KR20170049024A

KR20170049024A - Composition for prevention or treating cancer comprising inhibitors for expression or activity of ANKs1a, and screening method for thereof

Info

Publication number: KR20170049024A
Application number: KR1020150149863A
Authority: KR
Inventors: 박수철; 이혜령
Original assignee: 숙명여자대학교산학협력단
Priority date: 2015-10-28
Filing date: 2015-10-28
Publication date: 2017-05-10
Also published as: WO2017073971A1

Abstract

The present invention relates to a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient, and a screening method thereof, and provides a composition having excellent effects of preventing and treating cancer, You can provide a method.

Description

[0001] The present invention relates to a composition for preventing or treating cancer comprising an ANKs1a protein expression or activity inhibitor as an active ingredient, and a screening method for the composition,

The present invention relates to a composition for preventing or treating cancer comprising ANKs1a protein expression or activity inhibitor as an active ingredient, and a screening method thereof.

Cancer (malignant tumors) has been studied for more than 30 years, and cancer incidence continues to increase due to environmental pollution and erroneous eating habits, causing more than 10 million patients worldwide every year, The Organization (WHO) lists cancer as one of the leading causes of death. It is the major disease that occupies the first place in the modern society. Despite many studies, there is no epoch-making treatment. Treatment of cancer with chemotherapeutic agents such as anticancer drugs has some effects, but many studies are required because of the various mechanisms of cancer and the expression of anticancer drug resistance. In recent decades, the development of diagnostic and therapeutic techniques have resulted in limited improvements in cure rates and functional preservation, but the 5-year survival rate for many advanced cancers has been around 5 to 50 percent. These cancers are characterized by aggressive invasion, lymph node metastasis, distant metastasis, and the development of secondary cancers. Despite the wide variety of studies and therapies for some cancers, survival rates have remained largely unchanged over the past two decades.

In recent years, attempts have been made to increase the therapeutic effect of these cancers through a molecular biological approach, and studies on target treatment related to cancer proliferation, metastasis and apoptosis have been actively conducted. Among them, RNA interference (RNAi) technology is frequently used in research in the life sciences field, and its usefulness is widely recognized. Herein, RNAi refers to a phenomenon in which the mRNA is specifically degraded by the double-stranded RNA and the expression of the gene is suppressed as a result. In 2001, it was reported that siRNA (small interference RNA), a low molecular weight double-stranded RNA of 21 bases, could mediate RNAi in mammalian cells (Non-Patent Document 1), siRNA is a method for suppressing the expression of a target gene It is frequently used, and many shRNAs complementing the shortcomings of siRNA are also being utilized.

The first consideration in treatment using such RNA interference is to select an optimal siRNA and shRNA sequence (hereinafter referred to as "interference RNA") having the greatest activity in the target sequence. The efficiency of the ribonucleic acid-mediated interference phenomenon is known to have a large effect on the specific binding site to the target transcript. Based on the database of the last few years, algorithms have been developed and available to users to design the position of the interfering RNA sequence that actually inhibits the expression of target ribonucleic acid, rather than merely binding to the transcript. However, it can not be said that all the interference RNA determined by the in silico method using the computer algorithm can effectively suppress the target ribonucleic acid in the actual cells and the living body. Even if the requirement for complementary binding of RNA to a target transcript is met, there are many other factors that have yet to be elucidated, such as the stability and intracellular location of ribonucleic acid and protein, and the state of proteins involved in ribonucleic acid mediated interference Are involved in determining the efficiency of ribonucleic acid mediated interference phenomena. Therefore, it is necessary that a technique for preparing siRNAs by selecting multiple target sequence positions per transcript of a gene and locating the optimal position sequence having an excellent expression inhibiting effect among these candidate genes is performed on the target protein. On the other hand, cancer studies in relation to ANKs1a have focused on the control of endocytosis of EphA2 by binding between Anks1a and EphA2 (Non-Patent Documents 2 and 3).

1. US 2009-0263391

1. Elbashir S. M. et al., "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells" Nature, 411 (6836), p.494-498 (2001) 2. Flavia Anna Mercurio and et al., "SOLUTION STRUCTURE OF THE FIRST SAM DOMAIN OF ODIN AND BINDING STUDIES WITH THE EPHA2 RECEPTOR" Biochemistry. March 13; 51 (10): 2136-2145. 3. Muhammad Emaduddin and et al, "Odin (ANKS1A) is a Src family kinase target in colorectal cancer cells" Cell Communication and Signaling 2008, 6: 7

The present invention provides a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient, and a method for screening a composition for preventing or treating cancer.

In order to achieve the above object, the present invention provides a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient.

According to one aspect of the present invention, the ANKs1a protein expression or activity inhibitor of the composition for preventing or treating cancer is characterized by acting specifically on the ANK (ankyrin repeat region) domain.

According to one aspect of the present invention, the ANKs1a protein expression inhibitor of the composition for preventing or treating cancer comprises an antisense nucleotide complementarily binding to mRNA of the ANKs1a gene, a short interfering RNA (siRNA) and a short hairpin RNA hairpin RNA, shRNA).

According to one aspect of the present invention, the short hairpin RNA of the ANKs1a gene of the composition for preventing or treating cancer is characterized by having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

According to one aspect of the present invention, the ANKs1a protein activity inhibitor of the composition for preventing or treating cancer is any one or more selected from the group consisting of a compound which binds complementarily to ANKs1a protein, a peptide, a peptide mimetics, an aptamer and an antibody .

According to one aspect of the present invention, the composition for preventing or treating cancer is selected from the group consisting of liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, gastric cancer, breast cancer, Prostate cancer, pancreatic cancer, epidermal cancer, and lung cancer.

According to one aspect of the present invention, there is provided a method for producing a cell, comprising: (a) treating a candidate substance to a candidate cell; (b) measuring the expression or activity of the ANKs1a protein in the subject cell; And (c) selecting a candidate substance that decreases the expression or activity of ANKs1a protein among the candidate substances as a result of the measurement.

According to one aspect of the present invention, the step of measuring the expression or activity of an ANKs1a protein in the method for screening a substance for preventing or treating cancer comprises measuring the amount of the ANKs1a gene expression, the amount of the ANKs1a protein, A complex of ANKs1a protein with another protein, a complex between ANKs1a protein and another protein, and a complex of ANKs1a protein and another protein under the action of ANKs1a protein is detected or measured.

According to one aspect of the present invention, the other protein which interacts with or forms a complex with the ANKs1a protein in the screening method for a substance for preventing or treating cancer is EphA2, ErbB2 or a complex thereof.

According to one aspect of the present invention, a method for measuring the expression or activity of an ANKs1a protein in a screening method for a substance for preventing or treating cancer includes a reverse transcriptase-polymerase chain reaction, a real- a radioimmunoassay (RIA), a radioimmunodiffusion, and an immunoprecipitation assay (ELISA), a real time polymerase chain reaction (PCR), Western blot, northern blot, enzyme linked immunosorbent assay Is selected.

The present invention relates to a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient, and a method for screening the same. The present invention provides a composition having excellent effects of preventing and treating cancer, And can be usefully applied to the medical field.

FIGS. 1A and 1B show the result of Western blotting after treatment of ANKs1a-specific shRNA with CT26 cell line.
FIGS. 1C to 1F are the results of measurement of cancer-forming ability (FIG. 1D) and colony forming ability (FIG. 1E and FIG. 1F) of cells after administration of CT26 cell line treated with ANKs1a-specific shRNA to Balb / c mice.
FIG. 2A shows the result of measuring the cancer-forming ability when Knockout of ANKs1a was expressed in a breast cancer-expressing mouse (MMTV-Neu).
FIGS. 2B and 2C are the results of measurement of colony forming ability after administration of shRNA specific to ANKs1a to a breast cancer-expressing mouse (MMTV-Neu).
2d and 2e show the results of measurement of expression of EphA2 and ErbB2 after administration of shRNA specific to ANKs1a in breast cancer-expressing mice (MMTV-Neu).
Figures 3a and 3b are the results of measuring the effect of Anks1a on the migration of EphA2 and ErbB2 to the cell surface.

In order to accomplish the above object, the present invention provides a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient, and a screening method therefor. BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the drawings.

The present invention provides a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient. In the present invention, the ANKs1a protein (Ankyrin repeat and SAM domain-containing protein 1A) is an adapter protein existing in the intracellular cytoplasm and is expressed by the ANKs1a gene. The ANKs1a gene is present on the sixth chromosome (6p21.31) in human case, the nucleotide sequence has the sequence shown in NM_015245.2 of NCBI, and the amino acid sequence can have the sequence shown in NP_056060.2 of NCBI.

Through the present invention, the ANKs1a is expressed in an endoplasmic reticulum which plays an important role in protein production and migration to the cell membrane. Anks1a binds to EphA2 through the ANK (ankyrin repeat region) domain and binds to the endoplasmic reticulum through the PTB domain (Phosphotyrosine Binding Domains) And that it binds to the Sec23 protein (one of the components of the vesicle that migrates from the endoplasmic reticulum to the Golgi). Through this study, it was clarified that ANK of Anks1a interacts with EphA2 to regulate the migration process of EphA2 from the endoplasmic reticulum to the cell membrane, and using this, an agent for preventing or treating cancer, which comprises Anks1a protein expression or activity inhibitor as an active ingredient . For example, the expression or activity inhibitor of Anks1a contained in the composition for preventing or treating cancer according to the present invention may act specifically on the ANK (ankyrin repeat region) domain, but is not limited thereto.

In the present invention, the term "cancer" refers to a condition in which the abnormal function of the cell itself is troubled and abnormal cells that normally should die are over-proliferated and invade into surrounding tissues and organs to form lumps and destroy or deform existing structures And is used in the same sense as malignant tumors. In addition, "prevention or treatment" of cancer means inhibiting or preventing the growth of cancer, which reduces the growth and metastasis of cancer and reduces resistance to anticancer drugs when compared to when treated or untreated It is a concept that also includes making the effect more effective. The term " metastasis " means a process in which tumor (cancer) cells diffuse to a remote part of the body, and the term " tolerance to an anticancer drug "or" anticancer drug resistance " There is no therapeutic effect or it is effective in the early stage of cancer treatment, but it means that the effect of cancer treatment is lost in continuous treatment.

The ANKs1a protein expression inhibitor contained in the composition for preventing or treating cancer according to the present invention is characterized by comprising an antisense nucleotide complementarily binding to mRNA of ANKs1a gene, a short interfering RNA (siRNA) and a short hairpin RNA , shRNA), but is not limited thereto.

In the present invention, the term "antisense nucleotide" refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to a complementary sequence in mRNA and inhibits translation of mRNA into a protein And may be expressed as " antisense oligonucleotide ". The antisense nucleotide sequence refers to a DNA or RNA sequence that is complementary to ANKs1a mRNA and capable of binding ANKs1a mRNA and is an essential part of the ANKs1a mRNA for translational, cytoplasmic translocation, maturation, or any other overall biological function The activity can be inhibited. The length of the antisense nucleotide may be 6 to 100 bases, preferably 8 to 60 bases, more preferably 10 to 40 bases.

The antisense nucleotide may be modified at one or more bases, sugars, or backbone locations to enhance efficacy. The nucleotide backbone may be modified with phosphorothioate, phosphotriester, methylphosphonate, short chain alkyl, cycloalkyl, short chain heteroatomic, heterocyclic biantennary bond, and the like. In addition, the antisense nucleotides may comprise one or more substituted sugar moieties. Antisense nucleotides may include modified bases. Modified bases include, but are not limited to, hypoxanthane, 6-methyladenine, 5-methylpyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, genentioyl HMC, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, . In addition, the antisense nucleotides of the present invention may be chemically combined with one or more moieties or conjugates that enhance the activity and cytotoxicity of the antisense nucleotides. A cholesterol moiety, a cholesteryl moiety, a cholic acid, a thioether, a thiocholesterol, an aliphatic chain, a phospholipid, a polyamine, a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety, octadecylamine, hexylamino- And liposoluble moieties such as Cole sterol moieties. Methods for the preparation of new nucleotides including liposoluble moieties are well known in the art (U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleotides can increase stability to nuclease and increase the binding affinity of the antisense nucleotide to the target mRNA.

The antisense nucleotides may be synthesized in vitro by conventional methods and administered in vivo or may be used to synthesize antisense nucleotides in vivo. One example for the synthesis of antisense nucleotides in vitro is the use of RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose origin is a multi-cloning site (MCS) in the opposite direction. It is preferred that the antisense RNA is such that translation stop codon is present in the sequence so that it is not translated into the peptide sequence. The design of antisense nucleotides that can be used in the present invention can be easily produced by a method known in the art with reference to the nucleotide sequence of the ANKs1a gene.

The term "small interfering RNA" or "siRNA" in the present invention is a nucleic acid molecule capable of mediating RNA interference or gene silencing, and can inhibit the expression of a target gene. Therefore, an efficient gene knockdown method Or as a gene therapy method. When the siRNA molecule is used in the present invention, the sense strand (the sequence corresponding to the ANKs1a mRNA sequence) and the antisense strand (the sequence complementary to the ANKs1a mRNA sequence) are located on opposite sides to form a double-stranded structure or a self- single-stranded structure with sense and antisense strands. siRNAs are not limited to the complete pairing of double-stranded RNA portions that are paired with RNAs, but rather a mismatch (the corresponding base is not complementary), an expansion / bulge (a base corresponding to one strand And a non-paired portion may be included. The siRNA terminal structure is capable of blunt or cohesive termini as long as it can inhibit the expression of ANKs1a gene by RNA interference (RNAi) effect. The sticky end structure can be a 3'-end protruding structure and a 5'-end protruding structure.

In addition, the siRNA molecule of the present invention may have a form in which a short nucleotide sequence is inserted between self-complementary sense and antisense strands, in which case the siRNA molecule formed by the expression of the nucleotide sequence is Thereby forming a hairpin structure, which in turn forms a stem-and-loop structure. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

Methods for preparing siRNA include a method of directly synthesizing siRNA in a test tube, introducing the siRNA into a cell through transformation, and a method of expressing siRNA expression vector or PCR-derived siRNA expression cassette into a cell There is a way to convert or infect.

The composition of the present invention comprising the gene-specific siRNA may include an agent that promotes intracellular infiltration of siRNA. Agents that promote intracellular inflow of siRNA can generally include agents that promote nucleic acid inflow. Examples of such agents include liposomes or one lipophilic one of a number of sterols, including cholesterol, cholate, and deoxycholic acid Can be combined with the carrier. It is also possible to use poly-L-lysine, spermine, polysilazane, polyethylenimine (PEI), polydihydroimidazolenium, polyallylamine Cationic polymers such as chitosan, chitosan and the like may be used, and succinylated PLL, succinylated PEI, polyglutamic acid, polyaspartic acid, anionic polymers such as polyaspartic acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, and the like, Can be used.

The term "short hairpin RNA" or "shRNA" in the present invention refers to a single molecule in which two complementary portions having base sequences of siRNA form base pairs and are covalently bonded by a single chain hairpin region, Of about 50-70 nucleotides in length and has a stem loop structure in vivo. Long RNAs of 19-29 nucleotides complementary to both the loop region of 5-10 nucleotides form base pairs, forming a double-stranded stem. The shRNA is generally synthesized in vivo by transcription of a complementary base sequence from the Pol III promoter. Transcription induced by Pol-Ⅲ is terminated at the second residue of the line (-TTTT-), which starts at a known starting point and consists of four or more thymidines, resulting in a non-poly (A) transcript. The Pol III promoter is active in all cells and is capable of expressing shRNAs. After transcription, shRNA is truncated by the dicer and acts like siRNA [Tuschl, T. (2002), Cell 110 (5): 56374]. More preferably, the short hairpin RNA of ANKs1a gene of the composition for preventing or treating cancer according to the present invention may have the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

The ANKs1a protein activity inhibitor contained in the composition for preventing or treating cancer according to the present invention may be any one or more selected from the group consisting of a compound which binds complementarily to the ANKs1a protein, a peptide, a peptide mimetics, an aptamer and an antibody, It is not limited.

The term "peptidomemics" of the present invention is intended to inhibit the activity of the ANKs1a protein as a peptide or nonpeptide that inhibits the binding domain of the ANKs1a protein. The major residues of the non-hydrolyzable peptide analogs include the beta-turn dipeptide core (Nagai et al. Tetrahedron Lett. 26: 647, 1985), keto-methylene pseudopeptides (Ewenson et al. J Med Chem 29: 295, 1986; And Ewenson et al. In Peptides: Proceedings of the 9th American Peptide Symposium, Pierce Chemical Co. Rockland, IL, 1985), Huffman et al in Peptides (Chemistry and Biology, GR Marshall ed. ESCOM Publisher: Leiden, Netherlands, 1988), β-aminoalcohols (Gordon et al., Biochem Biophys Res. Commun 126: 419 1985) and substitution gamma-lactylation (Garvey et al. In Peptides: Chemistry and Biology, GR Marshell ed., ESCOM Publisher: Leiden, Netherlands, 1988).

In the present invention, the term "aptamer" refers to a nucleic acid molecule having a binding activity to a predetermined target molecule. The aptamer can inhibit the activity of the polynucleotide or protein by binding to ANKs la polynucleotide or protein. The aptamer of the present invention may be RNA, DNA, modified nucleic acid or a mixture thereof, and may be in a linear or cyclic form. The length of the aptamer of the present invention is not particularly limited and may be usually 15 to 200 nucleotides, but is, for example, 100 nucleotides or less, preferably 80 nucleotides or less, more preferably 60 nucleotides or less, still more preferably 45 Lt; / RTI > nucleotides. The length of the aptamer of the present invention may also be, for example, 18, 20 or 25 nucleotides or more. When the total number of nucleotides is small, chemical synthesis and mass production are easier, and the cost advantage is also great. In addition, chemical modification is easy, the stability in vivo is high, and the toxicity is low.

The aptamer of the present invention can be produced by using the SELEX method and its modification method. The SELEX (Systematic Evolution of Ligands by EXponential Enrichment) method is a method for selecting oligonucleotides that specifically bind to a target substance from a pool of oligonucleotides having about 10 to 14 different nucleotide sequences. This oligonucleotide pool is associated with the target substance, and only the oligonucleotide bound to the target substance is recovered using a filter or the like. The recovered oligonucleotide is labeled with RT -PCR, and this is used as a template for the next round. By repeating this operation 10 times, an aptamer that specifically binds to the target substance can be obtained. , It is possible to obtain a more robust application Thus, by controlling the number of rounds of SELEX or changing the contention state, aptamers having different binding strengths, aptamers having different binding forms, and aptamers having the same binding or binding pattern but different base sequences can be obtained. In addition, although the SELEX method includes an amplification process by PCR, it is possible to carry out SELEX with more diversity by giving a mutation by using manganese ion or the like in the process. In addition to the SELEX technique, the Cell-SELEX technique can be used to obtain complex targets, ie living cells and tissues. The Cell-SELEX technique has the advantage of developing an aptamer for diseased cells even when the surface marker target is unknown In addition, it may not exhibit its inherent characteristics in a separate state, Since the target protein to enable a more functional approach in the selection process, Cell-SELEX method has the advantage compared to conventional SELEX process.

On the other hand, aptamer binds to the target substance by various binding modes such as ionic bonding using negative charge of phosphate group, hydrophobic bonding using ribose and hydrogen bonding, hydrogen bonding using stacking of nucleic acid, or stacking. In particular, the ionic bond using the negative charge of the phosphate group, which exists as many as the constituent nucleotides, strongly binds to the plus charge of lysine or arginine present on the surface of the protein. For this reason, nucleic acid bases not related to direct binding with the target substance can be substituted. Particularly, since the portion of the stem structure is already formed of a base pair and is also directed toward the inside of the double helix structure, the nucleic acid base is difficult to bind directly to the target substance. Therefore, even if the base pair is replaced with another base pair, the activity of the aptamer does not often decrease. Even in a structure in which a base pair is not formed, such as a loop structure, base substitution is possible when the nucleotide base does not participate in direct binding with the target molecule. For example, at the 2 'position of the ribose, the nucleotide in which the hydroxyl group is substituted with any atom or group may be used. Examples of such an arbitrary atom or group include a hydrogen atom, a fluorine atom or an -O-alkyl group (e.g., -O-CH3), an -O-acyl group (e.g., -O- And the like. As such, an aptamer retains its activity unless it substitutes or deletes functional groups involved in direct binding with the target molecule. In addition, the aptamer is easy to modify because it can be chemically synthesized. The aptamer can predetermine the secondary structure using the MFOLD program or predict the steric structure by X-ray analysis or NMR analysis to predict which nucleotide can be substituted or deleted and where new nucleotides can be inserted . The predicted new sequence aptamer can be chemically synthesized easily and can be confirmed by existing analytical systems whether the aptamer remains active.

The term "antibody" in the present invention refers to a substance which is produced by stimulation of an antigen in the immune system and specifically binds to a specific antigen to cause an antigen-antibody reaction. In the present invention, in order to inhibit the activity of ANKs1a protein, Antibodies can be used. In particular, an antibody that acts on the ANK domain in the ANKs1a protein to inhibit binding to EphA2 or inhibits the migration of EphA2 to the cell surface can be used. An antibody specific for the ANKs1a protein that may be used in the present invention may be a polyclonal or monoclonal antibody, preferably a monoclonal antibody. Antibodies specific for the ANKs1a protein can be obtained by methods conventionally practiced in the art, for example, the fusion method (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), recombinant DNA methods (U.S. Patent No. 4,816,567 (Clackson et al., Nature, 352: 624-628 (1991) and Marks et al, J. Mol. Biol., 222: 58, 1-597 (1991)) have. For example, the preparation of a hybridoma cell producing monoclonal antibody is carried out by fusing an immortalized cell line with an antibody-producing lymphocyte, The techniques necessary for this process are well known and readily practicable by those skilled in the art. A polyclonal antibody can be obtained by injecting ANKs1a protein antigen into a suitable animal, collecting the antiserum from the animal, and then separating the antibody from the antiserum using a known affinity technique.

In the present invention, the antibody may comprise a single chain variable region segment (scFv). The single-stranded variable region fragment may be composed of "variable-region (VL) of light chain-variable-region (VH) of linker-double-stranded ". The linker refers to a constant-length amino acid sequence that artificially connects the variable region of the heavy chain and the light chain.

The composition for preventing or treating cancer according to the present invention may be used for the prevention and treatment of cancer such as liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, gastric cancer, breast cancer, cervical cancer, Epidermal cancer, and lung cancer, but is not limited thereto, and may be preferably a breast cancer.

The composition for preventing or treating cancer according to the present invention may contain at least one active ingredient which exhibits the same or similar function in addition to the above-mentioned expression or activity inhibitor of ANKs1a protein.

The composition can be administered orally or parenterally at the time of clinical administration and can be administered orally or parenterally in the case of parenteral administration by intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine injection, intracerebral injection, And may be used in the form of a general pharmaceutical preparation. The composition may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers. The daily dose of the composition is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, and it is preferable to administer the composition one time or several times a day. However, , The time of administration, the administration method, the excretion rate, and the severity of the disease.

The composition of the present invention can be administered in various forms of parenteral administration at the time of actual clinical administration. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, do. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. As a suppository base, witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like can be used

Another aspect of the present invention is a method for producing a cell, comprising the steps of: (a) treating a candidate substance to a target cell; (b) measuring the expression or activity of the ANKs1a protein in the subject cell; And (c) selecting a candidate substance that decreases the expression or activity of ANKs1a protein among the candidate substances as a result of the measurement. The expression inhibitor of ANKs1a gene or the inhibitor of activity of ANKs1a protein of the present invention can be obtained through the above screening method.

In the present invention, the term "candidate substance" means an unknown substance used in screening to examine whether expression of ANKs1a gene or activity of ANKs1a protein is affected. Such candidate materials include, but are not limited to, chemicals, peptides, and natural extracts. The candidate substance analyzed by the screening method of the present invention may be a single compound or a mixture of compounds and may be obtained from a library of synthetic or natural compounds.

The step of measuring the expression or activity of ANKs1a protein in the method for screening a substance for the preventive or therapeutic treatment of cancer according to the present invention comprises measuring the expression level or activity of ANKs1a protein by measuring the amount of ANKs1a gene expression, the amount of ANKs1a protein, the other protein having the action of ANKs1a protein, , A complex of an ANKs1a protein with another protein, and a complex of another protein under the action of an ANKs1a protein, but the present invention is not limited thereto. Other proteins that interact with or form complexes with the ANKs1a protein may be EphA2, ErbB2, or a complex thereof. For example, it is possible to measure the amount of mRNA expression of ANKs1a (more preferably, expression of an ANK local gene), quantify the amount of ANKs1a protein, quantify the amount of EphA2 protein on the cell surface before and after the candidate substance treatment, EphA2 protein can be quantitated, or the amount of ErbB / EphA2 complex can be quantified.

In the method for screening a substance for preventing or treating cancer according to the present invention, the expression or activity of the ANKs1a protein can be measured by a method commonly used in the art, and a reverse transcriptase-polymerase chain reaction reaction, real time-polymerase chain reaction, Western blot, Northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion (immunoprecipitation assay), but the present invention is not limited thereto.

In the present invention, the step (b) may further comprise the step of selecting a candidate substance that decreases the expression or activity of the ANKs1a protein among the candidate substances as a result of the measurement, wherein the activity of the ANKs1a gene or the activity of the ANKs1a protein is lowered Downregulation may be measured to be a substance for prevention or treatment of cancer.

The screening method of the present invention can be carried out in various ways, and can be carried out in a high throughput manner according to various binding assays known in the art. In the screening method of the present invention, the candidate substance or ANKs1a protein may be labeled with a detectable label. For example, the detectable label may be a chemical label (e.g., biotin), an enzyme label (such as horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase,? -Galactosidase, Fluorocetin, FITC (fluorescein isothiocyanate), rhodamine 6G, rhodamine B, TAMRA (6), and the like), radioactive labels (e.g., C14, I125, P32 and S35) (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl and FAM), emission labeling, chemiluminescent labeling, A label, a fluorescence resonance energy transfer (FRET) label or a metal label (e.g., gold and silver). When a detectable marker-labeled ANKs1a protein or candidate substance is used, whether or not a bond between the ANKs1a protein and the candidate substance is detected can be detected by detecting a signal from the label. For example, when alkaline phosphatase is used as a label, it is possible to use bromochloroindoleyl phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate ) And enhanced chemifluorescence (ECF). When horseradish peroxidase is used as a label, it is preferable to use chlorinaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorpine benzyl ether, luminol, HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2-Azine-di [3-ethylbenzthiazoline sulfonate ]), o-phenylenediamine (OPD) and substrates such as naphthol / pyronin. Alternatively, the binding of the candidate substance to the ANKs1a protein may be analyzed without labeling the interactants. For example, a microphysiometer can be used to analyze whether a candidate substance binds ANKs1a protein. The microphysiometer is an analytical tool that uses a light-addressable potentiometric sensor (LAPS) to measure the rate at which a cell acidifies its environment. Changes in the rate of acidification can be used as an indicator of the association between the candidate substance and the ANKs1a protein (McConnell et al., Science 257: 19061912 (1992)).

The ability of the candidate substance to bind to the ANKs1a protein can be analyzed using real-time bimolecular interaction assay (Szabo et al., Curr. Opin. Struct. Biol. 5: 699-705 (1995)). BIA is a technique for analyzing specific interactions in real time and can be performed without the labeling of interactants (e.g., BIAcore ™). Changes in surface plasmon resonance (SPR) can be used as indicators for real-time reactions between molecules.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

1. Experimental Method

(1) Cell culture

CT26 cell lines were grown in Dulbecco's modified MEM medium (DMEM) containing 10% FBS. Primary tumor cell (PMTC) was cultured from Anks1a ^+/- MMTV-Neu rats. First, cancer tissues were separated from rats, washed with PBS, and kneaded with a knife. The finely ground cancer tissue was immersed in a collagenase solution (0.2% trypsin, 0.2% collagenase A, 5% FBS, and 5 μg / ml gentamicin, diluted in DMEM / F12 medium) in a 50 ml tube for 2 hours Gt; 37 C < / RTI > After centrifugation at 1,500 rpm for 10 minutes, the supernatant was discarded and the pellet was mixed well with 4 ml of DMEM / F12 containing 2 U / ml of DNase and shaken slowly at room temperature for 5 minutes. After that, 6 ml of DMEM / F12 was further added, and centrifugation was performed at 1,500 rpm for 10 minutes to remove the supernatant. Finally, the supernatant was removed and the pellet was resuspended in growth media (1000 x ITS, 5 μg / ml epidermal growth factor (EGF), 5% fetal bovine serum (FBS), 500 μg / ml gentamycin, 10% Diluted in the medium) was added, and the mixture was cultured on a plate.

CT26 or PMTC cultured for colony formation analysis was placed in media containing lentivirus for 3 days. Before analysis, 2X DMEM containing 5% fetal bovine serum was mixed with 1: 1 in 1.5% agarose and placed on a 24-well plate. This was called basal agarose, and after it was completely settled, the cells infected with lentivirus were separated from the plate and mixed with serum-free DMEM and centrifuged. The supernatant was removed and the cells were plated on top of a firm agarose mix with top agarose mixed with 2: 1 DMEM containing 5% FBS and 1: 1 1% agarose. After incubation for 3 weeks in an incubator, photographs were taken under a microscope and the size of each colony was measured using Image J.

(2) Fluorescence staining

CT26 or PMTC infected with lentivirus are cultured on a cover slip. Anti-human IgG was mixed 1: 1 with 2 μg / ml of ephrinA5-Fc, pre-clustered on ice for 1 hour, and mixed with serum-free DMEM. After 1 hour at 4 < 0 > C, cells were washed three times with phosphate buffered saline (PBS). The cells were fixed on ice for 30 minutes with a fixed solution containing 4% paraformaldehyde, 2% sucrose and 3% bovine serum albumin (BSA). After washing three times with PBS, 5% horse serum, 0.1% Triton X-100, and 3% BSA were added and blocked for 30 minutes at room temperature. Then, goat anti-human IgG with FITC or TRITC was added to 3% BSA solution and stained at room temperature for 2 hours. This was photographed with a fluorescence microscope and the intensity of fluorescence was quantified using Image J.

Cell surface ErbB2 staining was performed by fixing cells on the coverslip and blocking, followed by overnight incubation at 4 ° C in an anti-ErbB2 antibody in 3% BSA solution. The next day, the cells were washed with PBS, blocked again, and stained with TRITC-rabbit anti-mouse IgG. This was photographed with a fluorescence microscope and the intensity of fluorescence was quantified using Image J.

(3) In vitro budding assay

HEK293T cells were grown on a 100 mm plate, and each gene was transfected and expressed. After 48 hours, the cells are washed with PBS, treated with trypsin, and dropped from the plate. Then, 10 ml of B88-0 (20 mM HEPES (pH 7.2), 250 mM sorbitol, 150 mM KOAc) buffer was added, and 10 μg / ml of soybean trypsin inhibitor was added thereto and centrifuged. Then, the supernatant was removed, and 40 μg / ml of digitonin was added to 10 ml of B88-0 buffer, and the mixture was placed on ice for 5 minutes, and centrifuged to collect the cells. The cells thus obtained were used to make vesicles as a donor membrane. Mouse liver cytosol, ATP regenerating system (40 nM creatinine phosphate, 0.2 mg / ml creatine phosphokinase, 1 mM ATP) and 0.2 mM GTP were added to the donor membrane at 30 ° C for 1 hour. Then, the donor membrane was removed by centrifugation at 15,000 rpm for 15 minutes, and the supernatant was centrifuged at 32,000 rpm for 114 minutes to separate the vesicles. This was dissolved in a solubilization buffer (10 mM Tris-HCl (pH 7.6), 100 mM sodium chloride, and 1% Triton X-100 (containing phosphatase inhibitor)) and immunoblotted on SDS-PAGE gel.

2. Experimental results

(1) Expression of ANKs1a and the relationship between EphA2

The expression of Anks1a and EphA2 were determined using CT26, a cell line derived from mouse colorectal cancer. The amount of Anks1a in the cells was reduced using shRNA and confirmed by Western blotting (Fig. IA). Herein, the sequence of the shRNA-17 is the nucleotide sequence shown in SEQ ID NO: 1 as [(CCGGCGTCCCTTTCAAGATTGGTTTCTCGAGAAACCAATCTTGAAAGGGACGTTTTTG)]. 3 'UTR region] and the sequence of shRNA-21 is [(CCGGCCAGATAGTACGTCTGCTCATCTCGAGATGAGCAGACGTACTATCTGGTTTTTG) as the nucleotide sequence shown in SEQ ID NO: 2; CDS region].

As a result, it was confirmed that the decrease of the amount of Anks1a did not change the amount of EphA2 in the cell (FIG. 1A, second row), but the amount of EphA2 located on the cell surface was decreased (FIG.

In addition, CT26 cell line treated with ANKs1a specific shRNA was injected into Balb / c mice to confirm the degree of cancer formation. As a result of the experiment, it was confirmed that when EphA2 on the cell surface was decreased by Anks1a, the cancer formation ability of cells was inhibited (FIG. 1d). Inhibition of this cancer-forming ability could be confirmed once again through analysis of cell-based colony formation (Figs. 1e and 1f); Generally, cancer cells can survive extreme conditions and maintain their proliferation. Thus, it can be confirmed whether or not the cells form cancer cell populations on the agarose and have the characteristics of cancer cells. The decrease in EphA2 on the cell surface was confirmed by Western blotting (Fig. 1a, third, fourth line) that decreased the Erk activity and led to a decrease in the cancer-forming ability of these cells.

(2) EphA2 cell membrane expression and cancer formation by ANKs1a

MMTV-Neu (ErbB2) rats were induced to express the ErbB2 gene continuously and intensely in the breast by the MMTV promoter, and after 8 months, the incidence of breast cancer formation was compared when the amount of Anks1a was decreased.

As a result of the experiment, it was confirmed that when the expression level of Anks1a was half or completely decreased, the ability of the rat to form breast cancer was decreased dependently (Fig. 2a). When the cells were cultured from a cancer tissue of a normal breast cancer cell line and Anks1a expression of the cell was decreased using shRNA, a decrease in cancer formation ability was confirmed again by colony formation analysis (FIGS. 2B and 2C). In addition, it was confirmed that the suppression of breast cancer formation was caused by the decrease of EphA2 on the cell surface when Anks1a was decreased, and it was confirmed that the cell surface expression of ErbB2 was decreased (Figs. 2d and 2e).

(3) Cell surface migration of EphA2 and ErbB2 by ANKs1a

We confirmed that Anks1a affects the migration of EphA2 and ErbB2 to the cell surface and identified EphA2 and ErbB2 present in the vesicle that migrates from the endoplasmic reticulum to the Golgi complex, the first step toward cell surface migration. The well known experimental method, budding assay, showed that the migration of EphA2 to the cell surface was effective when Anks1a was present (FIG. 3b). Surprisingly, it was also found that Anks1a and EphA2 are required together for cell migration of ErbB2 (Fig. 3a).

In conclusion, intracellular expression of ErbB2 is more stable when EphA2 is present, and the amount of ErbB2 / EphA2 complex present in the cell membrane is increased due to increased migration to the cell surface by Anks1a, And the cancer formation was promoted.

Therefore, if Anks1a-specific inhibitor is used to counteract the function of Anks1a, the amount of ErbB2 / EphA2 on the cell surface will be reduced to inhibit breast cancer. In particular, the ANK region involved in the interaction between ANKs1a and EphA2 If you develop an inhibitor, it is expected that it will be effective as cancer, especially breast cancer treatment.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry Academic Cooperation Foundation of Sookmyung Women's University <120> Composition for prevention inhibitors for expression or activity of ANKs1a, and screening method for <130> PN1509-270 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA-17 <400> 1 ccggcgtccc tttcaagatt ggtttctcga gaaaccaatc ttgaaaggga cgtttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA-21 <400> 2 ccggccagat agtacgtctg ctcatctcga gatgagcaga cgtactatct ggtttttg 58 <210> 3 <211> 3405 <212> PRT <213> Artificial Sequence <220> <223> ANKs1a cDNA seq <400> 3 Ala Thr Gly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Gly 1 5 10 15 Ala Gly Cys Thr Gly Cys Thr Gly Gly Ala Gly Gly Cys Gly Gly Cys 20 25 30 Cys Cys Gly Cys Ala Cys Cys Gly Gly Gly Cys Ala Cys Cys Thr Cys 35 40 45 Cys Cys Gly Gly Cys Gly Gly Thr Gly Gly Ala Gly Ala Ala Gly Cys 50 55 60 Thr Gly Cys Thr Gly Thr Cys Cys Gly Gly Gly Aly Ala Gly Cys Gly 65 70 75 80 Gly Cys Thr Cys Thr Cys Cys Thr Cys Ala Gly Gly Cys Thr Thr Thr 85 90 95 Gly Gly Gly Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly 100 105 110 Gly Thr Gly Gly Cys Thr Cys Thr Gly Gly Gly Gly Gly Cys Gly Gly 115 120 125 Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Ala Gly Cys Gly Gly Cys 130 135 140 Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Gly Gly Cys Cys 145 150 155 160 Thr Cys Gly Gly Cys Thr Cys Thr Thr Cys Cys Ala Gly Cys Cys Ala 165 170 175 Cys Cys Cys Cys Cys Thr Cys Thr Cys Cys Ala Gly Thr Cys Thr Gly 180 185 190 Cys Thr Cys Ala Gly Cys Ala Thr Gly Thr Gly Gly Ala Gly Ala Gly 195 200 205 Gly Gly Cys Cys Ala Ala Thr Gly Thr Gly Ala Ala Cys Thr Gly 210 215 220 Thr Gly Thr Thr Gly Ala Cys Ala Gly Cys Ala Cys Thr Gly Gly Cys 225 230 235 240 Thr Ala Cys Ala Cys Ala Cys Cys Cys Cys Thr Gly Cys Ala Cys Cys 245 250 255 Ala Thr Gly Cys Thr Gly Cys Thr Thr Thr Gly Ala Ala Thr Gly Gly 260 265 270 Cys Cys Ala Thr Ala Ala Gly Gly Ala Thr Gly Thr Gly Gly Thr Cys 275 280 285 Gly Ala Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly 290 295 300 Ala Cys Gly Ala Thr Gly Cys Gly Cys Thr Gly Ala Cys Cys Ala Ala 305 310 315 320 Cys Gly Thr Gly Gly Cys Thr Gly Ala Cys Thr Cys Ala Ala Ala Ala 325 330 335 Gly Gly Cys Thr Gly Cys Thr Ala Cys Cys Cys Thr Cys Thr Gly Cys 340 345 350 Ala Thr Thr Thr Gly Gly Cys Ala Gly Cys Cys Thr Gly Gly Ala Ala 355 360 365 Ala Gly Aly Gly Aly Gly Aly Thr Gly Cys Cys Cys Aly Gly Aly Thr Ala 370 375 380 Gly Thr Gly Cys Gly Gly Thr Thr Gly Cys Thr Cys Ala Thr Cys Cys 385 390 395 400 Ala Thr Cys Ala Ala Gly Gly Gly Cys Cys Thr Thr Cys Ala Cys Ala 405 410 415 Cys Ala Cys Cys Ala Gly Ala Gly Thr Cys Ala Ala Thr Gly Ala Ala 420 425 430 Cys Ala Gly Ala Ala Cys Ala Ala Thr Gly Ala Cys Ala Ala Cys Gly 435 440 445 Ala Gly Ala Cys Ala Gly Cys Cys Cys A Thr Gly Cys Ala A Thr Thr Gly 450 455 460 Thr Gly Cys Ala Gly Cys Gly Cys Ala Gly Thr Ala Thr Gly Gly Cys 465 470 475 480 Cys Ala Cys Ala Cys Ala Gly Ala Gly Gly Thr Gly Gly Thr Gly Ala 485 490 495 Ala Gly Gly Thr Gly Cys Thr Cys Thr Thr Ala Gly Ala Gly Gly Ala 500 505 510 Gly Cys Thr Gly Ala Cys Gly Gly Ala Cys Cys Cys Cys Ala Cys Cys 515 520 525 Ala Thr Gly Cys Gly Cys Ala Ala Cyr Ala Cyr Ala Ala Thr 530 535 540 Thr Cys Gly Ala Gly Ala Cys Cys Cys Cys Thr Thr Thr Gly Gly Ala 545 550 555 560 Cys Cys Thr Gly Gly Cys Ala Gly Cys Ala Cys Thr Gly Thr Ala Cys 565 570 575 Gly Gly Gly Cys Gly Aly Cys Thr Gly Gly Ala Gly Gly Thr Gly Gly 580 585 590 Thr Gly Ala Ala Ala Thr Gly Cys Thr Cys Cys Thr Thr Ala Ala 595 600 605 Thr Gly Cys Ala Cys Ala Cys Cys Cys Cys Ays Ala Cys Cys Thr Cys 610 615 620 Cys Thr Gly Ala Gly Cys Thr Gly Cys Ala Ala Cys Ala Cys Thr Ala 625 630 635 640 Ala Gly Ala Ala Gly Cys Ala Cys Ala Cys Cys Cys Cys Thr Cys Thr 645 650 655 Gly Cys Ala Cys Thr Thr Gly Gly Cys Ala Gly Cys Ala Ala Gly Gly 660 665 670 Ala Ala Thr Gly Cys Cys Cys Cys Gly 675 680 685 Thr Gly Gly Thr Cys Cys Ala Gly Gly Thr Cys Cys Thr Cys Cys Thr 690 695 700 Cys Gly Ala Thr Gly Cys Thr Gly Gly Cys Ala Thr Gly Gly Ala Cys 705 710 715 720 Ala Gly Cys Ala Ala Cys Thr Ala Cys Cys Ala Gly Ala Cys Gly Gly 725 730 735 Ala Gly Ala Thr Gly Gly Gly Cys Ala Gly Thr Gly Cys Thr Thr Thr 740 745 750 Gly Cys Ala Thr Gly Ala Gly Gly Cys Thr Gly Cys Thr Thr Thr Gly 755 760 765 Thr Thr Thr Gly Gly Cys Ala Ala Gly Aly Cys Cys Gly Ala Thr Gly 770 775 780 Thr Gly Gly Thr Gly Cys Ala Ala Ala Thr Cys Cys Thr Gly Cys Thr 785 790 795 800 Gly Gly Cys Thr Gly Cys Ala Gly Gly Ala Ala Cys Thr Gly Ala Cys 805 810 815 Gly Thr Cys Ala Ala Cys Ala Thr Ala Ala Ala Ala Gly Ala Thr Ala 820 825 830 Ala Cys Cys Ala Thr Gly Aly Cys Thr Gly Aly Cys Thr Gly Cys 835 840 845 Cys Cys Thr Ala Gly Ala Cys Ala Cys Thr Gly Thr Thr Cys Gly Gly 850 855 860 Gly Ala Ala Cys Thr Gly Cys Cys Thr Thr Cys Thr Cys Ala Ala Ala 865 870 875 880 Ala Gly Ala Gly Cys Ays Aly Gly Cys Ala Ala Ala Thr Ala Gly Cys 885 890 895 Ala Gly Cys Ala Thr Thr Ala Ala Thr Thr Gly Ala Ala Gly Ala Thr 900 905 910 Cys Ala Cys Ala Ala Ala Cyr Thr Gly 915 920 925 Gly Ala Ala Gly Thr Ala Cys Ala Ala Ala Aly Gly Ala Ala Gly Thr 930 935 940 Ala Gly Ala Thr Ala Ala Ala Ala Cys Cys Cys Cys Cys Cys Cys Cys Ala 945 950 955 960 Cys Cys Cys Cys Ala Gly Cys Cys Ala Cys Cys Thr Cys Thr Cys Ala 965 970 975 Thr Cys Thr Cys Cys Ala Gly Thr Ala Thr Gly Gly Ala Cys Thr Cys 980 985 990 Cys Ala Thr Ala Thr Cys Ala Cys Ala Gly Ala Ala Gly Thr Cys Thr 995 1000 1005 Cys Ala Gly Gly Aly Gly Aly Cly Gly Aly Gly Aly 1010 1015 1020 Ala Ala Gly Cys Ala Aly Cyr Thr Gly Ala Cys Thr Gly Ala Ala Cys Thr 1025 1030 1035 1040 Gly Ala Thr Thr Ala Thr Ala Gly Ala Thr Thr Thr Thr Gly Ala Thr 1045 1050 1055 Gly Cys Ala Ala Ala Ala Gly 1060 1065 1070 Ala Gly Gly Gly Thr Cys Cys Cys Thr Ala Cys Gly Ala Ala Gly Cys 1075 1080 1085 Thr Cys Thr Gly Thr Ala Thr Ala Ala Thr Gly Cys Cys Ala Thr Cys 1090 1095 1100 Thr Cys Cys Thr Gly Cys Cys Ala Thr Thr Cys Gly Thr Thr Gly Gly 1105 1110 1115 1120 Ala Cys Ala Gly Cys Ala Thr Gly Gly Cys Cys Ala Gly Cys Gly Gly 1125 1130 1135 Gly Cys Gly Ala Thr Cys Ala Thr Cys Thr Gly Ala Cys Cys Ala Ala 1140 1145 1150 Gly Ala Cys Thr Cys Cys Ala Cys Gly Ala Ala Cys Ala Ala Gly Gly 1155 1160 1165 Ala Gly Cys Aly Gly Cly Aly Gly Cly Aly Gly Cly Aly Gly Gly 1170 1175 1180 Ala Gly Thr Gly Ala Ala Cys Cys Thr Gly Cys Thr Gly Gly Ala 1185 1190 1195 1200 Gly Thr Gly Gly Aly Gly Aly Aly Aly Cys 1205 1210 1215 Gly Thr Cys Cys Ala Cys Cys Ala Cys Cys Thr Cys Cys Ala Gly Cys 1220 1225 1230 Ala Ala Ala Gly Cys Cys Ala Cys Cys Cys Cys Cys Cys Gly Ala Thr 1235 1240 1245 Gly Ala Gly Ala Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly 1250 1255 1260 Ala Cys Ala Thr Ala Gly Ala Thr Ala Ala Gly Ala Ala Gly Thr Ala 1265 1270 1275 1280 Thr Thr Thr Cys Cys Cys Thr Thr Gly Ala Cys Ala Gly Cys Thr 1285 1290 1295 Thr Cys Thr Gly Aly Gly Gly Thr Thr Cys Thr Gly Thr Cys Cys Ala 1300 1305 1310 Thr Gly Ala Gly Ala Cys Cys Thr Ala Gly Gly Ala Thr Thr Cys Ala 1315 1320 1325 Thr Gly Gly Gly Aly Gly Thr Gly Cys Ala Gly Cys Cys Cys Gly Gly 1330 1335 1340 Gly Ala Gly Aly Gly Aly Gly Aly Cys Gly Aly Aly Cys Aly Cys Cys 1345 1350 1355 1360 Cys Thr Thr Ala Thr Gly Ala Ala Cys Thr Gly Thr Thr Gly Thr Thr 1365 1370 1375 Ala Ala Cys Ala Aly Gly Aly Aly Gly Aly Gly Aly Cly Aly Aly Aly Gly 1380 1385 1390 Ala Ala Ala Gly Thr Gly Gly Thr Gly Thr Thr Gly Gly Thr Gly Gly 1395 1400 1405 Ala Thr Gly Aly Ala Ala Ala Ala Aly Aly Aly Aly Aly Aly Aly Aly Gly Ala 1410 1415 1420 Cys Cys Ala Cys Ala Gly Gly Cys Gly Gly Ala Gly Cys Ala Gly Cys 1425 1430 1435 1440 Ala Gly Cys Ala Gly Cys Cys Gly Gly Ala Gly Cys Cys Ala Gly Gly 1445 1450 1455 Ala Cys Thr Cys Thr Gly Cys Gly Gly Ala Gly Gly Gly Gly Cys Ala 1460 1465 1470 Gly Gly Ala Cys Gly Gly Gly Cys Ala Gly Gly Thr Cys Cys Cys Ala 1475 1480 1485 Gly Ala Gly Cys Ala Gly Thr Thr Cys Thr Cys Ala Gly Gly Cys Cys 1490 1495 1500 Thr Cys Cys Thr Cys Cys Ala Cys Gly Gly Cys Thr Cys Cys Thr Cys 1505 1510 1515 1520 Cys Cys Cys Gly Gly Thr Gly Thr Gly Cys Gly Aly Gly Gly Thr Gly 1525 1530 1535 Gly Gly Gly Cys Ala Gly Gly Ala Cys Cys Cys Thr Thr Thr Cys Cys 1540 1545 1550 Ala Gly Cys Thr Gly Cys Thr Cys Thr Gly Thr Ala Cys Cys Gly Cys 1555 1560 1565 Thr Gly Gys Cys Cys Ala Gly Ala Gly Cys Cys Ala Thr Cys Cys Ala 1570 1575 1580 Gly Ala Cys Gly Gly Gly Thr Cys Cys Cys Cys Cys Cys Ala Gly Cys 1585 1590 1595 1600 Ala Gly Gly Gly Cys Gly Cys Cys Thr Gly Cys Cys Ala Cys Ala Ala 1605 1610 1615 Gly Gly Cys Cys Ala Gly Cys Ala Thr Gly Cys Ala Gly Cys Thr Gly 1620 1625 1630 Gly Aly Gly Gly Aly Gly Aly Cys Gly Gly Gly Gly Thr Gly Thr Gly Cys 1635 1640 1645 Ala Thr Gly Cys Thr Cys Cys Thr Gly Aly Gly Cys Cys Thr Cys 1650 1655 1660 Cys Cys Ala Gly Cys Cys Cys Ala Gly Thr Gly Cys Cys Cys Thr Gly 1665 1670 1675 1680 Gly Aly Cys Cys Aly Gly Aly Gly Cys Aly Aly Gly Aly Gly Aly Gly 1685 1690 1695 Thr Gly Gly Gly Cys Thr Ala Cys Cys Thr Cys Ala Cys Ala Gly Gly 1700 1705 1710 Cys Cys Thr Gly Cys Cys Cys Ala Cys Cys Ala Cys Cys Ala Ala Cys 1715 1720 1725 Ala Gly Cys Cys Cys Gys Cys Thr Cys Gly Cys Ala Cys Cys Cys Thr Gly 1730 1735 1740 Ala Ala Ala Cys Thr Thr Thr Gly Ala Cys Thr Cys Ala Cys Ala Cys 1745 1750 1755 1760 Ala Gly Cys Ala Thr Cys Thr Cys Cys Gly Cys Ala Cys Cys Cys Thr 1765 1770 1775 Gly Gly Thr Gly Gly Thr Gly Cys Thr Gly Ala Gly Gly Ala Ala Gly 1780 1785 1790 Gly Aly Gly Aly Cys Cys Gly Gly Aly Gly Thr Gly Gly Gly Gly Cys 1795 1800 1805 Cys Ala Gly Gly Ala Gly Cys Cys Gly Ala Gly Cys Gly Cys Cys Thr 1810 1815 1820 Cys Cys Cys Cys Cys Cys Cys Cys Cys Ala 1825 1830 1835 1840 Ala Ala Gly Cys Thr Gly Ala Ala Cys Thr Cys Ala Ala Ala Cys Thr 1845 1850 1855 Cys Ala Gly Cys Cys Gly Cys Ala Gly Cys Thr Thr Gly Thr Cys Cys 1860 1865 1870 Ala Ala Gly Thr Cys Thr Gly Ala Cys Thr Cys Thr Gly Ala Thr Cys 1875 1880 1885 Thr Cys Cys Thr Gly Ala Cys Cys Thr Gly Cys Thr Cys Ala Cys Cys 1890 1895 1900 Cys Ala Cys Ala Gly Ala Gly Gly Ala Cys Gly Cys Thr Ala Cys Cys 1905 1910 1915 1920 Ala Thr Gly Gly Aly Gly Aly Gly Aly Gly Aly Gly Thr Gly 1925 1930 1935 Ala Gly Thr Cys Cys Thr Thr Ala Thr Cys Cys Ala Ala Cys Thr Gly 1940 1945 1950 Cys Ala Gly Cys Ala Thr Thr Gly Aly Ala Ala 1955 1960 1965 Ala Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly 1970 1975 1980 Cys Cys Thr Cys Cys Thr Thr Cys Gly Cys Cys Thr Cys Gly Gly Ala 1985 1990 1995 2000 Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly 2005 2010 2015 Ala Ala Ala Ala Thr Cys Ala Thr Gly Ala Gly Thr Thr Cys Thr Ala 2020 2025 2030 Thr Thr Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Thr Gly Aly 2035 2040 2045 Cys Thr Thr Thr Thr Cys Thr Cys Ala Gly Aly Ala Cys Gly Gly 2050 2055 2060 Cys Ala Gly Ala Aly Gly Aly Thr Cys Aly Gly Aly Gly Aly Gly Thr Thr 2065 2070 2075 2080 Thr Ala Cys Gly Gly Ala Cys Gly Cys Thr Gly Gly Ala Gly Cys Ala 2085 2090 2095 Gly Aly Gly Thr Gly Thr Cly Gly Gly Gly Gly 2100 2105 2110 Cys Thr Gly Gly Aly Gly Thr Cys Gly Ala Thr Thr Gly Gly Gly Cys 2115 2120 2125 Thr Gly Cys Ala Gly Cys Ala Gly Thr Ala Thr Gly Ala Gly Ala Gly 2130 2135 2140 Cys Ala Ala Gly Thr Thr Gly Cys Thr Thr Cys Thr Gly Ala Ala Thr 2145 2150 2155 2160 Gly Gly Cys Thr Thr Thr Gly Ala Cys Gly Ala Thr Gly Thr Cys Cys 2165 2170 2175 Ala Cys Thr Thr Cys Cys Thr Gly Gly Gly Gly Thr Cys Thr Ala Ala 2180 2185 2190 Thr Gly Thr Gly Aly Thr Gly Aly Gly Aly Gly Aly Gly Cys Ala Gly 2195 2200 2205 Gly Ala Cys Cys Thr Gly Cys Gly Gly Gly Ala Cys Ala Thr Cys Gly 2210 2215 2220 Gly Cys Ala Thr Cys Ala Gly Cys Gly Ala Cys Cys Cys Ala Cys Ala 2225 2230 2235 2240 Gly Cys Ala Cys Cys Gly Gly Cys Gly Gly Ala Gly Cys Thr Gly 2245 2250 2255 Cys Thr Cys Cys Ala Gly Gly Cys Gly Gly Cys Ala Cys Gly Cys Thr 2260 2265 2270 Cys Cys Cys Thr Ala Cys Cys Cys Ala Ala Gly Gly Thr Gly Ala Ala 2275 2280 2285 Gly Gly Cys Thr Cys Thr Gly Gly Gly Thr Thr Ala Thr Gly Ala Cys 2290 2295 2300 Gly Gly Gly Ala Ala Cys Ala Gly Cys Cys Cys Cys Cys Cys Cys Thr Ala 2305 2310 2315 2320 Gly Cys Gly Thr Gly Cys Cys Cys Thr Cys Cys Thr Gly Gly Cys Thr 2325 2330 2335 Gly Gly Ala Cys Thr Cys Cys Cys Thr Gly Gly Gly Gly Cys Thr Gly 2340 2345 2350 Cys Ala Gly Gly Ala Cys Thr Ala Cys Gly Thr Cys Cys Ala Thr Thr 2355 2360 2365 Cys Cys Thr Thr Cys Thr Thr Gly Thr Cys Ala Ala Gly Thr Gly Gly 2370 2375 2380 Thr Thr Ala Cys Ala Gly Cys Thr Cys Cys Ala Thr Thr Gly Ala Cys 2385 2390 2395 2400 Ala Cys Cys Cys Thr Cyr Thr Gly 2405 2410 2415 Gly Gly Gly Aly Gly Cys Thr Ala Gly Ala Gly Cys Thr Cys Gly Thr 2420 2425 2430 Cys Ala Ala Thr Gly Thr Cys Cys Thr Gly Ala Ala Gly Gly Thr Cys 2435 2440 2445 Cys Ala Gly Cys Thr Gly Cys Thr Cys Gly Gly Cys Cys Ala Thr Cys 2450 2455 2460 Gly Cys Ala Ala Gly Cys Gly Cys Ala Thr Cys Ala Thr Cys Gly Cys 2465 2470 2475 2480 Cys Thr Cys Cys Cys Thr Cys Gly Cys Ala Gly Ala Cys Ala Gly Ala 2485 2490 2495 Cys Cys Gly Thr Ala Cys Gly Aly Gly Gly Ala Gly Cys Cys Gly Cys 2500 2505 2510 Cys Cys Cys Ala Gly Ala Ala Gly Cys Cys Cys Cys Cys Cys Ala Gly 2515 2520 2525 Ala Thr Thr Cys Thr Cys Cys Cys Ala Gly Cys Thr Gly Ala Gly Gly 2530 2535 2540 Thr Gly Cys Cys Ala Ala Gly Ala Thr Thr Thr Gly Cys Thr Cys Thr 2545 2550 2555 2560 Cys Cys Cys Ala Gly Ala Cys Gly Thr Cys Ala Thr Cys Cys Cys Cys 2565 2570 2575 Ala Cys Thr Gly Ala Gly Thr Cys Ala Gly Ala Ala Thr Gly Ala Thr 2580 2585 2590 Thr Cys Cys Thr Gly Cys Ala Cys Thr Gly Gly Gly Cys Gly Gly Thr 2595 2600 2605 Cys Gly Gly Cys Ala Gly Ala Thr Cys Thr Gly Cys Thr Gly Cys Thr 2610 2615 2620 Gly Cys Cys Thr Cys Cys Ala Gly Gly Gly Gly Aly Cys Ala Cys Ala 2625 2630 2635 2640 Gly Gly Cys Ala Gly Gly Ala Gly Gly Cys Gly Cys Cys Ala Thr Gly 2645 2650 2655 Ala Cys Ala Gly Thr Cys Thr Cys Cys Ala Thr Gly Ala Cys Cys Cys 2660 2665 2670 Thr Gly Cys Gly Gly Cys Ala Cys Cys Cys Thr Cys Cys Cys Gly Ala 2675 2680 2685 Gly Cys Gly Gly Ala Gly Cys Gly Cys Thr Thr Cys Ala Gly Gly Ala 2690 2695 2700 Thr Cys Cys Ala Gly Gly Ala Gly Gly Ala Gly Cys Ala Cys Cys Gly 2705 2710 2715 2720 Thr Gly Ala Gly Gly Cys Cys Ala Ala Gly Cys Thr Gly Ala Cys Cys 2725 2730 2735 Cys Thr Gly Cys Gly Gly Cys Cys Cys Cys Cys Cys Gly Ala Gly Cys Cys 2740 2745 2750 Thr Gly Gys Cys Ala Gys Cys Cys Cys Cys Cys Thr Ala Cys Gly Cys 2755 2760 2765 Cys Cys Cys Ala Gly Thr Gly Cys Ala Gly Ala Gly Thr Thr Gly Gly 2770 2775 2780 Cys Ala Ala Cys Ala Cys Cys Ala Gly Cys Cys Ala Gly Ala Gly Ala 2785 2790 2795 2800 Ala Ala Cys Thr Cys Ala Thr Cys Thr Thr Cys Gly Ala Gly Thr Cys 2805 2810 2815 Cys Thr Gly Thr Gly Gly Thr Thr Ala Thr Gly Ala Ala Gly Cys Cys 2820 2825 2830 Ala Ala Thr Thr Ala Thr Cys Thr Gly Gly Gly Cys Thr Cys Cys Ala 2835 2840 2845 Thr Gly Cys Thr Gly Ala Thr Cys Ala Ala Ala Gly Ala Thr Cys Thr 2850 2855 2860 Gly Cys Gly Ala Gly Gly Gly Ala Cys Ala Gly Ala Ala Thr Cys Cys 2865 2870 2875 2880 Ala Cys Gly Cys Ala Ala Gly Ala Cys Gly Cys Cys Thr Gly Thr Gly 2885 2890 2895 Cys Cys Ala Ala Gla Ala Thr Gly Cys Gly Aly Ala Ala Thr Cys 2900 2905 2910 Thr Ala Cys Gly Aly Gly Aly Aly Gly Aly Cly Aly Cly Aly Aly Gly 2915 2920 2925 Ala Ala Gly Ala Thr Cys Cys Cys Cys Ala Cys Cys Ala Thr Cys Ala 2930 2935 2940 Thr Cys Cys Thr Gly Thr Cys Cys Ala Thr Cys Ala Cys Ala Thr Ala 2945 2950 2955 2960 Cys Ala Ala Gly Gly Thr Gly Thr Cys Ala Gly Thr Thr Cys 2965 2970 2975 Ala Thr Cys Gly Ala Thr Gly Cys Cys Thr Cys Cys Ala Ala Cys Ala 2980 2985 2990 Ala Gly Ala Ala Cys Aly Thr Cys Ala Thr Thr Gly Cys Ala Gly Ala 2995 3000 3005 Gly Cys Ala Cys Gly Ala Gly Ala Cys 3010 3015 3020 Ala Thr Thr Thr Cys Cys Thr Gly Thr Gly Cys Gly Gly Cys Cys Cys 3025 3030 3035 3040 Ala Gly Gly Aly Cys Cys Cys Gly Aly Gly Aly Gly Aly Cys Cys Thr 3045 3050 3055 Cys Thr Gly Thr Ala Cys Cys Thr Thr Thr Gly Cys Cys Thr Ala Cys 3060 3065 3070 Ala Thr Cys Ala Cys Cys Ala Ala Gly Aly Cys Cys Thr Gly Cys 3075 3080 3085 Ala Gly Ala Cys Cys Ala Gly Cys Cys Ala Cys Cys Ala Cys Thr Ala 3090 3095 3100 Thr Thr Gly Cys Cys Ala Thr Gly Thr Gly Thr Thr Cys Ala Gly Cys 3105 3110 3115 3120 Ala Cys Cys Gly Thr Gly Gly Ala Thr Gly Thr Gly Ala Ala Cys Cys 3125 3130 3135 Thr Gly Ala Cys Cys Thr Ala Cys Gly Ala Gly Ala Thr Cys Ala Thr 3140 3145 3150 Cys Cys Thr Gly Ala Cys Gly Cys Thr Gly Gly Gly Gly Cys Ala Gly 3155 3160 3165 Gly Cys Cys Thr Thr Cys Gly Ala Ala Gly Thr Gly Gly Cys Cys Thr 3170 3175 3180 Ala Thr Cys Ala Gly Thr Thr Gly Gly Cys Cys Cys Thr Gly Cys Ala 3185 3190 3195 3200 Gly Gly Cys Cys Cys Ala Gly Ala Gly Thr Cys Cys Ala Gly Gly 3205 3210 3215 Gly Cys Gly Ala Cys Gly Gly Gly Cys Gly Cys Cys Thr Cys Thr Gly 3220 3225 3230 Cys Ala Gly Cys Thr Gly Ala Gly Ala Thr Gly Ala Thr Thr Gly Ala 3235 3240 3245 Ala Ala Cys Ala Ala Ala Thr Cys Thr Thr Cys Cys Ala Ala Ala 3250 3255 3260 Cys Cys Gly Gly Thr Gly Cys Cys Thr Ala Ala Gly Cys Cys Thr Cys 3265 3270 3275 3280 Gly Gly Gly Thr Cys Gly Gly Cys Gly Thr Gly Aly Gly Gly Aly 3285 3290 3295 Ala Thr Cys Cys Cys Aly Cys Aly Cys Thr Gly Aly Ala Cys Cys Ala 3300 3305 3310 Cys Cys Thr Gly Ala Thr Ala Thr Gly Gly Ala Cys Cys Ala Ala Gly 3315 3320 3325 Ala Thr Gly Cys Cys Cys Ala Ala Thr Cys Cys Cys Ala Thr Gly Cys 3330 3335 3340 Cys Ala Gly Thr Gly Thr Cys Thr Cys Cys Thr Gly Gly Gly Thr Thr 3345 3350 3355 3360 Gly Thr Gly Gly Aly Cys Cys Cys Cys Cys Cys Cys Ala Gly 3365 3370 3375 Ala Cys Thr Cys Thr Ala Ala Gly Cys Gly Aly Gly Cys Cys Thr 3380 3385 3390 Cys Ala Gly Cys Ala Cys Cys Ala Ala Cys Thr Gly Ala 3395 3400 3405 <210> 4 <211> 1134 <212> PRT <213> Artificial Sequence <220> <223> ANKs1a animoacid seq <400> 4 Met Gly Lys Glu Glu Glu Leu Leu Glu Ala Ala Arg Thr Gly His Leu 1 5 10 15 Pro Ala Val Glu Lys Leu Leu Ser Gly Lys Arg Leu Ser Ser Gly Phe 20 25 30 Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Ser Gly 35 40 45 Gly Gly Gly Gly Gly Leu Gly Ser Ser Ser His Pro Leu Ser Ser Leu 50 55 60 Leu Ser Met Trp Arg Gly Pro Asn Val Asn Cys Val Asp Ser Thr Gly 65 70 75 80 Tyr Thr Pro Leu His His Ala Ala Leu Asn Gly His Lys Asp Val Val 85 90 95 Glu Val Leu Leu Arg Asn Asp Ala Leu Thr Asn Val Ala Asp Ser Lys 100 105 110 Gly Cys Tyr Pro Leu His Leu Ala Ala Trp Lys Gly Asp Ala Gln Ile 115 120 125 Val Arg Leu Leu Ile His Gln Gly Pro Ser His Thr Arg Val Asn Glu 130 135 140 Gln Asn Asn Asp Asn Glu Thr Ala Leu His Cys Ala Ala Gln Tyr Gly 145 150 155 160 His Thr Glu Val Val Lys Val Leu Leu Glu Glu Leu Thr Asp Pro Thr 165 170 175 Met Arg Asn Asn Lys Phe Glu Thr Pro Leu Asp Leu Ala Ala Leu Tyr 180 185 190 Gly Arg Leu Glu Val Val Lys Met Leu Leu Asn Ala His Pro Asn Leu 195 200 205 Leu Ser Cys Asn Thr Lys Lys His Thr Pro Leu His Leu Ala Ala Arg 210 215 220 Asn Gly His Lys Ala Val Val Gln Val Leu Leu Asp Ala Gly Met Asp 225 230 235 240 Ser Asn Tyr Gln Thr Glu Met Gly Ser Ala Leu His Glu Ala Ala Leu 245 250 255 Phe Gly Lys Thr Asp Val Val Gln Ile Leu Leu Ala Ala Gly Thr Asp 260 265 270 Val Asn Ile Lys Asp Asn His Gly Leu Thr Ala Leu Asp Thr Val Arg 275 280 285 Glu Leu Pro Ser Gln Lys Ser Gln Gln Ile Ala Ala Leu Ile Glu Asp 290 295 300 His Met Thr Gly Lys Arg Ser Thr Lys Glu Val Asp Lys Thr Pro Pro 305 310 315 320 Pro Gln Pro Pro Leu Ile Ser Ser Met Asp Ser Ser Ser Gln Lys Ser 325 330 335 Gln Gly Asp Val Glu Lys Ala Val Thr Glu Leu Ile Ile Asp Phe Asp 340 345 350 Ala Asn Ala Glu Glu Glu Gly Pro Tyr Glu Ala Leu Tyr Asn Ala Ile 355 360 365 Ser Cys His Ser Leu Asp Ser Met Ala Ser Gly Arg Ser Ser Asp Gln 370 375 380 Asp Ser Thr Asn Lys Glu Ala Glu Ala Ala Gly Val Lys Pro Ala Gly 385 390 395 400 Val Arg Pro Arg Glu Arg Pro Pro Pro Pro Ala Lys Pro Pro Pro Asp 405 410 415 Glu Glu Glu Glu Asp His Ile Asp Lys Lys Tyr Phe Pro Leu Thr Ala 420 425 430 Ser Glu Val Leu Ser Met Arg Pro Arg Ile His Gly Ser Ala Ala Arg 435 440 445 Glu Glu Asp Glu His Pro Tyr Glu Leu Leu Leu Thr Ala Glu Thr Lys 450 455 460 Lys Val Val Leu Val Asp Gly Lys Thr Lys Asp His Arg Arg Ser Ser 465 470 475 480 Ser Ser Arg Ser Gln Asp Ser Ala Glu Gly Gln Asp Gly Gln Val Pro 485 490 495 Glu Gln Phe Ser Gly Leu Leu His Gly Ser Ser Pro Val Cys Glu Val 500 505 510 Gly Gln Asp Pro Phe Gln Leu Leu Cys Thr Ala Gly Gln Ser His Pro 515 520 525 Asp Gly Ser Pro Gln Gln Gly Ala Cys His Lys Ala Ser Met Gln Leu 530 535 540 Glu Glu Thr Gly Val His Ala Pro Gly Ala Ser Gln Pro Ser Ala Leu 545 550 555 560 Asp Gln Ser Lys Arg Val Gly Tyr Leu Thr Gly Leu Pro Thr Thr Asn 565 570 575 Ser Arg Ser His Pro Glu Thr Leu Thr His Thr Ala Ser Pro His Pro 580 585 590 Gly Gly Ala Glu Glu Gly Asp Arg Ser Gly Ala Arg Ser Ser Ala Pro 595 600 605 Pro Thr Ser Lys Pro Lys Ala Glu Leu Lys Leu Ser Arg Ser Leu Ser 610 615 620 Lys Ser Asp Ser Asp Leu Leu Thr Cys Ser Pro Thr Glu Asp Ala Thr 625 630 635 640 Met Gly Ser Ser Arg Gly Ser Leu Ser Asn Cys Ser Ile Gly Lys Lys 645 650 655 Arg Leu Glu Lys Ser Pro Ser Phe Ala Ser Glu Trp Asp Glu Ile Glu 660 665 670 Lys Ile Met Ser Ser Ile Gly Glu Gly Ile Asp Phe Ser Gln Glu Arg 675 680 685 Gln Lys Ile Ser Gly Leu Arg Thr Leu Glu Gln Ser Val Gly Glu Trp 690 695 700 Leu Glu Ser Ile Gly Leu Glu Gln Tyr Glu Ser Lys Leu Leu Leu Asn 705 710 715 720 Gly Phe Asp Asp Val His Phe Leu Gly Ser Asn Val Met Glu Glu Gln 725 730 735 Asp Leu Arg Asp Ile Gly Ile Ser Asp Pro Gln His Arg Arg Lys Leu 740 745 750 Leu Gln Ala Ala Arg Ser Leu Pro Lys Val Lys Ala Leu Gly Tyr Asp 755 760 765 Gly Asn Ser Pro Pro Ser Val Pro Ser Trp Leu Asp Ser Leu Gly Leu 770 775 780 Gln Asp Tyr Val His Ser Phe Leu Ser Ser Gly Tyr Ser Ser Ile Asp 785 790 795 800 Thr Val Lys Asn Leu Trp Glu Leu Glu Leu Val Asn Val Leu Lys Val 805 810 815 Gln Leu Leu Gly His Arg Lys Arg Ile Ale Ser Leu Ala Asp Arg 820 825 830 Pro Tyr Glu Glu Pro Pro Gln Lys Pro Pro Arg Phe Ser Gln Leu Arg 835 840 845 Cys Gln Asp Leu Leu Ser Gln Thr Ser Ser Pro Leu Ser Gln Asn Asp 850 855 860 Ser Cys Thr Gly Arg Ser Ala Asp Leu Leu Leu Pro Pro Gly Asp Thr 865 870 875 880 Gly Arg Arg Arg His His Ser Leu His Asp Pro Ala Ala Pro Ser Arg 885 890 895 Ala Glu Arg Phe Arg Ile Gln Glu Glu His Arg Glu Ala Lys Leu Thr 900 905 910 Leu Arg Pro Pro Ser Leu Ala Ala Pro Tyr Ala Pro Val Gln Ser Trp 915 920 925 Gln His Gln Pro Glu Lys Leu Ile Phe Glu Ser Cys Gly Tyr Glu Ala 930 935 940 Asn Tyr Leu Gly Ser Met Leu Ile Lys Asp Leu Arg Gly Thr Glu Ser 945 950 955 960 Thr Gln Asp Ala Cys Ala Lys Met Arg Lys Ser Thr Glu His Met Lys 965 970 975 Lys Ile Pro Thr Ile Ile Leu Ser Ile Thr Tyr Lys Gly Val Lys Phe 980 985 990 Ile Asp Ala Ser Asn Lys Asn Val Ile Ala Glu His Glu Ile Arg Asn 995 1000 1005 Ile Ser Cys Ala Gln Asp Pro Glu Asp Leu Cys Thr Phe Ala Tyr 1010 1015 1020 Ile Thr Lys Asp Leu Gln Thr Ser His His Tyr Cys His Val Phe Ser 1025 1030 1035 1040 Thr Val Asp Val Asn Leu Thr Tyr Glu Ile Ile Leu Thr Leu Gly Gln 1045 1050 1055 Ala Phe Glu Val Ala Tyr Gln Leu Ala Leu Gln Ala Gln Lys Ser Arg 1060 1065 1070 Ala Thr Gly Ala Ser Ala Glu Met Ile Glu Thr Lys Ser Ser Lys 1075 1080 1085 Pro Val Pro Lys Pro Arg Val Gly Val Arg Lys Ser Ala Leu Glu Pro 1090 1095 1100 Pro Asp Met Asp Gln Asp Ala Gln Ser His Ala Ser Val Ser Trp Val 1105 1110 1115 1120 Val Asp Pro Lys Pro Asp Ser Lys Arg Ser Leu Ser Thr Asn 1125 1130

Claims

A composition for preventing or treating cancer comprising an Anx1a protein expression or activity inhibitor as an active ingredient.

The method according to claim 1,
Wherein the ANKs1a protein expression or activity inhibitor specifically acts on the ANK (ankyrin repeat region) domain.

The method according to claim 1,
The ANKs1a protein expression inhibitor may be any one selected from the group consisting of an antisense nucleotide complementary to the mRNA of the ANKs1a gene, a short interfering RNA (siRNA), and a short hairpin RNA (shRNA) Or a pharmaceutically acceptable salt thereof.

The method of claim 3,
Wherein the short hairpin RNA of the ANKs1a gene has the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

The method according to claim 1,
Wherein the ANKs1a protein activity inhibitor is any one or more selected from the group consisting of a compound that binds complementarily to ANKs1a protein, a peptide, a peptide mimetics, an aptamer, and an antibody.

The method according to claim 1,
The cancer is selected from the group consisting of liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, brain tumor, colon cancer, bladder cancer, kidney cancer, stomach cancer, breast cancer, cervical cancer, uterine cancer, prostate cancer, pancreatic cancer, Or a pharmaceutically acceptable salt thereof.

(a) treating the candidate cell with a candidate substance;
(b) measuring the expression or activity of the ANKs1a protein in the subject cell; And
(c) selecting a candidate substance that decreases expression or activity of ANKs1a protein among the candidate substances as a result of the measurement.

8. The method of claim 7,
The step of measuring the expression or activity of the ANKs1a protein comprises measuring the amount of the ANKs1a gene expression, the amount of the ANKs1a protein, the other protein having the action of the ANKs1a protein, the interaction between the ANKs1a protein and another protein, And a complex of another protein under the action of ANKs1a protein is detected or measured.

9. The method of claim 8,
Wherein the other protein is EphA2, ErbB2 or a complex thereof.

8. The method of claim 7,
The measurement may be performed using a reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blot, northern blot, enzyme linked immunosorbent assay (ELISA) a radioimmunoassay, a radioimmunodiffusion, and an immunoprecipitation assay. The method for screening a substance for preventing or treating cancer according to claim 1,