WO2011115271A1 - Tumor angiogenesis inhibitor - Google Patents

Abstract

Provided is an antitumor agent, or more specifically, an angiogenesis inhibitor, that contains as an active ingredient a substance which suppresses the expression or function of ENAH. Specifically, the angiogenesis inhibitor contains: an antisense nucleic acid, a ribozyme, or a nucleic acid having RNAi activity for the transcription product of the gene that encodes ENAH; or an antibody, or the like, that binds to ENAH. Also provided is a method for screening angiogenesis inhibitors, characterized in that the genes that encode ENAH, or compounds that reduce the level of expression of ENAH or the function of ENAH, are selected.

Description

Tumor angiogenesis inhibitor

The present invention relates to an angiogenesis inhibitor, and more particularly, to a substance useful as a pharmaceutical agent such as a cancer therapeutic agent / prophylactic agent, etc., which has an activity of suppressing proliferation and / or migration of tumor vascular endothelial cells, and a screening method thereof.

Many of the currently widely used methods for treating tumors, whether chemotherapy or radiation therapy, suppress tumor cell growth. Therefore, it is very important to selectively suppress the growth of tumor cells without affecting normal cells, but even with drugs that act selectively on tumor cells, the tumor cells are compared to other normal cells. It largely depends on the nature of repeating division and proliferation much more actively.
On the other hand, angiogenesis is indispensable for cell growth, and when malignant tumors grow, tumor cells themselves produce angiogenesis-promoting substances and induce angiogenesis in order to obtain nutrients and oxygen necessary for growth. . Also, when a malignant tumor metastasizes to another organ or site, tumor angiogenesis is induced, and the tumor cells move along the bloodstream. Therefore, in order to suppress the growth of solid tumors, therapeutic strategies have been proposed to cut off angiogenesis, which is a source of nutrients and oxygen. That is, instead of attacking the tumor cell itself, the tumor cell is put into a nutrient or oxygen-depleted state, and as a result, the therapeutic effect of suppressing the growth of the tumor cell and regression is achieved.
As a specific target of this technique, tumor blood vessels reaching the tumor are mentioned. Tumors containing cancer cells produce angiogenesis-promoting substances when they are about 1 to 2 mm ³ in size, ingesting nutrients and oxygen necessary for the growth of the cells themselves, and building a system to carry away metabolic waste products Will come to do. This system promotes the initial growth of the cells. Therefore, suppression of tumor cell proliferation / metastasis by suppressing angiogenesis is considered to be effective for cancer treatment, and research has been conducted on substances having angiogenesis inhibitory activity.
So far, angiogenesis inhibitors have been studied using vascular endothelial cell lines and normal vascular endothelial cells, but recently, it has become clear that the properties of tumor blood vessels and normal blood vessels are very different (non- (See Patent Document 1). For example, normal blood vessels have an ordered hierarchy of arteries, veins, and capillaries, while tumor blood vessels run disorderly. Also, the relationship between tumor vascular endothelial cells (adhesion, etc.) is sparse compared to normal vascular endothelial cells, and there are fewer pericytes, which enhances blood vessel permeability. Thus, it can be said that tumor blood vessels are immature blood vessels compared with normal blood vessels. In other words, it must be said that the conventional method using normal vascular endothelial cells is insufficient to find an ideal target for angiogenesis inhibitor as a cancer therapeutic agent. Accordingly, the present inventors have established a technique for separating and culturing tumor vascular endothelial cells in order to search for a target factor of an ideal angiogenesis inhibitor.
On the other hand, enabled homolog (ENAH) is one of the Ena / VASP family proteins and is known to be involved in the regulation of cell movement through the control of the actin cytoskeleton (see Non-Patent Document 2). . In addition, the expression of a specific splice variant of ENAH is increased in metastatic cancer cells, and it is reported that it may be involved in cancer cell migration (Patent Document 1, Non-Patent Document 3, and Non-Patent Document). 4).
However, it has not been known that ENAH is highly expressed in tumor vascular endothelial cells or that the growth or migration of tumor vascular endothelial cells is suppressed by suppressing the expression or function of ENAH.

WO2008 / 097466

The problem to be solved by the present invention is an angiogenesis inhibitor, more specifically, a substance having an activity of suppressing the proliferation and / or migration of tumor vascular endothelial cells, and useful as a pharmaceutical agent such as a cancer therapeutic agent / prophylactic agent, and the like It is in providing the screening method.

In order to search for substances having tumor angiogenesis inhibitory activity, the inventors of the present application conducted isolation and culture of tumor vascular endothelial cells, and as a result of intensive studies, they were involved in proliferation and / or migration of tumor vascular endothelial cells. We have succeeded in isolating a factor and isolating a substance that suppresses the expression or function of the factor.
That is, the present inventors have found ENAH as a factor that is highly expressed in tumor vascular endothelial cells compared to normal vascular endothelial cells, and further, siRNA that inhibits the expression of ENAH proliferates against tumor vascular endothelial cells. It was found to show inhibitory activity and migration inhibitory activity. The present invention has been completed based on the above findings.
That is, the present invention
[1] An antitumor agent comprising as an active ingredient a substance that suppresses the expression or function of ENAH;
[2] The agent according to [1], wherein the substance is a substance selected from the group consisting of the following (1) to (3), which suppresses the expression of ENAH:
(1) an antisense nucleic acid against a transcription product of a gene encoding ENAH,
(2) a ribozyme nucleic acid for a transcription product of a gene encoding ENAH, and (3) a nucleic acid having RNAi activity for a transcription product of a gene encoding ENAH or a precursor thereof;
[3] The agent according to [1], wherein the substance is an antibody that binds to ENAH;
[4] The agent according to any one of [1] to [3], wherein ENAH is a protein comprising an amino acid sequence selected from the following (a) to (e):
(A) the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53,
(B) in the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, one or more amino acids are deleted, added, inserted or substituted; The following properties (1) to (3):
(1) can bind to actin competitively with the anti-twist end cap protein;
(2) F-actin and G-actin binding motifs are conserved; and (3) the amino acid represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 Can be recognized by an antibody that specifically recognizes a protein consisting of a sequence;
An amino acid sequence having at least one of
(C) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 or more than 80% homology with the amino acid sequence represented by SEQ ID NO: 53 and (1) to ( An amino acid sequence having at least one of the properties of 3),
(D) an amino acid sequence encoded by DNA having the base sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, and (e) SEQ ID NO: 1. , SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52 encoded by DNA that hybridizes under stringent conditions with DNA having complementarity to the DNA having the base sequence shown in SEQ ID NO: 52 And an amino acid sequence having at least one of the above properties (1) to (3);
[5] The agent according to any one of [1] to [4], which is an angiogenesis inhibitor;
[6] The agent according to [5], which is a tumor angiogenesis inhibitor;
[7] The agent according to any one of [1] to [6], which is a tumor vascular endothelial cell proliferation and / or migration inhibitor;
[8] A method for screening an angiogenesis inhibitor, which comprises selecting a compound that reduces the expression level of ENAH;
[9] The screening method according to [8], comprising the following steps (1) to (3):
(1) contacting a test substance with a cell containing a nucleic acid encoding a gene encoding ENAH or a reporter protein under the control of a transcriptional regulatory region of the gene;
(2) a step of measuring the expression level of ENAH or a reporter protein in the cell; and (3) an angiogenesis inhibitor that reduces the expression level as compared with the case where measurement is performed in the absence of a test substance. Selecting as a candidate for;
[10] A method for screening an angiogenesis inhibitor, which comprises selecting a compound that reduces the expression level of a gene encoding ENAH;
[11] A method for screening an angiogenesis inhibitor, which comprises selecting a compound that decreases the function of ENAH;
[12] A method for determining whether or not there is a risk of developing cancer, or whether or not the patient is suffering from cancer, the method comprising the following steps (1) and (2):
(1) a step of measuring the expression level of ENAH-encoding gene or ENAH or ENAH function in a sample collected from a test animal, and (2) in comparison with the case of measuring in a sample derived from a normal animal, Determining the subject animal whose expression level or function is elevated to be at risk of developing cancer or suffering from cancer;
[13] The following groups:
(1) a base sequence represented by SEQ ID NO: 25 to 47, and (2) a base sequence having 2 to 4 bases added to the 3 ′ end of the base sequence represented by SEQ ID NO: 25 to 47,
An oligonucleotide consisting of any nucleotide sequence selected from:
[14] siRNA, wherein the double-stranded RNA portion consists of a base sequence represented by any one of SEQ ID NOs: 25 to 47;
[15] The siRNA according to [14], wherein an overhang of 2 to 4 bases is added to the 3 ′ end;
[16] The siRNA according to [14] or [15], wherein at least one base is chemically modified;
[17] The siRNA according to any one of [14] to [16], wherein at least one phosphodiester bond is chemically modified;
[18] An antitumor agent comprising the siRNA according to any one of [14] to [17] as an active ingredient;
About.

INDUSTRIAL APPLICABILITY According to the present invention, an angiogenesis inhibitor, more specifically, a substance having an activity of suppressing the proliferation and / or migration of tumor vascular endothelial cells and useful as a pharmaceutical agent for cancer treatment / prevention, and a screening method thereof are provided. It became possible to do.

It is a figure which shows the result of having compared the expression level of mouse | mouth ENAH in a mouse | mouth primary tumor vascular endothelial cell and a mouse | mouth primary normal vascular endothelial cell. The vertical axis shows ENAH mRNA expression level (Quantity value). As normal vascular endothelial cells, vascular endothelial cells collected from the skin tissue of normal mice were used. Tumor vascular endothelial cells include vascular endothelial cells collected from tumor tissues of mice transplanted with HSC3 (human tongue cancer cells), OSRC2 (human kidney cancer cells), and A375SM (human highly metastatic melanoma cells). Using. Mouse ENAH expression was shown to be significantly higher in mouse primary tumor vascular endothelial cells compared to mouse primary normal vascular endothelial cells.

The present invention provides an angiogenesis inhibitor, specifically a tumor vascular endothelial cell proliferation and / or migration inhibitor, comprising a substance that suppresses the expression or function of ENAH.
I. ENAH or the ENAH gene encoding the same In this specification, ENAH is a known protein and is known as SEQ ID NO: 2 known as Genbank Accession No .: NP_001008493 or Genbank Accession No .: NP_060682 A protein comprising the amino acid sequence of human ENAH represented by SEQ ID NO: 4 or an amino acid sequence substantially identical thereto.
In the present specification, proteins and peptides are described with the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end according to the convention of peptide designation.
As used herein, ENAH is a cell of a human or other warm-blooded animal (eg, guinea pig, rat, mouse, chicken, rabbit, dog, pig, sheep, cow, monkey, etc.) [eg, MDAMB361, MCF7, SKBr3, SBT , MAS, T47D, BT474, Calu3, A427, SiHa, CaSKi, LS180, HT29, ADF, U251, U87MG, U373, T98G cells, etc.] or any tissue from which those cells are derived [eg breast, lung, brain, colon Etc.] or a tissue expressing the protein in vivo [for example, bladder, gallbladder prostate, heart, uterus, etc.] and the like may be isolated and purified by a known protein separation and purification technique.

Examples of the “amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 or substantially the same amino acid sequence thereof” include the following (a) to (e):
(A) the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53;
(B) in the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, one or more amino acids are deleted, added, inserted or substituted; And the following properties (1) to (3):
(1) can bind to actin competitively with the anti-twist end cap protein;
(2) F-actin and G-actin binding motifs are conserved; and (3) the amino acid represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 Can be recognized by an antibody that specifically recognizes a protein consisting of a sequence;
An amino acid sequence having at least one of:
(C) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 or more than 80% homology with the amino acid sequence represented by SEQ ID NO: 53, and (1) to ( An amino acid sequence having at least one of the properties of 3);
(D) an amino acid sequence encoded by DNA having the base sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52; or (e) SEQ ID NO: 1 Encoded by DNA that hybridizes under stringent conditions with DNA having complementarity to the DNA having the base sequence represented by SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52; And an amino acid sequence having at least one of the above properties (1) to (3).

Specifically, the amino acid sequence of an ortholog in another mammal of the human protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4, or the amino acid represented by SEQ ID NO: 2 or SEQ ID NO: 4 Examples include amino acid sequences of splice variants, allelic variants, or polymorphic variants of human proteins or orthologs thereof. Specific examples of the splicing variants include human proteins having the amino acid sequence represented by SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53 (Biochimica et Biophysica Acta 1759 (2006) p99-107). reference).
As used herein, “homology” refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably the algorithm uses a sequence of sequences for optimal alignment). The percentage of the same amino acid residue and similar amino acid residues to all overlapping amino acid residues in (one or both of which can be considered introduction of a gap). "Similar amino acids" means amino acids that are similar in physicochemical properties, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn) ), Basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids with hydroxyl groups (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met), etc. Examples include amino acids classified into groups. It is expected that substitution with such similar amino acids will not change the phenotype of the protein (ie, is a conservative amino acid substitution). Specific examples of conservative amino acid substitutions are well known in the art and are described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).

The homology of the amino acid sequences in this specification is determined using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) and the following conditions (expected value = 10; allow gap; matrix = BLOSUM62; filtering) = OFF). Other algorithms for determining amino acid sequence homology include, for example, the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90: 5873-5877 (1993) [the algorithms are NBLAST and XBLAST] Embedded in the program (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 1997 (1997))], Needleman et al., J. Mol. Biol., 48: 444-453 (1970) [The algorithm is incorporated in the GAP program in the GCG software package], Myers and Miller, CABIOS, 4: 11-17 (1988) [The algorithm is part of the CGC sequence alignment software package. Embedded in the ALIGN program (version 2.0)], Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-2448 1988 (1988) [the algorithm is a GCG software package Are incorporated in the FASTA program in the system], and the like can be preferably used as well.

The stringent conditions in the above (e) are, for example, the conditions described in Current Protocols, in Molecular, Biology, John, Wiley, & Sons, 6.3.1-6.3.6, 1999, for example, 6 × SSC (sodium chloride / sodium citrate) / 45 ° C., followed by one or more washes at 0.2 × SSC / 0.1% SDS / 50-65 ° C., but those skilled in the art will give equivalent stringency. Hybridization conditions can be appropriately selected.

More preferably, as the “amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4,” SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 Or about 80% or more, preferably about 90% or more, more preferably about 95% or more, more preferably about 97% or more, particularly preferably about 98% or more, and most preferably the amino acid sequence represented by SEQ ID NO: 53 An amino acid sequence having about 99% or more identity is preferable.

“A protein comprising an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4” is substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4. And a protein having substantially the same function as the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4.
As used herein, “substantially the same function” means that the properties are qualitatively the same, for example, physiologically or pharmacologically, and the degree of function (eg, about 0.1 to about 10 Times, preferably 0.5 to 2 times) and quantitative factors such as the molecular weight of the protein may be different. Also,
(1) Can bind to actin competitively with anti-tapping end cap protein (CP), that is, interact with profilin and G-actin to suppress actin's anti-tapping end capping, or (2) sequence A protein that can be recognized by an antibody that specifically recognizes a protein consisting of the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53 is “substantially identical. Can be regarded as a protein having the function of
Here, the actin polymerization-promoting activity of ENAH and the interaction with profilin are described in, for example, Non-Patent Document 2 (Barzik M et al., J Biol Chem., 280, No. 31, pp. 28653-28662 ( 2005))).

As the protein: ENAH in the present invention, for example, (i) 1 to 50 in the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, Preferably, 1 to 30, more preferably 1 to 10, more preferably 1 to several (5, 4, 3 or 2) amino acid sequences deleted, (ii) SEQ ID NO: 2, SEQ ID NO : 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, the amino acid sequence represented by 1 to 50, preferably 1 to 30, more preferably 1 to 10, more preferably 1 to number An amino acid sequence to which (5, 4, 3 or 2) amino acids are added, (iii) an amino acid represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 1-50, preferably 1-30, more preferably 1-10, even more preferred in the sequence Or an amino acid sequence in which 1 to several (5, 4, 3 or 2) amino acids are inserted, (iv) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 1 to 50, preferably 1 to 30, more preferably 1 to 10, even more preferably 1 to several (5, 4, 3 or 2) amino acids in the amino acid sequence represented by 53 Also included are so-called muteins such as proteins containing amino acid sequences substituted with amino acids, or (v) amino acid sequences combining them.
When the amino acid sequence is inserted, deleted, added or substituted as described above, the position of the insertion, deletion, addition or substitution indicates the ability of the protein to bind to actin competitively with the anti-end cap protein. Retained, preserved F-actin and G-actin binding motifs, retained the ability to interact with profilin, or SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: : 51 or SEQ ID NO: 53, as long as it can be recognized by an antibody that specifically recognizes a protein consisting of the amino acid sequence represented by SEQ ID NO: 53.
Here, as a technique for artificially performing amino acid deletion, addition, insertion or substitution, for example, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 Examples include a method in which conventional site-directed mutagenesis is performed on DNA encoding the amino acid sequence shown, and then this DNA is expressed by a conventional method. Here, as a site-specific mutagenesis method, for example, a method using amber mutation (gapped duplex method, Nucleic Acids Res., 12,9441-9456 (1984)), a PCR method using a mutagenesis primer Etc.

Preferred examples of ENAH include, for example, a human protein (Genbank Accession No .: NP_001008493 or NP_060682) consisting of the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4, or their orthologs in other mammals (for example, , Mouse ENAH protein (SEQ ID NO: 6, 8, 10, or 12; Genbank Accession No. NP_034265, NP_032706, NP_001076589, or NP_001076590), rat ENAH protein (Genbank Accession No. NP_001012150), etc., allelic variant, polymorphism Variants etc. are raised.

The “gene encoding ENAH” is a base encoding the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 shown in the above (a) to (e) or an amino acid sequence substantially identical thereto. Represents a gene having a sequence. Specifically, the following (f) to (j):
(F) a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53,
(G) In the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, one or more amino acids are deleted, added, inserted or substituted, And the following properties (1) to (3):
(1) can bind to actin competitively with the anti-twist end cap protein;
(2) F-actin and G-actin binding motifs are conserved; and (3) the amino acid represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 Can be recognized by an antibody that specifically recognizes a protein consisting of a sequence;
A base sequence encoding an amino acid sequence having at least one of
(H) having 80% or more homology with the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, and the above (1) to ( A base sequence encoding an amino acid sequence having at least one of the properties of 3),
(I) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50, or SEQ ID NO: 52, or (j) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, a base sequence of DNA that hybridizes under stringent conditions with DNA having complementarity to the DNA having the base sequence represented by SEQ ID NO: 50 or SEQ ID NO: 52, and (1) to A base sequence encoding an amino acid sequence having at least one of the properties of (3),
The gene which has is mentioned.
Here, the gene may be any of DNA such as cDNA or genomic DNA, or RNA such as mRNA, and is a concept including both a single-stranded nucleic acid sequence and a double-stranded nucleic acid sequence. Further, in the present specification, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: The nucleic acid sequence shown in 52 etc. is a DNA sequence for convenience, but when an RNA sequence such as mRNA is shown, thymine (T) is interpreted as uracil (U).

II. Substance that suppresses expression of ENAH In the present invention, "substance that suppresses expression of ENAH" refers to the transcription level of the gene encoding ENAH (ENAH gene), the level of post-transcriptional regulation, the translation level to ENAH, and post-translational modification It may act at any stage, such as the level of. Therefore, substances that suppress ENAH expression include, for example, substances that inhibit the transcription of the ENAH gene (eg, antigene), substances that inhibit the processing of early transcripts into mRNA, and those that inhibit mRNA transport to the cytoplasm. Substances that inhibit the translation of ENAH from mRNA (eg, antisense nucleic acid, miRNA) or those that degrade mRNA (eg, siRNA, ribozyme), substances that inhibit post-translational modification of the initial translation product, etc. . Any substance that acts at any stage can be preferably used, but more preferably, a substance selected from the group consisting of the following (1) to (3) is exemplified.
(1) an antisense nucleic acid against a transcription product of a gene encoding ENAH,
(2) a ribozyme nucleic acid for the transcription product of the gene encoding ENAH,
(3) A nucleic acid having RNAi activity for a transcription product of a gene encoding ENAH or a precursor thereof.
A preferable example of the transcript is mRNA.

As a substance that specifically inhibits the translation of ENAH gene from mRNA to ENAH (or degrades mRNA), preferably a base sequence complementary to or substantially complementary to the base sequence of these mRNAs or a part thereof The nucleic acid containing is mentioned.
The base sequence substantially complementary to the base sequence of the mRNA of the ENAH gene can bind to the target sequence of the mRNA and inhibit its translation under physiological conditions of the tumor blood vessel that is the target tissue of a mammal. It means a base sequence having a degree of complementarity (or that cleaves the target sequence). Specifically, for example, a base sequence that is completely complementary to the base sequence of the mRNA (that is, a base sequence of a complementary strand of the mRNA) ) And about 80% or more, preferably about 90% or more, more preferably about 95% or more, and particularly preferably about 97% or more of the base sequence.
The “base sequence homology” in the present invention uses the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) and the following conditions (expected value = 10; allow gaps; filtering = ON; It can be calculated by match score = 1; mismatch score = -3).

More specifically, the base sequence complementary or substantially complementary to the base sequence of the mRNA of the ENAH gene includes the following (k) or (l):
(k) a nucleotide sequence complementary or substantially complementary to the nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52;
(l) a nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, and SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51, or complementary to a sequence encoding a protein having substantially the same function as the protein consisting of the amino acid sequence represented by SEQ ID NO: 53 Or a substantially complementary nucleotide sequence;
Is mentioned. Here, “substantially the same function” has the same meaning as described above.
The stringent conditions are as described above.

As a preferred example of mRNA of ENAH gene, human ENAH mRNA containing the nucleotide sequence (Genbank Accession No. NM_001008493 or NM_018212) represented by SEQ ID NO: 1 or SEQ ID NO: 3, amino acid represented by SEQ ID NO: 49 A base sequence represented by SEQ ID NO: 48 encoding a protein comprising the sequence, a base sequence represented by SEQ ID NO: 50 encoding a protein comprising the amino acid sequence represented by SEQ ID NO: 51, or SEQ ID NO: 53 The human ENAH mRNA comprising the nucleotide sequence represented by SEQ ID NO: 52, which encodes the protein consisting of the amino acid sequence represented by (2), or an ortholog thereof in other mammals (for example, the mouse represented by SEQ ID NO: 5) ENAH (Genbank Accession No. NM_010135), SEQ ID NO: 7 mouse ENAH (Genbank Accession No. NM_008680), SEQ ID NO: 9 Mouse ENAH (Genbank AccessionNo. NM_001083120), mouse ENAH represented by SEQ ID NO: 11 (Genbank Accession No. NM_001083121) or rat ENAH (Genbank Accession No.150NM_001012150)), and their splice variants and allelic variants Body, polymorphic variant and the like.

The nucleotide sequence of the ENAH gene mRNA and the “part of the complementary or substantially complementary nucleotide sequence” are those that can specifically bind to the mRNA of the ENAH gene and translate the protein from the mRNA. The length and the position are not particularly limited as long as they can inhibit (or degrade the mRNA), but at least 10 bases that are complementary or substantially complementary to the target sequence from the viewpoint of sequence specificity. As mentioned above, it preferably contains about 15 bases or more.

Specifically, a nucleic acid that includes a base sequence complementary to or substantially complementary to the base sequence of mRNA of the ENAH gene or a part thereof is preferably exemplified by any of the following (1) to (3) Is:
(1) antisense nucleic acid against mRNA of ENAH gene,
(2) Ribozyme nucleic acid against mRNA of ENAH gene, or
(3) A nucleic acid having RNAi activity against mRNA of ENAH gene or a precursor thereof.

(1) Antisense nucleic acid against mRNA of ENAH gene “Antisense nucleic acid against mRNA of ENAH gene” in the present invention includes a base sequence complementary to or substantially complementary to the base sequence of the mRNA or a part thereof. It is a nucleic acid and has a function of suppressing protein synthesis by forming a specific and stable duplex with a target mRNA.
Antisense nucleic acids are polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, Other polymers with non-nucleotide backbones (eg, commercially available protein nucleic acids and synthetic sequence specific nucleic acid polymers) or other polymers containing special linkages, provided that the polymer is a base as found in DNA or RNA And a nucleotide having a configuration that allows attachment of a base). They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, unmodified polynucleotides (or unmodified oligonucleotides), known modifications Additions, such as those with labels known in the art, capped, methylated, one or more natural nucleotides replaced with analogs, intramolecular nucleotide modifications Such as those with uncharged bonds (eg methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds or sulfur-containing bonds (eg phosphorothioates, phosphorodithioates, etc.) Such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine etc. ), Sugars (eg, monosaccharides), etc., side chain groups, intercurrent compounds (eg, acridine, psoralen, etc.), chelate compounds (eg, metals, radioactive metals) , Boron, an oxidizing metal, etc.), an alkylating agent, and a modified bond (for example, α-anomeric nucleic acid). Here, “nucleoside”, “nucleotide” and “nucleic acid” may include not only purine and pyrimidine bases but also those having other heterocyclic bases modified. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and modified nucleotides may also be modified at the sugar moiety, eg, one or more hydroxyl groups are replaced by halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may be converted.

As described above, the antisense nucleic acid may be DNA or RNA, or may be a DNA / RNA chimera. When the antisense nucleic acid is DNA, the RNA: DNA hybrid formed by the target RNA and the antisense DNA can be recognized by endogenous RNase H and cause selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only the sequence in mRNA but also the sequence of the intron region in the initial translation product of the ENAH gene. The intron sequence can be determined by comparing the genomic sequence with the cDNA base sequence of the ENAH gene using a homology search program such as BLAST or FASTA.

The target region of the antisense nucleic acid of the present invention is not particularly limited as long as the antisense nucleic acid hybridizes, and as a result, the translation into protein: ENAH is inhibited. The entire sequence or partial sequence of mRNA may be a short sequence of about 10 bases, and a long sequence of mRNA or the initial transcript. In view of easiness of synthesis, antigenicity, intracellular migration, etc., an oligonucleotide consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases is preferred, but is not limited thereto. Specifically, 5 'end hairpin loop of ENAH gene, 5' end 6-base pair repeat, 5 'end untranslated region, translation start codon, protein coding region, ORF translation stop codon, 3' end untranslated region A 3′-end palindromic region or a 3′-end hairpin loop can be selected as a preferred target region of an antisense nucleic acid, but is not limited thereto.

Furthermore, the antisense nucleic acid of the present invention not only hybridizes with the mRNA of the ENAH gene and the initial transcription product to inhibit translation into a protein, but also binds to these genes that are double-stranded DNA to form a triplex ( A triplex) that can inhibit transcription to RNA (antigene).

The nucleotide molecule constituting the antisense nucleic acid may be natural DNA or RNA, but various chemicals may be used to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA). Modifications can be included. For example, in order to prevent degradation by a hydrolase such as nuclease, the phosphate residue (phosphate) of each nucleotide constituting the antisense nucleic acid is chemically modified, for example, phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be substituted with a phosphate residue. In addition, the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R═CH ₃ (2′-O-Me), CH ₂ CH ₂ OCH ₃ (2′-O-MOE), CH ₂ CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.) may be substituted. Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl. Is mentioned.

The conformation of the sugar part of RNA is dominated by C2'-endo (S type) and C3'-endo (N type). In single-stranded RNA, it exists as an equilibrium between the two, but double-stranded Is fixed to the N type. Therefore, in order to give strong binding ability to the target RNA, BNA (LNA) (Imanishi) is an RNA derivative in which the conformation of the sugar moiety is fixed to N-type by cross-linking 2 'oxygen and 4' carbon. , T. et al., Chem. Commun., 1653-9, 2002; Jepsen, JS et al., Oligonucleotides, 14, 130-46, 2004) and ENA (Morita, K. et al., Nucleosides Nucleotides Nucleicides Nucleicides Nucleicides , 22, 1619-21, 2003) can also be preferably used.

The antisense oligonucleotide of the present invention determines the target sequence of mRNA or initial transcript based on the cDNA sequence or genomic DNA sequence of the ENAH gene, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman) Etc.) can be prepared by synthesizing a complementary sequence thereto. In addition, any of the above-described antisense nucleic acids containing various modifications can be chemically synthesized by a method known per se.

(2) Ribozyme Nucleic Acid for ENAH Gene mRNA Another preferred example of a nucleic acid comprising a base sequence complementary to or substantially complementary to the base sequence of the ENAH gene mRNA or a part thereof is the mRNA of the coding region. Examples include ribozyme nucleic acids that can be cleaved specifically inside. “Ribozyme” refers to RNA having an enzyme activity that cleaves nucleic acids in a narrow sense, but in this specification, it is used as a concept including DNA as long as it has sequence-specific nucleic acid cleavage activity. The most versatile ribozyme nucleic acids include self-splicing RNAs found in infectious RNAs such as viroids and virusoids, and hammerhead and hairpin types are known. The hammerhead type exhibits enzyme activity at about 40 bases, and several bases at both ends (about 10 bases in total) adjacent to the part having the hammerhead structure are made complementary to the desired cleavage site of mRNA. By doing so, it is possible to specifically cleave only the target mRNA. This type of ribozyme nucleic acid has the additional advantage of not attacking genomic DNA because it uses only RNA as a substrate. If the mRNA of the ENAH gene has a double-stranded structure by itself, the target sequence is made single-stranded by using a hybrid ribozyme linked to an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase. [Proc. Natl. Acad. Sci. USA, 98 (10): 5572-5577 (2001)]. Furthermore, when ribozymes are used in the form of expression vectors containing the DNA that encodes them, they should be hybrid ribozymes in which tRNA-modified sequences are further linked in order to promote the transfer of transcripts to the cytoplasm. [Nucleic Acids Res., 29 (13): 2780-2788 (2001)].

(3) siRNA against ENAH gene mRNA
In the present specification, a double-stranded RNA consisting of an oligo RNA complementary to the mRNA of the ENAH gene and its complementary strand, so-called siRNA, is also complementary or substantially complementary to the base sequence of the mRNA of the ENAH gene. Defined as encompassed by nucleic acid containing base sequence or part thereof. When a short double-stranded RNA is introduced into a cell, the mRNA complementary to the RNA is degraded. So-called RNA interference (RNAi) has long been known in nematodes, insects, plants, etc. Since it has been confirmed that this phenomenon occurs widely in animal cells [Nature, 411 (6836): 494-498 (2001)], it has been widely used as an alternative technique to the above-mentioned antisense nucleic acids and ribozymes.

siRNA is based on cDNA sequence information of a target gene, for example, Elbashir et al. (Genes Dev., 15, 188-200 (2001)), Teramoto et al. (FEBS Lett. 579 (13): p2878-82 (2005)) Can be designed according to the rules proposed by As a target sequence of siRNA, in principle, it has a length of 15 to 50 bases, preferably 19 to 49 bases, more preferably 19 to 27 bases. For example, AA + (N) 19 (following AA, 19 base sequence), AA + (N) 21 (21 base sequence following AA) or A + (N) 21 (21 base sequence following A).
The nucleic acid of the present invention may have an additional base at the 5 ′ or 3 ′ end. The length of the additional base is usually about 2 to 4 bases, and the total length of siRNA is 19 bases or more. The additional base may be DNA or RNA, but use of DNA may improve the stability of the nucleic acid. Examples of such an additional base sequence include ug-3 ′, uu-3 ′, tg-3 ′, tt-3 ′, ggg-3 ′, guuu-3 ′, gttt-3 ′, and ttttt-3. Examples include, but are not limited to, ', uuuuu-3'.
Further, siRNA may have a protruding portion sequence (overhang) at the 3 ′ end, and specifically includes those to which dTdT (dT represents deoxyribonucleic acid) is added. Further, it may be a blunt end (blunt end) without end addition.
In addition, siRNA may have a different number of bases in the sense strand and the antisense strand, for example, “aiRNA” in which the antisense strand has a protruding sequence (overhang) at the 3 ′ end and the 5 ′ end. Can be mentioned. A typical aiRNA consists of 21 bases in the antisense strand, 15 bases in the sense strand, and has an overhang structure of 3 bases at both ends of the antisense strand (Sun, X. et al., Nature Biotechnology Vol. 26 No.12 p1379, International Publication No. WO2009 / 029688 Pamphlet).
Specifically, a blunt-end siRNA having a length of 25 bases as described in Example 5 or a target sequence portion as described in Example 10 having a length of 19 bases and a dTdT at the 3 ′ end is used. SiRNA having a total length of 21 bases to which is added.
The position of the target sequence is not particularly limited, but it is desirable to select the target sequence from 5′-UTR and the start codon to about 50 bases and from regions other than 3′-UTR. For a candidate group of target sequences selected based on the above-mentioned rules and others, whether or not there is homology in a 16-17 base sequence in mRNA other than the target is determined by BLAST (http: //www.ncbi.nlm Investigate using homology search software such as .nih.gov / BLAST /) to confirm the specificity of the selected target sequence. About the target sequence whose specificity has been confirmed, a sense strand having a 3 'end overhang of TT or UU at 19-21 bases after AA (or NA), a sequence complementary to the 19-21 bases and TT or A double-stranded RNA consisting of an antisense strand having a 3 ′ end overhang of UU may be designed as an siRNA. In addition, for short hairpin RNA (shRNA) which is a precursor of siRNA, an arbitrary linker sequence (for example, about 5-25 bases) capable of forming a loop structure is appropriately selected, and the sense strand and the antisense strand are combined with each other. It can be designed by linking via a linker sequence.

The siRNA and / or shRNA sequences can be searched using search software provided free of charge on various websites. Examples of such sites include siRNA Target Finder (http://www.ambion.com/jp/techlib/misc/siRNA_finder.html) and pSilencer (registered trademark) Expression Vector insert design tools ( http://www.ambion.com/techlib/misc/psilencer_converter.html), GeneSeer provided by RNAixCodex (http://codex.cshl.edu/scripts/newsearchhairpin.cgi) Not.

The ribonucleoside molecule constituting siRNA may also be modified in the same manner as the above-described antisense nucleic acid in order to improve stability, specific activity and the like. However, in the case of siRNA, if all ribonucleoside molecules in natural RNA are replaced with a modified form, RNAi activity may be lost, so the introduction of the minimum modified nucleoside that allows the RISC complex to function is necessary. .
Specifically, in order to improve a part of the nucleotide molecule constituting siRNA, natural DNA, stability (chemical and / or enzyme) and specific activity (affinity with RNA) as the modification In addition, it can be substituted with RNA having various chemical modifications (see Usman and Cedergren, 1992, TIBS 17,34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163). For example, in order to prevent degradation by a hydrolase such as nuclease, phosphate residues (phosphates) of each nucleotide constituting siRNA are converted into chemically modified phosphates such as phosphorothioate (PS), methylphosphonate, and phosphorodithionate. It can be substituted with a residue. In addition, the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R═CH ₃ (2′-O-Me), CH ₂ CH ₂ OCH ₃ (2′-O-MOE), CH ₂ CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.) or a fluorine atom (—F) may be substituted. Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl. Is mentioned. In addition, the method for modifying an antisense nucleic acid described in (1) above can be used. Or you may give the chemical modification (2'-deoxylation, 2'-H) which substitutes a part of RNA in siRNA with DNA. Alternatively, an artificial nucleic acid (LNA: Locked Nucleic Acid) in which the 2′-position and 4′-position of sugar (ribose) are cross-linked with —O—CH ₂ and the conformation is fixed to N-type may be used.
In addition, the sense strand and antisense strand constituting siRNA are linked via a linker to a ligand, peptide, sugar chain, antibody, lipid, positive charge or molecular structure that specifically recognizes a receptor present on the cell surface. It may be chemically bonded to oligoarginine, Tat peptide, Rev peptide or Ant peptide that adsorbs and penetrates the surface layer.

The siRNA is synthesized by synthesizing a sense strand and an antisense strand of a target sequence on mRNA with a DNA / RNA automatic synthesizer, denatured at about 90 to about 95 ° C. for about 1 minute in an appropriate annealing buffer, It can be prepared by annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. It can also be prepared by synthesizing a short hairpin RNA (shRNA) serving as a precursor of siRNA and cleaving it with a dicer.

In the present specification, a nucleic acid designed to generate siRNA against the mRNA of the ENAH gene in vivo also includes a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of the mRNA of the ENAH gene. Defined as encompassed by a nucleic acid containing a moiety. Examples of such nucleic acids include expression vectors constructed so as to express the above-mentioned shRNA and siRNA. shRNA is an oligo containing a base sequence in which the sense strand and the antisense strand of the target sequence on mRNA are linked by inserting a spacer sequence (for example, about 5 to 25 bases) long enough to form an appropriate loop structure. It can be prepared by designing RNA and synthesizing it with an automatic DNA / RNA synthesizer. Vectors expressing shRNA include tandem type and stem loop (hairpin) type. In the former, siRNA sense strand expression cassette and antisense strand expression cassette are linked in tandem, and each strand is expressed and annealed in the cell to form double stranded siRNA (dsRNA). It is. On the other hand, the latter is one in which an shRNA expression cassette is inserted into a vector, in which shRNA is expressed in cells and processed by dicer to form dsRNA. As the promoter, a pol II promoter (for example, a CMV immediate early promoter) can be used, but in order to accurately transcribe a short RNA, a pol III promoter is generally used. Examples of the polIII promoter include mouse and human U6-snRNA promoters, human H1-RNase P RNA promoter, and human valine-tRNA promoter. Further, a sequence in which 4 or more Ts are continuous is used as a transcription termination signal.
The siRNA or shRNA expression cassette thus constructed is then inserted into a plasmid vector or viral vector. Examples of such vectors include retrovirus, lentivirus, adenovirus, adeno-associated virus, herpes virus, Sendai virus and other viral vectors, animal cell expression plasmids, and the like.

The above siRNA can be chemically synthesized according to a conventional method using an automatic DNA / RNA synthesizer such as a 394-Applied Biosystems, Inc. synthesizer based on the nucleotide sequence information. For example, Caruthers et al., 1992, Methods in Enzymology 211,3-19, Thompson et al., International Publication 99/54459, Wincott et al., 1995, Nucleic Acids Res.23,2677-2684, Wincott et al. , 1997, MethodsolMol.Bio., 74,59, Brennan et al., 1998, Biotechnol Bioeng., 61,33-45, Usman et al., 1987 J.Am.Chem.Soc., 109,7845, Scaringe et al., 1990 Nucleic Acids Res., 18, 5433), Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684, Wincott et al., 1997, Methods Mol. Bio., 74, 59, and the United States Examples include the method described in Japanese Patent No. 6001311. Specifically, it can be synthesized using a nucleic acid protecting group known to those skilled in the art (for example, dimethoxytrityl group at the 5 'end) and a coupling group (for example, phosphoramidite at the 3' end). That is, the protecting group at the 5 ′ end is deprotected with an acid such as TCA (trichloroacetic acid) and a coupling reaction is performed. Then, after capping with an acetyl group, the next nucleic acid condensation reaction is performed. In the case of siRNA containing modified RNA or DNA, a modified RNA (eg, 2′-O-methyl nucleotide, 2′-deoxy-2′-fluoro nucleotide) may be used as a raw material, and the coupling reaction These conditions can be adjusted as appropriate. When introducing a phosphorothioate bond in which the phosphate binding moiety is modified, a borage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide) can be used.

Alternatively, oligonucleotides may be synthesized separately and joined together after synthesis, for example, by ligation (Moore et al., 1992, Science 256,9923; Draper et al. International Publication WO93 / 23569; Shabarova et al. , 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997, Bioconjugate Chem. It may be connected. siRNA molecules can also be synthesized by tandem synthesis. That is, both siRNA strands are synthesized as a single continuous oligonucleotide separated by a cleavable linker, which is then cleaved to generate separate siRNA fragments that are hybridized and purified . The linker may be a polynucleotide linker or a non-nucleotide linker.

The synthesized siRNA molecules can be purified using methods known to those skilled in the art. For example, a method of purification by gel electrophoresis or a method of purification using high performance liquid chromatography (HPLC) can be mentioned.
Alternatively, siRNA molecules can be inserted into DNA or RNA vectors and expressed using recombinant vectors. The vector can be a DNA plasmid or a viral vector. Although the viral vector expressing siRNA is not limited, adenovirus and the like can be used.

Specific examples of siRNA include the following groups:
(1) an siRNA in which the double-stranded RNA portion includes a base sequence represented by any one of SEQ ID NOs: 13, 14, and 25 to 47;
(2) The siRNA according to (1) above, wherein an overhang of 2 to 4 bases is added to the 3 ′ end,
(3) The siRNA according to (1) or (2), wherein at least one base is chemically modified, or
(4) The siRNA according to any one of (1) to (3), wherein at least one phosphodiester bond is chemically modified,
Etc. can be illustrated. Here, the base length of the double-stranded RNA portion of siRNA is 15-50 bases, preferably 19-50 bases, more preferably 19-49 bases, 15-49 bases, more preferably 19-25 bases, 15- 25 bases, more preferably 19 to 23 bases.

Nucleic acids containing a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of the ENAH gene mRNA, or a part thereof, are provided in a special form such as liposomes or microspheres, applied to gene therapy, It can be given in an added form. In this way, the additional form can be used as a polycationic substance such as polylysine, which acts to neutralize the charge of the phosphate group skeleton, to enhance the interaction with the cell membrane, or to increase the uptake of nucleic acid Examples include hydrophobic substances such as lipids (eg, phospholipids, cholesterol, etc.). Preferred lipids for addition include cholesterol and derivatives thereof (eg, cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3 'or 5' end of the nucleic acid and can be attached via a base, sugar, intramolecular nucleoside bond. Examples of the other group include a cap group specifically arranged at the 3 'end or 5' end of a nucleic acid, which prevents degradation by nucleases such as exonuclease and RNase. Such capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol.

The protein: ENAH expression inhibitory activity of these nucleic acids should be examined using a transformant introduced with the ENAH gene, an in vivo or in vitro ENAH gene expression system, or an in vivo or in vitro protein: ENAH translation system. Can do.

The substance that inhibits the expression of ENAH in the present invention is not limited to a nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of the mRNA of the ENAH gene as described above or a part thereof, and the production of ENAH Other substances such as low molecular weight compounds may be used as long as they are directly or indirectly inhibited. Such a substance can be obtained, for example, by the screening method of the present invention described later.

III. Substance that Suppresses ENAH Function In the present invention, “substance that suppresses ENAH function” may be any substance as long as it suppresses the function of ENAH once produced functionally.

Specifically, examples of the substance that suppresses the function of ENAH include an antibody against ENAH. The antibody may be a polyclonal antibody or a monoclonal antibody. These antibodies can be produced according to a method known per se for producing antibodies or antisera. The isotype of the antibody is not particularly limited, but preferably IgG, IgM or IgA, particularly preferably IgG. The antibody is not particularly limited as long as it has at least a complementarity determining region (CDR) for specifically recognizing and binding a target antigen. In addition to a complete antibody molecule, for example, Fab, Fab ′, F (ab ') ₂ such as fragments, scFv, scFv-Fc, conjugation molecules prepared by genetic engineering such as minibodies and diabodies, or molecules having a protein stabilizing action such as polyethylene glycol (PEG) They may be modified derivatives thereof.
In a preferred embodiment, since the antibody against ENAH is used as a pharmaceutical for human administration, the antibody (preferably a monoclonal antibody) is an antibody with reduced risk of showing antigenicity when administered to humans. Specific examples include fully human antibodies, humanized antibodies, mouse-human chimeric antibodies, and particularly preferably fully human antibodies. Humanized antibodies and chimeric antibodies can be prepared by genetic engineering according to conventional methods. In addition, fully human antibodies can be produced from human-human (or mouse) hybridomas, but in order to provide a large amount of antibodies stably and at low cost, human antibody-producing mice and phage display methods are used. It is desirable to manufacture using.
ENAH has the property of binding to actin competitively with the anti-tapping end cap protein of actin filaments. That is, it interacts with profilin and G-actin to suppress actin anti-tapping edge capping. Examples of the anti-tapping end cap protein include CapG, heterodimeric capping protein (CapZ), and gelsolin. ENAH is an F-actin binding motif (region corresponding to Block B in FIG. 1 of Bachmann et al., J. Biol. Chem., 274, 33, 23549-23557) and G-actin. The binding motif (region corresponding to Block A in FIG. 1 in Bachmann et al., J. Biol. Chem., 274, No. 33, 23549-23557, FIG. 1) is preserved.
The substance that suppresses the ENAH function is desirably a substance excellent in tumor blood vessel migration and cell membrane permeability. Therefore, another preferable substance that suppresses the function of ENAH is a low-molecular compound commensurate with Lipinski's Rule. Such a compound can be obtained, for example, using the screening method of the present invention described later.

Substances that suppress the expression or function of ENAH exhibit angiogenesis inhibitory activity, specifically tumor angiogenesis inhibitory activity, more specifically, growth inhibitory activity and / or migration inhibitory activity of tumor vascular endothelial cells. As such, it is useful for improving the pathology of patients suffering from cancer and for preventing cancer, particularly cancer metastasis and recurrence.
Therefore, a medicament containing a substance that suppresses the expression or function of ENAH can be used as a preventive and / or therapeutic agent (antitumor agent) for cancer.

IV. An antisense nucleic acid of the present invention that binds complementarily to a transcription product of a pharmaceutical ENAH gene containing an antisense nucleic acid, a ribozyme nucleic acid, siRNA and a precursor thereof, and can suppress translation of a protein from the transcription product, SiRNA (or ribozyme) that can cleave the transcript from the homologous (or complementary) nucleotide sequence in the ENAH gene transcript, and shRNA that is the precursor of the siRNA (hereinafter referred to as “general” The "nucleic acid of the invention" may be used as an antitumor agent because it suppresses the expression of ENAH in vivo and suppresses the proliferation and / or migration of tumor vascular endothelial cells.
The medicament containing the nucleic acid of the present invention has low toxicity and is used as it is as a liquid or as a pharmaceutical composition of an appropriate dosage form, as a human or non-human mammal (eg, rat, rabbit, sheep, pig, cow, cat, It can be administered orally or parenterally (eg, intravascular administration, subcutaneous administration, etc.).

When the nucleic acid of the present invention is used as the antitumor agent, it can be formulated and administered according to a method known per se. That is, the nucleic acid of the present invention is inserted alone or in a functional manner into an appropriate expression vector for mammalian cells such as a retrovirus vector, adenovirus vector, adenovirus associated virus vector, and then formulated according to conventional means. can do. The nucleic acid can be administered as it is or together with an auxiliary agent for promoting intake by a catheter such as a gene gun or a hydrogel catheter. Alternatively, it can be aerosolized and locally administered into the trachea as an inhalant.
Furthermore, for the purpose of improving the pharmacokinetics, extending the half-life, and improving the efficiency of cellular uptake, the nucleic acid may be formulated (injection) alone or with a carrier such as a liposome and administered intravenously, subcutaneously, etc. .

The nucleic acid of the present invention may be administered per se or as an appropriate pharmaceutical composition. The pharmaceutical composition used for administration may contain the nucleic acid of the present invention and a pharmacologically acceptable carrier, diluent or excipient. Such a pharmaceutical composition is provided as a dosage form suitable for oral or parenteral administration.

As a composition for parenteral administration, for example, injections, suppositories and the like are used. Injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included. Such an injection can be prepared according to a known method. As a method for preparing an injection, it can be prepared, for example, by dissolving, suspending or emulsifying the nucleic acid of the present invention in a sterile aqueous liquid or oily liquid usually used for injection. As an aqueous solution for injection, for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)) and the like may be used in combination. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent. The prepared injection solution is preferably filled in a suitable ampoule. Suppositories used for rectal administration may be prepared by mixing the nucleic acid with a normal suppository base.

Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), and syrups. Agents, emulsions, suspensions and the like. Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field. As the carrier and excipient for tablets, for example, lactose, starch, sucrose, and magnesium stearate are used.

The above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dosage of the active ingredient. Examples of the dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories. The nucleic acid of the present invention is preferably contained, for example, usually 5 to 500 mg per dosage unit form, especially 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.

The dosage of the above-mentioned pharmaceutical containing the nucleic acid of the present invention varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, when used for the treatment / prevention of cancer, the nucleic acid of the present invention. Is usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably 1 day a day. It is convenient to administer about 3 times by intravenous injection. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.

Note that each of the above-described compositions may appropriately contain other active ingredients as long as an undesirable interaction is not caused by blending with the nucleic acid of the present invention.

V. A drug containing an antibody against ENAH, a low molecular compound that suppresses the expression or function of ENAH, etc. An antibody against ENAH or a low molecular compound that suppresses the expression or function of ENAH can inhibit the production or function of ENAH. Therefore, since these substances suppress the expression or function of ENAH in vivo, they can be used as preventive and / or therapeutic agents for cancer.
A medicine containing the above-mentioned antibody or low molecular weight compound has low toxicity, and it is used as a solution or as a pharmaceutical composition of an appropriate dosage form as a human or mammal (eg, rat, rabbit, sheep, pig, cow, cat). , Dogs, monkeys, etc.) or or parenterally (eg, intravascular administration, subcutaneous administration, etc.).

The above-mentioned antibodies and low molecular compounds may be administered per se, or may be administered as an appropriate pharmaceutical composition. The pharmaceutical composition used for administration may contain the above-mentioned antibody or low molecular compound or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such a pharmaceutical composition is provided as a dosage form suitable for oral or parenteral administration.

As a composition for parenteral administration, for example, injections, suppositories and the like are used. Injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included. Such an injection can be prepared according to a known method. As a method for preparing an injection, it can be prepared, for example, by dissolving, suspending or emulsifying the antibody or low molecular compound or salt thereof of the present invention in a sterile aqueous liquid or oily liquid that is usually used for injection. As an aqueous solution for injection, for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)) and the like may be used in combination. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent. The prepared injection solution is preferably filled in a suitable ampoule. A suppository used for rectal administration may be prepared by mixing the above-mentioned antibody or a salt thereof with an ordinary suppository base.

Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), and syrups. Agents, emulsions, suspensions and the like. Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field. As the carrier and excipient for tablets, for example, lactose, starch, sucrose, and magnesium stearate are used.

The above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dosage of the active ingredient. Examples of the dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories. The antibody or low molecular weight compound is preferably contained in an amount of usually 5 to 500 mg per dosage unit form, particularly 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.

The dose of the above-mentioned medicament containing the above-mentioned antibody or low-molecular compound or a salt thereof varies depending on the administration subject, target disease, symptom, administration route, etc. Is usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight 1 to 5 times a day, with an antibody or low molecular weight compound as a single dose. It is convenient to administer by intravenous injection to a degree, preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
Each of the above-described compositions may contain other active ingredients as long as an undesirable interaction is not caused by blending with the above antibody or low molecular weight compound.

A pharmaceutical composition containing the above-mentioned antisense nucleic acid against ENAH, ribozyme nucleic acid, siRNA and its precursor, an antibody against ENAH, a low molecular compound that suppresses the expression or function of ENAH, etc. Can be used to treat, prevent, or prevent progression of cancer. That is, it can be used to suppress cancer growth, metastasis, cancerous ascites or cancer pleural effusion. Specific cancers include solid cancer, transitional cell carcinoma, colon cancer, colorectal cancer, colon cancer, lung cancer (small cell cancer), lung cancer (non-small cell lung cancer), kidney cancer (renal cell carcinoma), liver cancer ( Hepatocellular carcinoma), brain tumor, glioma (glioma), glioblastoma, glioblastoma multiforme, pancreatic cancer, head and neck cancer (squamous cell carcinoma), multiple myeloma, prostate cancer, ovarian cancer, digestion Tubular stromal tumor (GIST), gastric cancer, female genital cancer, cervical cancer, breast cancer, melanoma (melanoma), lymphoma (non-Hodgkin), lymphoma (Hodgkin), lymphoma (diffuse large cell type), leukemia (acute bone marrow) ), Leukemia (chronic lymphatic), esophageal cancer, thyroid cancer, adrenocortical cancer, fibrous histiocytoma, meningioma, bladder cancer, Ewing sarcoma, Kaposi sarcoma, mesothelioma or elevated dermal fibrosarcoma, etc. Can be mentioned.
In addition, the above-described pharmaceutical composition containing an antisense nucleic acid against ENAH, a ribozyme nucleic acid, a nucleic acid containing siRNA and a precursor thereof, an antibody against ENAH, or a low molecular compound that suppresses the expression or function of ENAH is an angiogenesis inhibitor. As an agent, diseases associated with abnormal angiogenesis, specifically diabetic retinopathy, choroidal neovascularization, macular degeneration, heart failure, myelodysplasia, influenza, inflammation, arthritis, hepatitis C, psoriasis, edema, neurodegeneration Disease, amyloidosis, idiopathic pulmonary fibrosis, multiple sclerosis, Wilson disease, von Hippel-Lindau disease, Crohn's disease, systemic mastocytosis, myeloproliferative syndrome, myelodysplasia, etc., preferably diabetic retinopathy, macular To treat, prevent, or prevent progression of degeneration, inflammation, arthritis, psoriasis, edema, idiopathic pulmonary fibrosis, von Hippel-Lindau disease, Crohn's disease It can be used.

Treatment or prevention of cancer with a pharmaceutical composition containing the above-mentioned antisense nucleic acid against ENAH, ribozyme nucleic acid, siRNA and its precursor, an antibody against ENAH, a low molecular compound that suppresses the expression or function of ENAH, etc. May be used alone, or may be used in combination with one or more drugs having anticancer activity and / or radiation therapy.
The drugs to be used in combination are not particularly limited. For example, angiogenesis inhibitors such as Bevacizumab, Sunitinib, Sorafenib, Erlotinib, Erbitax, blood vessel destruction drugs such as ASA404, 5-FU (fluorouracil), gemcitabine And chemotherapeutic agents such as cisplatin, irinotecan, carboplatin, and paclitaxel.

VI. Screening for Drug Candidate Compounds for Diseases As described above, suppression of ENAH expression and / or function suppresses proliferation and / or migration of tumor vascular endothelial cells, preferably proliferation and migration of tumor vascular endothelial cells. Has anti-neoplastic activity. Therefore, the compound or its salt that suppresses the expression and / or function of ENAH can be used as an agent for preventing and / or treating cancer (antitumor agent).
Therefore, cells that produce ENAH can be used as a tool for screening for substances having angiogenesis inhibitory activity by using the expression level and / or function of ENAH (or ENAH gene) as an index.

When screening a compound or a salt thereof that suppresses the expression and / or function of ENAH, the screening method involves culturing cells capable of producing ENAH in the presence and absence of a test substance, Comparing the expression level and / or function of ENAH below.

Cells having the ability to produce ENAH used in the above screening methods may be human or other mammalian cells that naturally express them or biological samples (eg, blood, tissues, organs, etc.) containing them. There are no particular restrictions. In the case of blood, tissues, organs, etc. derived from non-human animals, they may be isolated from the living body and cultured, or the test substance is administered to the living body itself, and these biological samples are isolated after a certain period of time. May be.
Examples of cells having the ability to produce ENAH include various transformants prepared by known and commonly used genetic engineering techniques. As the host, for example, animal cells such as H4IIE-C3 cells, HepG2 cells, HEK293 cells, COS7 cells, CHO cells are preferably used.
Specifically, DNA encoding ENAH (that is, the nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, or complementary to the nucleotide sequence) A protein comprising an amino acid sequence that hybridizes with a stringent base sequence under stringent conditions and is represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53 A DNA containing a base sequence encoding a polypeptide having the same function as that of a protein) can be prepared by ligating downstream of a promoter in an appropriate expression vector and introducing it into a host animal cell.

A method for preparing a gene encoding ENAH is described below.
The gene encoding ENAH can be obtained by conventional genetic engineering methods (eg Sambrook J., Frisch EF, Maniatis T., Molecular Cloning 2nd edition), Cold Spring Harbor Laboratory (Cold Spring Harbor Laboratory). press), etc.). That is, DNA encoding ENAH is obtained by, for example, using an appropriate oligonucleotide based on the base sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50, or SEQ ID NO: 52. It can be synthesized as a probe or primer and cloned from the above-described cDNA or cDNA library derived from cells / tissues that produce ENAH using a hybridization method or a PCR method. Hybridization can be performed, for example, according to the method described in Molecular Cloning 2nd edition (above). When a commercially available library is used, hybridization can be performed according to the method described in the instruction manual attached to the library.

The DNA base sequence can be determined using a known kit such as Mutan ^™ -super Express Km (Takara Shuzo), Mutan ^™ -K (Takara Shuzo), etc., using the ODA-LA PCR method, the Gapped duplex method, Conversion can be performed according to a method known per se such as the Kunkel method or a method analogous thereto.

The cloned DNA can be used as it is or after digestion with a restriction enzyme or addition of a linker, if desired. The DNA may have ATG as a translation initiation codon on the 5 ′ end side and TAA, TGA or TAG as a translation termination codon on the 3 ′ end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.
Subsequently, ENAH (protein) can be produced and obtained in accordance with a normal genetic engineering method using the obtained ENAH gene.
For example, a culture obtained by preparing a plasmid that allows the ENAH gene to be expressed in a host cell, introducing it into the host cell, transforming it, and then culturing the transformed host cell (transformant) You can get ENAH from things. Examples of the plasmid include a promoter that contains genetic information that can be replicated in a host cell, can be propagated autonomously, can be easily isolated and purified from the host cell, and can function in the host cell. Preferred examples include those in which a gene encoding ENAH is introduced into an expression vector having a detectable marker.
Various types of expression vectors are commercially available.
For example, an expression vector used for expression in E. coli is an expression vector containing a promoter such as lac, trp, tac, etc., and these are commercially available from Pharmacia, Takara Bio and the like. Restriction enzymes used to introduce a gene encoding ENAH into the expression vector are also commercially available from Takara Bio and others. If it is necessary to induce further high expression, a ribosome binding region may be linked upstream of the gene encoding protein: ENAH. Examples of the ribosome binding region used include those described in reports by Guarente L. et al. (Cell 20, p543) and Taniguchi et al. (Genetics of Industrial Microorganisms, p202, Kodansha).

In addition, animal cell expression plasmids (eg pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); bacteriophages such as λ phage; animal virus vectors such as retrovirus, vaccinia virus, adenovirus, etc. It can also be used. The promoter may be any promoter as long as it is appropriate for the host used for gene expression. For example, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, β-actin A gene promoter, aP2 gene promoter, etc. are used. Of these, CMV promoter, SRα promoter and the like are preferable.
In addition to the above, an expression vector containing an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), etc. is used as desired. Can do.

Selectable markers include, for example, dihydrofolate reductase gene (hereinafter abbreviated as dhfr, methotrexate (MTX) resistance), ampicillin resistance gene (hereinafter abbreviated as amp ^r ), neomycin resistance gene ( hereinafter sometimes abbreviated as neo ^r, include G418 resistance) and the like. In particular, when dhfr gene-deficient Chinese hamster cells are used and the dhfr gene is used as a selection marker, the target gene can also be selected using a medium that does not contain thymidine.

An ENAH-expressing cell can be produced by transforming a host with an expression vector containing the above-described DNA encoding ENAH.
Examples of host cells include prokaryotic or eukaryotic microbial cells, insect cells, and mammalian cells. Examples of mammalian cells include HepG2 cells, HEK293 cells, HeLa cells, human FL cells, monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary cells (hereinafter abbreviated as CHO cells), dhfr gene-deficient CHO cells ( Hereinafter, abbreviated as CHO (dhfr ⁻ ) cells), mouse L cells, mouse AtT-20 cells, mouse myeloma cells, rat H4IIE-C3 cells, rat GH3 cells, and the like. For example, from the viewpoint of facilitating mass preparation of ENAH, E. coli and the like can be preferably mentioned.
The plasmid obtained as described above can be introduced into the host cell by an ordinary genetic engineering method. The transformant can be cultured by a conventional method used for culturing microorganisms, insect cells or mammalian cells. For example, in the case of Escherichia coli, culturing is performed in a medium appropriately containing a suitable carbon source, nitrogen source and trace nutrients such as vitamins. The culture method may be any of solid culture and liquid culture, and preferred examples include liquid culture such as aeration and agitation culture.

Transformation can be performed by calcium phosphate coprecipitation method, PEG method, electroporation method, microinjection method, lipofection method and the like. For example, the methods described in Cell Engineering Supplement 8, New Cell Engineering Experiment Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973) can be used.

The transformed cells obtained as described above, mammalian cells having the ability to naturally produce ENAH, or tissues / organs containing the cells are, for example, a minimum essential medium (MEM) containing about 5 to 20% fetal calf serum. ) [Science, 122, 501 (1952)], Dulbecco's modified Eagle medium (DMEM) [Virology, 8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association, 199, 519 (1967) )], 199 medium (Proceeding of the Society for biological the Biological Medicine, Vol. 73, 1 (1950)). The pH of the medium is preferably about 6-8. Cultivation is usually carried out at about 30-40 ° C, with aeration and agitation as necessary.

ENAH can be obtained by combining methods commonly used for isolation and purification of general proteins. For example, the transformants obtained by the above culture are collected by centrifugation or the like, and the transformants are crushed or dissolved, and if necessary, proteins are solubilized, and various types such as ion exchange, hydrophobicity, gel filtration, etc. What is necessary is just to refine | purify the process using a chromatography individually or in combination. An operation of restoring the higher order structure of the purified protein may be further performed. Further, for example, the transformant obtained by the above culture may be removed by centrifugation or the like, and ENAH may be purified from the culture supernatant in the same manner as described above.

In carrying out the screening of the present invention, examples of the test substance include proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. These substances may be novel or may be known ones.
In addition, when selecting a substance that reduces the expression level of ENAH or the ENAH gene, or a substance that decreases the function of ENAH, a control cell that does not contact the test substance can also be used as a comparative control. Here, “Do not contact the test substance” means that the same amount of solvent (blank) as the test substance is added instead of the test substance, or that the expression level of ENAH or ENAH gene or ENAH function is affected. The case where a negative control substance not given is added is also included.

The contact of the test substance with the cells may be performed by, for example, the above-mentioned medium or various buffers (for example, HEPES buffer, phosphate buffer, phosphate buffered saline, Tris-HCl buffer, borate buffer, acetic acid). The test substance can be added to a buffer solution or the like, and the cells can be incubated for a certain time. The concentration of the test substance to be added varies depending on the type of compound (solubility, toxicity, etc.), but is appropriately selected within the range of about 0.1 nM to about 100 μM, for example. Examples of the incubation time include about 10 minutes to about 24 hours.

When cells that produce ENAH are provided in the form of a non-human mammal individual, the state of the animal individual is not particularly limited. For example, model mice transplanted with cancer cells [for example, A375SM (human highly metastatic A mouse produced by transplanting the melanoma cell) into the right dorsal skin of a KSN / Slc nude mouse]. There are no particular restrictions on the breeding conditions of the animals used, but it is preferable that the animals are raised in an environment of SPF grade or higher. Contact of the test substance with the cells is carried out by administering the test substance to the animal individual. The administration route is not particularly limited, and examples thereof include intravenous administration, intraarterial administration, subcutaneous administration, intradermal administration, intraperitoneal administration, oral administration, intratracheal administration, and rectal administration. The dose is not particularly limited. For example, a dose of about 0.5 to 20 mg / kg can be administered 1 to 5 times a day, preferably 1 to 3 times a day for 1 to 14 days.
Alternatively, the screening method described above can be carried out by contacting a test substance with an extract of the cells or ENAH isolated and purified from the cells, instead of the cells having the ability to produce ENAH.

(Measurement of expression level of ENAH gene or ENAH)
The present invention relates to a screening for a substance having an angiogenesis inhibitory activity, characterized by comparing the expression of the protein (gene) in cells having the ability to produce ENAH in the presence and absence of a test substance. Provide a method. The cells used in this method, the type of test substance, the mode of contact between the test substance and cells, etc. are the same as described above.

The expression level of ENAH is a nucleic acid that can hybridize with the above-described DNA encoding ENAH under stringent conditions, that is, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50, or SEQ ID NO: : A nucleic acid (DNA) that can hybridize with the base sequence represented by 52 or a base sequence complementary thereto under stringent conditions (hereinafter sometimes referred to as “the nucleic acid for detection of the present invention”), By detecting the mRNA of the ENAH gene, it can be measured at the RNA level. Alternatively, the expression level can also be measured at the protein level by detecting these proteins using the above-mentioned antibody against ENAH (hereinafter sometimes referred to as “the detection antibody of the present invention”).
Therefore, more specifically, the present invention
(A) Cells having the ability to produce ENAH are cultured in the presence and absence of a test substance, and the amount of mRNA encoding the protein under both conditions is measured using the nucleic acid for detection of the present invention. A method for screening a substance having an angiogenesis inhibitory activity, characterized by comparing, and (b) culturing cells capable of producing ENAH in the presence and absence of a test substance, under both conditions A method for screening a substance having an angiogenesis inhibitory activity is provided, which comprises measuring and comparing the amount of the protein in (1) using the detection antibody of the present invention.

That is, screening for a substance that changes the expression level of ENAH can be performed as follows.
(I) Normal or disease (for example, transplanted model mice such as colon cancer and lung cancer: model mice transplanted with cancer cells subcutaneously on the right back of KSN / Slc nude mice) model non-human mammals (for example, mice, Rats, rabbits, sheep, pigs, cattle, cats, dogs, monkeys, etc.) after administration of the test substance, after a certain period of time (30 minutes to 3 days, preferably 1 hour to 2 days later, more Preferably, 1 hour to 24 hours later, blood, a specific organ (eg, brain, etc.), or a tissue or cell isolated from the organ is obtained.
ENAH mRNA can be quantified by extracting mRNA from cells and the like by a conventional method, or can be quantified by Northern blot analysis known per se. On the other hand, the amount of ENAH protein can be quantified using Western blot analysis or various immunoassay methods described in detail below.
(Ii) A cell that expresses the ENAH gene (for example, a transformant into which ENAH has been introduced) is prepared according to the method described above, and a test substance is added to a medium or a buffer when cultivating according to a conventional method for a certain period of time. After incubation (1 day to 7 days later, preferably 1 day to 3 days later, more preferably 2 days to 3 days later), ENAH or mRNA encoding the same contained in the cells is quantified in the same manner as in (i) above. Can be analyzed.

The detection and quantification of the expression level of the ENAH gene (mRNA) can be performed by a known method such as Northern blotting or RT-PCR using RNA prepared from the cells or a complementary polynucleotide transcribed therefrom. Specifically, the presence or absence of expression of the ENAH gene in RNA and its expression by using a polynucleotide having at least 15 bases continuous in the base sequence of the ENAH gene and / or its complementary polynucleotide as a primer or probe The level can be detected and measured. Such a probe or primer is based on the base sequence of the ENAH gene, for example, primer 3 (HYPERLINK http://www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi http: // www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi) or vector NTI (manufactured by Infomax).

When using Northern blotting, the primer or probe is labeled with a radioisotope (32P, 33P, etc .: RI) or a fluorescent substance and hybridized with cell-derived RNA transferred to a nylon membrane or the like according to a conventional method. After soy, the formed duplex of the primer or probe (DNA or RNA) and RNA is used as a signal from the primer or probe label (RI or fluorescent material) as a radiation detector (BAS- 1800II (manufactured by Fuji Film) or a method of detecting and measuring with a fluorescence detector can be exemplified. In addition, using the AlkPhos Direct Labeling and Detection System (manufactured by Amersham Pharmacia Biotech), the probe is labeled according to the protocol, hybridized with cell-derived RNA, and then the signal derived from the labeled product of the probe is multi-bypassed. A method of detecting and measuring with an imager STORM860 (manufactured by Amersham Pharmacia Biotech) can also be used.
When using the RT-PCR method, a cDNA is prepared from cell-derived RNA according to a conventional method, and using this as a template, a target ENAH gene region can be amplified. A method of detecting the amplified double-stranded DNA obtained by hybridizing a primer (a normal strand that binds to the above cDNA (-strand) and a reverse strand that binds to a + strand) and performing PCR according to a conventional method Can be illustrated. The detection of the amplified double-stranded DNA was performed by a method for detecting the labeled double-stranded DNA produced by performing the PCR using a primer previously labeled with RI or a fluorescent substance. For example, a method can be used in which double-stranded DNA is transferred to a nylon membrane or the like according to a conventional method, and the labeled primer is used as a probe to hybridize with this to detect it. The produced labeled double-stranded DNA product can be measured with an Agilent 2100 Bioanalyzer (manufactured by Yokogawa Analytical Systems). Also, prepare an RT-PCR reaction solution according to the protocol using SYBR Green RT-PCR Reagents (Applied Biosystems) and react with ABI PRISM 7900 Sequence Detection System (Applied Biosystems) to detect the reaction product. You can also
The expression level of ENAH gene in the cells to which the test substance is added is 2/3 times or less, preferably 1/2 times or less, more preferably 1/3 times the expression level in the control cells to which no test substance is added. The test substance can be selected as an ENAH gene expression inhibitor if it is below.
Screening for substances that change the expression level of ENAH can also be performed by a reporter gene assay using the transcriptional regulatory region of the ENAH gene. Here, the “transcriptional regulatory region” usually refers to a range from several kb to several tens of kb upstream of the chromosomal gene. For example, (i) 5′-race method (5′-RACE method) (for example, 5 (ii) Genome Walker Kit (which can be carried out using conventional methods such as oligocap method and S1 primer mapping) (ii) Genome Walker Kit ( The 5′-upstream region can be obtained using Clontech, etc., and the obtained upstream region can be identified by a technique including a step of measuring promoter activity. Specifically, in L. Urbanelli et al., Biochimica et Biophysica Acta 1759 (2006) p99-107, p105, based on the sequence of the 5′-upstream region disclosed in FIG. Can be identified.

A reporter protein expression vector is constructed by linking a nucleic acid encoding a reporter protein (hereinafter referred to as “reporter gene”) in a functional manner downstream of the transcriptional regulatory region of the ENAH gene. The vector may be prepared by a method known to those skilled in the art. That is, the conventional genetic engineering described in `` Molecular Cloning: A Laboratory Manual 2nd edition '' (1989), Cold Spring Harbor Laboratory Press, `` Current Protocols In Molecular Biology '' (1987), John Wiley & Sons, Inc. The transcriptional regulatory region of ENAH gene excised according to the technique can be incorporated on a plasmid containing a reporter gene.
Reporter proteins include β-glucuronidase (GUS), luciferase, chloramphenicol transacetylase (CAT), β-galactosidase (GAS), green fluorescent protein (GFP) and the like.
Using a normal genetic engineering technique, insert a reporter gene that is operably linked to the prepared transcriptional regulatory region of the ENAH gene into a vector that can be used in the cell into which the reporter gene is to be introduced. And can be introduced into a suitable host cell. Stable transformed cells can be obtained by culturing in a medium with selection conditions according to the selection marker gene mounted on the vector. Alternatively, a reporter gene in which the transcriptional regulatory region of the ENAH gene is operably linked may be transiently expressed in the host cell.
In addition, as a method for measuring the expression level of the reporter gene, a method corresponding to each reporter gene may be used. For example, when a luciferase gene is used as a reporter gene, the transformed cell is cultured for several days, an extract of the cell is obtained, and then the extract is reacted with luciferin and ATP to cause chemiluminescence, and the emission intensity Promoter activity can be detected by measuring. In this case, a commercially available luciferase reaction detection kit such as Picker Gene Dual Kit (registered trademark; manufactured by Toyo Ink) can be used.

As a method for measuring ENAH protein amount, specifically, for example,
(I) Quantifying ENAH in a sample solution by competitively reacting the detection antibody of the present invention with the sample solution and labeled ENAH, and detecting the labeled protein bound to the antibody How,
(Ii) The sample solution is reacted with the detection antibody of the present invention insolubilized on the carrier and another labeled detection antibody of the present invention simultaneously or continuously, and then the labeling agent on the insolubilized carrier. A method of quantifying ENAH in a sample solution by measuring the amount (activity) of s.

ENAH protein expression level can be detected and quantified according to a known method such as Western blotting using an antibody recognizing ENAH. Western blotting uses an antibody that recognizes ENAH as the primary antibody, and then binds to the primary antibody labeled with a radioisotope such as ¹²⁵ I, a fluorescent substance, or an enzyme such as horseradish peroxidase (HRP) as the secondary antibody. This is carried out by measuring the signal derived from these labeling substances using a radiation measuring instrument (BAI-1800II: manufactured by Fuji Film Co., Ltd.), a fluorescence detector or the like. In addition, after using an antibody recognizing ENAH as a primary antibody, detection is performed according to the protocol using ECL Plus Western Blotting Detection System (Amersham Pharmacia Biotech) It can also be measured.

The above-described antibody is not particularly limited in its form, and may be a polyclonal antibody having ENAH as an immunizing antigen, or may be a monoclonal antibody thereof. Usually, an antibody having antigen-binding ability against a polypeptide consisting of 8 amino acids, preferably 15 amino acids, more preferably 20 amino acids can also be used.
Methods for producing these antibodies are already well known, and the antibodies of the present invention can also be produced according to these conventional methods (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley and Sons. Section 11.12-11.13).

In the quantification method (ii) above, it is desirable that the two antibodies recognize different portions of ENAH. For example, if one antibody recognizes the N-terminal part of ENAH, one that reacts with the C-terminal part of the protein can be used as the other antibody.
As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like is used. As the radioisotope, for example, [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are used. The enzyme is preferably stable and has a large specific activity. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used. Furthermore, a biotin- (strept) avidin system can be used for binding of an antibody or antigen to a labeling agent.

The ENAH quantification method using the detection antibody of the present invention is not particularly limited, and the amount of antibody, antigen or antibody-antigen complex corresponding to the amount of antigen in the sample solution is chemically or physically determined. Any measurement method may be used as long as it is a measurement method that is detected by means and calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, competition method, immunometric method and sandwich method are preferably used. In view of sensitivity and specificity, for example, the sandwich method described later is preferably used.

In the insolubilization of the antigen or antibody, physical adsorption may be used, or a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, or glass.

In the sandwich method, the sample solution is reacted with the insolubilized detection antibody of the present invention (primary reaction), and further labeled with another detection antibody of the present invention (secondary reaction), and then on the insolubilized carrier. By measuring the amount or activity of the labeling agent, ENAH in the sample solution can be quantified. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at different times. The labeling agent and the insolubilizing method can be the same as those described above. Further, in the immunoassay by the sandwich method, the antibody used for the immobilized antibody or the labeled antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity. May be.

The detection antibody of the present invention can also be used in measurement systems other than the sandwich method, such as a competitive method, an immunometric method, or nephrometry.
In the competitive method, ENAH in the sample solution and labeled ENAH are reacted competitively with the antibody, and then the unreacted labeled antigen (F) and the labeled antigen (B) bound to the antibody are separated. (B / F separation) Quantify ENAH in the sample solution by measuring the amount of label B or F. In this reaction method, a soluble antibody is used as an antibody, B / F separation is performed using polyethylene glycol or a secondary antibody against the antibody (primary antibody), and a solid phase is used as the primary antibody. Either the antibody is used (direct method), or the primary antibody is soluble, and the immobilized antibody is used as the secondary antibody (indirect method).
In the immunometric method, ENAH in a sample solution and solid-phased ENAH are subjected to a competitive reaction with a certain amount of labeled antibody, and then the solid phase and the liquid phase are separated, or ENAH in the sample solution is separated. After reacting with an excess amount of labeled antibody, solid-phased ENAH is added to bind unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to quantify the amount of antigen in the sample solution.
In nephrometry, the amount of insoluble precipitate produced as a result of the antigen-antibody reaction in a gel or solution is measured. Even when the amount of ENAH in the sample solution is small and only a small amount of precipitate is obtained, laser nephrometry using laser scattering is preferably used.

In applying these individual immunological measurement methods to the quantification method of the present invention, special conditions, operations and the like are not required to be set. An ENAH measurement system may be constructed by adding ordinary technical considerations to those skilled in the art to the usual conditions and operation methods in each method. For details of these general technical means, it is possible to refer to reviews, books and the like.
For example, Hiroshi Irie “Radioimmunoassay” (Kodansha, published in 1974), Hiroshi Irie “Continue Radioimmunoassay” (published in Kodansha, 1979), “Enzyme Immunoassay” edited by Eiji Ishikawa et al. 53), edited by Eiji Ishikawa et al. "Enzyme Immunoassay" (2nd edition) (Medical Shoin, published in 1982), edited by Eiji Ishikawa et al. "Enzyme Immunoassay" (3rd edition) (Medical School, Showa 62)), "Methods in ENZYMOLOGY" Vol. 70 (Immunochemical Techniques (Part A)), ibid Vol. 73 (Immunochemical Techniques (Part B)), ibid Vol. 74 (Immunochemical Techniques (Part C)), ibid Vol 84 (Immunochemical Techniques (Part D: Selected Immunoassays)), ibid. Vol. 92 (Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods)), ibid. )) (Above, published by Academic Press) It is possible to see.
As described above, by using the detection antibody of the present invention, the amount of ENAH in cells can be quantified with high sensitivity.

For example, in the above screening method, the expression level (mRNA level or protein level) of ENAH in the presence of the test substance is about 20% or more, preferably about 30%, compared to the case in the absence of the test substance. As described above, when the inhibition is more preferably about 50% or more, the test substance can be selected as a candidate for ENAH expression-suppressing substance, and thus a substance having angiogenesis inhibitory activity.

Alternatively, in the screening method described above, cells containing a reporter gene under the control of the transcriptional regulatory region in the ENAH gene can be used instead of cells expressing the ENAH gene. Such cells may be cells, tissues, organs or individuals of transgenic animals into which a reporter gene (eg, luciferase, GFP, etc.) under the control of the transcriptional regulatory region of the ENAH gene has been introduced. When such cells are used, the expression level of ENAH can be evaluated by measuring the expression level of the reporter gene using a conventional method.

(Measurement of ENAH function)
The screening method of the present invention can also be performed using as an index whether or not a test substance suppresses the function of ENAH.
Specifically, in tumor vascular endothelial cells expressing ENAH, it can be carried out by measuring whether or not proliferation or migration of the cells is suppressed by adding a test substance. For example, cell proliferation or cell migration of tumor vascular endothelial cells in the presence of the test substance is about 10% or more, preferably about 20% or more, more than cell growth or cell migration in the absence of the test substance. When it is preferably inhibited by about 30% or more, more preferably about 50% or more, the test substance can be selected as a candidate for ENAH function-suppressing substance, and thus a substance having angiogenesis inhibitory activity.
In the screening method described above, as a control, cells that have been prepared using conventional methods and have the ENAH gene knocked out should not exhibit the above function in control cells that do not express the ENAH gene. Can be confirmed. That is, it can be confirmed that the action mechanism of the candidate substance having angiogenesis inhibitory activity obtained in the above screening method is based on suppression of ENAH or ENAH gene expression or suppression of ENAH function.

The substance that suppresses the expression or function of ENAH obtained by using any one of the screening methods of the present invention is useful as a pharmaceutical for the prevention and / or treatment of cancer.
When the compound obtained by using the screening method of the present invention is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated in the same manner as the low molecular weight compound that suppresses the expression or function of ENAH, and has the same administration route and The dose may be administered orally or parenterally to humans or mammals (eg, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.). it can.

VII. Method for Determining Cancer Onset or Onset Risk In addition, the present invention provides a method for determining cancer onset or onset risk, characterized by measuring the expression level of ENAH in a sample collected from a test animal. The method includes the following steps (a) and (b).
(A) a step of measuring the expression level of ENAH gene or ENAH or the function of ENAH in a sample collected from a test animal; and (b) the expression level as compared with the case of measuring in a sample derived from a normal animal. Alternatively, the step of determining that the test animal having an increased function has cancer or has a high risk of developing in the future.

Examples of test animals include humans and other mammals, preferably humans, mice, rats, rabbits, dogs, monkeys and the like that are widely used as experimental animals. Examples of the measurement target sample include blood, plasma, serum, cerebrospinal fluid, lymph fluid, saliva, mucous membrane, urine, tears, semen, joint fluid, biopsy sample, and the like.

ENAH gene expression level and protein: ENAH level in a sample can be measured by the same method as described in the above screening method using the gene or protein expression level as an index.
As a result of the above measurement, the amount of ENAH gene expression or ENAH in the sample collected from the test animal is significantly higher than the amount of ENAH gene expression or ENAH in the sample collected from the normal animal It can be determined that the test animal has developed cancer or has a high risk of developing in the future. Alternatively, the expression level in a normal animal is identified in advance, for example, the average value + 2SD is defined as a cut-off value, and the expression level of the ENAH gene or the amount of ENAH in a sample collected from the test animal If the value is exceeded, the test animal can also be determined to have developed cancer or have a high risk of developing in the future.

Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited to these examples.

[Example 1]
Preparation of cancer cell suspension for transplantation HSC3 (human tongue cancer cells) is a DMEM medium (manufactured by SIGMA) containing 10% FBS (manufactured by Hyclone), and A375SM (human highly metastatic melanoma cells) is Using MEM medium (GIBCO) containing 10% FBS (Hyclone), OSRC2 (human kidney cancer cells) using RPMI medium (SIGMA) containing 10% FBS (Hyclone) Each was cultured at 37 ° C. and 5% CO ₂ . After removing the medium by suction, the cells were washed once with PBS (Nissui Pharmaceutical Co., Ltd.), added with 0.5% trypsin-EDTA solution (manufactured by SIGMA), and detached after 5 minutes at 37 ° C and 5% CO ₂ Was suspended in DMEM medium (SIGMA) containing 10% FBS. The cell suspension is centrifuged at 1000 rpm at 4 ° C. for 5 minutes to collect cells, diluted and suspended at 1 × 10 ⁷ cells / ml with Hank's buffered salt solution (hereinafter referred to as HBSS, manufactured by GIBCO). This was a cancer cell suspension for transplantation.

[Example 2]
Transplantation of cancer cells into mice 6 to 7-week-old mice (strain: KSN / Slc nude, gender: female, breeder: Nippon SLC) subcutaneously transplanted in Example 1 per mouse. 0.1 ml of the cell suspension was injected using a 1 mL syringe syringe (Terumo) and a 27G needle (Terumo). The mice were reared until the diameter of the transplanted tumor was about 10 mm.

Example 3
Preparation of Mouse Primary Vascular Endothelial Cells The tumor subcutaneously transplanted mice prepared in Example 2 were euthanized after general anesthesia with isoflurane (Abbott Japan). After removing the tumor part (tumor mass) and cutting it finely with scissors in 20 ml of a collagenase type II (Collagenase Type II, GIBCO) solution with a final concentration of 10-15 mg / ml, the final concentration becomes 20-30 μg / ml As described above, DNase (Roche) was added and incubated at 37 ° C. for 30 minutes (shaking) to prepare a cell suspension. The tube containing the cell suspension is placed on ice, and the suspension (upper layer) from which the undigested tissue fragments that have precipitated are removed is transferred to a new 50 mL tube through a 100 μm mesh size cell strainer (BD Biosciences). did. The collagenase was inactivated by adding the same amount of FBS as the cell suspension. The cells were collected by centrifugation at 1000 rpm at 4 ° C. for 5 minutes, and then suspended in 20 mL of HBSS (GIBCO). Mononuclear cells separated into an intermediate layer by overlaying the cell suspension on the same volume (20 ml) of Histopaque (registered trademark) -1077 (manufactured by SIGMA ALDRICH), centrifuging at 2000 rpm, 4 ° C. for 20 minutes Was recovered. 40ml of HBSS (manufactured by GIBCO) was added to the collected solution, and the cells were collected by centrifugation at 1000rpm and 4 ° C for 10 minutes, then 40ml of 0.5% BSA (Albumin solution, from bovine serum, 30%, ASEPTICALLY FILLED: SIGMA The product was resuspended in HBSS. After centrifugation at 1000 rpm and 4 ° C. for 5 minutes, the suspension was suspended in 1 ml of HBSS containing 0.5% BSA and incubated (stirred) at room temperature for 20 minutes. Thereto, 5 μl of rat anti-mouse CD31 antibody (Purified Rat Anti-mouse CD31, manufactured by BD Biosciences pharmingen) was added and incubated (stirred) at 4 ° C. for 30 minutes. After centrifugation at 1000 rpm and 4 ° C. for 5 minutes, the cells were suspended in 0.5% BSA-containing HBSS and centrifuged again at 1000 rpm and 4 ° C. for 5 minutes. Suspend the collected cells in 80 μl of 0.5% BSA-containing MACS buffer (degassed PBS buffer containing 2 mM EDTA), and then add 20 μl of goat anti-rat IgG magnetic beads (Goat Anti-Rat IgG Microbeads, manufactured by Miltenyi Biotec). And left at 4 ° C. for 15 minutes. Centrifugation was performed at 1000 rpm and 4 ° C. for 5 minutes, and the precipitated cells were suspended in 1 ml of MACS buffer. MS column (MS Columns, manufactured by Miltenyi Biotec) if the number of cells in the suspension is 1 × 10 ⁷ or less, LS column (LS Columns, manufactured by Miltenyi Biotec) if it is 1 × 10 ⁷ or more The following operation (MACS) was performed using First, place the selected column on the attached magnetic magnet, add 500 μl of MACS buffer 3 times for calibration (initial calibration), add 1 mL of cell suspension to the column, and wash 3 times with 500 μl of MACS buffer. did. The column was removed from the magnet, and the magnetically labeled CD31 positive cells remaining in the column were pushed out into a 15 ml tube with 1 mL of MACS buffer using a syringe attached to the column. 6-well plate (manufactured by Nunc) coated with PBS containing 1.5% gelatin (manufactured by SIGMA) after resuspending the cells using a medium dedicated to vascular endothelial cells EGM-2MV (manufactured by Lonza) and counting the number of cells 2x10 ⁵ cells / well in a 20% FBS-containing EGM-2MV medium containing diphtheria toxin (Calbiochem) at a final concentration of 500 ng / ml for 16 hours and then converted to a medium containing no diphtheria toxin. Cultured for 2 weeks. The cultured cells are collected, resuspended in HBSS containing 0.5% BSA, and then BS1-B4 positive cells are separated and collected by MACS using BS1-B4 (Vector Laboratories) instead of the CD31 antibody. The tumor vascular endothelial cells were used in the following experiments. On the other hand, normal vascular endothelial cells were prepared in the same manner as the above-described method for preparing tumor vascular endothelial cells, starting from the skin blood vessels of mice not transplanted with tumor cells.

Example 4
Cultivation of mouse primary vascular endothelial cells Cultured at 37 ° C. and 5% CO ₂ using a growth medium for vascular endothelial cells (Brett Kit EGM-2MV, manufactured by Lonza). During passage, after removing the medium from the flask by suction, it was washed once with PBS (GIBCO), added with 0.05% trypsin-EDTA solution (GIBCO), and then at 37 ° C and 5% CO ₂ The cells detached in 3 minutes were suspended and collected by adding DMEM medium containing 10% FBS (manufactured by Nacalai Tesque). The cell suspension was centrifuged at 800 rpm for 5 minutes at room temperature, and the cells were collected, diluted and suspended in EGM-2MV medium, and cultured.

Example 5
SiRNA transfection of mouse primary vascular endothelial cells Add 1.44 μl of 10 μM siRNA solution and 8 μl of Lipofectamine RNAiMAX reagent (Invitrogen) to 0.8 ml of EBM-2 medium (Lonza) and mix at room temperature for 10- The mixture was allowed to stand for 20 minutes to form a complex of the following siRNA (showing only the sense strand) and liposome.

mENAH-1 siRNA: GACAGAAAUGAAGAUGCAGAGCCUA (SEQ ID NO: 13)
mENAH-2 siRNA: CAACUGGGUUCAGCAGAGUACAUAU (SEQ ID NO: 14)

Thereto was added 4 ml of a vascular endothelial cell suspension diluted to 9 × 10 ⁴ cells / ml in EBM-2 medium containing 0.5% FBS, and mixed. The mixture is 55 μl / well in a 96-well plate (Costar) for proliferation assay, 2.25 ml / well in a 6-well plate (Asahi Techno Glass) for migration assay, and 6 wells for RNA preparation. Each plate was dispensed at 1.5 ml / well on a plate (Asahi Techno Glass). 37 ° C., after 6 hours of culture under 5% CO _2, EGM-2 MV medium equal volumes of (Lonza Inc.) were added, respectively, 37 ° C. until carrying out the assay, and incubated under 5% CO ₂ .
The siRNA used here is mENAH-1: Enah Stealth Select RNAi (registered trademark) siRNA (MSS203860) and mENAH-2: Enah Stealth Select RNAi siRNA (MSS274145), which are commercially available from Invitrogen.

Example 6
Proliferation assay Two kinds of siRNAs described in Example 5 were transfected into mouse primary tumor vascular endothelial cells prepared from A375SM (human highly metastatic melanoma cells) transplanted model mice and primary normal vascular endothelial cells prepared from normal mice. The cell growth inhibitory effect was confirmed.
72 hours after siRNA transfection, 20 μl of the mixed solution obtained by mixing Alamar Blue solution (Alamar Bioscience) and EGM-2MV medium at a ratio of 13: 7 was added to the 96-well plate for proliferation assay prepared in Example 5. / Well and incubated at 37 ° C. under 5% CO ₂ for 2 to 3 hours. Fluorescence values are measured using a fluorescence plate reader (Ascent FL, Labsystems) (excitation wavelength: 544 nm / measurement wavelength: 590 nm). The measured value of only the medium without cells (blank) is 0%, and no siRNA is transferred. The relative value (%) of the cells into which siRNA was introduced was calculated with the measured value of the cells (mock) to which only the detection reagent was added as 100%. The growth inhibition rate was calculated by the following formula.

Growth inhibition rate = 100%-relative value of cells into which siRNA has been introduced (%)

The results of confirming the cell growth inhibitory effect are shown in Table 1.

As described above, the growth of primary tumor vascular endothelial cells and primary normal vascular endothelial cells was suppressed by transfecting siRNA of ENAH gene to suppress ENAH gene expression. From this, it was found that ENAH siRNA has an inhibitory activity on the proliferation of vascular endothelial cells.

Example 7
Migration assay Angiogenesis system: Measured using a vascular endothelial migration assay (Becton Dickinson). That is, 48 hours after siRNA transfection, the medium of the 6-well plate for migration assay prepared in Example 5 was removed by suction, washed once with PBS (manufactured by GIBCO), and then EBM-2 containing 0.2% BSA. The medium was added at 1-2 ml / well and cultured at 37 ° C. under 5% CO ₂ for 2-3 hours. After detaching and suspending the cells by pipetting, the number of cells was counted by staining with 0.2% trypan blue (GIBCO) (0.2% BSA as necessary to reach about 10-20x10 ⁴ cells / ml). Diluted with EBM-2 medium containing The above cell suspension was added at 0.075 ml / well to the upper chamber of a 96-well plate for migration assay (Becton Dickinson) returned to room temperature, and then EGM-2MV diluted 10-fold with EBM-2 medium. The medium was added to the lower well at 0.225 ml / well and cultured for 16-20 hours in a CO ₂ incubator (37 ° C., 5% CO ₂ condition). After removing the culture medium in the upper chamber by suction, another 96-well plate (Falcon) filled with 0.225 ml / well of Calcein AM (Becton Dickinson) solution prepared to a concentration of 4 μg / ml with HBSS (GIBCO) The chamber was immersed in a CO ₂ incubator for 90 minutes in a CO ₂ incubator (37 ° C., 5% CO ₂ condition), and the cells that passed (migrated) through the chamber membrane were fluorescently labeled. Fluorescence values are measured with a downward photometric fluorescence plate reader (CytoFluor II, manufactured by PerSeptive Biosystems) (excitation wavelength: 485 nm / measurement wavelength: 530 nm), corrected by the number of cells in the upper chamber and corrected for the fluorescence value per 10 ⁴ cells. Calculated. Relative value of cells into which siRNA is introduced (%), where the measured value of the medium without cells (blank) is 0% and the measured value of the cells (mock) to which only the transfection reagent without siRNA is added is 100% Was calculated. The migration inhibition rate was calculated by the following formula.

Migration inhibition rate = 100%-relative value of cells introduced with siRNA (%)

The results are shown in Table 2.

From the above results, the migration of primary tumor vascular endothelial cells and primary normal vascular endothelial cells was suppressed by transfecting siRNA of ENAH gene to suppress ENAH gene expression. From this, it was found that ENAH siRNA has the activity of inhibiting migration of vascular endothelial cells.

Example 8
Quantitative RT-PCR
(RNA preparation)
RNA was prepared from the cells described in Example 5 using QuickGene-800 (Fuji Film) according to the attached protocol. That is, 48 hours after siRNA transfection, the medium was aspirated and removed from each well of the 6-well plate for RNA preparation prepared in Example 5, and then the LRC lysate attached to QuickGene RNA cultured cell kit S (Fuji Film) was attached. A mixed solution obtained by adding 2-mercaptoethanol at 10 μl / ml to the solution was added at 350 μl / well to prepare a cell lysate. After adding 350 μl of 70% ethanol solution and mixing, the mixture was collected by centrifugation at 10000 rpm for 1 minute at room temperature, and the entire amount of the collected mixture was added to the cartridge attached to the kit. After setting the cartridge in a predetermined place of QuickGene-800, RNA mode was selected and RNA was automatically prepared. The concentration of the prepared RNA was measured with Nanodrop-1000 (manufactured by Thermo scientific) and subjected to RT-PCR reaction.
(RT-PCR)
Using the prepared RNA as a template, cDNA was synthesized using TaqMan Reverse Transcription Reagents (ABI). Using the resulting cDNA as a template, a pair of primers (a normal strand that binds to the cDNA (-strand) and a reverse strand that binds to the + strand so that the base sequence region encoding the gene to be quantified can be specifically amplified. ) Was designed and synthesized in the usual way. When quantifying mouse ENAH, primers 1 and 2 having the base sequences shown below were used.

Mouse ENAH Primer 1: CACATTCAGAGTTGTGGGCAGA (SEQ ID NO: 15)
Mouse ENAH primer 2: TGCTGCCAAAGTTGAGACCATAC (SEQ ID NO: 16)
Mouse 18S ribosomal RNA Primer 1: GGGAGCCTGAGAAACGGC (SEQ ID NO: 17)
Mouse 18S ribosomal RNA Primer 2: GGGTCGGGAGTGGGTAATTT (SEQ ID NO: 18)

Prepare the RT-PCR reaction solution according to the protocol using the synthesized primer and SYBR Green RT-PCR Reagents (Applied Biosystems), and react with ABI PRISM7900 Sequence Detection System (Applied Biosystems). Detection and quantification. The value obtained by correcting the expression level of mouse ENAH in each sample with the expression level of 18S ribosomal RNA was defined as the ENAH expression level in each sample, and the gene expression suppression rate was usually determined by the following formula.
((Expression level of control cell) − (expression level of cell introduced with siRNA)) / (expression level of control cell) × 100
Here, the control cell means a cell (mock) that does not contain siRNA and to which only the transfection reagent is added. Table 3 shows the inhibition rate of mouse ENAH gene expression when each siRNA of the mouse ENAH gene (see Example 5) was introduced into mouse primary tumor vascular endothelial cells.

From the above results, it was found that ENAH expression was suppressed by two types of siRNAs, mENAH-1 and mENAH-2.

Example 9
Expression in mouse primary tumor vascular endothelial cells RNA was prepared from the cells prepared in Example 4 by the method described in Example 8, and quantitative RT-PCR was performed. When quantifying mouse ENAH, primers 1 and 2 having the base sequences shown below were used.

Mouse ENAH Primer 1: GGCAAGATCACCGTGCATTGAAAT (SEQ ID NO: 19)
Mouse ENAH Primer 2: GCGCCCTCTGGAAAAAAATCTCTG (SEQ ID NO: 20)

As a result, it was shown that ENAH expression was significantly higher in mouse primary tumor vascular endothelial cells than in mouse primary normal vascular endothelial cells (FIG. 1).

Example 10
Inhibition of human ENAH expression Phosphoramidite method using siRNA sequence for human ENAH (see Table 4) (21-base double-stranded siRNA consisting of 19 base pairs and 2-base 3'-end overhang) using amidite Was synthesized with an RNA synthesizer (ABI394).
10 ml of Lipofectamine RNAiMAX reagent (manufactured by Invitrogen) was added per 1 ml of Opti-MEM medium (manufactured by GIBCO), mixed, and dispensed into a 6-well plate (manufactured by Asahi Techno Glass) at 400 μl / well. 2.4 μl of 10 μM siRNA solution was added or not added to 400 μl of the RNAiMAX diluted solution and allowed to stand at room temperature for 20 minutes to form a complex of siRNA and liposome. 2 ml of HEK293 (human fetal kidney-derived cell line) cell suspension prepared to 1 × 10 ⁵ cells / ml in DMEM medium (GIBCO) containing 10% FBS was added thereto, at 37 ° C., 5% Incubate overnight under CO ₂ conditions. Then, after removing the culture medium from each well of the 6-well plate, 350 μl of a mixed solution obtained by adding 2-mercaptoethanol at 10 μl / ml to the LRC solution attached to QuickGene RNA cultured cell kit S (Fujifilm) is added. A cell lysate was prepared. Thereafter, RNA was prepared by the method described in Example 8, and quantitative RT-PCR was performed using a primer specific for human ENAH and a primer specific for human GAPDH. The value obtained by correcting the expression level of human ENAH in each sample with the expression level of GAPDH was used as the expression level of ENAH in each sample, and the gene expression suppression rate was determined by the method described in Example 8. Untreated cells were used as control cells.
The following primers were used.

Human ENAH Primer 1: GTGGCTCAACTGGATTCAGCA (SEQ ID NO: 21)
Human ENAH Primer 2: AGGAATGGCACAGTTTATCACGA (SEQ ID NO: 22)
Human GAPDH Primer 1: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 23)
Human GAPDH Primer 2: TGGTGAAGACGCCAGTGGA (SEQ ID NO: 24)

Table 4 shows the sequence of each siRNA and the gene expression suppression effect. Table 4 shows the portion corresponding to the sense strand of the target gene, and the actually prepared siRNA has an overhang sequence “dTdT” added to the 3 ′ end of the sequence shown in Table 4. Yes.

From the above results, it was found that siRNA of human ENAH has a gene expression inhibitory effect on human ENAH.

Example 11
SiRNA Transfection into Primary Tumor Vascular Endothelial Cells of Mouse Among siRNA sequences for human ENAH described in Table 4 of Example 10, siRNA having a sequence that completely matches mouse ENAH (SEQ ID NO: 35) was used to produce primary mouse SiRNA transfection into tumor vascular endothelial cells was performed.
That is, 6 μl of 5 μM siRNA solution and 12 μl of Lipofectamine RNAiMAX reagent (Invitrogen) were added to 1.2 ml of EBM-2 medium (Lonza), mixed, and allowed to stand at room temperature for 10 to 20 minutes. The complex of was formed.
4.8 ml of vascular endothelial cell suspension diluted to 8 × 10 ⁴ cells / ml with EBM-2 medium containing 0.5% FBS was added thereto and mixed. The mixture is 50 μl / well in a 96-well plate (Costar) for proliferation assay, 2 ml / well in a 6-well plate (Asahi Techno Glass) for migration assay, and 6-well plate for RNA preparation. (Asahi Techno Glass Co., Ltd.) was dispensed at 1.5 ml / well. After culturing at 37 ° C. and 5% CO ₂ for 6 hours, an equal amount of EGM-2MV medium (Lonza) was added, and the cells were cultured at 37 ° C. and 5% CO ₂ until each assay was performed. .

Example 12
Proliferation assay The assay was performed according to the method described in Example 6. The results of confirming the cell growth inhibitory effect are shown in Table 5.

As described above, even when unmodified siRNA without chemical modification is used, the growth of primary tumor vascular endothelial cells is suppressed by transfecting the siRNA of ENAH gene to suppress the expression of ENAH gene. It was done.

Example 13
Migration assay The migration assay was performed according to the method described in Example 7. The results of confirming the cell migration inhibitory effect are shown in Table 6.

As described above, even when unmodified siRNA without chemical modification is used, the migration of primary tumor vascular endothelial cells is suppressed by transducing the ENAH gene siRNA to suppress ENAH gene expression. It was done.

Example 14
Quantitative RT-PCR
From the cells described in Example 11, RNA was prepared 24 hours after siRNA transfection according to the method described in Example 8, and quantitative RT-PCR was performed. Table 7 shows the inhibition rate of mouse ENAH gene expression when siRNA (SEQ ID NO: 35) of mouse ENAH gene was introduced into mouse primary tumor vascular endothelial cells. When quantifying mouse ENAH, primers 1 and 2 having the base sequences shown below were used.
Mouse ENAH primer 1: GGCAAGATCACCGTGCATTGAAAT (SEQ ID NO: 19)
Mouse ENAH Primer 2: GCGCCCTCTGGAAAAAAATCTCTG (SEQ ID NO: 20)

From the above results, it was found that the expression of mouse ENAH was suppressed by unmodified siRNA against ENAH.

The substance that suppresses the expression or function of ENAH or the ENAH gene of the present invention exhibits the activity of inhibiting the growth and / or migration of tumor vascular endothelial cells, and is useful as a medicine, specifically as a therapeutic or preventive agent for cancer. Moreover, the screening method of the present invention is useful for searching for an angiogenesis inhibitor that is a candidate substance for cancer treatment or prevention.

SEQ ID NOs: 13-14: siRNA
SEQ ID NO: 15-24: PCR primer SEQ ID NO: 25-47: siRNA

While the invention has been described with emphasis on preferred embodiments, it will be apparent to those skilled in the art that the preferred embodiments can be modified. The present invention contemplates that the present invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the appended claims.
The contents of all publications, including the patents and patent application specifications mentioned herein, are hereby incorporated by reference herein to the same extent as if all were specified. .
This application is based on Japanese Patent Application No. 2010-062825 filed on Mar. 18, 2010, the contents of which are incorporated in full herein.

Claims (18)

1. An antitumor agent containing as an active ingredient a substance that suppresses the expression or function of ENAH.
2. The agent according to claim 1, wherein the substance is a substance selected from the group consisting of the following (1) to (3), which suppresses the expression of ENAH:
   (1) an antisense nucleic acid against a transcription product of a gene encoding ENAH,
   (2) a ribozyme nucleic acid for a transcription product of a gene encoding ENAH, and (3) a nucleic acid having a RNAi activity for a transcription product of a gene encoding ENAH or a precursor thereof.
3. The agent according to claim 1, wherein the substance is an antibody that binds to ENAH.
4. The agent according to any one of claims 1 to 3, wherein ENAH is a protein comprising an amino acid sequence selected from the following (a) to (e):
   (A) the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53,
   (B) in the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, one or more amino acids are deleted, added, inserted or substituted; And the following properties (1) to (3):
   (1) can bind to actin competitively with the anti-twist end cap protein;
   (2) F-actin and G-actin binding motifs are conserved; and (3) the amino acid represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 Can be recognized by an antibody that specifically recognizes a protein consisting of a sequence;
   An amino acid sequence having at least one of
   (C) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, which has 80% or more homology with the amino acid sequence shown in the following (1) to An amino acid sequence having at least one of the properties of (3),
   (D) an amino acid sequence encoded by DNA having the base sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, and (e) SEQ ID NO: 1. , SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52 encoded by DNA that hybridizes under stringent conditions with DNA having complementarity to DNA having the base sequence And an amino acid sequence having at least one of the above properties (1) to (3).
5. The agent according to any one of claims 1 to 4, which is an angiogenesis inhibitor.
6. The agent according to claim 5, which is a tumor angiogenesis inhibitor.
7. The agent according to any one of claims 1 to 6, which is a tumor vascular endothelial cell proliferation and / or migration inhibitor.
8. A screening method for an angiogenesis inhibitor, which comprises selecting a compound that reduces the expression level of ENAH.
9. The screening method according to claim 8, comprising the following steps (1) to (3):
   (1) contacting a test substance with a cell containing a nucleic acid encoding a gene encoding ENAH or a reporter protein under the control of a transcriptional regulatory region of the gene;
   (2) a step of measuring the expression level of ENAH or a reporter protein in the cell; and (3) an angiogenesis inhibitor that reduces the expression level as compared with the case where measurement is performed in the absence of a test substance. Selecting as a candidate.
10. A method for screening an angiogenesis inhibitor, which comprises selecting a compound that reduces the expression level of a gene encoding ENAH.
11. A screening method for an angiogenesis inhibitor, which comprises selecting a compound that reduces the function of ENAH.
12. A method for determining whether or not there is a risk of developing cancer, or whether or not the patient is suffering from cancer, comprising the following steps (1) and (2):
    (1) a step of measuring the expression level of ENAH-encoding gene or ENAH, or the function of ENAH in a sample collected from a test animal, and (2) compared with the case of measuring in a sample derived from a normal animal, Determining the subject animal whose expression level or function is elevated to be at risk of developing cancer or suffering from cancer.
13. The following groups:
    (1) a base sequence represented by SEQ ID NO: 25 to 47, and (2) a base sequence having 2 to 4 bases added to the 3 ′ end of the base sequence represented by SEQ ID NO: 25 to 47,
    An oligonucleotide comprising any nucleotide sequence selected from
14. An siRNA in which the double-stranded RNA portion consists of a base sequence represented by any one of SEQ ID NOs: 25 to 47.
15. The siRNA according to claim 14, wherein an overhang of 2 to 4 bases is added to the 3 'end.
16. The siRNA according to claim 14 or 15, wherein at least one base is chemically modified.
17. The siRNA according to any one of claims 14 to 16, wherein at least one phosphodiester bond is chemically modified.
18. An antitumor agent comprising the siRNA according to any one of claims 14 to 17 as an active ingredient.

Images