genomic analysis for exome-wide repeat validation

When selecting an information marker set for producing GRS with an exome-wide significance lead marker, five exome-wide significance lead SNPs in step I (P < 1.0 x 10 &lt; ^{- 4} ) to analyze the genotypes in Chungbuk National University sample for repeated verification. The specific analysis method is the same as the above 4.

5-2. Genetic risk score (GRS) production and risk assessment

Prostate cancer susceptibility (susceptibility) locus (loci) to make the GRS, 5 of eksom each LD block verified in other ethnic groups using a-wide significance lead ^{SNP (P <8.30 × 10 -} 7) were considered. A cumulative number of risk alleles was recorded using an additive model (for an effect allele, the homozygous of non-risk alleles was 0, a heterozygous allele heterozygous of alleles), homozygous of the risk alleles (2), and a total of 5 SNPs, so a score from 0 to 10 is possible.

6. Statistical Analysis

EPACTS v3.2.4 (http://genome.sph.umich.edu/wiki/EPACTS), PLINK (http://pngu.mgh.harvard.edu/~purcell/plink/) and SAS program (version 9.1; SAS institute Inc., Cary, NC, USA) was used to analyze the single-variant association test. Data were analyzed using unconditional logistic regression and the relative risk of prostate cancer susceptibility according to SNP genotype was calculated as OR (odds ratio). For multiple comparisons (multiple comparisons), the limit of statistical significance (statistical significant threshold) (P < 3.7 × 10 - 4) it was used, based on Bonferroni correction. Meta-analysis was performed using the METAL program (http://genome.sph.umich.edu/wiki/METAL).

Experiment result

1. Experimental group

We selected 1,001 prostate cancer patients and 2,641 controls (step I). Participants were analyzed using the HumanExome BeadChip. An additional 514 PCa cases were enrolled for external validation and 548 controls (independent cohort) were analyzed for SNPs identified in step 1 (step II). The clinical characteristics of the participating groups are shown in Table 2 below.

Variables Prostate cancer (n = 1,001) Control (n = 2,641) Prostate Cancer II (n = 514) Control II (n = 548) Mean Age (yrs) ± SD 66.32 + - 6.65 50.94 + - 8.50 69.08 + - 7.56 50.04 + 13.33 Median PSA (ng / ml) ± SD 9.19 ± 138.60 N.A 10.10 + - 648.92 N.A. Prostate volume (ml) ± SD 37.48 ± 17.35 N.A N.A N.A. Body mass index (kg / m ² ) ± SD 24.47 + - 8.23 24.25 + - 3.04 Pathologic stage (n_%) - pT2 460 (56.1) - N.A pT3a 271 (33.0) - N.A pT3b 79 (9.6) - N.A pT4 10 (1.2) - N.A Gleason score (n_%) - 6 393 (39.3) - 43 (8.4) 7 411 (41.1) - 278 (54.1) 8 138 (13.8) - 86 (16.7) 9 47 (4.7) - 95 (18.5) 10 12 (1.2) 12 (2.3)

SD = standard deviation; PSA = prostate specific antigen

All the men who participated in the experiment were a racially homogeneous group of Koreans. The 1,001 hospital-based prostate cancer patients had an average age of 66.3 years, an average PSA of 9.19 ng / ml, and an average prostate size of 37.48 cc. Most biopsy Gleason scores were less than 8 (biopsy Gleason score 6 was 39.3% and biopsy Gleason score 7 was 41.1%). Initially, 41 metastatic prostate cancer patients (4.1%) were enrolled and 820 patients (81.9%) experienced radical prostatectomy (RP). The control group selected three healthy (age- / BMI-matched) individuals with age and BMI from cohort-based groups. The mean age and BMI of the 2,641 controls were 50.9 years and 24.25 kg / m ^2, respectively. Individuals with a history of malignant tumors or taking drugs were excluded.

2. Clinical classification

The overall experimental design of the GWAS for prostate cancer using the exome array is shown in Fig. After quality control analysis of the collected prostate cancer samples, a new prostate cancer susceptibility factor was found by analyzing 988 prostate cancer patients and a control group of 2,641 age- / BMI-matched (age- / BMI-matched) . In order to investigate the reproducibility between clinical criteria, the analysis was divided into five comparison sub-sets according to the aggressiveness of prostate cancer. Based on lead SNPs at a genome-wide significance level of the genome scale, 38 SNPs were selected in the Set 1 assay (comparison of patients with total prostate cancer vs. control). In Set 2 analysis, 28 SNPs were selected by comparing the patients with high non-obsessive-Gollier score and the control group. In the set 3 analysis, 9 SNPs were selected by comparing the PSA patients with prostate cancer and the control group. In set 4 analysis, 23 SNPs were selected by comparing D'amico high - risk prostate cancer patients with controls. In Set 5 analysis, 40 SNPs were selected by comparing the patients with prostate cancer of high pathological Gleason score to the control group.

3. Exome-wide association (stage I) and repeat validation (stage II)

In the GWAS discovery step we used Bonferroni correction ( P < 3.7 x 10 ^-4 , see Fig. 3) to generate 38 SNPs in the Set 1 analysis, 28 SNPs in the Set 2 analysis, We found 9 SNPs in the analysis, 23 SNPs in the set 4 analysis, and 40 SNPs in the set 5 analysis.

The inventors of the present invention found that the level of association with the linkage disequilibrium and prostate cancer-related factors was used as a first criterion and SNPs not previously disclosed were used as a second criterion, SNPs were selected (see Fig. 4). Figure 4 shows the number of SNPs significant in the analysis of the five sets described above and means the distribution of SNPs that are meaningful either commonly or individually in each set.

After this step, 24 SNPs were screened for additional replication analysis and 2 SNPs were eliminated according to double-trial quality results and 514 hospital-based prostate cancer patients and 548 patients Additional repeat analyzes were performed in normal controls (see Table 3).

22 prostate cancer-associated target SNPs ( p <1 × 10 ^-4 ) selected at the discovery GWAS stage SNPID Chr location Alleles Gene MAF p-value Reference rs1016343 8q24.21 intron A / G PRNCR1 0.3341 1.29E-16 18264097, 21743057 rs13252298 8q24.21 intron G / A PRNCR1 0.2761 1.28E-08 21743057 rs1456315 8q24.21 intron G / A PRNCR1 0.2647 3.11E-19 20676098, 23023329 rs16901979 8q24.21 intergenic A / C PRNCR1 CASC19 0.2468 5.91E-10 17401366, 19767754 rs1447295 8q24.21 intron A / C CASC8 0.1780 9.99E-11 17401363, 17401366, 19767754, 24753544 rs7837688 8q24.21 intergenic A / C CASC8 - CASC11 0.1572 1.23E-15 20676098 rs4242382 8q24.21 intergenic A / G CASC8 - CASC11 0.1912 1.05E-12 18264096 rs4242384 8q24.21 intergenic C / A CASC8 - CASC11 0.1799 2.05E-15 18264097, 21743057 rs1512268 8p21.2 intergenic A / G NKX3-1 0.3253 1.66E-08 20676098, 19767753, 22923026 rs339331 6q22.1 intron G / A RFX6 0.3461 6.21E-06 20676098 rs4430796 17q12 intron G / A HNF1B 0.2983 1.03E-06 19767754, 18264096, 17603485 rs7501939 17q12 intron A / G HNF1B 0.2684 2.40E-08 18264097, 20676098, 21743057, 19767753 rs2735839 19q13.33 intron A / G KLK3 0.3699 5.86E-07 18264097, 23269536 rs75647314 4q13.2 intron A / C TMPRSS11B 0.0074 1.67E-29 - rs1048167 5q13.3 nonsynonymous A / G GFM2 0.0047 1.29E-18 - rs11147922 13q14.11 intron G / A ENOX1 0.3603 2.75E-05 - rs28484999 16q23.2 intron A / G CDYL2 0.0209 5.96E-26 - rs6901250 6q22.1 synonymous G / A GPRC6A 0.4971 5.68E-05 - rs636252 6q22.1 intergenic G / A GPRC6A RFX6 0.4825 2.80E-05 - rs2016588 6q25.3 intergenic A / G  RSPH3-TAGAP 0.4938 1.75E-05 - rs57006764 12p13.31 nonsynonymous A / G PZP 0.4282 3.95E-05 - rs149008055 15q26.1 synonymous G / A FANCI 0.0063 3.19E-05 -

OR = odds ratio; SNP = single nucleotide polymorphism

On the other hand, the QQ plot in FIG. 5 shows that for any reason no expansion due to I-type error has occurred (expansion index by genome controlled analysis, λ = 0.92).

A Manhattan plot for analysis of the prostate cancer susceptibility locus that tests the additive effect of each SNP is shown in FIG.

Figure 7 shows a regional plot with an LD structure for chromosome region 8q24.21. As can be seen, the two SNPs in the 8q24.21 region are in different LD blocks.

Of the 22 SNPs, 10 significant SNPs were screened through a secondary analysis (514 hospital-based prostate cancer patients and 548 normal control subjects in Chungbuk National University Hospital). That is, in an independent replication experiment, we analyzed the genotypes of an additional 22 SNPs for 514 hospital-based prostate cancer patients and 548 normal controls. A total of 10 SNPs were identified as significant genetic variants of prostate cancer. It was also found that the risk for prostate cancer increases with the variation of all 10 SNPs (see Table 4). Table 4 shows the results of the first analysis (988 prostate cancer patients and 2641 controls performed) and the second analysis (514 patients and 548 controls performed) .

Prostate cancer meta-analysis results SNPID Gene MAF Stage I Stage II Combined Meta Case Control OR (95% CI) P OR (95% CI) P OR (95% CI) P rs1512268 NKX3-1 0.376 0.306 1.37 (1.23-1.53) 1.90E-08 1.27 (1.06-1.52) 8.08E-03 1.34 (1.22-1.47) 6.64E-10 rs1016343 PRNCR1 0.408 0.306 1.58 (1.42-1.77) 2.42E-16 1.28 (1.06-1.53) 9.56E-03 1.50 (1.36-1.64) 5.47E-17 rs13252298 PRNCR1 0.228 0.294 1.43 (1.26-1.62) 1.49E-08 1.37 (1.12-1.67) 1.94E-03 1.41 (1.27-1.57) 1.13E-10 rs16901979 PRNCR1 - CASC19 0.298 0.228 1.44 (1.28-1.62) 7.45E-10 1.48 (1.20-1.82) 1.93E-04 1.45 (1.31-1.61) 6.16E-13 rs1447295 CASC8 0.226 0.160 1.53 (1.34-1.74) 1.41E-10 1.55 (1.24-1.94) 1.46E-04 1.53 (1.37-1.71) 9.13E-14 rs4242382 CASC8 - CASC11 0.245 0.171 1.57 (1.39-1.78) 1.69E-12 1.63 (1.31-2.04) 1.45E-05 1.58 (1.42-1.77) 1.30E-16 rs4242384 CASC8 - CASC11 0.239 0.158 1.67 (1.47-1.70) 4.37E-15 1.58 (1.26-1.98) 5.94E-05 1.65 (1.47-1.84) 1.37E-18 rs7837688 CASC8 - CASC11 0.213 0.136 1.73 (1.51-1.98) 2.85E-15 1.49 (1.19-1.87) 5.23E-04 1.66 (1.48-1.87) 1.13E-17 rs4430796 HNF1B 0.256 0.314 1.34 (1.19-1.51) 1.12E-06 1.65 (1.35-2.02) 9.70E-07 1.41 (1.28-1.56) 2.49E-11 rs7501939 HNF1B 0.221 0.286 1.42 (1.25-1.60) 2.78E-08 1.59 (1.29-1.97) 1.59E-05 1.46 (1.31-1.62) 3.19E-12

OR = odds ratio; SNP = single nucleotide polymorphism, MAF = minor allele frequency

Eight SNPs (rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 and rs4242384) were located in the 8q21-24 region and two SNPs (rs4430796 and rs7501939) were located in the HNF1B gene in 17q12 . In a combined meta-analysis of all samples (1,494 cases and 3,189 controls), we found a strong correlation to the level of genomic significance in Koreans.

4-1. Screening of 5 SNPs for repeat validation stage (stage II)

In the 22 SNPs were derived from the 5 stage I of eksom were ^select-wide significance lead ^{SNP (4 P <1.0 × 10} ). Two SNPs (rs1456315 and rs266849) of the five SNPs were not analyzed in the phase II sample, so that adjacent SNPs rs1016343 and rs2735839 with high LD (r> 0.9) and significant signal (p <10E-05) ).

Three SNPs are located at 8q21-24, one at 17q12 and one at 19q13.33. All five are present at or near the previously identified gene in the GWA study; For example, NK3-1, PRNCR1, CASC8 / 11, HNF1B and KLK3 (Table 5).

Table 5 shows the results of prostate cancer and exome-wide association and shows the results of previous studies of genome-wide significance for each SNP. For the five nucleotide sequences (rs1512268 of 8p21.2, rs1016343 and rs7837688 of 8q24.21, rs7501939 of 17q12 and rs2735839 of 19q13.33), the final exome-wide significance was confirmed (p <8.3x10 ^-7 ).

SNP Gene Chromo-somal region Korean Study (Stage I) Previously reported results (reference /
risk allele, forward) Risk allele frequency OR (95% CI) p-value Genetic context population OR (95% CI) p-value case control rs1512268 (C / T) NKX3-1 8p21.2 0.376 0.306 1.37 (1.23-1.53) 1.90E-08 Intergenic UK and Australia [14] 1.18 (1.14-1.22) 2.5x10-23 Japanese [15] 1.34 4.3x10-11 Latinos [16] 1.21 (1.07-1.37) 2.8x10-3 rs1016343 (C / T) PRNCR1 8q24.21 0.408 0.306 1.58 (1.42-1.77) 2.42E-16 Exonic UK and Australia [17] 1.37 1x10-7 European [18] 1.31 (1.20-1. 42) 4x10-10 rs7837688 (G / T) CASC8 - CASC11 8q24.21 0.213 0.136 1.73 (1.51-1.98) 2.85E-15 Intergenic Japanese [15] NA 1x10-25 UK and Australia [17] 1.41 9x10-12 rs7501939 * (T / C) HNF1B 17q12 0.779 0.714 1.41 (1.25-1.61) 2.78E-08 Intronic Japanese [15] NA 1x10-12 European [18] 1.19 (1.11-1.28) 2x10-6 rs2735839 * (A / G) KLK3 19q13.33 0.677 0.605 1.31 (1.19-1.47) 6.35E-07 Upstream UK and Australia [17] 0.83 (0.75-0.91) 1.5x10-18 European [18] 1.20 (1.10-1.33) 2x10-18 Multi-ethnic [19] 1.20 (1.13-1.28) 2x10-18

* risk allele is the major allele

4-2. GRS for risk prediction

When a genetic risk score was prepared by the above method and the number of base strains of the 5 SNPs was counted (0 to 10 - 0 to 2 per SNP), GRS The mean follow-up was 4.23 ± 1.44 in the control group and 4.78 ± 1.43 in the experimental group (FIG. 8).

Referring to FIG. 9, GRS was associated with an increased risk of prostate cancer for a second stage sample at Chungbuk National University Hospital (experimental n = 514, control n = 548); On the GRS group of 4, the higher GRS group showed an increase and the lower GRS group showed a decrease in prostate cancer risk. A GRS score of 6 or greater showed statistically significant prostate cancer risk; OR = 1.85, 95% CI [1.28, 2.69], OR 2.11, 95% CI [1.26, 3.53] and OR 3.34, 95% CI [1.05, 10.62] for GRS = 6,7 and 8 or more groups respectively. The risk of PCa risk increases with increasing GRS (p <0.0001, trend test) and the risk of the highest GRS group (GRS> = 8) compared to the lowest group (GRS <= 1) Respectively.

The area under the curve (AUC) was 0.605 and the 95% CI ranged from 0.573 to 0.637 when evaluating the predictive performance of the GRS using reciprocal function curves (Fig. 10).

<110> SEOUL NATIONAL UNIVERSITY BUNDANG HOSPITAL <120> Single Nucleotide Polymorphisms Associated With Korean Prostate <130> P17041 <150> KR 10-2016-0035588 <151> 2016-03-24 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or g <400> 1 aatgcagatt gagttaaatt tgcacyatct acagaaaggg tttgcttcac a 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is c or t <400> 2 caagaccatg tgttacattt ccctcycatg attactcaca gcttcacagt t 51 <210> 3 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or g <400> 3 cacttgctgt cttctcagat acaatytcag aaacttataa tccaagaaaa a 51 <210> 4 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or c <400> 4 gtgttaatga tttagcatta cttatytctg gcaaatggta tttttgagat a 51 <210> 5 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or c <400> 5 agtgccattg gggaggtatg taaaaygtgc tatggaaaaa aagcaacagg a 51 <210> 6 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is g or t <400> 6 catttcccac tagagtggtg catttygtac aattgggtct atgttgacac g 51 <210> 7 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or g <400> 7 attttgtccc tctagttatc ttcccycagg cccatcaaga atcaggcagt a 51 <210> 8 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or c <400> 8 agtcccatgc tagaagctgc tttacyaaca cagtcagctg ctatctccac a 51 <210> 9 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or g <400> 9 atacagagag gcagcacaga ctggayatgc tgcataaagc ttaaattggg c 51 <210> 10 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is c or t <400> 10 ggtgtagagg ctgaaataga tacagyattg caacataata agcaatttta t 51 <210> 11 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or g <400> 11 agggatctgg ttctgtcttg tggccyagtg gaccatgggg ctatcccaag a 51

Claims (14)

Determining the susceptibility or prognosis of prostate cancer, consisting of at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 &lt; th &gt; base of any one of SEQ ID NOS: 1 to 11, or a complementary base sequence thereof Polynucleotide. The method according to claim 1,
The 26th base of SEQ ID NO: 1 is A, the 26th base of SEQ ID NO: 2 is T, the 26th base of SEQ ID NO: 3 is G, the 26th base of SEQ ID NO: The 26th base of SEQ ID NO: 6 is T, the 26th base of SEQ ID NO: 7 is A, the 26th base of SEQ ID NO: 8 is C, the 26th base of SEQ ID NO: Or a polynucleotide for determining the susceptibility or prognosis of prostate cancer, wherein the 26 &lt; th &gt; base of SEQ ID NO: 11 is A. A composition for determining the susceptibility or prognosis of a prostate cancer, which comprises a primer, a probe or an antibody that specifically binds to the polynucleotide of claim 1. A kit for judging the susceptibility or prognosis of prostate cancer comprising the composition of claim 3. 5. The method of claim 4,
A primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 &lt; th &gt; base of SEQ ID NO: 1 nucleotide sequence or a complementary polynucleotide thereof ;
A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 2 or a complementary polynucleotide thereof ;
A primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 &lt; th &gt; base of SEQ ID NO: 6 or a complementary polynucleotide thereof ;
A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 10 or a complementary polynucleotide thereof ; And
A primer, a probe or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th base of SEQ ID NO: 11 or a complementary polynucleotide thereof A kit for determining the susceptibility or prognosis of prostate cancer. A microarray for determining the susceptibility or prognosis of a prostate cancer comprising the polynucleotide of claim 1, a polynucleotide that hybridizes therewith, a polypeptide specifically encoded by the polynucleotide, an antibody specific thereto, or cDNA of the polypeptide. The method according to claim 6,
A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26 &lt; th &gt; base of SEQ ID NO: 1 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto;
A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 2 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto;
A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 6 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto;
A polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located in the 26th nucleotide of SEQ ID NO: 10 or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto; And
A polynucleotide consisting of at least 10 consecutive nucleotide sequences comprising a SNP (single nucleotide polymorphism) located at the 26 &lt; th &gt; base of SEQ ID NO: 11 or a complementary base sequence thereof, or a polynucleotide hybridizing thereto, Microarray for cancer susceptibility or prognosis determination. Identifying a SNP (single nucleotide polymorphism) located in the 26th base of one or more of the nucleotide sequences of SEQ ID NOS: 1-11 with respect to the nucleic acid sample obtained from the subject, and information useful for judging the sensitivity or prognosis of prostate cancer How to. 9. The method of claim 8,
The SNPs of SEQ ID NOS: 1 to 8 (each NCBI refSNP ID is rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 and rs4242384) are present in the 8q21-24 region of human genome, (Wherein each NCBI refSNP ID is rs4430796 and rs7501939) is present in the HNF1B gene in the 17q12 region of the human genome and the SNP in SEQ ID NO: 11 (NCBI refSNP ID is rs2735839) is in the 19q13 region of the human genome. 9. The method of claim 8,
When the genotype of the 26 th base of SEQ ID NO: 1 is &quot; A &quot;, when the genotype of the 26 th base of SEQ ID NO: 2 is &quot; T & 4, the genotype of the 26 th base of SEQ ID NO: 5 is &quot; A &quot;, the genotype of the 26 th base of SEQ ID NO: 5 is &quot; A & When the genotype of the 26 th base is &quot; A &quot;, when the genotype of the 26 th base of SEQ ID NO: 8 is &quot; C &quot;, and when the genotype of 26 base of SEQ ID NO: Wherein the genotype of the base is &quot; T &quot;, or the genotype of the 26 &lt; th &gt; base of SEQ ID NO: 11 is &quot; A &quot;. 9. The method of claim 8,
Wherein the identifying step is identifying a SNP (single nucleotide polymorphism) located in the 26 th base of the nucleotide sequence of SEQ ID NOS: 1, 2, 6, 10 and 11. 12. The method of claim 11,
The method according to any one of claims 1 to 3, further comprising the step of performing a genetic risk score analysis for a SNP (single nucleotide polymorphism) located at the 26th base of the nucleotide sequence of SEQ ID NOs: 1, 2, 6, How to provide useful information. 13. The method of claim 12,
The genetic risk score analysis showed that for the five SNPs homozygous of non-risk alleles were 0, heterozygous of alleles were 1, homozygous of the risk alleles ) Is given a detailed score of 2 and is analyzed based on the cumulative score of each detail score. 9. The method of claim 8,
Wherein said subject is an Asian person.

Images