KR20170104427A - Composition for prevention or treating cancer comprising inhibitors for expression or activity of ANKs1a, and screening method for thereof - Google Patents

Abstract

The present invention relates to a composition for preventing or treating cancer comprising inhibitor for the expression or activity of Anks1a protein as an active ingredient, and a screening method thereof. Accordingly, a composition having excellent effects of preventing and treating cancer, and a method of easily screening an anticancer agent can be provided.

Description

[Composition for prevention or treating cancer comprising inhibitors for expression or activity of ANKs1a, and screening method for thereof]

The present invention relates to a composition for preventing or treating cancer comprising an inhibitor of ANKs1a protein expression or activity as an active ingredient, and a screening method thereof.

Cancer (malignant tumor) continues to increase in cancer incidence due to environmental pollution and poor dietary habits, even now, with more than 30 years of in-depth research on cancer, more than 10 million patients occur worldwide every year. The Organization (WHO) cites cancer as one of the leading causes of death. It is a major disease that ranks first in the mortality rate in the modern society, and despite many studies to date, there is no breakthrough treatment. In the treatment of cancer, treatment using chemotherapeutic agents such as anticancer drugs has been effective to some extent, but many studies are required due to the various onset mechanisms of cancer and the expression of resistance to anticancer drugs. In recent decades, the development of diagnosis and treatment technology has resulted in a limited improvement in the treatment rate and functional preservation for cancer treatment, but the 5-year survival rate for many advanced cancers is hovering around 5 to 50%. These cancers can be characterized by aggressive invasion, lymph node metastasis, distant metastasis, and the occurrence of secondary cancer. In some cancers, despite various studies and treatments, survival rates have not changed significantly over the past 20 years.

Recently, there are many attempts to increase the therapeutic effect of such cancer through molecular biological approaches, and studies on targeted treatments related to cancer proliferation, metastasis, and apoptosis are actively progressing. Among them, RNA interference (RNAi) technology is frequently used in research in the field of life science, and its usefulness has come to be widely recognized. Here, RNAi refers to a phenomenon in which mRNA is degraded specifically for its sequence by double-stranded RNA, and as a result, gene expression is suppressed. Since it was reported in 2001 that siRNA (small interference RNA), a 21-base small molecule double-stranded RNA, can mediate RNAi in mammalian cells (Non-Patent Document 1), siRNA is a method for inhibiting the expression of a target gene. It is frequently used, and shRNA, which compensates for the shortcomings of siRNA, is also widely used.

The first point to be considered in the treatment using such RNA interference is to select the optimal siRNA and shRNA sequences (hereinafter referred to as "interfering RNA") that have the greatest activity in the target nucleotide sequence. The efficiency of ribonucleic acid-mediated interference is known to have a great influence on the specific binding site to the target transcript. Based on the database of the past several years, an algorithm that can design the sequence position of the interfering RNA that not only binds to the transcript but actually inhibits the expression of the target ribonucleic acid has been developed and provided to users. However, it cannot be said that all interfering RNAs determined in silico using computer algorithms can effectively inhibit target ribonucleic acid in real cells and in vivo. Even if the requirement for complementary binding of RNA to the target transcript is satisfied, there are many other factors that have not yet been identified, such as the stability and intracellular location of ribonucleic acids and proteins, and the status of proteins involved in ribonucleic acid-mediated interference. It is known that they are involved in determining the efficiency of ribonucleic acid mediated interference. Therefore, it is necessary to perform a technique for producing siRNA by selecting several target sequence positions per transcript of one gene and discovering the sequence of the optimal position having excellent expression suppression effect among these candidate groups for the target protein. On the other hand, cancer research related to ANKs1a has been conducted only focusing on the regulation of endocytosis of EphA2 by binding between Anks1a and EphA2 (Non-Patent Documents 2 and 3).

1.US 2009-0263391

1. Elbashir S.M. et al., "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells" Nature, 411 (6836), p.494-498 (2001) 2. Flavia Anna Mercurio and et al., "SOLUTION STRUCTURE OF THE FIRST SAM DOMAIN OF ODIN AND BINDING STUDIES WITH THE EPHA2 RECEPTOR" Biochemistry. 2012 March 13; 51(10): 2136-2145. 3. Muhammad Emaduddin and et al, "Odin (ANKS1A) is a Src family kinase target in colorectal cancer cells" Cell Communication and Signaling 2008, 6:7

The present invention is to provide a composition for preventing or treating cancer and a method for screening a composition for preventing or treating cancer, comprising an Anks1a protein expression or activity inhibitor as an active ingredient.

In order to achieve the above object, the present invention provides a composition for preventing or treating cancer comprising an inhibitor of Anks1a protein expression or activity as an active ingredient.

According to an aspect of the present invention, the ANKs1a protein expression or activity inhibitor of the composition for preventing or treating cancer is characterized in that it acts specifically on an ankyrin repeat region (ANK) domain.

According to one aspect of the present invention, the ANKs1a protein expression inhibitor of the composition for preventing or treating cancer is an antisense nucleotide complementarily binding to the mRNA of the ANKs1a gene, a short interfering RNA (siRNA), and a short hairpin RNA (short). hairpin RNA, shRNA).

According to one aspect of the present invention, the short hairpin RNA (Short hairpin RNA) of the ANKs1a gene of the composition for preventing or treating cancer is characterized in that it has a nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2.

According to one aspect of the present invention, the ANKs1a protein activity inhibitor of the composition for preventing or treating cancer is any one or more selected from the group consisting of compounds, peptides, peptidomimetics, aptamers, and antibodies that bind complementarily to ANKs1a protein. It is characterized.

According to one aspect of the present invention, the composition for preventing or treating cancer is liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, stomach cancer, breast cancer, cervical cancer, uterine cancer, It is characterized in that it is applied to any one cancer selected from the group consisting of prostate cancer, pancreatic cancer, epidermal cancer, and lung cancer.

According to an aspect of the present invention, (a) treating the target cell with a candidate substance; (b) measuring the expression or activity of the ANKs1a protein in the target cell; And (c) as a result of the measurement, it provides a method for screening a substance for preventing or treating cancer comprising the step of selecting a candidate substance that reduces the expression or activity of ANKs1a protein from among the candidate substances.

According to an aspect of the present invention, the step of measuring the expression or activity of ANKs1a protein in the method for screening a substance for preventing or treating cancer includes the amount of ANKs1a gene expression, the amount of ANKs1a protein, another protein subjected to the action of the ANKs1a protein, It is characterized by detecting or measuring any one or more selected from the interaction between the ANKs1a protein and other proteins, the complex between the ANKs1a protein and other proteins, and the complex of other proteins subjected to the action of the ANKs1a protein.

According to one aspect of the present invention, in the method for screening a substance for preventing or treating cancer, other proteins that interact with or form a complex with ANKs1a protein are EphA2, ErbB2, or a complex thereof.

According to an aspect of the present invention, a method of measuring the expression or activity of ANKs1a protein in the method for screening a substance for preventing or treating cancer is reverse transcriptase-polymerase chain reaction, real-time polymerase chain reaction. (real time-polymerase chain reaction), Western blot, Northern blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, and immunoprecipitation assay. It is characterized in that it is selected.

The present invention relates to a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient, and a screening method thereof, through which a composition having excellent cancer prevention and treatment effects is provided, and an anticancer agent can be easily screened. It provides a method that can be usefully applied in the field of medicine.

1A and 1B are results of Western blotting after treatment with ANKs1a-specific shRNA in CT26 cell line.
1C to 1F are results of measuring the cancer-forming ability (FIG. 1D) and colony-forming ability of the cells (FIG. 1E and 1F) after administration of the CT26 cell line treated with ANKs1a-specific shRNA to Balb/c mice.
2A is a result of measuring cancer formation ability when ANKs1a expression was knocked out in breast cancer-expressing mice (MMTV-Neu).
2B and 2C are results of measuring colony formation ability after administration of shRNA specific to ANKs1a to breast cancer-expressing mice (MMTV-Neu).
2D and 2E show the results of measuring the expression of EphA2 and ErbB2 after administering shRNA specific to ANKs1a to breast cancer-expressing mice (MMTV-Neu).
3A and 3B are results of measuring the effect of Anks1a on the migration of EphA2 and ErbB2 to the cell surface.

The present invention for achieving the above-described object, the present invention provides a composition for preventing or treating cancer, and a screening method thereof, comprising an Anks1a protein expression or activity inhibitor as an active ingredient. Hereinafter, the present invention will be described in detail with reference to the drawings.

The present invention provides a composition for preventing or treating cancer comprising an inhibitor of Anks1a protein expression or activity as an active ingredient. In the present invention, the ANKs1a protein (Ankyrin repeat and SAM domain-containing protein 1A) is an adapter protein present in the cytoplasm of a cell, and is expressed by the ANKs1a gene. The ANKs1a gene is present on the 6th chromosome (6p21.31) in humans, the nucleotide sequence has a sequence shown in NM_015245.2 of NCBI, and the amino acid sequence may have a sequence shown in NP_056060.2 of NCBI.

Through the present invention, the ANKs1a is expressed in the endoplasmic reticulum, which plays an important function in the production of proteins and movement to the cell membrane, and Anks1a binds to EphA2 through the ANK (ankyrin repeat region) domain and through the PTB domain (Phosphotyrosine Binding Domains). It was confirmed that it binds to the Sec23 protein (one of the components of the vesicle that moves from the vesicle to the Golgi apparatus). Through this, the ANK of Anks1a interacts with EphA2 to determine the properties that can regulate the process of migration from the endoplasmic reticulum to the cell membrane of EphA2, and by using this, a composition for preventing or treating cancer containing an inhibitor of Anks1a protein expression or activity as an active ingredient Is to provide. For example, an inhibitor of expression or activity of Anks1a included in the composition for preventing or treating cancer according to the present invention may specifically act on an ankyrin repeat region (ANK) domain, but is not limited thereto.

In the present invention, the term "cancer" refers to a state in which abnormal cells that normally need to be killed due to a problem in the regulatory function of the cells themselves proliferate and invade surrounding tissues and organs to form a lump and destroy or deform the existing structure. It means, and is used in the same meaning as a malignant tumor. In addition, "prevention or treatment" of cancer means that it inhibits or prevents the growth of cancer, which reduces the growth and metastasis of cancer compared to when not treated or treated, and reduces resistance to anticancer drugs to treat It is a concept that includes making it more effective. The metastasis of cancer refers to a process in which tumor (cancer) cells spread to distant parts of the body, and the term "anticancer drug resistance" or "anticancer drug resistance" refers to the treatment of cancer patients using anticancer drugs, from the beginning of treatment. It means that there is no therapeutic effect or it has a cancer treatment effect in the early stage, but the cancer treatment effect is lost in the course of continuous treatment.

The ANKs1a protein expression inhibitor contained in the composition for preventing or treating cancer according to the present invention is an antisense nucleotide complementarily binding to the mRNA of the ANKs1a gene, short interfering RNA (siRNA), and short hairpin RNA. , shRNA) may be any one or more selected from the group consisting of, but is not limited thereto.

In the present invention, the term "antisense nucleotide" is a DNA or RNA containing a nucleic acid sequence complementary to a specific mRNA sequence, or a derivative thereof, which binds to a complementary sequence in the mRNA and inhibits the translation of the mRNA into a protein. And may also be expressed as'antisense oligonucleotide'. Antisense nucleotide sequence refers to a DNA or RNA sequence that is complementary to ANKs1a mRNA and capable of binding to ANKs1a mRNA, and is essential for translation, translocation into the cytoplasm, maturation, or any other overall biological function of ANKs1a mRNA. It can inhibit activity. The length of the antisense nucleotide may be 6 to 100 bases, preferably 8 to 60 bases, more preferably 10 to 40 bases.

The antisense nucleotide may be modified at one or more bases, sugars, or backbone positions to enhance efficacy. The nucleotide skeleton may be modified by phosphorothioate, phosphotriester, methyl phosphonate, short-chain alkyl, cycloalkyl, short-chain heteroatomic, heterocyclic inter-sugar bond, or the like. In addition, antisense nucleotides may contain one or more substituted sugar moieties. Antisense nucleotides can include modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-methyl pyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenin, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine Etc. In addition, the antisense nucleotide of the present invention may be chemically combined with one or more moieties or conjugates that improve the activity and cell adsorption of the antisense nucleotide. Cholesterol moiety, cholesteryl moiety, cholic acid, thioether, thiocholesterol, fatty chain, phospholipid, polyamine, polyethylene glycol chain, adamantane acetic acid, palmityl moiety, octadecylamine, hexylamino-carbonyl-oxy Fat-soluble moieties such as cholesterol moieties, and the like, but are not limited thereto. A method for preparing a new nucleotide containing a fat-soluble moiety is already well known in the technical field of the present invention (US Patent Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleotide can increase the stability for nucleases and increase the binding affinity between the antisense nucleotide and the target mRNA.

The antisense nucleotide may be synthesized in vitro by a conventional method and administered in vivo, or the antisense nucleotide may be synthesized in vivo. One example of synthesizing antisense nucleotides in vitro is the use of RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow antisense RNA to be transcribed using a vector whose origin is in the opposite direction of the multicloning site (MCS). It is preferable that the antisense RNA has a translation stop codon in the sequence so that it is not translated into a peptide sequence. The design of the antisense nucleotide that can be used in the present invention can be easily prepared according to a method known in the art by referring to the nucleotide sequence of the ANKs1a gene.

In the present invention, the terms "small interfering RNA" and "siRNA" are nucleic acid molecules capable of mediating RNA interference or gene silencing, and since they can inhibit the expression of target genes, an efficient gene knockdown method Or it is used as a gene therapy method. When the siRNA molecule is used in the present invention, the sense strand (a sequence corresponding to the ANKs1a mRNA sequence) and the antisense strand (a sequence complementary to the ANKs1a mRNA sequence) are located on opposite sides to form a double strand or self-complementary (self -complementary) It may have a single-chain structure with sense and antisense strands. siRNA is not limited to a complete pair of double-stranded RNA portions that form a pair of RNAs, and is not limited to mismatch (the corresponding base is not complementary), swelling/bulge (the base corresponding to one chain is None) may include parts that do not form a pair. The siRNA terminal structure can be either a blunt end or a cohesive end as long as the expression of the ANKs1a gene can be suppressed by the effect of RNA interference (RNAi). The adhesive end structure can be both a 3'-end protruding structure and a 5'-end protruding structure.

In addition, the siRNA molecule of the present invention may have a form in which a short nucleotide sequence is inserted between the self-complementary sense and antisense strands, and in this case, the siRNA molecule formed by the expression of the nucleotide sequence is suitable for intramolecular hybridization. As a result, a hairpin structure is formed, and a stem-and-loop structure is formed as a whole. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

The method of producing siRNA is a method of directly synthesizing siRNA in a test tube and then introducing it into a cell through a transformation process, and a siRNA expression vector or PCR-derived siRNA expression cassette prepared so that the siRNA is expressed in the cell is transformed into the cell. There are methods of conversion or infection.

The composition of the present invention comprising the gene-specific siRNA may include an agent that promotes the introduction of siRNA into cells. Formulations that promote the influx of siRNA into cells can generally be used as agents that promote the influx of nucleic acids, such as liposomes or lipophilicity of one of a number of sterols including cholesterol, cholate, and deoxycholic acid. It can be combined with a carrier. In addition, poly-L-lysine, spermine, polysilazane, polyethylenimine (PEI), polydihydroimidazolenium, polyallylamine ), a cationic polymer such as chitosan may be used, and succinylated PLL (PLL), succinylated PEI (succinylated PEI), polyglutamic acid, polyaspartic acid Anionic polymers such as (polyaspartic acid), polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, etc. Can be used.

In the present invention, the terms "short hairpin RNA" and "shRNA" are a single molecule in which two complementary parts having a base sequence of siRNA form a base pair and are covalently bonded by a single-stranded hairpin region. It is about 50-70 nucleotides long and has a stem loop structure in vivo. Long RNAs of 19-29 nucleotides complementarily on both sides of the loop region of 5-10 nucleotides form a double-stranded stem by forming base pairs. The shRNA is generally synthesized in vivo by transcription of a complementary nucleotide sequence from the Pol III promoter. Pol-III-induced transcription begins at a well-known starting point and ends at the second residue of the line (-TTTT-) consisting of four or more thymidines, resulting in a non-poly(A) transcript. The Pol III promoter is active in all cells and can express shRNA. After transcription, the loop of shRNA is cut by Dicer and acts like siRNA [Tuschl, T. (2002), Cell 110(5): 56374]. More preferably, the short hairpin RNA (Short hairpin RNA) of the ANKs1a gene of the composition for preventing or treating cancer according to the present invention may have a nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2.

The ANKs1a protein activity inhibitor included in the composition for preventing or treating cancer according to the present invention may be any one or more selected from the group consisting of compounds, peptides, peptidomimetics, aptamers, and antibodies that complement ANKs1a protein. Not limited.

The term "peptide mitemix" of the present invention is a peptide or non-peptide that inhibits the binding domain of the ANKs1a protein and inhibits the activity of the ANKs1a protein. The main residues of the non-hydrolyzable peptide analog include β-turn dipeptide core (Nagai et al. Tetrahedron Lett 26:647, 1985), keto-methylene pseudopeptides (Ewenson et al. J Med Chem 29:295, 1986; And Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), azepine (Huffman et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), benzodiazepines (Freidinger et al. in Peptides; Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), β-amino alcohols (Gordon et al. Biochem Biophys Res) Commun 126:419 1985) and substituted gammalac tamping (Garvey et al. in Peptides: Chemistry and Biology, GR Marshell ed., ESCOM Publisher: Leiden, Netherlands, 1988).

In the present invention, the term "aptamer" refers to a nucleic acid molecule having binding activity to a predetermined target molecule. The aptamer may inhibit the activity of the polynucleotide or protein by binding to the ANKs1a polynucleotide or protein. The aptamer of the present invention may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be in a linear or cyclic form. The length of the aptamer of the present invention is not particularly limited and may be usually 15 to 200 nucleotides, but for example, it is 100 nucleotides or less, preferably 80 nucleotides or less, more preferably 60 nucleotides or less, and even more preferably 45 It may be less than or equal to nucleotides. The length of the aptamer of the present invention may also be, for example, 18, 20 or 25 nucleotides or more. When the total number of nucleotides is small, chemical synthesis and mass production are easier, and the cost advantage is also great. In addition, chemical formula is easy, stability in vivo is high, and toxicity is low.

The aptamer of the present invention can be produced by using the SELEX method and its improvement method. The SELEX (Systematic Evolution of Ligands by EXponential enrichment) method is a method for selecting oligonucleotides that specifically bind to a target substance from a pool of oligonucleotides having about 10 to 14 different nucleotide sequences. The oligonucleotides used are used. The nucleotide has a structure in which a random sequence of about 40 residues is inserted as a primer sequence, and this oligonucleotide pool is associated with a target substance, and only the oligonucleotide bound to the target substance is recovered using a filter, etc. The recovered oligonucleotide is RT. -Amplify by PCR and use it as a template for the next round By repeating this operation about 10 times, an aptamer that specifically binds to the target substance can be obtained. By using, aptamers with stronger binding power to the target substance can be concentrated and selected. Therefore, by controlling the number of rounds of SELEX or changing the race state, aptamers having different binding strengths, aptamers having different binding forms, It is possible to obtain an aptamer having the same binding strength or binding form but different nucleotide sequences.In addition, although the SELEX method includes amplification process by PCR, it is possible to obtain more diversity by imparting mutations by using manganese ions in the process. In addition to the conventional SELEX technique, aptamers can be obtained using the Cell-SELEX technique for complex targets, that is, living cells and tissues. In addition, it has the advantage of being able to develop aptamers for diseased cells, and in the isolated state, it may not exhibit its original properties, so that the target protein in a physiological state enables a more functional approach in the selection process. Therefore, the Cell-SELEX technique has an advantage over the conventional SELEX process.

On the other hand, the aptamer binds to the target material through various bonding modes such as ionic bonding using the negative charge of a phosphate group, hydrophobic bonding and hydrogen bonding using ribose, hydrogen bonding or stacking bonding using a nucleotide base. In particular, the ionic bond using the negative charge of the phosphate group present as many as the number of constituent nucleotides strongly binds with the positive charge of lysine or arginine present on the surface of the protein. For this reason, nucleotide bases not involved in direct binding to the target substance can be substituted. In particular, since the part of the stem structure has already made a base pair and faces the inside of the double helix structure, it is difficult for the nucleic acid base to directly bind to the target substance. Therefore, even if a base pair is substituted with another base pair, the activity of the aptamer is not often decreased. Even in a structure that does not form a base pair, such as a loop structure, when the nucleic acid base is not involved in direct binding to the target molecule, the base can be substituted. For example, in the 2'position of ribose, it may be a nucleotide in which a hydroxyl group is substituted with an arbitrary atom or group. As such an arbitrary atom or group, for example, a hydrogen atom, a fluorine atom or an -O-alkyl group (eg -O-CH3), an -O-acyl group (eg -O-CHO), an amino group (eg -NH2) And nucleotides substituted with. As described above, the aptamer retains its activity unless a functional group involved in direct binding to the target molecule is substituted or deleted. In addition, the aptamer can be easily modified because it can be chemically synthesized. Aptamer predicts the secondary structure using the MFOLD program, or predicts the three-dimensional structure by X-ray analysis or NMR analysis, so that it can predict to what extent what nucleotides can be substituted or deleted, and where new nucleotides can be inserted. . The aptamer of the predicted new sequence can be easily chemically synthesized, and whether or not the aptamer maintains activity can be confirmed by an existing analysis system.

In the present invention, the term "antibody" is a substance produced by stimulation of an antigen in the immune system and specifically binds to a specific antigen to cause an antigen-antibody reaction. In the present invention, in order to inhibit the activity of the ANKs1a protein, a specific ANKs1a protein Antibodies that bind operatively can be used. In particular, an antibody that acts on the ANK domain in the ANKs1a protein to inhibit the binding of EphA2 or inhibits the migration of EphA2 to the cell surface may be used. An antibody specific for the ANKs1a protein that can be used in the present invention may be a polyclonal or monoclonal antibody, preferably a monoclonal antibody. Antibodies specific to the ANKs1a protein are methods commonly practiced in the art, for example, fusion methods (Kohler and Milstein, European Journal of Immunology, 6:511-519 (1976)), recombinant DNA methods (US Pat. No. 4,816,567). No.) or phage antibody library method (Clackson et al, Nature, 352:624-628 (1991) and Marks et al, J. Mol. Biol., 222:58, 1-597 (1991)). have. The general procedure for antibody production can use methods known in the art, for example, the production of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with antibody-producing lymphocytes, Techniques required for this process are well known to those skilled in the art and can be easily implemented. Polyclonal antibodies can be obtained by injecting the ANKs1a protein antigen into a suitable animal, collecting antisera from this animal, and then isolating the antibody from the antisera using a known affinity technique.

In the present invention, the antibody may include a single chain variable region fragment (scFv). The single chain variable region fragment may be composed of a "light chain variable region (VL)-linker-heavy chain variable region (VH)". The linker refers to an amino acid sequence of a predetermined length that functions to artificially link the variable regions of the heavy and light chains.

The composition for preventing or treating cancer according to the present invention includes liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, gastric cancer, breast cancer, cervical cancer, uterine cancer, prostate cancer, pancreatic cancer, It may be applied to any one cancer selected from the group consisting of epidermal cancer and lung cancer, but is not limited thereto, and may preferably be breast cancer.

The composition for preventing or treating cancer according to the present invention may contain one or more active ingredients exhibiting the same or similar function in addition to the above-described ANKs1a protein expression or activity inhibitor.

The composition can be administered orally or parenterally during clinical administration, and when administered parenterally, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine dural injection, cerebrovascular injection or intrathoracic injection It can be administered by, and can be used in the form of a general pharmaceutical formulation. The composition may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers. The daily dosage of the composition is about 0.0001 to 100 mg/kg, preferably 0.001 to 10 mg/kg, and it is preferable to administer once to several times a day, but the patient's weight, age, sex, health status, diet , The range varies depending on the administration time, administration method, excretion rate, and severity of disease.

The composition of the present invention can be administered in various parenteral formulations at the time of actual clinical administration.When formulated, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. do. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, etc. can be used.

Another aspect of the present invention, (a) treating the target cell with a candidate substance; (b) measuring the expression or activity of the ANKs1a protein in the target cell; And (c) as a result of the measurement, it provides a method for screening a substance for preventing or treating cancer comprising the step of selecting a candidate substance that reduces the expression or activity of ANKs1a protein from among the candidate substances. The "ANKs1a gene expression inhibitor" or "ANKs1a protein activity inhibitor" of the present invention can be obtained through the above screening method.

In the present invention, the term "candidate" refers to an unknown substance used in screening to examine whether it affects the expression of the ANKs1a gene or the activity of the ANKs1a protein. The candidate substances are not limited thereto, but may include chemical substances, peptides, and natural extracts. The candidate material analyzed by the screening method of the present invention may be a single compound or a mixture of compounds, and may be obtained from a library of synthetic or natural compounds.

The step of measuring the expression or activity of ANKs1a protein in the method for screening a substance for preventing or treating cancer according to the present invention includes the amount of ANKs1a gene expression, the amount of ANKs1a protein, another protein subjected to the action of the ANKs1a protein, ANKs1a protein and other proteins. Any one or more selected from interactions with, ANKs1a protein and other protein complexes, and other protein complexes subjected to the ANKs1a protein action may be detected or measured, but is not limited thereto. Other proteins that interact with or form a complex with the ANKs1a protein may be EphA2, ErbB2, or a complex thereof. For example, measuring the amount of mRNA expression of ANKs1a (more preferably, expression of ANK region genes), quantifying the amount of ANKs1a protein, quantifying the amount of EphA2 protein on the cell surface before and after treatment with a candidate substance, or a candidate substance It may be a method of quantifying changes in the EphA2 protein inside and on the surface of cells before and after treatment, or quantifying the amount of ErbB/EphA2 complex.

In the method for screening a substance for preventing or treating cancer according to the present invention, the expression or activity of the ANKs1a protein can be measured by a method commonly used in the art, and reverse transcriptase-polymerase chain reaction), real time-polymerase chain reaction, Western blot, Northern blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion and immunoprecipitation assay It may be selected from the group consisting of (immunoprecipitation assay), but is not limited thereto.

In the present invention, step (b) is a step of selecting a candidate substance that reduces the expression or activity of ANKs1a protein from among the candidate substances as a result of the measurement, and the expression of the ANKs1a gene or the activity of the ANKs1a protein is lowered by the candidate substance. By measuring downregulation, it can be determined as a substance for preventing or treating cancer.

The screening method of the present invention can be carried out in a variety of ways, and in particular, can be carried out in a high throughput manner according to various binding assays known in the art. In the screening method of the present invention, a candidate substance or ANKs1a protein may be labeled with a detectable label. For example, the detectable label is a chemical label (e.g., biotin), an enzyme label (e.g. horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, β-galactosidase and β- Glucosidase), radioactive labels (e.g., C14, I125, P32 and S35), fluorescent labels (e.g., coumarin, fluorescein, FITC (fluoresein isothiocyanate), rhodamine 6G, rhodamine B, TAMRA (6) -carboxy-tetramethylrhodamine), Cy-3, Cy-5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl and FAM), luminescent label, chemiluminescent Label, fluorescence resonance energy transfer (FRET) label, or metal label (eg, gold and silver). When a detectable label-labeled ANKs1a protein or candidate substance is used, whether or not binding between the ANKs1a protein and the candidate substance occurs can be analyzed by detecting a signal from the label. For example, when alkaline phosphatase is used as a label, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS-B1-phosphate) ) And a color-reactive substrate such as ECF (enhanced chemifluorescence) to detect the signal. When horse radish peroxidase is used as a label, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorupine benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2-Azine-di[3-ethylbenzthiazoline sulfonate) ]), o-phenylenediamine (OPD) and substrates such as naphthol/pyronine are used to detect signals. Alternatively, the binding of the candidate substance to the ANKs1a protein may be analyzed without labeling of the interactants. For example, it is possible to analyze whether a candidate substance binds to the ANKs1a protein using a microphysiometer. Microfigometers are analytical tools that measure the rate at which cells acidify their environment using a light-addressable potentiometric sensor (LAPS). The change in acidification rate can be used as an indicator for the binding between the candidate substance and the ANKs1a protein (McConnell et al., Science 257:19061912 (1992)).

The ability of the candidate to bind to the ANKs1a protein can be analyzed using real-time bimolecular interaction analysis (BIA) (Szabo et al., Curr. Opin. Struct. Biol. 5:699-705 (1995)). BIA is a technique for analyzing specific interactions in real time, and can be performed without labeling of interactants (eg, BIAcore™). Changes in surface plasmon resonance (SPR) can be used as an indicator of real-time reactions between molecules.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention will not be construed as being limited by these examples.

1. Experimental method

(1) cell culture

The CT26 cell line was grown in Dulbecco's modified MEM medium (DMEM) containing 10% FBS. Primary tumor cells (PMTC) were ^{cultured from Anks1a +/-} MMTV-Neu mice. First, the cancer tissue was separated from the rat, washed with PBS, and then chopped finely with a knife. Put the finely chopped cancer tissue into a 50 ml tube and immerse it in a collagenase solution (0.2% trypsin, 0.2% collagenase A, 5% FBS, and 5 μg/ml gentamicin, diluted in DMEM/F12 medium) for 2 hours. It was placed at 37°C. Then, centrifugation was performed at 1,500 rpm for 10 minutes to discard the supernatant, and the pellet was mixed well with 4 ml of DMEM/F12 containing 2U/ml DNase and shaken slowly at room temperature for 5 minutes. Then, 6 ml of DMEM/F12 was added and the process of centrifuging at 1,500 rpm for 10 minutes to remove the supernatant was repeated 5 times. At the end, the supernatant was removed and the growth medium (1000×ITS, 5 μg/ml epidermal growth factor (EGF), 5% fetal bovine serum (FBS)), 500 μg/ml gentamicin, 10% antibiotics, DMEM/F12 Dilution in the medium) was added and mixed, and then spread on a plate and cultured.

For the analysis of colony formation, the cultured CT26 or PMTC was placed in a media containing lentivirus for 3 days. And before the analysis, 2X DMEM containing 5% fetal calf serum was mixed 1:1 with 1.5% agarose and laid on a 24-well plate to solidify. This is called the base agarose, and after it is completely solidified, the cells infected with the lentivirus were separated from the plate, mixed with serum-free DMEM, and centrifuged. The supernatant was removed, and the cells were mixed with top agarose in which 2X DMEM containing 5% FBS and 1% agarose were mixed 1:1, and spread on the solid base agarose. After culturing this in an incubator for 3 weeks, a picture was taken under a microscope, and the size of each colony was measured using Image J.

(2) fluorescent staining

CT26 or PMTC infected with lentivirus is incubated on a cover slip. Anti-human IgG was mixed 1:1 with 2µg/ml of ephrinA5-Fc, pre-clustered on ice for 1 hour, and then mixed with serum-free DMEM and put into cells. After being placed at 4° C. for 1 hour, the cells were washed three times with phosphate buffered saline (PBS). Then, a fixing solution containing 4% paraformaldehyde, 2% sucrose, and 3% bovine serum albumin (BSA) was added to fix the cells on ice for 30 minutes. After washing again with PBS three times, 5% horse serum, 0.1% Triton X-100, and 3% BSA were added and blocked at room temperature for 30 minutes. Then, FITC or goat anti-human IgG with TRITC was added to 3% BSA solution and stained at room temperature for 2 hours. This was photographed with a fluorescence microscope and the intensity of fluorescence was quantified using Image J.

ErbB2 staining on the cell surface was performed by fixing cells cultured on a cover slip, followed by a blocking process, and then put an anti-ErbB2 antibody in 3% BSA solution and placed in a refrigerator at 4°C overnight. Then, the next day, it was washed with PBS, blocked again, and stained with rabbit anti-mouse IgG with TRITC. This was photographed with a fluorescence microscope and the intensity of fluorescence was quantified using Image J.

(3) In vitro budding assay

HEK293T cells are grown on a 100 mm plate, and each gene is transfected for expression. After 48 hours, the cells are washed with PBS, treated with trypsin and removed from the plate. Then, 10 ml of B88-0 (20mM HEPES (pH7.2), 250mM sorbitol, 150mM KOAc) buffer was added, and 10 µg/ml of soybean trypsin inhibitor was mixed thereto, followed by centrifugation. Thereafter, the supernatant was removed, 40 μg/ml digitonin was added to 10 ml of B88-0 buffer, placed on ice for 5 minutes, and then centrifuged to collect cells. The cells thus obtained were used to make vesicles with a donor membrane. Mouse liver cytosol, ATP regenerating system (40nM creatine phosphate, 0.2mg/ml creatine phosphokinase, 1mM ATP) and 0.2mM GTP were added to the donor membrane and reacted at 30℃ for 1 hour. Then, the donor membrane was removed by centrifugation at 15,000 rpm for 15 minutes, and the supernatant was centrifuged again at 32,000 rpm for 114 minutes to separate the vesicles. This was dissolved in a solubilization buffer (10 mM Tris-HCl (pH7.6), 100 mM sodium chloride, and 1% Triton X-100 (containing a phosphatase inhibitor)), followed by immunoblotting on an SDS-PAGE gel.

2. Experiment result

(1) Relationship between ANKs1a expression and EphA2

Using CT26, a cell line obtained from colon cancer in mice, the relationship between the expression of Anks1a and EphA2 was investigated. The amount of Anks1a in the cells was reduced using shRNA, which was confirmed through Western blotting (FIG. 1A). At this time, the sequence of the shRNA-17 is the nucleotide sequence described in SEQ ID NO: 1 [(CCGGCGTCCCTTTCAAGATTGGTTTCTCGAGAAACCAATCTTGAAAGGGACGTTTTTG); 3'UTR region], and the sequence of shRNA-21 is the nucleotide sequence set forth in SEQ ID NO: 2 [(CCGGCCAGATAGTACGTCTGCTCATCTCGAGATGAGCAGACGTACTATCTGGTTTTTG); CDS region].

As a result of the experiment, it was confirmed that the decrease in the amount of Anks1a did not change the amount of EphA2 in the cell (Fig. 1a, second row), but the amount of EphA2 located on the cell surface decreased (Fig. 1b).

In addition, the CT26 cell line treated with ANKs1a-specific shRNA was injected into Balb/c mice to confirm the degree of cancer formation. As a result of the experiment, it was confirmed that when EphA2 on the cell surface was decreased by Anks1a, the cancer-forming ability of the cells was inhibited (FIG. 1D). The inhibition of the cancer-forming ability was once again confirmed through colony formation analysis using cells (FIGS. 1e and 1f); In general, using the property that cancer cells survive and maintain proliferation under extreme conditions, it can be confirmed whether they have the characteristics of cancer cells depending on whether or not cells grow on agarose to form cell colonies. It was confirmed through Western blotting that the decrease in EphA2 on the cell surface decreased Erk activity, thereby inducing a decrease in the cancer-forming ability of these cells (Fig. 1a, third and fourth lines).

(2) Cell membrane expression and cancer formation of EphA2 by ANKs1a

In MMTV-Neu (ErbB2) mice, which develop breast cancer after 8 months by inducing strong expression of the ErbB2 gene in the breast by the MMTV promoter, the frequency of breast cancer formation in mice was compared when the amount of Anks1a was decreased.

As a result of the experiment, it was confirmed that when the expression level of Anks1a was reduced by half or completely, the ability of the mice to form breast cancer was decreased depending on this (FIG. 2A). When cells were cultured from cancer tissues of mice with normal breast cancer, and the expression of Anks1a of these cells was reduced using shRNA, it was confirmed once again through colony formation analysis that the cancer formation ability was reduced (FIGS. 2b and 2c). In addition, it was confirmed that the inhibition of breast cancer formation was due to a decrease in EphA2 on the cell surface when Anks1a was decreased, and in addition, it was confirmed that the cell surface expression of ErbB2 was decreased (FIGS. 2D and 2E ).

(3) Effect of ANKs1a on cell surface migration of EphA2 and ErbB2

It was confirmed that Anks1a affects the migration of EphA2 and ErbB2 to the cell surface, and EphA2 and ErbB2 present in the vesicle moving from the endoplasmic reticulum to the Golgi apparatus, which is the first step in the migration to the cell surface, were identified. It can be seen that the migration of EphA2 to the cell surface is effective in the presence of Anks1a through the well-known experimental method, budding assay (Fig. 3b). In addition, surprisingly, it was found that the cell migration of ErbB2 requires both Anks1a and EphA2 (Fig. 3a).

In conclusion, the intracellular expression of ErbB2 is more stable in the presence of EphA2, and at this time, the migration to the cell surface by Anks1a is increased, and the amount of ErbB2/EphA2 complex present in the cell membrane is increased. It was confirmed that it was elevated to promote cancer formation.

Therefore, if the function of Anks1a is offset by using an inhibitor specific to Anks1a, it will be possible to suppress breast cancer by reducing the amount of ErbB2/EphA2 on the cell surface.In particular, targeting the ANK region involved in the interaction between ANKs1a and EphA2 If an inhibitor is developed, it is expected to be highly effective as a treatment for cancer, especially breast cancer.

As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it is obvious that this specific technique is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> Industry Academic Cooperation Foundation of Sookmyung Women's University <120> Composition for prevention or treating cancer comprising inhibitors for expression or activity of ANKs1a, and screening method for thereof <130> PN1709-308 <150> KR 1020150149863 <151> 2015-10-28 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA-17 <400> 1 ccggcgtccc tttcaagatt ggtttctcga gaaaccaatc ttgaaaggga cgtttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA-21 <400> 2 ccggccagat agtacgtctg ctcatctcga gatgagcaga cgtactatct ggtttttg 58 <210> 3 <211> 3405 <212> PRT <213> Artificial Sequence <220> <223> ANKs1a cDNA seq <400> 3 Ala Thr Gly Gly Gly Gly Ala Ala Gly Gly Ala Gly Cys Ala Gly Gly 1 5 10 15 Ala Gly Cys Thr Gly Cys Thr Gly Gly Ala Gly Gly Cys Gly Gly Cys 20 25 30 Cys Cys Gly Cys Ala Cys Cys Gly Gly Gly Cys Ala Cys Cys Thr Cys 35 40 45 Cys Cys Gly Gly Cys Gly Gly Thr Gly Gly Ala Gly Ala Ala Gly Cys 50 55 60 Thr Gly Cys Thr Gly Thr Cys Cys Gly Gly Gly Ala Ala Gly Cys Gly 65 70 75 80 Gly Cys Thr Cys Thr Cys Cys Thr Cys Ala Gly Gly Cys Thr Thr Thr 85 90 95 Gly Gly Gly Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly 100 105 110 Gly Thr Gly Gly Cys Thr Cys Thr Gly Gly Gly Gly Gly Cys Gly Gly 115 120 125 Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Ala Gly Cys Gly Gly Cys 130 135 140 Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Cys 145 150 155 160 Thr Cys Gly Gly Cys Thr Cys Thr Thr Cys Cys Ala Gly Cys Cys Ala 165 170 175 Cys Cys Cys Cys Cys Thr Cys Thr Cys Cys Ala Gly Thr Cys Thr Gly 180 185 190 Cys Thr Cys Ala Gly Cys Ala Thr Gly Thr Gly Gly Ala Gly Ala Gly 195 200 205 Gly Gly Cys Cys Ala Ala Ala Thr Gly Thr Gly Ala Ala Cys Thr Gly 210 215 220 Thr Gly Thr Thr Gly Ala Cys Ala Gly Cys Ala Cys Thr Gly Gly Cys 225 230 235 240 Thr Ala Cys Ala Cys Ala Cys Cys Cys Cys Thr Gly Cys Ala Cys Cys 245 250 255 Ala Thr Gly Cys Thr Gly Cys Thr Thr Thr Gly Ala Ala Thr Gly Gly 260 265 270 Cys Cys Ala Thr Ala Ala Gly Gly Ala Thr Gly Thr Gly Gly Thr Cys 275 280 285 Gly Ala Gly Gly Thr Thr Cys Thr Thr Cys Thr Gly Ala Gly Gly Ala 290 295 300 Ala Cys Gly Ala Thr Gly Cys Gly Cys Thr Gly Ala Cys Cys Ala Ala 305 310 315 320 Cys Gly Thr Gly Gly Cys Thr Gly Ala Cys Thr Cys Ala Ala Ala Ala 325 330 335 Gly Gly Cys Thr Gly Cys Thr Ala Cys Cys Cys Thr Cys Thr Gly Cys 340 345 350 Ala Thr Thr Thr Gly Gly Cys Ala Gly Cys Cys Thr Gly Gly Ala Ala 355 360 365 Ala Gly Gly Ala Gly Ala Thr Gly Cys Cys Cys Ala Gly Ala Thr Ala 370 375 380 Gly Thr Gly Cys Gly Gly Thr Thr Gly Cys Thr Cys Ala Thr Cys Cys 385 390 395 400 Ala Thr Cys Ala Ala Gly Gly Gly Cys Cys Thr Thr Cys Ala Cys Ala 405 410 415 Cys Ala Cys Cys Ala Gly Ala Gly Thr Cys Ala Ala Thr Gly Ala Ala 420 425 430 Cys Ala Gly Ala Ala Cys Ala Ala Thr Gly Ala Cys Ala Ala Cys Gly 435 440 445 Ala Gly Ala Cys Ala Gly Cys Cys Cys Thr Gly Cys Ala Thr Thr Gly 450 455 460 Thr Gly Cys Ala Gly Cys Gly Cys Ala Gly Thr Ala Thr Gly Gly Cys 465 470 475 480 Cys Ala Cys Ala Cys Ala Gly Ala Gly Gly Thr Gly Gly Thr Gly Ala 485 490 495 Ala Gly Gly Thr Gly Cys Thr Cys Thr Thr Ala Gly Ala Gly Gly Ala 500 505 510 Gly Cys Thr Gly Ala Cys Gly Gly Ala Cys Cys Cys Cys Ala Cys Cys 515 520 525 Ala Thr Gly Cys Gly Cys Ala Ala Cys Ala Ala Cys Ala Ala Ala Thr 530 535 540 Thr Cys Gly Ala Gly Ala Cys Cys Cys Cys Thr Thr Thr Gly Gly Ala 545 550 555 560 Cys Cys Thr Gly Gly Cys Ala Gly Cys Ala Cys Thr Gly Thr Ala Cys 565 570 575 Gly Gly Gly Cys Gly Ala Cys Thr Gly Gly Ala Gly Gly Thr Gly Gly 580 585 590 Thr Gly Ala Ala Ala Ala Thr Gly Cys Thr Cys Cys Thr Thr Ala Ala 595 600 605 Thr Gly Cys Ala Cys Ala Cys Cys Cys Cys Ala Ala Cys Cys Thr Cys 610 615 620 Cys Thr Gly Ala Gly Cys Thr Gly Cys Ala Ala Cys Ala Cys Thr Ala 625 630 635 640 Ala Gly Ala Ala Gly Cys Ala Cys Ala Cys Cys Cys Cys Thr Cys Thr 645 650 655 Gly Cys Ala Cys Thr Thr Gly Gly Cys Ala Gly Cys Ala Ala Gly Gly 660 665 670 Ala Ala Thr Gly Gly Cys Cys Ala Cys Ala Ala Ala Gly Cys Cys Gly 675 680 685 Thr Gly Gly Thr Cys Cys Ala Gly Gly Thr Cys Cys Thr Cys Cys Thr 690 695 700 Cys Gly Ala Thr Gly Cys Thr Gly Gly Cys Ala Thr Gly Gly Ala Cys 705 710 715 720 Ala Gly Cys Ala Ala Cys Thr Ala Cys Cys Ala Gly Ala Cys Gly Gly 725 730 735 Ala Gly Ala Thr Gly Gly Gly Cys Ala Gly Thr Gly Cys Thr Thr Thr 740 745 750 Gly Cys Ala Thr Gly Ala Gly Gly Cys Thr Gly Cys Thr Thr Thr Gly 755 760 765 Thr Thr Thr Gly Gly Cys Ala Ala Gly Ala Cys Cys Gly Ala Thr Gly 770 775 780 Thr Gly Gly Thr Gly Cys Ala Ala Ala Thr Cys Cys Thr Gly Cys Thr 785 790 795 800 Gly Gly Cys Thr Gly Cys Ala Gly Gly Ala Ala Cys Thr Gly Ala Cys 805 810 815 Gly Thr Cys Ala Ala Cys Ala Thr Ala Ala Ala Ala Gly Ala Thr Ala 820 825 830 Ala Cys Cys Ala Thr Gly Gly Ala Cys Thr Gly Ala Cys Thr Gly Cys 835 840 845 Cys Cys Thr Ala Gly Ala Cys Ala Cys Thr Gly Thr Thr Cys Gly Gly 850 855 860 Gly Ala Ala Cys Thr Gly Cys Cys Thr Thr Cys Thr Cys Ala Ala Ala 865 870 875 880 Ala Gly Ala Gly Cys Cys Ala Gly Cys Ala Ala Ala Thr Ala Gly Cys 885 890 895 Ala Gly Cys Ala Thr Thr Ala Ala Thr Thr Gly Ala Ala Gly Ala Thr 900 905 910 Cys Ala Cys Ala Thr Gly Ala Cys Thr Gly Gly Ala Ala Ala Ala Ala 915 920 925 Gly Ala Ala Gly Thr Ala Cys Ala Ala Ala Ala Gly Ala Ala Gly Thr 930 935 940 Ala Gly Ala Thr Ala Ala Ala Ala Cys Cys Cys Cys Cys Cys Cys Ala 945 950 955 960 Cys Cys Cys Cys Ala Gly Cys Cys Ala Cys Cys Thr Cys Thr Cys Ala 965 970 975 Thr Cys Thr Cys Cys Ala Gly Thr Ala Thr Gly Gly Ala Cys Thr Cys 980 985 990 Cys Ala Thr Ala Thr Cys Ala Cys Ala Gly Ala Ala Gly Thr Cys Thr 995 1000 1005 Cys Ala Gly Gly Gly Thr Gly Ala Cys Gly Thr Gly Gly Ala Gly Ala 1010 1015 1020 Ala Ala Gly Cys Ala Gly Thr Gly Ala Cys Thr Gly Ala Ala Cys Thr 1025 1030 1035 1040 Gly Ala Thr Thr Ala Thr Ala Gly Ala Thr Thr Thr Thr Gly Ala Thr 1045 1050 1055 Gly Cys Ala Ala Ala Thr Gly Cys Thr Gly Ala Ala Gly Ala Ala Gly 1060 1065 1070 Ala Gly Gly Gly Thr Cys Cys Cys Thr Ala Cys Gly Ala Ala Gly Cys 1075 1080 1085 Thr Cys Thr Gly Thr Ala Thr Ala Ala Thr Gly Cys Cys Ala Thr Cys 1090 1095 1100 Thr Cys Cys Thr Gly Cys Cys Ala Thr Thr Cys Gly Thr Thr Gly Gly 1105 1110 1115 1120 Ala Cys Ala Gly Cys Ala Thr Gly Gly Cys Cys Ala Gly Cys Gly Gly 1125 1130 1135 Gly Cys Gly Ala Thr Cys Ala Thr Cys Thr Gly Ala Cys Cys Ala Ala 1140 1145 1150 Gly Ala Cys Thr Cys Cys Ala Cys Gly Ala Ala Cys Ala Ala Gly Gly 1155 1160 1165 Ala Gly Gly Cys Thr Gly Ala Gly Gly Cys Ala Gly Cys Ala Gly Gly 1170 1175 1180 Ala Gly Thr Gly Ala Ala Ala Cys Cys Thr Gly Cys Thr Gly Gly Ala 1185 1190 1195 1200 Gly Thr Gly Ala Gly Gly Cys Cys Thr Ala Gly Gly Gly Ala Ala Cys 1205 1210 1215 Gly Thr Cys Cys Ala Cys Cys Ala Cys Cys Thr Cys Cys Ala Gly Cys 1220 1225 1230 Ala Ala Ala Gly Cys Cys Ala Cys Cys Gly Cys Cys Cys Gly Ala Thr 1235 1240 1245 Gly Ala Ala Gly Ala Gly Gly Ala Ala Gly Ala Ala Gly Ala Cys Cys 1250 1255 1260 Ala Cys Ala Thr Ala Gly Ala Thr Ala Ala Gly Ala Ala Gly Thr Ala 1265 1270 1275 1280 Thr Thr Thr Thr Cys Cys Cys Thr Thr Gly Ala Cys Ala Gly Cys Thr 1285 1290 1295 Thr Cys Thr Gly Ala Gly Gly Thr Thr Cys Thr Gly Thr Cys Cys Ala 1300 1305 1310 Thr Gly Ala Gly Ala Cys Cys Thr Ala Gly Gly Ala Thr Thr Cys Ala 1315 1320 1325 Thr Gly Gly Gly Ala Gly Thr Gly Cys Ala Gly Cys Cys Cys Gly Gly 1330 1335 1340 Gly Ala Ala Gly Ala Ala Gly Ala Cys Gly Ala Ala Cys Ala Cys Cys 1345 1350 1355 1360 Cys Thr Thr Ala Thr Gly Ala Ala Cys Thr Gly Thr Thr Gly Thr Thr 1365 1370 1375 Ala Ala Cys Ala Gly Cys Ala Gly Ala Gly Ala Cys Ala Ala Ala Gly 1380 1385 1390 Ala Ala Ala Gly Thr Gly Gly Thr Gly Thr Thr Gly Gly Thr Gly Gly 1395 1400 1405 Ala Thr Gly Gly Ala Ala Ala Ala Ala Cys Ala Ala Ala Ala Gly Ala 1410 1415 1420 Cys Cys Ala Cys Ala Gly Gly Cys Gly Gly Ala Gly Cys Ala Gly Cys 1425 1430 1435 1440 Ala Gly Cys Ala Gly Cys Cys Gly Gly Ala Gly Cys Cys Ala Gly Gly 1445 1450 1455 Ala Cys Thr Cys Thr Gly Cys Gly Gly Ala Gly Gly Gly Gly Cys Ala 1460 1465 1470 Gly Gly Ala Cys Gly Gly Gly Cys Ala Gly Gly Thr Cys Cys Cys Ala 1475 1480 1485 Gly Ala Gly Cys Ala Gly Thr Thr Cys Thr Cys Ala Gly Gly Cys Cys 1490 1495 1500 Thr Cys Cys Thr Cys Cys Ala Cys Gly Gly Cys Thr Cys Cys Thr Cys 1505 1510 1515 1520 Cys Cys Cys Gly Gly Thr Gly Thr Gly Cys Gly Ala Gly Gly Thr Gly 1525 1530 1535 Gly Gly Gly Cys Ala Gly Gly Ala Cys Cys Cys Thr Thr Thr Cys Cys 1540 1545 1550 Ala Gly Cys Thr Gly Cys Thr Cys Thr Gly Thr Ala Cys Cys Gly Cys 1555 1560 1565 Thr Gly Gly Cys Cys Ala Gly Ala Gly Cys Cys Ala Thr Cys Cys Ala 1570 1575 1580 Gly Ala Cys Gly Gly Gly Thr Cys Cys Cys Cys Cys Cys Ala Gly Cys 1585 1590 1595 1600 Ala Gly Gly Gly Cys Gly Cys Cys Thr Gly Cys Cys Ala Cys Ala Ala 1605 1610 1615 Gly Gly Cys Cys Ala Gly Cys Ala Thr Gly Cys Ala Gly Cys Thr Gly 1620 1625 1630 Gly Ala Gly Gly Ala Gly Ala Cys Gly Gly Gly Thr Gly Thr Gly Cys 1635 1640 1645 Ala Thr Gly Cys Thr Cys Cys Thr Gly Gly Ala Gly Cys Cys Thr Cys 1650 1655 1660 Cys Cys Ala Gly Cys Cys Cys Ala Gly Thr Gly Cys Cys Cys Thr Gly 1665 1670 1675 1680 Gly Ala Cys Cys Ala Gly Ala Gly Cys Ala Ala Gly Ala Gly Ala Gly 1685 1690 1695 Thr Gly Gly Gly Cys Thr Ala Cys Cys Thr Cys Ala Cys Ala Gly Gly 1700 1705 1710 Cys Cys Thr Gly Cys Cys Cys Ala Cys Cys Ala Cys Cys Ala Ala Cys 1715 1720 1725 Ala Gly Cys Cys Gly Cys Thr Cys Gly Cys Ala Cys Cys Cys Thr Gly 1730 1735 1740 Ala Ala Ala Cys Thr Thr Thr Gly Ala Cys Thr Cys Ala Cys Ala Cys 1745 1750 1755 1760 Ala Gly Cys Ala Thr Cys Thr Cys Cys Gly Cys Ala Cys Cys Cys Thr 1765 1770 1775 Gly Gly Thr Gly Gly Thr Gly Cys Thr Gly Ala Gly Gly Ala Ala Gly 1780 1785 1790 Gly Ala Gly Ala Cys Cys Gly Gly Ala Gly Thr Gly Gly Gly Gly Cys 1795 1800 1805 Cys Ala Gly Gly Ala Gly Cys Cys Gly Ala Gly Cys Gly Cys Cys Thr 1810 1815 1820 Cys Cys Cys Ala Cys Thr Ala Gly Cys Ala Ala Ala Cys Cys Cys Ala 1825 1830 1835 1840 Ala Ala Gly Cys Thr Gly Ala Ala Cys Thr Cys Ala Ala Ala Cys Thr 1845 1850 1855 Cys Ala Gly Cys Cys Gly Cys Ala Gly Cys Thr Thr Gly Thr Cys Cys 1860 1865 1870 Ala Ala Gly Thr Cys Thr Gly Ala Cys Thr Cys Thr Gly Ala Thr Cys 1875 1880 1885 Thr Cys Cys Thr Gly Ala Cys Cys Thr Gly Cys Thr Cys Ala Cys Cys 1890 1895 1900 Cys Ala Cys Ala Gly Ala Gly Gly Ala Cys Gly Cys Thr Ala Cys Cys 1905 1910 1915 1920 Ala Thr Gly Gly Gly Gly Ala Gly Thr Cys Gly Gly Ala Gly Thr Gly 1925 1930 1935 Ala Gly Thr Cys Cys Thr Thr Ala Thr Cys Cys Ala Ala Cys Thr Gly 1940 1945 1950 Cys Ala Gly Cys Ala Thr Thr Gly Gly Gly Ala Ala Gly Ala Ala Ala 1955 1960 1965 Ala Gly Gly Cys Thr Ala Gly Ala Gly Ala Ala Gly Thr Cys Ala Cys 1970 1975 1980 Cys Cys Thr Cys Cys Thr Thr Cys Gly Cys Cys Thr Cys Gly Gly Ala 1985 1990 1995 2000 Gly Thr Gly Gly Gly Ala Thr Gly Ala Gly Ala Thr Thr Gly Ala Gly 2005 2010 2015 Ala Ala Ala Ala Thr Cys Ala Thr Gly Ala Gly Thr Thr Cys Thr Ala 2020 2025 2030 Thr Thr Gly Gly Ala Gly Ala Ala Gly Gly Gly Ala Thr Thr Gly Ala 2035 2040 2045 Cys Thr Thr Thr Thr Cys Thr Cys Ala Gly Gly Ala Ala Cys Gly Gly 2050 2055 2060 Cys Ala Gly Ala Ala Gly Ala Thr Cys Thr Cys Ala Gly Gly Thr Thr 2065 2070 2075 2080 Thr Ala Cys Gly Gly Ala Cys Gly Cys Thr Gly Gly Ala Gly Cys Ala 2085 2090 2095 Gly Ala Gly Thr Gly Thr Cys Gly Gly Gly Gly Ala Gly Thr Gly Gly 2100 2105 2110 Cys Thr Gly Gly Ala Gly Thr Cys Gly Ala Thr Thr Gly Gly Gly Cys 2115 2120 2125 Thr Gly Cys Ala Gly Cys Ala Gly Thr Ala Thr Gly Ala Gly Ala Gly 2130 2135 2140 Cys Ala Ala Gly Thr Thr Gly Cys Thr Thr Cys Thr Gly Ala Ala Thr 2145 2150 2155 2160 Gly Gly Cys Thr Thr Thr Gly Ala Cys Gly Ala Thr Gly Thr Cys Cys 2165 2170 2175 Ala Cys Thr Thr Cys Cys Thr Gly Gly Gly Gly Thr Cys Thr Ala Ala 2180 2185 2190 Thr Gly Thr Gly Ala Thr Gly Gly Ala Ala Gly Ala Gly Cys Ala Gly 2195 2200 2205 Gly Ala Cys Cys Thr Gly Cys Gly Gly Gly Ala Cys Ala Thr Cys Gly 2210 2215 2220 Gly Cys Ala Thr Cys Ala Gly Cys Gly Ala Cys Cys Cys Ala Cys Ala 2225 2230 2235 2240 Gly Cys Ala Cys Cys Gly Gly Cys Gly Gly Ala Ala Gly Cys Thr Gly 2245 2250 2255 Cys Thr Cys Cys Ala Gly Gly Cys Gly Gly Cys Ala Cys Gly Cys Thr 2260 2265 2270 Cys Cys Cys Thr Ala Cys Cys Cys Ala Ala Gly Gly Thr Gly Ala Ala 2275 2280 2285 Gly Gly Cys Thr Cys Thr Gly Gly Gly Thr Thr Ala Thr Gly Ala Cys 2290 2295 2300 Gly Gly Gly Ala Ala Cys Ala Gly Cys Cys Cys Cys Cys Cys Thr Ala 2305 2310 2315 2320 Gly Cys Gly Thr Gly Cys Cys Cys Thr Cys Cys Thr Gly Gly Cys Thr 2325 2330 2335 Gly Gly Ala Cys Thr Cys Cys Cys Thr Gly Gly Gly Gly Cys Thr Gly 2340 2345 2350 Cys Ala Gly Gly Ala Cys Thr Ala Cys Gly Thr Cys Cys Ala Thr Thr 2355 2360 2365 Cys Cys Thr Thr Cys Thr Thr Gly Thr Cys Ala Ala Gly Thr Gly Gly 2370 2375 2380 Thr Thr Ala Cys Ala Gly Cys Thr Cys Cys Ala Thr Thr Gly Ala Cys 2385 2390 2395 2400 Ala Cys Cys Gly Thr Gly Ala Ala Gly Ala Ala Cys Cys Thr Cys Thr 2405 2410 2415 Gly Gly Gly Ala Gly Cys Thr Ala Gly Ala Gly Cys Thr Cys Gly Thr 2420 2425 2430 Cys Ala Ala Thr Gly Thr Cys Cys Thr Gly Ala Ala Gly Gly Thr Cys 2435 2440 2445 Cys Ala Gly Cys Thr Gly Cys Thr Cys Gly Gly Cys Cys Ala Thr Cys 2450 2455 2460 Gly Cys Ala Ala Gly Cys Gly Cys Ala Thr Cys Ala Thr Cys Gly Cys 2465 2470 2475 2480 Cys Thr Cys Cys Cys Thr Cys Gly Cys Ala Gly Ala Cys Ala Gly Ala 2485 2490 2495 Cys Cys Gly Thr Ala Cys Gly Ala Gly Gly Ala Gly Cys Cys Gly Cys 2500 2505 2510 Cys Cys Cys Ala Gly Ala Ala Gly Cys Cys Cys Cys Cys Cys Ala Gly 2515 2520 2525 Ala Thr Thr Cys Thr Cys Cys Cys Ala Gly Cys Thr Gly Ala Gly Gly 2530 2535 2540 Thr Gly Cys Cys Ala Ala Gly Ala Thr Thr Thr Gly Cys Thr Cys Thr 2545 2550 2555 2560 Cys Cys Cys Ala Gly Ala Cys Gly Thr Cys Ala Thr Cys Cys Cys Cys 2565 2570 2575 Ala Cys Thr Gly Ala Gly Thr Cys Ala Gly Ala Ala Thr Gly Ala Thr 2580 2585 2590 Thr Cys Cys Thr Gly Cys Ala Cys Thr Gly Gly Gly Cys Gly Gly Thr 2595 2600 2605 Cys Gly Gly Cys Ala Gly Ala Thr Cys Thr Gly Cys Thr Gly Cys Thr 2610 2615 2620 Gly Cys Cys Thr Cys Cys Ala Gly Gly Gly Gly Ala Cys Ala Cys Ala 2625 2630 2635 2640 Gly Gly Cys Ala Gly Gly Ala Gly Gly Cys Gly Cys Cys Ala Thr Gly 2645 2650 2655 Ala Cys Ala Gly Thr Cys Thr Cys Cys Ala Thr Gly Ala Cys Cys Cys 2660 2665 2670 Thr Gly Cys Gly Gly Cys Ala Cys Cys Cys Thr Cys Cys Cys Gly Ala 2675 2680 2685 Gly Cys Gly Gly Ala Gly Cys Gly Cys Thr Thr Cys Ala Gly Gly Ala 2690 2695 2700 Thr Cys Cys Ala Gly Gly Ala Gly Gly Ala Gly Cys Ala Cys Cys Gly 2705 2710 2715 2720 Thr Gly Ala Gly Gly Cys Cys Ala Ala Gly Cys Thr Gly Ala Cys Cys 2725 2730 2735 Cys Thr Gly Cys Gly Gly Cys Cys Cys Cys Cys Gly Ala Gly Cys Cys 2740 2745 2750 Thr Gly Gly Cys Ala Gly Cys Cys Cys Cys Cys Thr Ala Cys Gly Cys 2755 2760 2765 Cys Cys Cys Ala Gly Thr Gly Cys Ala Gly Ala Gly Thr Thr Gly Gly 2770 2775 2780 Cys Ala Ala Cys Ala Cys Cys Ala Gly Cys Cys Ala Gly Ala Gly Ala 2785 2790 2795 2800 Ala Ala Cys Thr Cys Ala Thr Cys Thr Thr Cys Gly Ala Gly Thr Cys 2805 2810 2815 Cys Thr Gly Thr Gly Gly Thr Thr Ala Thr Gly Ala Ala Gly Cys Cys 2820 2825 2830 Ala Ala Thr Thr Ala Thr Cys Thr Gly Gly Gly Cys Thr Cys Cys Ala 2835 2840 2845 Thr Gly Cys Thr Gly Ala Thr Cys Ala Ala Ala Gly Ala Thr Cys Thr 2850 2855 2860 Gly Cys Gly Ala Gly Gly Gly Ala Cys Ala Gly Ala Ala Thr Cys Cys 2865 2870 2875 2880 Ala Cys Gly Cys Ala Ala Gly Ala Cys Gly Cys Cys Thr Gly Thr Gly 2885 2890 2895 Cys Cys Ala Ala Gly Ala Thr Gly Cys Gly Gly Ala Ala Ala Thr Cys 2900 2905 2910 Thr Ala Cys Gly Gly Ala Gly Cys Ala Cys Ala Thr Gly Ala Ala Gly 2915 2920 2925 Ala Ala Gly Ala Thr Cys Cys Cys Cys Ala Cys Cys Ala Thr Cys Ala 2930 2935 2940 Thr Cys Cys Thr Gly Thr Cys Cys Ala Thr Cys Ala Cys Ala Thr Ala 2945 2950 2955 2960 Cys Ala Ala Ala Gly Gly Thr Gly Thr Cys Ala Ala Gly Thr Thr Cys 2965 2970 2975 Ala Thr Cys Gly Ala Thr Gly Cys Cys Thr Cys Cys Ala Ala Cys Ala 2980 2985 2990 Ala Gly Ala Ala Cys Gly Thr Cys Ala Thr Thr Gly Cys Ala Gly Ala 2995 3000 3005 Gly Cys Ala Cys Gly Ala Gly Ala Thr Cys Cys Gly Gly Ala Ala Cys 3010 3015 3020 Ala Thr Thr Thr Cys Cys Thr Gly Thr Gly Cys Gly Gly Cys Cys Cys 3025 3030 3035 3040 Ala Gly Gly Ala Cys Cys Cys Gly Gly Ala Gly Gly Ala Cys Cys Thr 3045 3050 3055 Cys Thr Gly Thr Ala Cys Cys Thr Thr Thr Gly Cys Cys Thr Ala Cys 3060 3065 3070 Ala Thr Cys Ala Cys Cys Ala Ala Gly Gly Ala Cys Cys Thr Gly Cys 3075 3080 3085 Ala Gly Ala Cys Cys Ala Gly Cys Cys Ala Cys Cys Ala Cys Thr Ala 3090 3095 3100 Thr Thr Gly Cys Cys Ala Thr Gly Thr Gly Thr Thr Cys Ala Gly Cys 3105 3110 3115 3120 Ala Cys Cys Gly Thr Gly Gly Ala Thr Gly Thr Gly Ala Ala Cys Cys 3125 3130 3135 Thr Gly Ala Cys Cys Thr Ala Cys Gly Ala Gly Ala Thr Cys Ala Thr 3140 3145 3150 Cys Cys Thr Gly Ala Cys Gly Cys Thr Gly Gly Gly Gly Cys Ala Gly 3155 3160 3165 Gly Cys Cys Thr Thr Cys Gly Ala Ala Gly Thr Gly Gly Cys Cys Thr 3170 3175 3180 Ala Thr Cys Ala Gly Thr Thr Gly Gly Cys Cys Cys Thr Gly Cys Ala 3185 3190 3195 3200 Gly Gly Cys Cys Cys Ala Gly Ala Ala Gly Thr Cys Cys Ala Gly Gly 3205 3210 3215 Gly Cys Gly Ala Cys Gly Gly Gly Cys Gly Cys Cys Thr Cys Thr Gly 3220 3225 3230 Cys Ala Gly Cys Thr Gly Ala Gly Ala Thr Gly Ala Thr Thr Gly Ala 3235 3240 3245 Ala Ala Cys Ala Ala Ala Ala Thr Cys Thr Thr Cys Cys Ala Ala Ala 3250 3255 3260 Cys Cys Gly Gly Thr Gly Cys Cys Thr Ala Ala Gly Cys Cys Thr Cys 3265 3270 3275 3280 Gly Gly Gly Thr Cys Gly Gly Cys Gly Thr Gly Ala Gly Gly Ala Ala 3285 3290 3295 Ala Thr Cys Cys Gly Cys Ala Cys Thr Gly Gly Ala Ala Cys Cys Ala 3300 3305 3310 Cys Cys Thr Gly Ala Thr Ala Thr Gly Gly Ala Cys Cys Ala Ala Gly 3315 3320 3325 Ala Thr Gly Cys Cys Cys Ala Ala Thr Cys Cys Cys Ala Thr Gly Cys 3330 3335 3340 Cys Ala Gly Thr Gly Thr Cys Thr Cys Cys Thr Gly Gly Gly Thr Thr 3345 3350 3355 3360 Gly Thr Gly Gly Ala Cys Cys Cys Cys Ala Ala Ala Cys Cys Ala Gly 3365 3370 3375 Ala Cys Thr Cys Thr Ala Ala Gly Cys Gly Gly Ala Gly Cys Cys Thr 3380 3385 3390 Cys Ala Gly Cys Ala Cys Cys Ala Ala Cys Thr Gly Ala 3395 3400 3405 <210> 4 <211> 1134 <212> PRT <213> Artificial Sequence <220> <223> ANKs1a animoacid seq <400> 4 Met Gly Lys Glu Gln Glu Leu Leu Glu Ala Ala Arg Thr Gly His Leu 1 5 10 15 Pro Ala Val Glu Lys Leu Leu Ser Gly Lys Arg Leu Ser Ser Gly Phe 20 25 30 Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Ser Gly 35 40 45 Gly Gly Gly Gly Gly Leu Gly Ser Ser Ser His Pro Leu Ser Ser Leu 50 55 60 Leu Ser Met Trp Arg Gly Pro Asn Val Asn Cys Val Asp Ser Thr Gly 65 70 75 80 Tyr Thr Pro Leu His His Ala Ala Leu Asn Gly His Lys Asp Val Val 85 90 95 Glu Val Leu Leu Arg Asn Asp Ala Leu Thr Asn Val Ala Asp Ser Lys 100 105 110 Gly Cys Tyr Pro Leu His Leu Ala Ala Trp Lys Gly Asp Ala Gln Ile 115 120 125 Val Arg Leu Leu Ile His Gln Gly Pro Ser His Thr Arg Val Asn Glu 130 135 140 Gln Asn Asn Asp Asn Glu Thr Ala Leu His Cys Ala Ala Gln Tyr Gly 145 150 155 160 His Thr Glu Val Val Lys Val Leu Leu Glu Glu Leu Thr Asp Pro Thr 165 170 175 Met Arg Asn Asn Lys Phe Glu Thr Pro Leu Asp Leu Ala Ala Leu Tyr 180 185 190 Gly Arg Leu Glu Val Val Lys Met Leu Leu Asn Ala His Pro Asn Leu 195 200 205 Leu Ser Cys Asn Thr Lys Lys His Thr Pro Leu His Leu Ala Ala Arg 210 215 220 Asn Gly His Lys Ala Val Val Gln Val Leu Leu Asp Ala Gly Met Asp 225 230 235 240 Ser Asn Tyr Gln Thr Glu Met Gly Ser Ala Leu His Glu Ala Ala Leu 245 250 255 Phe Gly Lys Thr Asp Val Val Gln Ile Leu Leu Ala Ala Gly Thr Asp 260 265 270 Val Asn Ile Lys Asp Asn His Gly Leu Thr Ala Leu Asp Thr Val Arg 275 280 285 Glu Leu Pro Ser Gln Lys Ser Gln Gln Ile Ala Ala Leu Ile Glu Asp 290 295 300 His Met Thr Gly Lys Arg Ser Thr Lys Glu Val Asp Lys Thr Pro Pro 305 310 315 320 Pro Gln Pro Pro Leu Ile Ser Ser Met Asp Ser Ile Ser Gln Lys Ser 325 330 335 Gln Gly Asp Val Glu Lys Ala Val Thr Glu Leu Ile Ile Asp Phe Asp 340 345 350 Ala Asn Ala Glu Glu Glu Gly Pro Tyr Glu Ala Leu Tyr Asn Ala Ile 355 360 365 Ser Cys His Ser Leu Asp Ser Met Ala Ser Gly Arg Ser Ser Asp Gln 370 375 380 Asp Ser Thr Asn Lys Glu Ala Glu Ala Ala Gly Val Lys Pro Ala Gly 385 390 395 400 Val Arg Pro Arg Glu Arg Pro Pro Pro Pro Ala Lys Pro Pro Pro Asp 405 410 415 Glu Glu Glu Glu Asp His Ile Asp Lys Lys Tyr Phe Pro Leu Thr Ala 420 425 430 Ser Glu Val Leu Ser Met Arg Pro Arg Ile His Gly Ser Ala Ala Arg 435 440 445 Glu Glu Asp Glu His Pro Tyr Glu Leu Leu Leu Thr Ala Glu Thr Lys 450 455 460 Lys Val Val Leu Val Asp Gly Lys Thr Lys Asp His Arg Arg Ser Ser 465 470 475 480 Ser Ser Arg Ser Gln Asp Ser Ala Glu Gly Gln Asp Gly Gln Val Pro 485 490 495 Glu Gln Phe Ser Gly Leu Leu His Gly Ser Ser Pro Val Cys Glu Val 500 505 510 Gly Gln Asp Pro Phe Gln Leu Leu Cys Thr Ala Gly Gln Ser His Pro 515 520 525 Asp Gly Ser Pro Gln Gln Gly Ala Cys His Lys Ala Ser Met Gln Leu 530 535 540 Glu Glu Thr Gly Val His Ala Pro Gly Ala Ser Gln Pro Ser Ala Leu 545 550 555 560 Asp Gln Ser Lys Arg Val Gly Tyr Leu Thr Gly Leu Pro Thr Thr Asn 565 570 575 Ser Arg Ser His Pro Glu Thr Leu Thr His Thr Ala Ser Pro His Pro 580 585 590 Gly Gly Ala Glu Glu Gly Asp Arg Ser Gly Ala Arg Ser Arg Ala Pro 595 600 605 Pro Thr Ser Lys Pro Lys Ala Glu Leu Lys Leu Ser Arg Ser Leu Ser 610 615 620 Lys Ser Asp Ser Asp Leu Leu Thr Cys Ser Pro Thr Glu Asp Ala Thr 625 630 635 640 Met Gly Ser Arg Ser Glu Ser Leu Ser Asn Cys Ser Ile Gly Lys Lys 645 650 655 Arg Leu Glu Lys Ser Pro Ser Phe Ala Ser Glu Trp Asp Glu Ile Glu 660 665 670 Lys Ile Met Ser Ser Ile Gly Glu Gly Ile Asp Phe Ser Gln Glu Arg 675 680 685 Gln Lys Ile Ser Gly Leu Arg Thr Leu Glu Gln Ser Val Gly Glu Trp 690 695 700 Leu Glu Ser Ile Gly Leu Gln Gln Tyr Glu Ser Lys Leu Leu Leu Asn 705 710 715 720 Gly Phe Asp Asp Val His Phe Leu Gly Ser Asn Val Met Glu Glu Gln 725 730 735 Asp Leu Arg Asp Ile Gly Ile Ser Asp Pro Gln His Arg Arg Lys Leu 740 745 750 Leu Gln Ala Ala Arg Ser Leu Pro Lys Val Lys Ala Leu Gly Tyr Asp 755 760 765 Gly Asn Ser Pro Pro Ser Val Pro Ser Trp Leu Asp Ser Leu Gly Leu 770 775 780 Gln Asp Tyr Val His Ser Phe Leu Ser Ser Gly Tyr Ser Ser Ile Asp 785 790 795 800 Thr Val Lys Asn Leu Trp Glu Leu Glu Leu Val Asn Val Leu Lys Val 805 810 815 Gln Leu Leu Gly His Arg Lys Arg Ile Ile Ala Ser Leu Ala Asp Arg 820 825 830 Pro Tyr Glu Glu Pro Pro Gln Lys Pro Pro Arg Phe Ser Gln Leu Arg 835 840 845 Cys Gln Asp Leu Leu Ser Gln Thr Ser Ser Pro Leu Ser Gln Asn Asp 850 855 860 Ser Cys Thr Gly Arg Ser Ala Asp Leu Leu Leu Pro Pro Gly Asp Thr 865 870 875 880 Gly Arg Arg Arg His Asp Ser Leu His Asp Pro Ala Ala Pro Ser Arg 885 890 895 Ala Glu Arg Phe Arg Ile Gln Glu Glu His Arg Glu Ala Lys Leu Thr 900 905 910 Leu Arg Pro Pro Ser Leu Ala Ala Pro Tyr Ala Pro Val Gln Ser Trp 915 920 925 Gln His Gln Pro Glu Lys Leu Ile Phe Glu Ser Cys Gly Tyr Glu Ala 930 935 940 Asn Tyr Leu Gly Ser Met Leu Ile Lys Asp Leu Arg Gly Thr Glu Ser 945 950 955 960 Thr Gln Asp Ala Cys Ala Lys Met Arg Lys Ser Thr Glu His Met Lys 965 970 975 Lys Ile Pro Thr Ile Ile Leu Ser Ile Thr Tyr Lys Gly Val Lys Phe 980 985 990 Ile Asp Ala Ser Asn Lys Asn Val Ile Ala Glu His Glu Ile Arg Asn 995 1000 1005 Ile Ser Cys Ala Ala Gln Asp Pro Glu Asp Leu Cys Thr Phe Ala Tyr 1010 1015 1020 Ile Thr Lys Asp Leu Gln Thr Ser His His Tyr Cys His Val Phe Ser 1025 1030 1035 1040 Thr Val Asp Val Asn Leu Thr Tyr Glu Ile Ile Leu Thr Leu Gly Gln 1045 1050 1055 Ala Phe Glu Val Ala Tyr Gln Leu Ala Leu Gln Ala Gln Lys Ser Arg 1060 1065 1070 Ala Thr Gly Ala Ser Ala Ala Glu Met Ile Glu Thr Lys Ser Ser Lys 1075 1080 1085 Pro Val Pro Lys Pro Arg Val Gly Val Arg Lys Ser Ala Leu Glu Pro 1090 1095 1100 Pro Asp Met Asp Gln Asp Ala Gln Ser His Ala Ser Val Ser Trp Val 1105 1110 1115 1120 Val Asp Pro Lys Pro Asp Ser Lys Arg Ser Leu Ser Thr Asn 1125 1130

Claims (2)

A short hairpin RNA (shRNA) represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and complementarily binding to the mRNA of ANKs1a gene as an active ingredient and reducing the amount of ErbB2 / EphA2 on the cell surface A pharmaceutical composition for preventing or treating colorectal cancer or breast cancer. Comprising the step of treating a cell with a short hairpin RNA (shRNA) represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and complementarily binding to the mRNA of the ANKs1a gene in vitro A method for inhibiting ErbB2 and EphA2 expression on a cell surface.

Images