KR20170017519A - Pharmaceutical composition for preventing or treating inflammatory bone disease comprising miR 218-2 - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating inflammatory bone diseases containing miR-218-2 as an active ingredient and, more specifically, miR-218-2 inhibits the expression of inflammatory factors which are activated by an inflammatory signal and inhibits the expression of receptor activator of nuclear factor kappa B ligand (RANKL) proteins which induce differentiation into osteoclasts. As the miR-218-2 is confirmed to inhibit inflammatory bone loss, the composition containing miR-218-2 as an active ingredient can be used as a therapeutic agent for inflammatory bone diseases and an osteoclast differentiation inhibitor. Furthermore, the degree of miR-218-2 expression of macrophages in blood can be identified, thereby being used to diagnose bone diseases.

Description

[0001] The present invention relates to a pharmaceutical composition for preventing or treating inflammatory bone diseases containing miR 218-2 as an active ingredient,

The present invention relates to a composition for preventing or treating inflammatory bone diseases, which comprises miR 218-2 as an active ingredient.

The bones support the body's soft tissue and body weight and surround the internal organs to protect the internal organs from external shocks. It is also an important part of the human body that not only supports the muscles and organs but also stores calcium and other essential minerals, such as phosphorus and magnesium, in the body. Thus, adult bones do not stop growing, but old bones are removed and replaced with new bones. The process of production and absorption is repeated continuously to maintain balance, which is called bone remodeling. Such bone reshaping is essential for restoring fine bone damage caused by growth and stress and for maintaining bone function properly.

Two types of cells are involved in bone remodeling. Healthy bones are maintained by osteoblasts forming bones and osteoclasts destroying bones. In order to differentiate and activate osteoclasts, a protein called RANKL plays an important role. RANKL binds to a receptor rank (RANK) existing on the surface of osteoclast precursor cells, and osteoclast precursor cells are differentiated into osteoclasts, resulting in bone resorption .

Thus, the absorption or destruction of old bone is accomplished by the osteoclast through the above mechanism, which is used to maintain a bodily function by releasing a small amount of calcium into the blood stream through a hole in the bone, Filling and depositing calcium and phosphorus deposits, and rebuilding the skeleton by making solid new bones.

However, when the equilibrium of bone formation and destruction is broken, various bone diseases are induced. Among them, increase of migration and differentiation of osteoclast precursor cells caused by inflammation induces excessive bone uptake, which is a cause of bone diseases .

Since excessive bone destruction caused by the inflammatory reaction causes bone diseases such as osteoporosis by causing bone loss, it is possible to prevent or treat osteopathy due to reduction of bone density by inhibiting osteoclast hyperplasia induced by inflammation reaction It is necessary to develop technology.

Korean Patent No. 10-1264014 (2013.05.07)

The present invention provides a composition comprising miR 218-2 as an active ingredient which inhibits osteoclast differentiation induced by an inflammatory reaction, as a pharmaceutical composition capable of preventing or treating inflammatory bone diseases and an osteoclast differentiation inhibitor.

The present invention is intended to provide a pharmaceutical composition for preventing or treating inflammatory bone diseases containing miR 218-2 as an active ingredient.

The present invention provides an osteoclast differentiation inhibitor containing miR 218-2 as an active ingredient.

In addition, the present invention provides a method for treating a hematopoietic cell, comprising: separating macrophages from blood; And confirming the expression level of miR 218-2 in the isolated macrophages.

According to the present invention, it has been confirmed that miR 218-2 inhibits the expression of an inflammatory factor activated by an inflammatory signal and suppresses the expression of RANK protein inducing differentiation into osteoclasts, thereby suppressing inflammatory bone loss, a composition containing miR 218-2 as an active ingredient can be used as a therapeutic agent for inflammatory bone disease and an osteoclast differentiation inhibitor and can be used for diagnosing bone diseases by confirming the expression level of miR 218-2 in macrophages in blood.

Figure 1 shows the effect of SLIT3 and miR 218-2 on the expression of inflammatory factors induced by inflammatory signals. Figure 1A shows that SLIT3 stimulates SLPS3 siRNA-transfected macrophages with LPS to induce the expression of inflammatory factors FIG. 1B shows the results of examining the effect of miR 218-2 on the expression of inflammatory factors by treating miR 218-2 inhibitor with LPS-stimulated macrophages.
FIG. 2A shows RT-PCR results of SLIT3 and ROBO1 RNA expression levels confirmed by LPS, FIG. 1B shows real-time PCR results, FIG. 1C shows SLIT3 And ROBO1 protein expression levels and expression positions.
FIG. 3 shows the results of confirming the effect of SLIT3 on osteoclast differentiation. FIG. 3A shows RT-PCR results of SLIT3 mRNA expression level by LPS treatment in SLIT3 siRNA transfected macrophages, and FIG. 3B shows SLIT3 siRNA (Tnfrsf11a) mRNA expression level by LPS treatment in the injected macrophages. FIG. 3C shows RT-PCR results of RANK (Tnfrsf11a) and Csf1r (M) in osteoclast differentiation in LPS- FIG. 3D shows RT-PCR and RT-PCR results of RANK (Tnfrsf11a) and Csf1r (M-CSF receptor) mRNA expression levels in LPS-treated macrophages.
FIG. 4 shows the results of confirming the effect of SLIT3 expression on RANKL-induced osteoclast differentiation. FIG. 4A shows the results of RANKL-treated macrophages treated with LPS or untreated, and 3 days after TRAP staining, FIG. 4B shows the results of confirming the osteoclast differentiation level by TRAP staining 3 days after treatment with SLP3 siRNA-treated macrophages with or without LPS treatment.
FIG. 5 shows the effect of LPS on signal transduction of SLIT3 regardless of SLIT3 expression. FIG. 5A shows that SLIT3 siRNA transfected macrophages were treated with LPS at a concentration of 10 ng / ml for the indicated time and treated with LPS FIG. 5B shows RT-PCR results of confirming the expression level of miR 218-2 by LPS treatment in SLIT3 siRNA-transfected macrophages.
FIG. 6 shows the results of confirming the effect of miR 218-2 on the expression of RANK. FIG. 6A shows the expression of miR 218-2 in LPS treated with 1 and 10 ng / ml of SLIT3 siRNA transfected macrophages 6B is a schematic diagram showing two regions of the RANK 3'TUR region to which miR 218-2 binds and a mutant thereof, and Fig. 6C is a schematic diagram showing the WT plasmid DNA or each mutant plasmid DNA (Mut1, Mut2 or Mut1 / Mut2) 6D is a result of RT-PCR, and FIG. 6E is a graph showing the results of the RT-PCR in the case of real-time PCR FIG. 6F shows the results of RT-PCR. FIG. 6F shows that miR 218-2 or anti-miR 218-2 was transfected into cells and stimulated with RANKL and LPS at 24 hours, The results are confirmed.

The present invention can provide a pharmaceutical composition for preventing or treating inflammatory bone diseases containing miR 218-2 as an active ingredient.

The inflammatory bone disease may be selected from the group consisting of osteoporosis, degenerative arthritis and ankylosing spondylitis, but is not limited thereto.

The miR 218-2 inhibits the expression of inflammatory factors and inhibits the expression of RANK protein to inhibit osteoclast differentiation.

As shown in FIG. 1, SILT3 and miR 218-2 are proteins activated by LPS, which is an inflammatory signal. When SILT3 is activated, expression of inflammatory factors is increased, whereas miR 218-2 And inhibited the expression of inflammatory factors activated by LPS, an inflammatory signal. In addition, miR 218-2 inhibited the expression of RANK, a receptor protein bound to RANKL protein, and inhibited the differentiation of macrophages into osteoclasts in RANKL signaling that induces osteoclast differentiation, MiR 218-2 of the invention can prevent or treat osteopathy caused by inflammatory bone loss by inhibiting osteoclast differentiation and expression of inflammatory factors that are induced expression from an inflammatory signal.

In addition, the present invention can be used as an osteoclast differentiation inhibitor containing miR 218-2 as an active ingredient.

In one embodiment of the invention, the pharmaceutical composition may comprise 0.01 to 90 parts by weight, 0.1 to 90 parts by weight, 1 to 90 parts by weight or 10 to 90 parts by weight of miR 218-2 relative to 100 parts by weight of the pharmaceutical composition But the present invention is not limited thereto, and may vary depending on the condition of the patient, the type of disease, and the progress of the disease.

In another embodiment of the present invention, the pharmaceutical composition comprises a carrier, an excipient, a disintegrant, a sweetener, a coating agent, a swelling agent, a lubricant, a lubricant, a flavoring agent, an antioxidant, a buffer, a bacteriostatic agent, a diluent, a dispersant, A lubricant, and a lubricant.

Specific examples of carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Solid formulations for oral administration may be in the form of tablets, pills, powders, granules, capsules These solid preparations can be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., into the composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, syrups and the like, and various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin which are commonly used simple diluents. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As the suppository base, witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like can be used.

In another embodiment of the invention, the formulation of the pharmaceutical composition comprises granules, powders,

And may be selected from the group consisting of tablets, tablets, pills, capsules, suppositories, gels, syrups, juices, suspensions, emulsions, drops or solutions.

According to one embodiment of the present invention, the pharmaceutical composition may be administered orally, intraarterally, intraperitoneally, intramuscularly, intraarterally, intraperitoneally, intrasternally, transdermally, nasally, inhaled, topically, rectally, Can be administered to a subject in a conventional manner via the intradermal route.

The preferred dosage of the pharmaceutical composition may vary depending on the condition and body weight of the patient, the type and degree of disease, the type of drug, the route of administration, and the duration, and may be appropriately selected by those skilled in the art. According to one embodiment of the present invention, the daily dose may be 0.01 to 1,000 mg / kg, specifically 0.1 to 1,000 mg / kg, more specifically 0.1 to 100 mg / kg, though it is not limited thereto. The administration may be performed once a day or divided into several times, and thus the scope of the present invention is not limited thereto.

In the present invention, the 'subject' may be a mammal including a human, but is not limited thereto.

The present invention relates to a method for the isolation of macrophages from blood; And confirming the expression level of miR 218-2 in the isolated macrophages.

More specifically, miR 218-2 expression is reduced in blood-derived macrophages, thereby diagnosing inflammatory bone diseases.

In addition, the present invention can provide a biomarker composition for the diagnosis of inflammatory bone diseases, which comprises an agent for detecting miR 218-2.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Example  1> Identification of protein activity by inflammatory signal

The effects of SLIT3 and miR 218-2 expressed by LPS, an inflammatory signal, on macrophages were examined.

Macrophages were stimulated with SLIT3 siRNA (Thermo Scientific Dharmacon, Lafayette, CO) or control siRNA (Thermo Scientific Dharmacon) for 24 hours and then treated with 10 ng / ml LPS for 4 hours. Thereafter, in order to confirm the level of expression of the inflammatory protein by LPS, the cells were collected and RNA was extracted and subjected to real-time PCR using MMP-9, IL-1β, TNF-α and IL-6 primers specific for cDNA synthesis Respectively.

As a result, when the activity of SLIT3 was decreased as shown in Fig. 1A, RNA expression of the inflammatory factors MMP-9, TNF-a and IL-6 decreased.

In addition, anti-miR 218-2 (Qiagen, Hilden, Germany), which is an inhibitor of miR 218-2 activity, was treated with macrophages having increased miR 218-2 activity by treatment with LPS, After cDNA synthesis, real-time PCR was performed using specific MMP-9, IL-1β, TNF-α and IL-6 primers.

As a result, as shown in FIG. 1B, miR 218-2 activity was inhibited by the miR 218-2 activity inhibitor, indicating that the inflammatory proteins MMP-9, IL-1β, TNF-α and IL-6 there was.

From these results, it was confirmed that SLIT3 and miR 218-2 expressed by the inflammatory signal function as signaling factors to regulate macrophage differentiation and activity through different double signals.

< Example  2> According to inflammation signal SLIT3  And ROBO1  Identify protein expression levels

In order to confirm the previous experimental results, macrophages derived from bone marrow were divided into 5 × 10 ⁵ cells on a culture plate, cultured for 24 hours, treated with 1 or 10 ng / ml of LPS for 4 hours The cells were harvested by stimulation and RNA was extracted. CDNA was synthesized using the extracted RNA and PCR amplification was performed using specific SLIT3 and ROBO1 receptor primers. RT-PCR and real time PCR were performed to confirm the expression level.

In order to confirm the expression levels and positions of the proteins of SLIT3 and ROBO1, 8 × 10 ³ macrophages were attached to cover glasses and treated with LPS at a concentration of 10 ng / ml for 6 hours to stimulate and fix the cells , SLIT3 was expressed with Alexa-fluor 488 dye (green) as a secondary antibody, and ROBO1 was expressed with Alexa-fluor 649 dye (red) to bind SLIT3 and ROBO1 Expression level and location were confirmed.

As a result, as shown in FIG. 2, expression levels of SLIT3 and ROBO1 proteins were increased by LPS, and all of the proteins showed high expression density around the nuclear membrane.

In addition, SLIT3 and ROBO1 protein expression was also observed in the plasma membrane of the moving cells.

From the above results, it was confirmed that the inflammatory signal due to LPS is involved in the expression of SLIT3 and ROBO1 proteins.

< Example  3> SLIT3 of RANK  Confirm expression control ability

To confirm the effect of SLIT3 expression, which is increased by LPS, on RANK expression, SLIT3-specific siRNA was introduced into cells at a concentration of 100 nM and cultured for 24 hours. And RT-PCR and real-time PCR were performed to confirm changes in protein expression.

As a result, as shown in FIG. 3, the expression of SLIT3 protein, which was increased by LPS after SLIT3 siRNA introduction, was decreased and the expression of RANK, which was inhibited by SLIT3, was restored.

In fact, according to the GEO profile analysis, the expression of RANK and Csf1r (M-CSF receptor), the major signal proteins in osteoclastogenesis in bone marrow-derived macrophages (BMMs) As shown in FIG. 3, the present inventors also confirmed by RT-PCR and real-time PCR that the expression of RANK and Csf1r is reduced by the LPS signal, and that the expression of RANK is regulated by SLIT3 I could confirm.

In osteoclast differentiation, LPS, which is an inflammatory signaling substance, is known to suppress early osteoclast differentiation by inhibiting the expression of RANK and inhibiting the activity of RANKL.

In order to confirm this, RANKL and LPS treatment of cells showed that osteoclast differentiation was significantly reduced in the experimental group treated with RANKL and LPS as shown in FIG. 4A. In order to confirm the function of SLIT3, SLIT3-specific siRNA was introduced into cells and incubated for 24 hours. RANKL and LPS were treated to induce differentiation of osteoclasts. After 3 days of induction of differentiation, cells were fixed and TRAP staining PMID: 24664887; Lee et al., PTX3 stimulates osteoclastogenesis by increasing osteoblast RANKL production, J Cell Physiol. 2014 Nov; 229 (11): 1744-52).

As a result, it was confirmed that osteoclast differentiation was restored by LPS treatment in the cell group in which SLIT3 expression was suppressed as shown in Fig. 4B.

These results suggest that inhibition of RANK expression by LPS can be restored through inhibition of SLIT3 expression, suggesting that osteoclast differentiation may be partially restored by activation of the RANKL signaling process.

As described above, it was confirmed by Western blotting that the signal transduction process by LPS could be independently controlled even in the inhibition of SLIT3 expression.

First, macrophages (5 × 10 ⁵ cells) were seeded on a 6-well plate, cultured for 24 hours, and 100 nM of control siRNA or SLIT3 siRNA was transfected using lipofectamine RNAi Max reagent. After 24 hours of transfection, stimulation was given at the time indicated by 10 ng / ml of LPS, and proteins were collected using 2 x SDS-sample buffer, followed by Western blotting using each antibody.

As a result, as shown in FIG. 5A, it was confirmed that the expression and activity of proteins affected by LPS were not affected even when SLIT3 knockout occurred.

From the above results, the present inventors expected that there would be another factor that regulates the expression of RANK by LPS and confirmed the expression of miR 218-2 regulated by SLIT3 expression.

 As a result, it was confirmed that the expression of miR 218-2 was also increased by LPS specifically as shown in FIG. 5B.

From the above results, it was confirmed that miR 218-2, which is encoded by the intron of SLIT3 and regulated by SLIT3 expression, can be regulated by LPS, suggesting that miR 218-2 can regulate the expression of RANK &Lt; / RTI &gt;

< Example  4> miR  218-2 RANK  Confirm expression control ability

To confirm the previous experimental results, we first checked whether the expression of SLIT3 can be regulated by miR 218-2.

SLIT3 siRNA was transfected into the cells, and after 24 hours, 10 ng / ml LPS was treated to stimulate the cells and the amount of protein expression was confirmed by collecting the cells.

As a result, it was confirmed that the expression of miR 218-2 was increased by LPS in the control group as shown in FIG. 6A, whereas the expression of miR 218-2 was inhibited in the group with the suppression of SLIT3 expression.

From the above results, it was confirmed that the expression of miR 218-2 was regulated by SLIT3.

Next, we confirmed whether miR 218-2 can bind to the RANK 3'UTR region using the miR binding prediction program.

As a result, as shown in FIG. 6B, two regions in which the miR 218-2 could bind were identified in the RANK 3'UTR region.

In order to confirm whether miR 218-2 binds to the above-identified two sites to regulate the expression of RANK, the RANK 3'UTR 1kb region was cloned into pMIR-report vector DNA (Fig. 6B, WT) Binding sites were mutagenized using the pMIR-report based Muta-Direct ^TM site-directed mutagenesis kit (intron, seoul) (Fig. 6B, Mut1 or Mut2).

The WT plasmid DNA or each mutated plasmid DNA (Mut1, Mut2 or Mut1 / Mut2) was transfected into mouse NIH 3T3 cells with miR 218-2 mimic oligonucleotides at a concentration of 100 nM.

After 24 hours of transfection, cells were harvested, proteins were extracted and luciferase assay was performed.

As a result, activity was decreased by miR 218-2 in WT as shown in Fig. 6C, but activity did not decrease in the mutagenized group of both binding sites.

In addition, RT-PCR (FIG. 6D) and real-time RT-PCR (FIG. 6E) showed that RANK expression was decreased in the LPS treated cells and in the miR 218-2 transfected cells, whereas anti-miR 218- The expression of RANK was significantly increased in the cell line in which the miR 218-2 activity was inhibited by treatment with LPS and anti-miR 218-2.

In order to confirm whether miR 218-2 could affect osteoclast differentiation, cells were transfected with miR 218-2 or anti-miR 218-2 at a concentration of 100 nM respectively, and after 24 hours, RANKL and LPS Stimulated osteoclast differentiation.

As a result, as shown in FIG. 6F, the differentiation of miR 218-2 into osteoclast was reduced in the cells transfected with miR 218-2, whereas the differentiation into osteoclasts was increased in the cells transfected with anti-miR 218-2, It was also confirmed that osteoclast differentiation was increased by inhibiting the increase of miR 218-2 activity by LPS in the cell group treated with anti-miR 218-2.

From the above results, it was confirmed that miR 218-2 expression targets RANK expression, and that osteoclast differentiation is negatively regulated through signaling by LPS.

name The sequence (5'-3 ') Accession SEQ ID NO: mir-218-2 (mmu-mir-218-2-3p) CAUGGUUCUGUCAAGCACCGCG MIMAT0005444 One ROBO1
Forward primer AGGGAAGCCTACGCAGATG NM_09413.2
2 Reverse primer TGGACAGTGGGCGATTTTAT 3 SLIT3
Forward primer CTAAACCAGACCCTGAACCTGGTGGTAGAC NM_011412.3
4 Reverse primer AAGGTAGAGGGGGCTGTTGCTGCCCACT 5 MMP-9
Forward primer GAGACGGGTATCCCTTCGAC NM_013599.3
6 Reverse primer TGACATGGGGCACCATTTGAG 7 IL-1?
Forward primer AAATACCTGTGGCCTTG NM_008361.3
8 Reverse primer TTAGGAAGACACGGATTC 9 TNF-a
Forward primer AGTGACAAGCCTGTAGCC NM_013693.3
10 Reverse primer AGGTTGACTTTCTCCTGG 11 IL-6
Forward primer GGAGTACCATAGCTACCTGG NM_031168.1
12 Reverse primer CTAGGTTTGCCGAGTAGATC 13 c-fms
(csf1r) Forward primer CCCACCCTGAAGTCCTGAGT NM_001037859.2
14 Reverse primer CTTTGTCCTAGGGAGACGGC 15 RANK
(Tnfrsf11a) Forward primer CAGATGTCTTTTCGTCCACAGA NM_009399.3
16 Reverse primer AGACTGGGCAGGTAAGCCT 17 GAPDH
Forward primer TGGCCTTCCGTGTTCCTAC GU214026.1
18 Reverse primer GAGTTGCTGTTGAAGTCGCA 19

Hereinafter, formulation examples of the pharmaceutical composition of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

< Formulation example  1> Preparation of injection

10 mg of miR 218-2, 3.0 mg of sodium metabisulfite, 0.8 mg of methylparaben, 0.1 mg of propylparaben and an appropriate amount of sterilized distilled water for injection were mixed to prepare a final volume of 2 ml by a conventional method, Ampicillin and sterilized to prepare an injection.

< Formulation example  2> Preparation of tablets

10 mg of miR 218-2, 100 mg of lactose, 100 mg of starch and an appropriate amount of magnesium stearate were mixed and tableted according to a conventional preparation method.

&Lt; Formulation Example 3 > Preparation of capsules

10 mg of miR 218-2, 50 mg of lactose, 50 mg of starch, 2 mg of talc, and an appropriate amount of magnesium stearate were mixed and filled in gelatin capsules according to a conventional capsule preparation method to prepare capsules.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> University of Ulsan Foundation for Industry Cooperation <120> Pharmaceutical composition for or treating          inflammatory bone disease comprising miR 218-2 <130> ADP-2015-0236 <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> miR-218-2 <400> 1 caugguucug ucaagcaccg cg 22 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ROBO1 forward primer <400> 2 agggaagcct acgcagatg 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ROBO1 reverse primer <400> 3 tggacagtgg gcgattttat 20 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLIT3 forward primer <400> 4 ctaaaccaga ccctgaacct ggtggtagac 30 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SLIT3 reverse primer <400> 5 aaggtagagg gggctgttgc tgcccact 28 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 forward primer <400> 6 gagacgggta tcccttcgac 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 reverse primer <400> 7 tgacatgggg caccatttga g 21 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> IL-1 beta forward primer <400> 8 aaatacctgt ggccttg 17 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> IL-1 beta reverse primer <400> 9 ttaggaagac acggattc 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TNF-a forward primer <400> 10 agtgacaagc ctgtagcc 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TNF-a reverse primer <400> 11 aggttgactt tctcctgg 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-6 forward primer <400> 12 ggagtaccat agctacctgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-6 reverse primer <400> 13 ctaggtttgc cgagtagatc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> c-fms forward primer <400> 14 cccaccctga agtcctgagt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> c-fms reverse primer <400> 15 ctttgtccta gggagacggc 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RANK forward primer <400> 16 cagatgtctt ttcgtccaca ga 22 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RANK reverse primer <400> 17 agactgggca ggtaagcct 19 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 18 tggccttccg tgttcctac 19 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 19 gagttgctgt tgaagtcgca 20

Claims (7)

A pharmaceutical composition for preventing or treating inflammatory bone diseases, comprising miR 218-2 as an active ingredient. The pharmaceutical composition according to claim 1, wherein the inflammatory bone disease is selected from the group consisting of osteoporosis, degenerative arthritis and ankylosing spondylitis. The pharmaceutical composition according to claim 1, wherein the miR 218-2 inhibits the expression of an inflammatory factor and inhibits the expression of RANK protein to inhibit osteoclast differentiation. An inhibitor of osteoclast differentiation comprising miR 218-2 as an active ingredient. Separating the macrophages from the blood; And
And determining the degree of miR 218-2 expression of the isolated macrophage. 6. The method according to claim 5, wherein the diagnostic method is characterized in that miR 218-2 expression of blood-derived macrophages is decreased. A biomarker composition for the diagnosis of inflammatory bone disease comprising an agent for detecting miR 218-2.

Images