KR101206596B1 - SNPs as a prognostic marker for lung cancer and method for predicting the survivals and the risks of developing lung cancer using them - Google Patents

Abstract

The present invention relates to techniques for selecting specific monobasic polymorphisms (SNPs) that significantly correlate with the risk of lung cancer development and prediction of lung cancer survival prognosis, and using these as markers to predict lung cancer risk and lung cancer survival prognosis. More specifically, the present invention relates to a method for predicting lung cancer risk and lung cancer survival prognosis by identifying a base of a specific monobasic polymorphism (SNP) that has a significant correlation with lung cancer risk and predicting lung cancer survival prognosis. The present invention relates to a polynucleotide for predicting lung cancer risk and prognosis of lung cancer survival or a complementary polynucleotide thereof, a polynucleotide hybridizing thereto, a polypeptide encoded by the microarray, and a kit comprising the polynucleotide.

Description

SNPs as a prognostic marker for lung cancer and method for predicting the survivals and the risks of developing lung cancer using them}

The present invention is a method for predicting lung cancer risk and lung cancer survival prognosis by identifying a base of a specific monobasic polymorphism (SNP) that has a significant correlation with lung cancer risk and prediction of lung cancer survival prognosis, lung cancer onset including the SNP A polynucleotide for predicting risk and prognosis of lung cancer, or a complementary polynucleotide thereof, a polynucleotide hybridizing thereto, a polypeptide encoded by the same, a microarray and a kit comprising the polynucleotide.

Lung cancer, especially non-small cell lung cancer (NSCLC), is one of the leading causes of death from cancer worldwide (Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. CA Cancer J Clin 58: 71-96, 2008.). Despite advances in the diagnosis and treatment of NSCLC over the past decades, the average five-year survival rate for patients with lung cancer is still less than 15%. In addition, many of the resectable stage NSCLC patients die from cancer recurrence (Miller YE. Pathogenesis of lung cancer: 100 year report. Am J Respir Cell Mol Biol 33: 216-23, 2005.). Although there is a TNM staging system as the best diagnostic guideline for surgical NSCLC patients, there is a significant variation between relapse and survival in patients at the same pathological stage for the disease (Miller YE. lung cancer: 100 year report.Am J Respir Cell Mol Biol 33: 216-23, 2005 .; Arrigada R, Bergman B, Dunant A, et al. Cisplatin-based adjuvant chemotherapy for completely resected non-small cell lung cancer.N Eng J Med 350: 351-60, 2004.). Thus, studies are currently underway to identify molecular markers associated with the diagnosis of lung cancer patients (Singhal S, Vachani A, Antin-Ozerkis D, et al. Prognostic implications of cell cycle, apoptosis, and angiogenesis biomarkers in non- small cell lung cancer: a review.Clin Cancer Res 11: 3974-86, 2005.). Such studies may help to select a subgroup of patients for adjuvant therapy with either traditional chemotherapy or new targeted therapies.

Single nucleotide polymorphism (SNP) is the most common form of genetic variation in humans. Some studies have demonstrated that some of these SNPs affect the expression or activity of enzymes and thereby are associated with the risk of cancer (Zhang X, Miao X, Sun T, et al. Functional polymorphisms in cell death pathway genes FAS and FASL contribute to risk of lung cancer.J Med Genet 42: 479-84, 2005 .; MacPherson G, Healey CS, Teare MD, et al. Association of a common variant of the CASP8 gene with reduced risk of breast cancer.J Natl Cancer Inst 24: 1866-9, 2004 .; Park JY, Park JM, Jang JS, et al: Caspase 9 promoter polymorphisms and risk of primary lung cancer.Human Mol Genet 15: 1963-71, 2006.). In addition, genetic polymorphism is being progressively studied as a diagnostic or prognostic marker for various cancers including lung cancer (Zhou W, Gurubhagavatula S, Liu G, et al. Excision repair crosscomplementation group 1 polymorphism predicts overall survival in advanced non-small cell . lung cancer patients treated with platinum- based chemotherapy Clin Cancer Res 10:. 4939-43, 2004 .; Heist RS, Zhou W, Chirieac LR, et al MDM2 polymorphism, survival, and histology in early-stage non-small cell lung J. Clin Oncol 25: 2243-7, 2007 .; Heist RS, Zhai R, Liu G, et al. VEGF polymorphisms and survival in early-stage non-small cell lung cancer.J Clin Oncol 26: 856-62, 2008.). We have previously studied the association between apoptosis gene polymorphism and survival of lung cancer patients (Park JY, Lee WK, Jung DK, et al. Polymorphisms in the FAS and FASL genes and survival of early stage non-small Clin Cancer Res 15: 1794-800, 2009 .; Yoo SS, Choi JE, Lee WK, et al. Polymorphisms in the CASPASE genes and survival in patients with early stage non-small cell lung cancer.J Clin Oncol (in press).).

DNA repair systems are essential for the maintenance of genome integrity. Thus, deregulation of DNA repair genes can dramatically increase cancer risk (Hoeijmakers JHJ. Genome maintenance mechanisms for preventing cancer.Nature 411: 366-74, 2001 .; Ronen A, Glickman BW.Human DNA repair genes.Environ Mol Mutagen 37: 241-83, 2001.). In humans, more than 125 genes are involved in DNA damage response, base excision repair, nucleotide excision repair, mismatch repair and duplication. There are several types of DNA repair pathways, such as double strand break repair. Nucleotide excision repair pathways preferentially remove bulk DNA adducts such as UV-induced photolesions and chemically induced DNA adducts. The base excision repair route serves to remove small base adducts caused by oxidation, methylation and radiation. Mismatch repair pathways correct replication errors caused by DNA polymerase errors. Double helix break repair pathways repair double helix breaks caused by exposure to a variety of factors including ionizing radiation, free radicals and telomeres (Ronen A, Glickman BW. Human DNA repair genes. Environ Mol Mutagen 37: 241-83, 2001 .; http://www.cgal.icnet.uk/DNA_Repair_Genes.html).

However, although the impact of DNA repair gene polymorphism on the risk of cancer has been extensively studied, only a few studies have reported the diagnostic importance of DNA repair gene polymorphism in cancer patients. Therefore, the present inventors hypothesized that individual variation in the DNA repair ability given by DNA repair gene polymorphism affects the survival result of lung cancer patients.

One object of the present invention is to identify a base of a specific SNP that has a significant correlation with the risk of lung cancer risk and the prediction of lung cancer survival for gene samples collected from a patient to predict the risk of lung cancer and lung cancer survival prognosis To provide.

Another object of the present invention is to provide a polynucleotide or a complementary polynucleotide for predicting lung cancer risk and lung cancer survival prognosis, including certain SNPs, which has a significant correlation with lung cancer risk and prediction of lung cancer survival prognosis. It is.

Another object of the present invention is to specifically identify a polynucleotide for predicting lung cancer risk and lung cancer survival prognosis including a specific SNP or a complementary polynucleotide thereof, which includes a particular SNP that has a significant correlation with the risk of lung cancer and predicting lung cancer survival prognosis. It is to provide a polynucleotide that hybridizes.

Another object of the present invention is to provide a method for predicting lung cancer risk and lung cancer survival prognosis including a specific SNP which has a significant correlation with lung cancer risk and prediction of lung cancer survival prognosis or a complementary polynucleotide thereof. To provide a polypeptide to be encoded.

Another object of the present invention is a polynucleotide or a complementary polynucleotide thereof for predicting lung cancer risk and lung cancer survival prognosis, including certain SNPs having a significant correlation with lung cancer risk and predicting lung cancer survival prognosis, To provide a composition for predicting lung cancer risk and lung cancer survival prognosis comprising a polynucleotide that hybridizes specifically to, or a polypeptide specifically encoded by the polypeptide or cDNA thereof.

Another object of the present invention is a polynucleotide or a complementary polynucleotide thereof for predicting lung cancer risk and lung cancer survival prognosis, including certain SNPs having a significant correlation with lung cancer risk and predicting lung cancer survival prognosis, To provide a microarray for predicting lung cancer risk and lung cancer survival prognosis comprising a polynucleotide that hybridizes specifically with or a polypeptide specifically encoded by the polypeptide or cDNA thereof.

Another object of the present invention is a polynucleotide or a complementary polynucleotide thereof for predicting lung cancer risk and lung cancer survival prognosis, including certain SNPs having a significant correlation with lung cancer risk and predicting lung cancer survival prognosis, The present invention provides a kit for predicting lung cancer risk and lung cancer prognosis including a polynucleotide hybridizing specifically with a polypeptide, or a polypeptide encoded specifically therewith or a cDNA thereof.

The present invention provides a gene sample obtained from a patient, SNP located in the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene; SNP located in the 27th base of the sequence represented by SEQ ID NO: 2 in XRCC1 gene; SNP located in the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene; SNP located in the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene; SNP located in the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene; And identifying a base of at least one SNP selected from the group consisting of SNPs located at the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene, and a method for predicting lung cancer risk and lung cancer survival prognosis. . These sequences are shown in Table 1 below.

NCBI refSNP ID order SEQ ID NO: rs1136410 CTTTCTTTTGCTCCTCCAGGCCAAGGYGGAAATGCTTGACAACCTGCTGGAC One rs25489 GTCTTCTCCAGTGCCAGCTCCAACTCRTACCCCAGCCACAGCCCCAGTCCCT 2 rs12917 CTATCGAAGAGTTCCCCGTGCCGGCTYTTCACCATCCCGTTTTCCAGCAAGG 3 rs2228000 CCATCGTAAGGACCCAAGCTTGCCAGYGGCATCCTCAAGCTCTTCAAGCAGT 4 rs1799793 CCCACCTGGCCAACCCCGTGCTGCCCRACGAAGTGCTGCAGGGTGAGCCCCG 5 rs3731283 TAAATTTACCAACAGGTTTGCAAGTCRTTATTATATTTTTAACCCTTTATTA 6

R = A / G; Y = T / C

In one aspect of the present invention, when the genotype is CC in the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene, it is predicted that the risk of developing lung cancer is low or the survival prognosis after the onset of lung cancer is high, and the genotype is TT or TC. May have a high risk of developing lung cancer or a low survival prognosis after developing lung cancer.

In another aspect of the present invention, when the genotype is AA or AG in the 27th base of the sequence represented by SEQ ID NO: 2 in the AXRCC1 gene, it is predicted that the risk of developing lung cancer is low or the survival prognosis after the onset of lung cancer is high. GG is predicted to have a high risk of developing lung cancer or a low survival prognosis after lung cancer.

In another aspect of the present invention, when the genotype is CC in the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene, it is predicted that the risk of developing lung cancer is low or the survival prognosis after the onset of lung cancer is high, and the genotype is TT or TC is expected to have a high risk of developing lung cancer or a low survival prognosis after developing lung cancer.

In another aspect of the present invention, when the genotype is CT or TT in the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene, it is predicted that the risk of developing lung cancer is low or the survival prognosis after the development of lung cancer is high. CC is associated with a high risk of developing lung cancer or a low survival prognosis after lung cancer.

In another aspect of the present invention, when the genotype is GG or GA in the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene, it is predicted that the risk of developing lung cancer is low or the survival prognosis after the onset of lung cancer is high. AA is associated with a high risk of developing lung cancer or a low survival prognosis after lung cancer.

In another aspect of the present invention, when the genotype is GG or AG in the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene, it is predicted that the risk of developing lung cancer is low or the survival prognosis after the onset of lung cancer is high. AA is associated with a high risk of developing lung cancer or a low survival prognosis after lung cancer.

The present inventors investigated whether polymorphisms of various DNA repair genes correlate with risk of lung cancer and survival prognosis after lung cancer in order to predict lung cancer risk and survival prognosis after lung cancer. To this end, 310 lung cancer patients, especially non-small cell cancer patients, were selected (see Example 1), and 39 selected SNPs were examined in these lung cancer patients. As a result, overall survival (OS) and disease-free survival (DFS) of lung cancer patients and six specific SNPs (rs1136410 T> C, rs25489 G> A, rs12917 C> T, rs2228000 C> T, rs1799793 G> A and rs3731283 A> G) are significantly associated, and among the six specific SNPs, rs1136410 TT or TC, rs25489 GG, rs12917 CT or TT, rs2228000 CC, rs1799793 AA and rs3731283 AA genotypes Lung cancer patients found that survival outcomes were even worse. The overall survival (OS) refers to the day from the surgery to the day of death or last follow-up, the disease-free survival (DFS) refers to the day of recurrence or death from the day of operation.

In addition, any one or more of the six SNPs specified by the present invention could be arbitrarily combined to predict lung cancer risk and survival prognosis after lung cancer with higher precision. As described in the examples below, it was found that there was a high correlation between the combination of SNPs and lung cancer survival results. That is, as the number of SNPs identified by the present invention from lung cancer patients increased, the overall survival (OS) and disease free survival (DFS) of lung cancer patients were found to decrease.

In the above description, the patient is a general patient before the onset of lung cancer and a patient who wants to predict and manage the risk of developing lung cancer, or a patient with lung cancer, namely, squamous cell carcinoma, small cell cancer, adenocarcinoma, large cell cancer or non-cell cancer. In addition, the patient includes a patient who has surgically resected lung cancer, namely squamous cell carcinoma, small cell carcinoma, adenocarcinoma, large cell carcinoma or non-cell carcinoma, in which case the lung cancer is preferably in stage I stage. Gene samples are obtained from tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine, etc. obtained from these lung cancer patients, and the gene samples include DNA, mRNA, or cDNA synthesized from mRNA.

As used herein, the term “prognosis” refers to the progress and cure of a disease such as lung cancer-caused death or progression of neoplastic diseases such as lung cancer, for example, onset, recurrence, metastatic spread, and drug resistance. . For the purposes of the present invention, prognosis refers to the risk of developing lung cancer and the survival prognosis after the onset of lung cancer, and preferably the prognosis of a patient who has surgically resected lung cancer, more preferably a patient who has surgically resected non-small cell cancer. The ideal treatment for lung cancer is early detection and removal of the cancer completely, but early treatment is difficult because more than half of the patients are diagnosed with lung cancer. Using the method of the present invention can easily predict the risk of developing lung cancer, by managing the risk of developing lung cancer can be early detection of lung cancer to completely remove the cancer by surgery. In addition, after the onset of lung cancer, non-small cell carcinoma, in particular, if the surgery is not advanced enough to perform the surgery first, radical resection is only 30% can be performed. The 5-year survival rate for postoperative cure depends on the progression of the cancer. However, 37% of squamous cell carcinoma, 27% of adenocarcinoma and 27% of large cell carcinoma were cured in all patients who underwent curative resection. Thus, using the method of the present invention, it is possible to easily determine the prognosis of lung cancer, and to easily determine whether to use additional necessary treatment methods. This can significantly increase the survival rate after developing lung cancer.

As used herein, the term "prediction" refers to the determination of whether a patient is likely to develop lung cancer, the treatment of a patient, for example, a particular therapeutic agent, in a positive or unfavorable response to treatments such as chemotherapy or radiation therapy, and And / or survive and / or the possibility of survival after surgical removal of the primary tumor and / or treatment with chemotherapy for a certain period of time without cancer recurrence. The predictive method of the present invention is a patient who is at high risk of developing lung cancer for any particular patient, through special and appropriate management, so as not to delay or develop onset, or to select a treatment method by selecting the most appropriate treatment method for patients with lung cancer. Can be used clinically. In addition, the predictive methods of the present invention determine whether a patient preferentially responds to a treatment regimen, such as, for example, a treatment regimen, including administration of a given therapeutic agent or combination, surgical intervention, chemotherapy, etc. It is possible to predict whether long term survival is possible.

The invention also provides compositions for predicting lung cancer risk and lung cancer survival prognosis in a patient.

The composition is located at the 27th base of the sequence represented by SEQ ID NO: 2 in the SNP, XRCC1 gene located at the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene, for the gene sample isolated from the patient. SNP located at the 27th base of the sequence represented by SEQ ID NO: 3 in the SNP and MGMT genes, and SNP located at the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene and SEQ ID NO: 5 in the XPD gene And a reagent for identifying a base of at least one SNP selected from the group consisting of an SNP located at the 27th base of the sequence to be obtained, and an SNP located at the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene. It is characterized by.

The reagent contained in the composition of the present invention is preferably at least one polynucleotide selected from the following polynucleotides:

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the XRCC1 gene or a complementary polynucleotide thereof;

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene or a complementary polynucleotide thereof;

Polynucleotides or complementary polynucleotides consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene;

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene or a complementary polynucleotide thereof; And

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides the polynucleotide in one aspect.

Said polynucleotides or their complementary polynucleotides according to the invention consist of at least 10, preferably from 10 to 100, more preferably from 20 to 60, even more preferably from 40 to 60 consecutive bases.

The polynucleotide according to the present invention or its complementary polynucleotide is a polymorphic sequence. Polymorphic sequenc refers to a sequence comprising a polymorphic site representing a monobasic polymorphism in a nucleotide sequence. The polymorphic site refers to a site where a monobasic polymorphism occurs in the polymorphic sequence. In the present invention, the polynucleotide may be DNA or RNA.

The reagent contained in the composition of the present invention is preferably at least one polynucleotide selected from polynucleotides that specifically hybridize with the following polynucleotides:

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the XRCC1 gene or a complementary polynucleotide thereof;

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene or a complementary polynucleotide thereof;

Polynucleotides or complementary polynucleotides consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene;

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene or a complementary polynucleotide thereof; And

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides, in one aspect, a polynucleotide that specifically hybridizes with the polynucleotide or its complementary polynucleotide.

In the present invention, the polynucleotide that specifically hybridizes with the polynucleotide or its complementary polynucleotide is an allele-specific polynucleotide.

An allele-specific polynucleotide is meant to hybridize specifically to each allele. That is, it means hybridizing to specifically distinguish bases of the polymorphic sites present in the polymorphic sequence. Here, hybridization is usually carried out under stringent conditions, for example salt concentrations of 1 M or less and temperatures of 25 ° C. or higher. For example, conditions of 5 × SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 ° C. may be suitable for allele specific probe hybridization.

In the present invention, the allele specific polynucleotide may be an allele specific probe. That is, in the present invention, the probe means a hybridization probe, and means an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid. The allele-specific probe of the present invention has a polymorphic site in nucleic acid fragments derived from two individuals of the same species, and hybridizes to a DNA fragment derived from one individual but not to a fragment derived from another individual. In this case, hybridization conditions should be strict enough to hybridize to only one of the alleles, as the hybridization conditions show a significant difference in hybridization strength between alleles. In the probe of the present invention, the central region is preferably aligned with the polymorphic region of the polymorphic sequence. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used in diagnostic kits or prediction methods such as microarrays for detecting alleles and predicting lung cancer risk and lung cancer survival prognosis.

In addition, in the present invention, the allele specific polynucleotide may be an allele specific primer. Appropriate lengths of primers may vary depending on the intended use, but generally consist of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template. The primer hybridizes to a DNA sequence comprising a polymorphic site to amplify a DNA fragment comprising a polymorphic site. The primer of the present invention can be used in diagnostic kits or prediction methods such as microarrays for detecting alleles and predicting lung cancer risk and lung cancer survival prognosis.

The reagent contained in the composition of the present invention is a polypeptide preferably encoded by one or more polynucleotides selected from the following polynucleotides:

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the XRCC1 gene or a complementary polynucleotide thereof;

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene or a complementary polynucleotide thereof;

Polynucleotides or complementary polynucleotides consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene;

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene or a complementary polynucleotide thereof; And

A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene, or a complementary polynucleotide thereof.

Thus, the present invention provides, as an aspect, a polypeptide encoding the polynucleotide. Such polypeptides can be used in compositions for predicting lung cancer risk and prognosis of lung cancer survival, microarrays or kits for predicting lung cancer risk and prognosis of lung cancer survival. Alternatively, antibodies to the polypeptide can be used in place of the polypeptide. It is preferable that it is a monoclonal antibody as said antibody.

Lung cancer risk and lung cancer survival prognosis for one or more polynucleotides selected from the following polynucleotides included in the compositions of the present invention, polynucleotides that hybridize specifically thereto, or polypeptides specifically encoded by them or cDNAs thereof For use in the preparation of predictive microarrays or kits. The microarray or kit may be manufactured by conventional methods known to those skilled in the art.

The predictive technology of lung cancer risk and survival prognosis according to the present invention predicts the risk of lung cancer in a non-lung cancer patient in advance to prevent delay or onset of the disease through appropriate and special management for patients at high risk of lung cancer. Can be. In addition, the predictive technology of lung cancer risk and survival prognosis according to the present invention can easily evaluate the patient's prognosis for patients with lung cancer and target the means and treatment for the selection and evaluation of the treatment to improve the survival rate of patients with lung cancer. It can increase.

1 shows genotype frequencies of DNA repair gene polymorphisms analyzed from non-small cell cancer patients (n = 310).
Figure 2 shows the results of a univariate analysis of the relationship between overall survival (OS) and disease free survival (DFS) of patients for demographics, smoking status, histological type and pathological stage.
Figure 3 shows the results of univariate and multivariate analysis of the relationship between DNA repair gene polymorphism and overall survival (OS) and disease-free survival (DFS).
4 is a result showing the relationship between overall survival (OS) and disease-free survival (DFS) according to the polymorphism of the DNA repair gene.
5 is a result showing the relationship between overall survival (OS) and disease-free survival (DFS) according to the combination of the polymorphism of the six DNA repair genes.
FIG. 6 shows survival analysis results for overall survival (A) and disease free survival (DFS) according to the number of defective genotypes of six SNPs using the Kaplan-Meier method.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Selection of Research Subjects

All patients (310) of the present invention are non-small cell cancer patients with stage I, II or III (micro-infiltrating N2), 1998-2006 at Kyungpook National University Hospital (Daegu, Korea) The patients underwent surgical resection during the month. Among the patients, patients who received chemotherapy or radiotherapy before surgery to avoid the effect on DNA were excluded. All tissues were harvested at the time of surgery, rapidly frozen with liquid nitrogen and stored at -80 ° C until the bioassay associated with this experiment was performed. All patients in this study were Korean. Histological types of lung cancer patients were classified according to Brambilla E, Travis WD, Colby TV, et al. The new World Health Organization classification of lung tumors.Eur Respir J 18: 1059-68, 2001. The patients included 189 (61.0%) squamous cell carcinomas (SQs), 116 (37.4%) patients with adenocarcinomas (ACs) and 5 (1.6%) large cell carcinomas. ). The pathological stage of the tumor was determined according to the International System for Staging Lung Cancer (Mountain CF.Revisions in the international System for Staging Lung Cancer.Chest 111: 1710-7, 1997.) They consisted of 177 (57.1%) stage I, 46 (14.8%) stage II and 87 (28.1%) stage IIIA stages. Written informed consent was obtained from all patients prior to surgery and approved by the Institutional Review Board of Kyungpook National University Hospital.

Example 2: Polymorphism Selection and Genotyping

Published database (http://www.ncbi.nlm.nih.gov/SNP) and related documents identified as potentially functional polymorphisms in DNA repair genes (Spitz MR, Wu X, Wang Y, et al. nucleotide excision repair capacity by XPD polymorphisms in lung cancer patients.Cancer Res 61: 1354-7, 2001 .; Park JY, Park SH, Choi JE, et al. Polymorphisms of the DNA repair gene Xeroderma Pigmentosum group A and risk of primary lung Cancer Epidemiol Biomarkers Prev 11: 993-7, 2002 .; Jeon HS, Kim KM, Park SH, et al. Relationship between XPG codon 1104 polymorphism and risk of primary lung cancer.Carcinogenesis 24: 1677-81, 2003 .; Hao B, Wang H, Zhou K, et al. Identification of genetic variants in base excision repair pathways and their associations with risk of esophageal squamous cell carcinoma. Cancer Res 64: 4378-84, 2004. Of the repair genes, 48 single nucleotide polymorphisms (SNPs) were selected. SNP selection preferred that the minor allele frequency (MAF) was at least 10%, located in the non-toxin or coding region of the promoter or gene, assessed as being related to conventional cancer, or evidence of functional significance. These selected SNPs were genotyped using a mass spectrometyr-based genotyping assay based on mass spectrometry from Sequenom. 48 SNP set selected from the group consisting of single type (monomorphic) of 7 SNP (APEX L104R, E126D, R237A and D283G; MSH2 rs17224094 and rs17217681 and rs17217877), the call rate of the genotype (genotyping call rate) is one SNP (RAD52 90.0% less than rs11226) and one SNP outside the Hardy-Weinberg equilibrium (HWE, P <0.05) (ATR rs2227930) were excluded from further analysis. The remaining 39 SNPs out of 26 genes were evaluated for relevant analysis. Figure 1 shows the SNP identification number, genotype and minor allele frequencies (MAF), genotyping call rate and P -value of HWE for the remaining 39 SNPs out of 26 genes. For quality control, genotyping was performed without knowledge of the patient. In addition, about 10% of the samples were randomly selected and genotyped again by RCR-RFLP or DNA sequencing.

Example 3: Statistical Analysis

Demographic and clinical information was compared using the χ ² test for categorical variables across genotypes and stages. The Hardy-Weinberg equilibrium was tested at one degree of freedom using a goodness-of-fit χ ² test. Linkage disequilibrium coefficients between polymorphisms were measured by HaploView (Barrett JC, Fry B, Maller J, Daly MJ.Haploview: analysis and visualization of LD and haplotype maps.Bioinformatics 21: 263-5.30 , 2005.). Haplotypes and their frequencies were calculated based on the Bayesian algorithm using a Phase program (Stephens M, Smith MJ, Donnelly P. A new statistical method for haplotype reconstruction from population data Am J Hum Genet 68: 978-89, 2001. Overall survival (OS) was estimated from the day of surgery to the day of death from any cause or the day of last follow-up. Disease-free survival (DFS) was calculated from the day of surgery to the day of relapse or death for some cause. Survival analysis was calculated using Kaplan-Meier method. Differences in OS or DFS between different genotypes were compared using a log-rank test. Hazard ratio (HR) and 95% confidence intervals (CIs) were calculated using multivariate Cox proportional hazards models, which were age (≤64 vs.> 64) , Sex (male to female), smoking status (non-smoker to smoking experience), pathological stage (stage I to II IIIA), and adjuvant therapy. All analyzes were performed using the Statistical Analysis System for Windows, version 9.1 (SAS Institute, Cary, NC, USA).

Example 4: Patient Characteristics and Clinical Prognosis

The clinical and pathological characteristics of the patients and their association with overall survival (OS) and disease free survival (DFS) are shown in FIG. 2 below. 114 (36.8%) died. Overall 5 year survival (OS) and disease free survival (DFS) calculated for all patients were 53.3% (95% CI = 45.8%-60.2%) and 44.0% (95% CI = 36.9%-50.9%), respectively. Univariate analysis revealed that the pathological stage was significantly associated with overall survival (OS) and disease free survival (DFS) ( P <0.0001 for OS and DFS).

Example 5: Genotype Frequency and Effect on Overall Survival (OS) and Disease-Free Survival (DFS)

Of the 39 SNPs examined, the haplotypes of 33 SNPs and XPA, MLH1, NBS1 and ATR SNPs were not significantly associated with survival outcomes. 6 SNPs ( ADPRT rs1136410T> C [V762A], XRCC1 rs25489G> A [R280H], MGMT rs12917C> T [L115F], XPC rs2228000C> T [A499V], XPD rs1799793G> A [D312N], and MSH2 rs37321 IVS10 + 12)) was significantly associated with survival outcomes in multivariate analysis (see Figure 3 below). Patients with the ADPRT rs1136410 CC genotype showed significantly better OS and DFS compared to patients with the TT or TC genotype (adjusted HR [aHR] = 0.50, 95% CI = 0.28-0.88, for OS) P = 0.02; and aHR = 0.48, 95% CI = 0.23-0.78, P = 0.003 for DFS). XRCC1 rs25489, XPC rs2228000 and MSH2 rs3732183 SNPs showed better survival results under the dominant model for variant alleles for each SNP. MGMT rs12917C> T showed worse OS under dominant model for variant T allele, and XPD rs1799793G> A showed worse OS under recessive model for variant A allele (see FIG. 4 below).

None of the polymorphisms were significantly associated with factors such as age, sex, smoking status, histological subtypes, pathological staging or adjuvant therapy, which are patient- or tumor-associated factors (data not shown).

Example 6 Combination Effects of DNA Damage Gene SNPs on OS and DFS

The inventors conducted a screening test to analyze the effects on OS and DFS in the combination of six SNPs that were significantly related to survival results in individual SNP analysis. Since the rs1136410 TT or TC, rs25489 GG, rs12917 CT or TT, rs2228000 CC, rs1799793 AA and rs3731283 AA genotypes were associated with worse survival results, we considered these 6 genotypes as poor genotypes and Patients were grouped based on number to examine the combined results. Since only 6 cases have 0 bad genotypes and 6 cases have 5 bad genotypes, we have a group of patients (0 or 1, 2, 3, and 4 or 5 bad genotypes). Patients with). As shown in Figures 5 and 6, OS and DFS decreased as the number of defective genotypes increased ( P _trend <0.0001 for OS and DFS). Five-year OS and DFS for patients with 0 or 1, 2, 3, and 4 or 5 bad genotypes were 80.8% and 73.4%, 62.3% and 50.0%, 50.4% and 41.0%, and 38.3, respectively. % And 30.4%. By multivariate analysis, patients with three and four or five bad genotypes showed significantly worse OS and DFS compared to patients with zero or one bad genotype (three bads). AHR = 3.53, 95% CI = 1.25-9.97, P = 0.02, and aHR = 3.31, 95% CI = 1.41-7.76, P = 0.006 for OS related to patients with genotypes; 4 or 5 AHR = 5.47, 95% CI = 1.87-16.00, P = 0.002, and aHR = 4.42, 95% CI = 1.82-10.74, P = 0.001 for OS associated with patients with poor genotypes).

Attach an electronic file to a sequence list

Claims (12)

For gene samples from patients,
SNP located in the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene, SNP located in the 27th base of the sequence represented by SEQ ID NO: 2 in the XRCC1 gene, and the sequence represented by SEQ ID NO: 3 in the MGMT gene SNP located in the 27th base of SNP, SNP located in the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene, SNP located in the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene, And identifying a base of the SNP located at the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene. 20. A method of providing information for predicting lung cancer risk and lung cancer survival prognosis. The method of claim 1, wherein the base of the SNP is confirmed,
When the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene is TT or TC, the risk of developing lung cancer is lower or the lung cancer survival prognosis is lower than that when the base is CC;
When the 27th base of the sequence represented by SEQ ID NO: 2 in the XRCC1 gene is GG, the risk of developing lung cancer is lower or the lung cancer survival prognosis is lower than when the base is AA or AG;
When the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene is TT or TC, the risk of developing lung cancer is lower or the lung cancer survival prognosis is lower than that when the base is CC;
When the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene is CC, the risk of developing lung cancer is lower or the lung cancer survival prognosis is lower than when the base is CT or TT;
The 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene has a higher risk of developing lung cancer or a lower prognosis of lung cancer than the case where the base is GG or GA; And
Characterized in that the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene is classified as having a higher risk of developing lung cancer or a lower prognosis of lung cancer than the case where the base is GG or AG.
A method of providing information for predicting lung cancer risk and lung cancer survival prognosis. The method of claim 1, wherein the patient is a lung cancer patient. 15. The method of claim 1, wherein the patient is a lung cancer patient. 4. The method of claim 3, wherein the lung cancer is squamous cell carcinoma, small cell carcinoma, adenocarcinoma, large cell carcinoma, or non-small cell carcinoma, the method of providing information for predicting lung cancer risk and lung cancer survival prognosis. The method of claim 3, wherein the lung cancer has a pathological stage I stage. The method of claim 3, wherein the lung cancer has stage I disease risk and lung cancer survival prognosis. A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the ADPRT gene or a complementary polynucleotide thereof;
A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the XRCC1 gene or a complementary polynucleotide thereof;
A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the MGMT gene or a complementary polynucleotide thereof;
Polynucleotides or complementary polynucleotides consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 in the XPC gene;
A polynucleotide consisting of at least 10 consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 5 in the XPD gene or a complementary polynucleotide thereof; And
A composition for predicting lung cancer risk and lung cancer survival prognosis comprising a polynucleotide consisting of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 6 in the MSH2 gene, or a complementary polynucleotide thereof. A composition for predicting lung cancer risk and lung cancer prognosis comprising a polynucleotide that specifically hybridizes to the polynucleotide of claim 6. 8. The composition for predicting lung cancer risk and lung cancer prognosis according to claim 7, wherein the specifically hybridizing polynucleotide is an allele-specific probe or an allele-specific primer. A composition for predicting lung cancer risk and lung cancer prognosis comprising a polypeptide encoded by the polynucleotide of claim 6. delete A microarray for predicting lung cancer risk and lung cancer prognosis, comprising the polynucleotide of claim 6, a polynucleotide hybridizing thereto, or a polypeptide specifically encoded by the polypeptide or a cDNA thereof. A kit for predicting lung cancer risk and lung cancer prognosis comprising the microarray of claim 11.

Images