KR20160137903A - Novel Salmonella for treatment of cancer, and use thereof - Google Patents

Abstract

YC0843(STM2875, relA/spoT), YC0844(STM3096, relA/spoT) and YC0845(STM4332/4333, relA/spoT), which are double mutation genes, significantly reduce viability in normal organs, minimize negative effects caused by salmonella infection, and inhibit the size of tumors, thereby being used as a pharmaceutical composition for treating cancer.

Description

The novel Salmonella strain for treatment of cancer and its use TECHNICAL FIELD OF THE INVENTION

The present invention is to provide a novel double mutant strain in which a Salmonella pathogenic gene is additionally deleted in the Salmonella genus strain in which the ppGpp production gene is deleted, or a pharmaceutical composition for cancer treatment containing the same as an active ingredient.

The incidence of cancer is increasing by more than 5% every year worldwide due to the social structure of low birthrate and aging population, environmental degradation due to industrial development, and westernization of food culture. This increase in cancer incidence not only suggests that cancer should be considered very seriously in terms of health management of the elderly, but also the population capable of productive economic activity in their 20s and 30s due to lack of social structure, lack of exercise, and poor lifestyles. Also shows that it cannot be safe from cancer.

According to the'National Cancer Incidence Statistics (2007)', if life expectancy is reached, 1 in 3 men and 1 in 4 women are likely to develop cancer, and the World Health Organization (WHO) estimates 12 million people every year. It is estimated that new cancer patients will occur and 7 million people will die of cancer.

Since cancer was regarded as an object to be conquered by humanity, research on all-round anti-cancer treatment from basic research at the cellular level has been promoted worldwide. The mechanism of occurrence of cancer is still unclear, and it is difficult to prevent and cure recurrence, so the demand for anticancer drugs is exploding, and enormous research expenses are being invested in research institutes and companies. However, expensive chemotherapy costs not only direct medical costs, but also indirect costs for the contraction of social economic activities after the onset, rehabilitation, and patient care are added, which is an economic burden to the entire family and members of the society of cancer patients. There is a demand for the introduction of new technology. Currently, viral vectors, non-viral vectors using nano-particles, and bacterial vectors using anaerobic microorganisms ( bacterial vector) is being used. Among them, viral vectors, which show high drug delivery efficiency, are used not only for chemotherapy, but also for gene therapy of other diseases. However, the recently reported side effects of viral vectors clearly show the limitations of viral vectors (the range of host cells is wide and causes immune side effects when repeated administration), and thus, the development of a safer gene delivery system is required.

In line with this situation, after a bacterial suppression of cancer was reported about 100 years ago, strains with anticancer effects have been developed by many researchers, and some research groups are already in the clinical stage. It is also a characteristic of the habitat favored by pathogenic strains that proliferate in the cellular environment of cancer tissues, which are represented by low partial pressure of oxygen, abundant nutrients, and lack of immune response. In particular necromancer tick area, located in the heart of cancer tissue (necrotic region) is there not carried out drug delivery is efficient, known to induce such metastasis, Clostridium (Clostridium), Bifidobacterium (Bifidobacterium), Salmonella ( Salmonella ), etc. are accumulated and proliferated in the abundant nutrients in the necrotic area in the center of cancer tissues, and in this process, the reduction and growth inhibition of cancer tissues have been observed, and have been used as viable strains for chemotherapy since ancient times.

Chinese Dr. The Xu research team devised a system that delivered Bifidobacterium longum , an angiogenesis inhibitor, to solid cancer tissues by oral administration of Bifidobacterium longum. (Xu YF, et al., Cancer Gene Ther. 2007, 14(2):151-7; Hu B, et al., Cancer Gene Ther. 2009, 16(8):655) -63).

In 1997, Dr. Bermudes of Yale University mentioned the possibility of Salmonella as a new anticancer target carrier. Since then, various research teams including the National Cancer Institute (NCI) have published the results of the inhibition of cancer growth of Salmonella, and its effect in connection with radiation therapy has been demonstrated. I took a look. In addition, in cooperation with Vion Pharmaceuticals Inc., VNP20009, a mutant strain that weakened the toxicity of Salmonella typhimurium , was developed, and cytosine deaminase, a precursor drug, was introduced into cancer cells. I have tried clinical trials by making it appear.

In 2006, Dr. Gnjatic of Yale University combined Salmonella's tumor markers with the secretion signals of the Type III secretion system (TTSS) to secrete them into cancer tissues, and then activate CD8 T cells in the body to prevent cancer. An anticancer vaccine development system that reduced the size of was reported (Nishikawa H, et al., J Clin Invest. 2006, 116(7):1946-54).

Anticancer research using Salmonella has been conducted in Korea. In 2010, Professor Jeong-Jun Min's team at Chonnam National University conducted guanosine 5'-diphosphate-3'-diphosphate (ppGpp); hereinafter: guanosine 5'-diphosphate-3'-diphosphate (ppGpp) , Guanosine tetraphosphate (described as guanosine tetraphosphate; ppGpp)) By binding a fluorescent gene to a Salmonella strain lacking the ability to produce, the migration pathway of the strain was observed, and at the same time, the cytolysin (cytolysin A) gene was expressed in cancer tissues. We developed a recombinant strain of attenuated Salmonella designed to selectively kill (Nguyen VH, et al., Cancer Res. 2010, 1;70(1):18-23), and in 2013, Professor Choi Hyun-il's team at the same university stably developed a strain. Salmonella and E. coli strains that can deliver anticancer therapeutic substances to cancer tissues were developed (Kim K, et al., PLoS One. 2013, 8(3):e60511).

However, in the anticancer treatment using Salmonella, whose pathogenicity has been weakened, there has been a concern about the occurrence of side effects due to the remaining Salmonella that has not been removed after tumor cell death. In the case of chronic infection by residual Salmonella, there is a risk of infection to other surrounding people as carriers, and fatal sepsis may occur due to Salmonella, which has weakened pathogenicity to patients with weakened immune function or to the elderly. There is a risk of developing autoimmune diseases, such as arthritis, blepharitis, and urethritis.

Therefore, in the development of anticancer treatment technology using Salmonella, in order to increase the proliferation specificity of Salmonella to tumor tissues and to minimize excessive immune responses and adverse effects in normal organs, Salmonella viability in normal tissues other than tumor tissues is effectively improved. By controlling it, it is necessary to develop a strain that can be quickly eliminated in case of Salmonella infection in normal organs.

Therefore, as a result of our efforts to develop Salmonella strains with excellent anticancer effect and efficiently regulating Salmonella viability in normal tissues other than tumor tissues, we found that Salmonella pathogenicity was found in Salmonella strains in which the previously known ppGpp-producing gene was deleted. As a result of additionally lacking the gene hilD gene, it was confirmed that the viability in normal organs was reduced and the tumor cell size was significantly suppressed, thereby revealing that the new strain can be usefully used as an active ingredient of an anticancer composition. Completed.

An object of the present invention is to provide a method for preparing a Salmonella genus strain in which the ppGpp production gene and Salmonella pathogenic gene are deleted, and a pharmaceutical composition for cancer treatment, a composition for drug delivery, a vaccine composition, and a method for producing a mutant strain of Salmonella genus containing the same as an active ingredient. To provide.

In order to achieve the above object, the present invention provides a Salmonella (Salmonella) strains in which the gene and produce ppGpp salmonella virulence gene deletion.

In addition, the present invention provides a pharmaceutical composition for the treatment of cancer containing as an active ingredient a Salmonella genus strain in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

In addition, the present invention provides a composition for drug delivery comprising a strain of the genus Salmonella in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

In addition, it provides a vaccine composition comprising a strain of Salmonella genus in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

In addition, the present invention provides a method for producing a mutant strain of the genus Salmonella comprising the step of deleting a gene for producing ppGpp and a pathogenic gene for Salmonella in a Salmonella wild-type strain.

The present invention is a novel double mutant strain in which a Salmonella pathogenic gene is additionally deleted in the Salmonella genus strain in which the ppGpp production gene is deleted, and the viability in normal organs is reduced, and the tumor cells exhibit a significant anticancer effect, so the novel double mutant strain is It can be used as an active ingredient in anticancer compositions.

1 is a diagram showing the structure of a 24-nt DNA barcode used for strain labeling.
The 135-nt nucleotide sequence inserted instead of the target gene is the scar site (or FRT) remaining after the removal of the kan cassette, the 24-nt barcode (N, purine or pyrimidine base; V, the base excluding thymine base), and the scarF/ of nested PCR. It is composed of Priming site 4/1 recognized by scar primer.
Figure 2 is a diagram showing a schematic diagram of the qPCR CI method:
① Cultivation of strains labeled with barcodes; ② mix of strains; ③ DNA separation from INPUT strain mixture; ④ Measure the Ct value of each strain after real-time PCR using INPUT DNA; ⑤ infection of the strain mixture of ② above with a mouse; ⑥ collection of host organs by time of infection; ⑦ cultivation of viable bacteria in the organ; ⑧ DNA isolation from the OUTPUT strain mixture; ⑨ Measurement of the Ct value of each strain after real-time PCR using the infection result (OUTPUT) DNA; ⑩ Calculate _{CI qPCR} value using Ct value in injection and infection results.
3 is a graph comparing the viability of 12 strains in a host through qPCR CI.
Figure 4 is a diagram comparing the viability of the three strains in the host spleen using the traditional CI method.
Figure 5 is a graph comparing the viability of the three strains in the host spleen using ^{Nramp1 -/- host.}
Figure 6 This is a graph comparing the viability of the strains YC0843, YC0844, and YC0845 in the host spleen.
Degree 7 is a graph comparing the growth rate or viability of YC0843 in the tumor and spleen in a tumor host.
8 is It is a diagram showing the tumor proliferation inhibitory effect of strain YC0843.

Hereinafter, the present invention will be described in detail.

The attenuated Salmonella strain with a deletion of the ppGpp-producing gene of the present invention can be used for diagnosis and therapeutic purposes of diseases that can be targeted by Salmonella such as cancer and infarct tissue. Salmonella strain, an anaerobic Gram-negative bacteria, is known to selectively target cancer tissues (Bermudes et al., Adv. Exp. Med. Biol., 465: 57-63, 2000), infarct tissues such as myocardial infarction and cerebral infarction. Was found to selectively target (WO2010/0137900A). Therefore, Salmonella strains are recognized for their potential as a selective drug delivery system for cancer tissues and infarct tissues. In particular, since Salmonella is easy to genetically manipulate, it can be genetically modified to express a specific protein or nucleic acid drug, and if the drug is a compound, the inside of Salmonella, which is essential for the biochemical pathway, is utilized by utilizing the biochemical pathway used to produce the drug. Genetic manipulation is performed so that the drug is produced by metabolism of Salmonella strains through gene manipulation to inactivate genes related to the bypass pathway to block other bypass pathways so that the biochemical pathway is preferentially applied. It has the advantage of being able to perform.

Accordingly, the present invention provides a strain of the genus Salmonella in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

The ppGpp production gene is relA ( SEQ ID NO: 82) and spoT ( SEQ ID NO: 83), the Salmonella pathogenic gene is bcfH (SEQ ID NO: 66) , STM0829 (SEQ ID NO: 67) / STM0290 (SEQ ID NO: 68) / STM0291 (SEQ ID NO: 69), cstA (SEQ ID NO: 70) , glnQ ( SEQ ID NO: 71) , STM0839 (SEQ ID NO: 72), STM1024 (SEQ ID NO: 73), sseA ( SEQ ID NO: 74) , hilD ( SEQ ID NO: 75) , yqgE ( SEQ ID NO: 76) , yqgF ( SEQ ID NO: 77) , rsd ( SEQ ID NO: 78) , yjaG ( SEQ ID NO: 79) , yjeJ ( SEQ ID NO: 80) And It is preferably any one or more selected from the group consisting of yjeK ( SEQ ID NO: 81), and more preferably hilD.

The Salmonella sp is Salmonella typhimurium (Salmonella Typhimurium), Salmonella cholera shoe devices (Salmonella choleraesuis) and Salmonella entera ET display one preferably composed of any one selected from the group consisting of (Salmonella enteritidis), but not always limited thereto.

Salmonella strains in which the ppGpp-producing gene is deleted are known to exhibit tumor suppressing effects, but they also exhibit significant viability in normal organs and tissues, so infection by Salmonella may occur.In addition, strains in which only the pathogenic genes of Salmonella bacteria are deleted are also known. As pathogenicity is maintained in normal organs, the possibility of use as a therapeutic strain is minimal. However, the novel double mutant strain of the present invention in which the ppGpp production gene and the pathogenic gene of Salmonella are simultaneously deleted can be usefully used as an anticancer therapeutic agent by significantly reducing the tumor suppressing effect and viability in normal organs.

In a specific embodiment of the present invention, the present inventors produced Salmonella strains each lacking 12 kinds of genes (group) thought to be important for the pathogenicity of Salmonella using a homologous recombination method using λ phage (Table 1). And Table 2), as ^{a result of testing the viability of 12 strains in Nramp1 +/+} 129SvJ host model mice, three strains ΔSTM1397, ΔSTM2875, and ΔSTM4332/, which significantly reduced viability in the spleen within the host on days 5 and 7 after infection. 4333 was selected as an attenuated strain suitable for anticancer treatment (see Fig. 3), and the CI values of the three selected strains ΔSTM1397, ΔSTM2875 and ΔSTM4332/4333 were compared with the reference strain MA6054, resulting in decreased viability in the host. It was confirmed that (see Fig. 4).

In addition, as ^{a result of comparing the viability of the mutant Salmonella strain of the present invention in normal organs using Nramp1 -/-} BALB/c mice, the viability in the host was not significantly different compared to the wild-type strain, so that the host animal died within a few days. Accordingly, it was shown that the possibility of utilization as a therapeutic strain was small (see FIG. 5). In order to overcome this problem, ΔSTM1397, ΔSTM2875 and relA the ΔSTM4332 / 4333 strain And spoT Double mutant strains lacking additional ppGpp, which are important for pathogenicity, were produced by additionally removing the gene, and as a result of confirming the viability after infection into their host, the double mutant strains YC0843 (ΔSTM2875, Δ relA / spoT ), YC0844 (ΔSTM3096, Δ relA / spoT ) and YC0845 (ΔSTM4332/4333, Δ relA / spoT ) were found to significantly decrease viability in normal organs compared to the wild-type SHJ2037 (Δ relA / spoT) strain (see FIG. 6). When comparing the targeting ability and viability of the double mutant strain in a tumor-bearing host with the wild-type SHJ2037, it was confirmed that the YC0843 strain in particular had a target effect on tumor tissues more than 100 times better than that of normal tissues (see Fig. 7). , As a result of investigating the proliferation inhibitory effect on the tumor of the YC0843 strain, it was confirmed that the weight of the tumor decreased by about 1/3 (see FIG. 8).

Therefore, the double mutant strains of the present invention YC0843 (ΔSTM2875, Δ relA / spoT ), YC0844 (ΔSTM3096, Δ relA / spoT ) and YC0845 (ΔSTM4332/4333, Δ relA / spoT ) significantly decreased viability in normal organs, resulting in Salmonella. It was confirmed that it can be usefully used to treat cancer by suppressing the size of the tumor while minimizing the negative effect due to infection.

The present invention provides a pharmaceutical composition for cancer treatment containing as an active ingredient a strain of the genus Salmonella in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

In addition, it provides a composition for drug delivery comprising a Salmonella genus strain in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

In addition, it provides a vaccine composition comprising a strain of Salmonella genus in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

In addition, it provides a health functional food for cancer improvement containing as an active ingredient a strain of Salmonella genus in which the ppGpp production gene and the Salmonella pathogenic gene are deleted.

The ppGpp-producing genes are preferably relA and spoT.

The Salmonella pathogenic gene is bcfH , STM0289/0290/0291, cstA , glnQ , STM0839, STM1024, sseA , hilD , yqgE / yqgF , rsd , yjaG , and It is preferably any one or more selected from the group consisting of yjeJ / yjeK , and more preferably hilD.

The Salmonella genus strain is preferably any one selected from the group consisting of Salmonella Typhimurium, Salmonella choleraesuis , and Salmonella enteritidis, but is not limited thereto.

The Salmonella strain in which the ppGpp-producing gene and the Salmonella pathogenic gene of the present invention are deleted were prepared by producing a Salmonella strain in which the Salmonella pathogenic gene was deleted, and then additionally added the relA and spoT genes, which are ppGpp-producing genes, using the p22 bacteriophage method. It can be produced by fruiting.

Salmonella strains in which the ppGpp-producing gene is deleted are known to exhibit tumor suppressing effects, but they also exhibit significant viability in normal organs and tissues, so infection by Salmonella may occur.In addition, strains in which only the pathogenic genes of Salmonella are deleted are also known. As pathogenicity is maintained in normal organs, the possibility of use as a therapeutic strain is minimal. However, the novel double mutant strain of the present invention in which the pGpp-producing gene and the pathogenic gene of Salmonella are simultaneously deleted can be usefully used as an anticancer therapeutic agent by significantly reducing the tumor suppressing effect and viability in normal organs.

Examples of such cancers include non-small cell lung cancer, neuroblastoma, inflammatory myeloid fibroblast tumor, rhabdomyosarcoma, myofibroblastoma, breast cancer, gastric cancer, lung cancer, melanoma, large B-cell lymphoma, systemic phenoblastosis, inflammatory myofibroblast sarcoma. Alternatively, it may be useful for esophageal squamous cell carcinoma.

The pharmaceutical composition of the present invention may be in various oral or parenteral dosage forms. In the case of formulation, it can be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose, lactose ( lactose) or gelatin. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally according to a desired method, and when administered parenterally, select a method for external use of the skin or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrathoracic or topical injection. It is desirable to do it.

The dosage of the pharmaceutical composition of the present invention varies according to the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease, and the scope of the present invention by any method Is not limited to. Individual dosages specifically contain the amount at which the effective drug is administered at one time.

The dosage of the pharmaceutical composition of the present invention varies according to the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease, and the daily dosage is according to the present invention. Based on the amount of the composition, it is 0.0001 to 100 mg/kg, preferably 0.001 to 10 mg/kg, and may be administered 1 to 6 times a day.

The pharmaceutical composition of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers.

Hereinafter, the present invention will be described in more detail by examples and experimental examples.

However, the following examples and experimental examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples and experimental examples.

<Example 1> Preparation of Candidate Strains for Development of Salmonella Strains for Anticancer Treatment

In order to produce Salmonella strains for chemotherapy, first, based on existing data, 12 genes (groups) thought to be important for the pathogenicity of Salmonella were selected, and 12 kinds of these 12 genes or gene groups each lacking. Salmonella strains were prepared and named as ΔSTM0028, ΔSTM0289/0290/0291, ΔSTM0600, ΔSTM0828, ΔSTM0839, ΔSTM1024, ΔSTM1397, ΔSTM2875, ΔSTM3096, ΔSTM4156, ΔSTM4169, ΔSTM4332/4333.

Specifically, the gene removal method used a homologous recombination method using λ phage.

PKD13-mod plasmid (Yoon H, et al., PLoS ) with various types of DNA barcodes (barcodes) consisting of 24-nucleotides (nucleotide(nt)) Pathog . 2009, 5(2):e1000306) were used as a template, and the Kan cassette ( kan cassette) and DNA barcode (DNA barcode) portion were PCR amplified with a pair of primer sets. At this time, a pair of PCR primer sets each has a length of 60-nt and includes a 40-nt sequence having nucleotide sequence homology with the gene to be removed in addition to the 20-nt of the 3'end binding to the pKD13-mode template at the 5'end. As a result, the DNA product obtained by PCR undergoes homologous recombination with the target gene portion of the Salmonella chromosomal DNA, so that the target gene can be replaced with a kan cassette and a DNA barcode. The PCR primer sequences used to remove a total of 12 genes (groups) are shown in Table 1 below.

Primer sequence used for substitution with Kan cassette and DNA barcode instead of target gene Strain gene
designation Primer sequence
(Advance: from 5’ to 3’) Primer sequence
(Reverse: from 5’ to 3’) ΔSTM0028 bcfH GGGAGGCTTTCCGAACTTATCGAACGAGACTTTTATTATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 3) CTCCTCTGAGCGAATATCACCCCTTCGCTTTCTGAATCGCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 4) ΔSTM0289/0290/0291 - CTATTTATTTTAATCCGGTATTAAAGGAGTCACTACCATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 5) CACAATTTAAATTTATTTAGCATTTTGCTTCAACTTCCCCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 6) ΔSTM0600 cstA GTAACATCTCTCTGGAACACCCAAACGGACAACAACTATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 7) TATTGATGTAAAAAGATTAGTGCGCGCCTTTCGCCTGCGTGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 8) ΔSTM0828 glnQ TTATTTTGCGTCGTCTTGAAAGAAGGATGAAAATCCTGTGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 9) CTGGAAGGGCGATATCTCAGGAGACGTGCTGTAAAAATTCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 10) ΔSTM0839 - TACTCTCCCGGAAAATAATTCAAAAGAACTCACCCGCTTGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 11) CAATTACCCCGATTTCTCAATGAGCATTACACTCATCTTCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 12) ΔSTM1024 - ACACACTGCGCCATCCGAGCTATCGGAGGTGAGGCTTATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 13) GAAATCGGACGTGGACTCACGCTAAGTGAGAGCGAAATCCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 14) ΔSTM1397 sseA TTAGCACGTTAATTATCTATCGTGTATATGGAGGGGAATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 15) CTGAAGACATTATGCTTTACCTTTTTGTTTTTCCTGACGGGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 16) ΔSTM2875 hilD GTAAGGAACATTAAAATAACATCAACAAAGGGATAATATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 17) TGTCTATGTTTTTTACAATTACCAAGCGGTAAAAATACTTGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 18) ΔSTM3096/3097 yqgE /
yqgF TGTCGTTTTTTTGAACCAGGAAACAGAACCTCTGACAATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 19) GCTGACAAAAACGGCTTTAATACCCCTGTTCAAAATAGCTGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 20) ΔSTM4156 rsd GATTTATGGGATAAATTTAAAGTCACATTTGGAATCAATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 21) TTAATGAATAAATGAATTATTTTTTCATGACTCTTGTTTCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 22) ΔSTM4169 yjaG GGTAAACTGCCGCTAATTTCCGATTCGAGATTCCATCATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 23) ATCACGTTTTCTGGTGTCATTGCTGAAAATTTATACCGATGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 24) ΔSTM4332/4333 yjeJ /
yjeK GCCCTCTGAAATTGTTAACTGGTAGCTAAGCCACAAAATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 25) TCAGAGGGCGATATGGTTAGCGTTTTTCCTGCGATGATGCGTGTAGGCTGGAGCTGCTCC
(SEQ ID NO: 26)

Electroporation method in Salmonella Typhimurium 14028S (ATCC 14028S) suspension washed with sterilized distilled water containing 1.3 kb of PCR product containing kan cassette and DNA barcode, and pKD46 in cells. And cultured in Kanamycin medium to isolate colonies in which kan cassette and DNA barcode were substituted instead of the target gene. The presence of the kan cassette substituted for the target gene and the DNA barcode was confirmed by PCR using primers K1 (5-CAGTCATAGCCGAATAGCCT-3; SEQ ID NO: 1) and K2 (5TTGTCAAGACCGACCTGTCC-3; SEQ ID NO: 2). Thereafter, the transformed strain was subjected to pCP20 plasmid (Datsenko KA, et al., Proc Natl Acad Sci US A. 2000, 6;97(12):6640-5) was introduced by electroporation and the kan cassette was removed through FLP recombinase by pCP20, and in-frame non-polar deletion (in-frame nonpolar deletion) strain was prepared. The nucleotide sequence structure near the DNA barcode of the deleted strain prepared in this way is shown in FIG. 1. Colonies from which the kan cassette was removed were selected by confirming the removal of the kan cassette through PCR as well as an antibiotic medium test. The diagnostic PCR primer sequence used to diagnose the presence or absence of the kan cassette is shown in Table 2 below.

Diagnostic primer sequence used to confirm the presence or absence of the Kan cassette Strain gene
designation Primer sequence
(Advance: from 5’ to 3’) Primer sequence
(Reverse: from 5’ to 3’) ΔSTM0028 bcfH TGGCAAAGTATTAATGACTATG
(SEQ ID NO: 27) GATCCCATAAAATGAATCTGAG
(SEQ ID NO: 28) ΔSTM0289/0290/0291 - TTATTTTCATGGCTCTTGTCAG
(SEQ ID NO: 29) TACAGCTTAGGTCATCCCATAC
(SEQ ID NO: 30) ΔSTM0600 cstA AAGGAAGTGATCTGGTTAACAC
(SEQ ID NO: 31) GGCACGCCAATCATCATTTTTG
(SEQ ID NO: 32) ΔSTM0828 glnQ CACCTCGTTGTTTATTGTTATC
(SEQ ID NO: 33) ATGACTCCTCCAGTGAGAAAAG
(SEQ ID NO: 34) ΔSTM0839 - TTTTGGAACGCTTTTTTGGCC
(SEQ ID NO: 35) CGCAGAAAACATTAAACAAATC
(SEQ ID NO: 36) ΔSTM1024 - ACCAATTTCATTAGGTCGCTTC
(SEQ ID NO: 37) ATTTCGGTTTCTAGCACATAAC
(SEQ ID NO: 38) ΔSTM1397 sseA TAGTACGTGAGGTTTGACTCG
(SEQ ID NO: 39) ATTTATTATTTGCGATAGCCTG
(SEQ ID NO: 40) ΔSTM2875 hilD CTGTTAGCGATGTCTGTCG
(SEQ ID NO: 41) AAAGGCAGGAGGGTTATG
(SEQ ID NO: 42) ΔSTM3096 yqgE /
yqgF AATCTATTGCCCGATAAGGCAG
(SEQ ID NO: 43) TGAAGTTTCTATGGCGCAACC
(SEQ ID NO: 44) ΔSTM4156 rsd AAATGTCCCGCGTAAACAATC
(SEQ ID NO: 45) ATTATTGTCGCCACCGCTATTC
(SEQ ID NO: 46) ΔSTM4169 yjaG AGCGCTGTATGAAAGGGTATC
(SEQ ID NO: 47) GGAAATGCCAGAAAAGCACTC
(SEQ ID NO: 48) ΔSTM4332/4333 yjeJ /
yjeK TTACCCGGTTTCACGAATTCAC
(SEQ ID NO: 49) TGCTGTATGGCGTAAGTAGTC
(SEQ ID NO: 50)

< Experimental Example 1 > Principle of primary selection of strains lacking pathogenicity using qPCR competition index (CI)

In order to experimentally evaluate the importance of actual Salmonella infection among the 12 genes (groups), the self-developed qPCR CI method (Yoon H, et al., Infect Immun. 2011, 79(1):360) -368) was used to simultaneously test the viability of 12 strains in host model mice.

Specifically, the same amount of cultures of wild type and mutant strains labeled with different 24-nt DNA barcodes were mixed and injected to infect the same host. After a certain period of time, the host organ was isolated and the cell lysate thereof was used as an infection product or product. In order to increase the number of bacteria in the product sample, the lysate of the host organ was smeared on an agar plate, and nested PCR was performed on the mixed suspension of the resulting colonies to amplify the DNA barcode portion. . Nested PCR was carried out by continuously performing one time of 95°C for 10 minutes, 30 times of 95°C for 30 seconds, 50°C for 30 seconds, 72°C for 30 seconds, and one time at 72°C for 5 minutes. The primer sets (scarF and scarR) used in nested PCR were designed to recognize the priming site 4 and the priming site 1 of FIG. 1, and the base sequence thereof is as follows:

scarF: 5'-ATTCCGGGGATCCGTCGACCT-3' (SEQ ID NO: 51), scarR: 5'- GTGTAGGCTGGAGCTGCTCC-3' (SEQ ID NO: 52).

Whether the relative increase or decrease of each strain in the product was performed by repeating real-time PCR at 95°C for 15 seconds and 60°C for 1 minute, 50 times using a primer that can identify DNA barcodes using the nested PCR product as a template. Was expressed through the Ct value.

When performing real-time PCR, the injection sample was also shown through the Ct value of the relative increase or decrease of each strain used during host infection through nested PCR and continuous real-time PCR. The difference in Ct values between the wild-type and specific mutant strains obtained from the product (OUTPUT) sample and the injection (INPUT) sample is expressed as a ratio, and the viability of the specific mutant strain in the host is compared with the wild-type strain and quantified as a CI value (CI _qPCR ). Showed.

The _{formula for calculating the CI qPCR} is as follows (Equation 1). When the CI _qPCR value is 1, the mutant strain has no difference in viability from the wild-type strain. When it is greater than 1, the mutant strain has superior viability than the wild-type strain, and when it is less than 1, the mutant strain has less viability than the wild-type strain. Show. In the CI _qPCR formula, E is the PCR amplification efficiency, which is a constant representing the amplification efficiency during real-time PCR of each DNA barcode.

At the threshold, where Q is the amount of template DNA and wt is the wild type, and the mutant is the mutation.

OUTPUT represents the product sample and INPUT represents the injection sample.

The nucleotide sequence of the DNA barcode used for labeling the 12 strains used in the present invention is shown in Table 3 below, and the E value of each DNA barcode is also displayed (FIG. 2).

Strain 24-nt barcode sequence (5' to 3') E (PCR efficiency) value
ΔSTM0028 AATGCTGTTCTTGATCGTGATAGT
(SEQ ID NO: 53) 1.94 ΔSTM0289/0290/0291 AAAAGACTGATTGCAAAAATAAGG
(SEQ ID NO: 54) 1.58 ΔSTM0600 CAAAGTGCAATGAGAGTACTTGGC
(SEQ ID NO: 55) 1.73 ΔSTM0828 ATCATTAATGCTCTGACCCTGAGC
(SEQ ID NO: 56) 1.68 ΔSTM0839 AGTAATGTCATTGATATGGCTAAC
(SEQ ID NO: 57) 1.53 ΔSTM1024 GTGGTTGCTCGGGATATTGGCAGT
(SEQ ID NO: 58) 1.9 ΔSTM1397 ATTCCAATGCAAGGTGCAACCAGC
(SEQ ID NO: 59) 1.86 ΔSTM2875 GGACGCATGATTGTTGGTGGGCGC
(SEQ ID NO: 60) 1.79 ΔSTM3096 AGCCGTGAAAGTGTTGGCGTCCGG
(SEQ ID NO: 61) 1.93 ΔSTM4156 ATTGGTAAAAGGCATGTGGACAGC
(SEQ ID NO: 62) 1.71 ΔSTM4169 AGTATTGAAATTCACAAAAATCTG
(SEQ ID NO: 63) 1.81 ΔSTM4332/4333 CGCAGTGGAGATGATGGTGTGGGT
(SEQ ID NO: 64) 1.66 ΔSTM0314 (for reference) AGGGCGAACGCCAGTGCTGTTGCC
(SEQ ID NO: 65) 1.87

<Experimental Example 2> Confirmation of viability comparison of candidate strains lacking pathogenicity

In order to compare the viability in mice of one wild type labeled with different 24-nt barcodes and the 12 mutant strains prepared in Example 1, the following experiment was performed using the qPCR CI method described above. Performed.

Specifically, a total of 13 strains of Salmonella were cultured for 12 hours or more after inoculation in Luria Bertani (LB) broth, respectively. After standardization by measuring the absorbance at 600 nm (Optical Density; OD ₆₀₀ ), the culture solution of each strain corresponding to the same amount is mixed, washed with PBS and diluted to 10 ⁵ colony-forming units ( CFU)/ml) concentration of strain mixed turbid solution was prepared. Pathogenicity was compared on days 2, 5, and 7 after Nramp1 ^+/+ 129SvJ female mice (4-5 weeks old) were infected with an intraperitoneal infection (ip infection) with a strain mixture to a ^{concentration of 10 4 CFU/mouse.}

Nramp1 ^+/+ 129SvJ mice supply various factors, including iron and magnesium, which are essential for the proliferation of Salmonella in the phagosome through the Nramp1 (or Slc11a1) protein distributed in the membrane of the phagosome. It is a species that has improved resistance to various pathogenic bacteria including Salmonella by limitation, and is used when research on long-term infection is required using these characteristics. Therefore, compared to normal BALB/c mice that die within a week when injected into the abdominal cavity of wild-type Salmonella, Nramp1 ^+/+ 129SvJ mice can survive up to 1 month when the inoculation amount is adjusted (Wyllie S, et al., Microbes Infect. 2002, 4(3):351-359; Lawley TD, et al., PLoS Pathog. 2006, 2(2):e11.Epub 2006 Feb 24).

^{In the present invention, Nramp1 +/+} 129SvJ mice, which have some degree of resistance to Salmonella infection, were used to prevent the host from dying at the beginning of infection when inoculated at the same time. The inoculation amount of the mouse was confirmed by measuring the number of viable cells by diluting the strain mixed solution (INPUT) and culturing it on agar medium. After washing the cell suspension corresponding to 2 x 10 ⁸ CFU of the injected samples with distilled water, nested PCR and real-time PCR were successively performed as a template, and the number of each strain in the injected sample was relatively measured through the Ct value.

On the 2nd, 5th, and 7th days after the infection of the host, 5 mice were euthanized, and the spleen was separated, pulverized in 0.1% Triton X-100 solution, homogenized, and the lysate was spread on an agar plate. Salmonella was grown. The next day, the colonies on the plate were scraped and made into a cell suspension using PBS, and used as a product (OUTPUT) sample. ^{After washing the cell suspension corresponding to 2 x 10 8} CFU of the product sample with distilled water, nested PCR and real-time PCR were successively performed as a template, and the number of each strain in the OUTPUT sample was relatively measured through the Ct value, Using the Ct values of each strain obtained from the injection and product samples, the viability of each strain in the host was compared with that of the wild-type strain.

As a result, as shown in FIG. 3, three strains (ΔSTM2875, ΔSTM3096, and ΔSTM4332/4333) with a significantly reduced viability by 10 times or more in the spleen in the host on the 5th and 7th days after infection could be selected, The three strains of ΔSTM2875, ΔSTM3096, and ΔSTM4332/4333 were selected as attenuated strains suitable for anticancer treatment as strains with significantly reduced viability in the spleen from 2 days after infection with the host (Fig. 3).

< Experimental example 3> Verification of primary selected strains using Competitive Index (CI)

In order to retest the viability of ΔSTM2875, ΔSTM3096 and ΔSTM4332/4333 selected in <Experimental Example 2>, only two strains including the mutant strain and the reference strain were infected to compare the viability of the mutant strain in the host. The traditional CI method (Ho TD, et al., J Bacteriol. 2002, 184(19):5234-5239) was implemented.

The traditional CI method is a method of comparing the viability between two strains by mixing one mutant strain and one wild-type strain serving as a reference. At this time, wild-type Salmonella (MA6054; Ho TD et al., Identification of GtgE, a novel virulence factor encoded on the Gifsy-2 bacteriophage of Salmonella enterica serovar Typhimurium. J Bacteriol . 2002, 184(19):5234-5239) is chromosomal DNA. Since there is a β-galactosidase synthesis gene that induces expression with arabinose, 5-bromo-4-chloro, a substrate in the presence of arabinose (1 mM), is present even when mixed with a mutant strain. -3-indolyl-β-D-galactopyranoside (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal)) (40 ㎍ / ㎖) Make it blue. CI was performed using the difference in phenotype, and the formula for obtaining the traditional CI value is shown as follows.

When the CI value is 1, it indicates that there is no difference in viability between the reference strain and the mutant strain, when the CI <1 indicates that the viability of the mutant strain is lower than that of the reference strain, when the CI >1, the viability of the mutant strain is It means high compared to the reference strain.

Specifically, the reference strain MA6054 and the three mutant strains ΔSTM2875, ΔSTM3096, and ΔSTM4332/4333 were cultured in LB liquid medium for 12 hours or longer, and then _{the strain was standardized using the OD 600} value, and the MA6054 strain and each mutant strain were 1: After mixing with PBS so as to be mixed at 1, Nramp1 ^+/+ 129SvJ mice (female, 4-5 weeks old) were injected intraperitoneally so as to be ^{10 4 CFU/mouse.} The number of inoculated bacteria and the ratio between strains in the injection sample used at the time of inoculation were confirmed by diluting and spreading the inoculum containing arabinose and X-gal on an agar plate. On the 2nd, 5th and 7th days after infection, 3 mice were euthanized for each strain, the spleen was separated, the lysate was diluted, and smears were cultured in a medium containing arabinose and X-gal. Using the method of <Equation 2>, the ratio between the MA6054 strain and each mutant strain in the product sample was calculated, and the CI value was calculated by dividing by the ratio between the strains in the injection sample.

As a result, as shown in FIG. 4, three strains of ΔSTM2875, ΔSTM3096 and ΔSTM4332/4333 have the same viability in the host from the 5th day after infection ^{with Nramp1 +/+ 129SvJ mice in the same manner as the qPCR CI result of <Experimental Example 2>.} By confirming the decrease, it was verified that the viability of Salmonella in the spleen cells in the host decreases from 2 days after infection when the three kinds of genes are absent.

< Experimental Example 4> Comparison and confirmation of the viability of Salmonella strains in normal host organs after infection

In order to examine the growth rate in the host when the mutant strain was infected alone using ^{Nramp1 -/-} BALB/c mouse, which is a mouse model commonly used in studies for chemotherapy using Salmonella, the following experiment was performed.

Specifically, Nramp1 ^-/- BALB/c mice were inoculated with mutant strains or wild-type Salmonella, respectively, and then the viability in the spleen of the host was compared for each time period.

The wild-type strain and three strains of ΔSTM2875, ΔSTM3096, and ΔSTM4332/4333 were each cultured in LB liquid medium for 12 hours or longer, and then washed and diluted with PBS. ^{Each of the strains was injected intraperitoneally into Nramp1 -/-} BALB/c mice so that the final strain concentration was 10 ⁸ CFU/mouse, and the number of inoculated bacteria was confirmed by diluted smear culture on an agar plate. After inoculation, three mice per strain were euthanized, and then the lysate of the spleen of the host was diluted and smeared on an agar plate to measure the number of viable cells.

As a result, as shown in FIG. 5, ^{when comparing the proliferation rate of each strain in Nramp1 -/-} BALB/c mice, the three mutant strains showed viability not significantly different from the wild-type strain, but the infected host All died within 7 days, and the decrease in the viability of Salmonella in the spleen with the passage of time could no longer be compared (FIG. 5). This is because the three strains selected in <Experimental Example 2> and <Experimental Example 3> using ^{the Nramp1 +/+ mouse are Nramp1 -/-} hosts whose resistance to Salmonella is weakened, and thus the pathogenicity of the strain is strong. It was shown that the possibility of utilization as a strain was small.

< Experimental Example 5> ppGpp production mechanism and Salmonella pathogenic gene of the strain was deleted in Nramp1 ^-/- BALB/c mice confirmed the viability in the spleen

<5-1> Production of double mutant strain lacking ppGpp

As confirmed in the <Experimental Example 4>, the ΔSTM1397, ΔSTM2875, and ΔSTM4332/4333 strains are unlikely to be used as therapeutic strains because the pathogenicity of the strain acts strongly ^{in the Nramp1 -/- host whose resistance to Salmonella is weakened.}

On the other hand, the Δ relA / spoT strain, which cannot produce ppGpp, is known to be safe even when infected with a host due to its reduced pathogenicity as a strain that has been widely used in anticancer treatment studies using existing Salmonella.

Thus, the present inventors relA to ΔSTM1397, ΔSTM2875, ΔSTM4332/4333 strains And By additionally removing the spoT gene, a double mutant strain lacking additional ppGpp, which is important for pathogenicity, was constructed.

*Specifically, relA / spoT The removal of the gene was carried out by introducing the relA :: cat , spoT :: kan traits into each of the three mutant strains through transduction using P22 bacteriophage (Margolin P. 1987. Generalized transduction. In Neidhardt F, Ingraham J, Low K, Magasanik B, Schaechter M, Umbarger H. 1987. Escherichia coli and Salmonella Typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, DC; Masters M. 1985. Generalized transduction. In Scaife J, Leach D, Galizzi A (eds). Genetics of Bacteria, p. 197-205. Academic Press, NY).

SHJ2037 (relA :: cat , spoT :: kan ; Song M, et al., J Biol Chem. 2004, 279(33):34183-34190) strain cultured in LB liquid medium to the stationary phase. /1 int -201 phage lysate (10 ⁸ -10 ⁹ plaque-forming unit/ml) was added at 1:4, incubated for 8 hours or more, centrifuged to obtain a supernatant, and a small amount of chloroform was added thereto. After sterilization, a P22 lysate of SHJ2037 donor cells was obtained.

*Three ΔSTM2875, ΔSTM3096 and ΔSTM4332/4333 strains to be used as recipient cells were cultured in LB liquid medium until stationary phase, and then 10 µl of P22 lysate of SHJ2037 was added to 100 µl of each culture solution (10: 1) Reaction at 37°C for 15 minutes. 900 µl of LB EGTA (10 mM EGTA in LB liquid medium) was added to the culture solution and reacted for an additional 20 minutes, followed by smear culture on an LB agar plate containing chloramphenicol (20 µg/ml) for transduction. The colony in which this occurred was secured.

Among the colonies resistant to chloramphenicol, EBU (trypton 1%, yeast extract 0.5%, NaCl 0.5%, dextrose 0.25%, K ₂ HPO ₄ 0.25%, evans blue 0.00125%, uranine) ) 0.0025%) colonies having a white phenotype were first selected by culturing on a plate to exclude the possibility of contamination of lysogenic phage, and subsequently the first selected colonies were cross-streaked into the lysate of P22 H5 phage ( Cross-streaking), and then by examining whether clear plaques were formed after infection, colonies obtained by homologous recombination of only the relA :: cat trait without contamination of Yongwon phage were selected.

spoT :: kan of Transformation was also performed using P22 transduction in a medium containing kanamycin (50 μg/ml) in the same manner as above, so that YC0843 (ΔSTM2875, Δ relA / spoT ), YC0844 (ΔSTM3096, Δ relA / spoT ) And YC0845 (ΔSTM4332/4333, Δ relA / spoT ) three kinds of double mutations were constructed.

<5-2> Confirmation of the viability of the double mutant strain

To examine the possibility of developing three double mutants (YC0843, YC0844, YC0845) produced by P22 transduction in Experimental Example <5-1> as a strain for anticancer therapy, Salmonella among the normal organs of the host The viability of double mutant strains in the spleen associated with systemic infection was compared.

In order to compare the viability between the ppGpp-deficient strain and the double mutant strain used in existing anticancer treatment studies, the SHJ2037 ( relA :: cat , spoT :: kan ) strain was used as a reference Salmonella strain. SHJ2037, YC0843, YC0844, and YC0845 strains were each cultured in LB liquid medium for 12 hours, washed with PBS, and inoculated to BALB/c mice (male, 5 weeks old) to become 10 ⁸ CFU/mouse due to intraperitoneal infection. The Salmonella turbid solution used for inoculation was diluted and used to measure the inoculum by smear culture. On the 1st, 2nd, 3rd and 8th days after host infection, the spleen was isolated from 3 mice per each strain, homogenized in Triton X-100 (0.1%), and then smeared on an agar plate to measure the number of viable cells.

As a result, as shown in FIG. 6, the proliferation degree of all three strains decreased from the second day after infection compared to SHJ2037 (Δ relAspoT ), and in particular, YC0843 (ΔSTM2875, Δ relA / spoT ) was close to 10 times compared to SHJ2037. It was confirmed that the viability decreased (FIG. 6 ).

Therefore, when Salmonella is infected with tumor-bearing mice, considering that Salmonella clusters into tumor cells within 1 day after infection, strains such as YC0843, which can be quickly removed from normal tissues from the 2nd day after infection, are immune to the host. It is expected to be suitable for suppressing tumor proliferation while minimizing the negative effects of system disturbance and Salmonella infection.

< Experimental Example 6> Comparison of viability of YC0843 Salmonella strain in tumor tissues and normal organs

YC0843 (ΔSTM2875, Δ relA / spoT ) with a significant decrease in viability in the normal spleen from the 2nd day after infection in the <Experimental Example 5> When the strain was infected into a tumor-transplanted host, the following experiment was performed to investigate the targeting ability of YC0843 to tumor cells and the inhibitory effect on tumor proliferation.

Specifically, CT-26 mouse epithelial carcinoma cell line (ATCC CRL-2638) was used in DMEM medium containing glucose (4.5 g/L) (10% fetal bovine serum, 1% penicillin-streptomycin). Included), washed with PBS and ^{diluted to a concentration of 10 7} cells/ml, followed by subcutaneous infection (sc infection) into the right thigh of BALB/c mice (male, 5 weeks old). After the tumor cells are injected, the size of the tumor is measured every 2 days until the diameter is 4-7 mm, or the tumor volume is 100-130 mm ³ (length*width*depth/2)(Length*Width *Depth/2) tumor tissue was proliferated. When tumors of an appropriate size were grown in the host, 10 ⁸ CFU of Salmonella strain per mouse was injected intraperitoneally. Salmonella strains used for inoculation were SHJ2037 and YC0843 strains, each cultured in LB liquid medium for 12 hours, washed with PBS, ^{diluted to 10 6} CFU/µl, and injected into the intraperitoneal cavity of the mouse with 100 µl and inoculated into the host. The number of Salmonella strains used for inoculation was confirmed by measuring the number of viable cells by smear culture. On the 1st, 2nd, 3rd and 9th days after infection, 3 mice were euthanized for each strain, the tumor and spleen were separated, homogenized in 0.1% Triton X-100, and the diluted lysate was added to an agar plate. The number of viable cells was measured by smear culture. In addition, by measuring the weight of each separated tissue, the measured value of the number of viable cells per host individual organ was corrected.

As a result, as shown in FIG. 7, when comparing the targeting ability to tumor tissue and viability in spleen tissue of SHJ2037 and YC0843 strains in BALB/c mice transplanted with CT-26 tumor cells, YC0843 strain It was confirmed that the target effect on the tumor tissue was 100 times or more superior to that of the normal tissue (FIG. 7).

In addition, when comparing the viability of the YC0843 strain and the SHJ2037 strain in the spleen, which is a normal organ, it was observed that the viability of the YC0843 strain decreased from the second day of infection compared to the SHJ2037 (Fig. 7), and due to this, the YC0843 strain was used for chemotherapy. In this case, it was confirmed that damage to normal organs caused by Salmonella infection can be reduced.

<Experimental Example 7> Confirmation of tumor growth inhibitory effect by YC0843

In order to investigate the proliferation inhibitory effect of the YC0843 strain on tumors, the tumor mice used in Example 6 were infected with the YC0843 strain and then compared with the tumor mice mock-infected with PBS instead of Salmonella on the 9th day of infection. The weight of the tumor was measured.

As a result, as shown in FIG. 8, it was confirmed that the mouse infected with the YC0843 Salmonella strain reduced the weight of the tumor by about 1/3 compared to the case not infected with Salmonella (Mock) (FIG. 8). Therefore, YC0843 (ΔSTM2875, Δ relA / spoT ) strain, which significantly decreases the viability in the normal spleen while maintaining the target ability to tumor cells, can be usefully used to treat tumors while minimizing the negative effects caused by Salmonella infection. Confirmed that there is.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Novel Salmonella for treatment of cancer, and use thereof <130> 2016P-11-034 <150> KR 10-2014-0164469 <151> 2014-11-24 <160> 83 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer K1 <400> 1 cagtcatagc cgaatagcct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer K2 <400> 2 ttgtcaagac cgacctgtcc 20 <210> 3 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> bcfH-F <400> 3 gggaggcttt ccgaacttat cgaacgagac ttttattatg attccgggga tccgtcgacc 60 60 <210> 4 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> bcfH-R <400> 4 ctcctctgag cgaatatcac cccttcgctt tctgaatcgc gtgtaggctg gagctgctcc 60 60 <210> 5 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> STM0289-F <400> 5 ctatttattt taatccggta ttaaaggagt cactaccatg attccgggga tccgtcgacc 60 60 <210> 6 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> STM0289-R <400> 6 cacaatttaa atttatttag cattttgctt caacttcccc gtgtaggctg gagctgctcc 60 60 <210> 7 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> cstA-F <400> 7 gtaacatctc tctggaacac ccaaacggac aacaactatg attccgggga tccgtcgacc 60 60 <210> 8 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> cstA-R <400> 8 tattgatgta aaaagattag tgcgcgcctt tcgcctgcgt gtgtaggctg gagctgctcc 60 60 <210> 9 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> glnQ-F <400> 9 ttattttgcg tcgtcttgaa agaaggatga aaatcctgtg attccgggga tccgtcgacc 60 60 <210> 10 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> glnQ-R <400> 10 ctggaagggc gatatctcag gagacgtgct gtaaaaattc gtgtaggctg gagctgctcc 60 60 <210> 11 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> STM0839-F <400> 11 tactctcccg gaaaataatt caaaagaact cacccgcttg attccgggga tccgtcgacc 60 60 <210> 12 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> STM0839-R <400> 12 caattacccc gatttctcaa tgagcattac actcatcttc gtgtaggctg gagctgctcc 60 60 <210> 13 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> STM1024-F <400> 13 acacactgcg ccatccgagc tatcggaggt gaggcttatg attccgggga tccgtcgacc 60 60 <210> 14 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> STM1024-R <400> 14 gaaatcggac gtggactcac gctaagtgag agcgaaatcc gtgtaggctg gagctgctcc 60 60 <210> 15 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> sseA-F <400> 15 ttagcacgtt aattatctat cgtgtatatg gaggggaatg attccgggga tccgtcgacc 60 60 <210> 16 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> sseA-R <400> 16 ctgaagacat tatgctttac ctttttgttt ttcctgacgg gtgtaggctg gagctgctcc 60 60 <210> 17 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> hilD-F <400> 17 gtaaggaaca ttaaaataac atcaacaaag ggataatatg attccgggga tccgtcgacc 60 60 <210> 18 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> hilD-R <400> 18 tgtctatgtt ttttacaatt accaagcggt aaaaatactt gtgtaggctg gagctgctcc 60 60 <210> 19 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> yqgP/yqgF-F <400> 19 tgtcgttttt ttgaaccagg aaacagaacc tctgacaatg attccgggga tccgtcgacc 60 60 <210> 20 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> yqgP/yqgF-R <400> 20 gctgacaaaa acggctttaa tacccctgtt caaaatagct gtgtaggctg gagctgctcc 60 60 <210> 21 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> rsd-F <400> 21 gatttatggg ataaatttaa agtcacattt ggaatcaatg attccgggga tccgtcgacc 60 60 <210> 22 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> rsd-R <400> 22 ttaatgaata aatgaattat tttttcatga ctcttgtttc gtgtaggctg gagctgctcc 60 60 <210> 23 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> yjaG-F <400> 23 ggtaaactgc cgctaatttc cgattcgaga ttccatcatg attccgggga tccgtcgacc 60 60 <210> 24 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> yjaG-R <400> 24 atcacgtttt ctggtgtcat tgctgaaaat ttataccgat gtgtaggctg gagctgctcc 60 60 <210> 25 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> yjeJ/yjeK-F <400> 25 gccctctgaa attgttaact ggtagctaag ccacaaaatg attccgggga tccgtcgacc 60 60 <210> 26 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> yjeJ/yjeK-R <400> 26 tcagagggcg atatggttag cgtttttcct gcgatgatgc gtgtaggctg gagctgctcc 60 60 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> bcfH-F <400> 27 tggcaaagta ttaatgacta tg 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> bcfH-R <400> 28 gatcccataa aatgaatctg ag 22 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> STM0289/0290/0291-F <400> 29 ttattttcat ggctcttgtc ag 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> STM0289/0290/0291-R <400> 30 tacagcttag gtcatcccat ac 22 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> cstA-F <400> 31 aaggaagtga tctggttaac ac 22 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> cstA-R <400> 32 ggcacgccaa tcatcatttt tg 22 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> glnQ-F <400> 33 cacctcgttg tttattgtta tc 22 <210> 34 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> glnQ-R <400> 34 atgactcctc cagtgagaaa ag 22 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> STM0839-F <400> 35 ttttggaacg cttttttggc c 21 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> STM0839-R <400> 36 cgcagaaaac attaaacaaa tc 22 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> STM1024-F <400> 37 accaatttca ttaggtcgct tc 22 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> STM1024-R <400> 38 atttcggttt ctagcacata ac 22 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sseA-F <400> 39 tagtacgtga ggtttgactc g 21 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sseA-R <400> 40 atttattatt tgcgatagcc tg 22 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> hilD-F <400> 41 ctgttagcga tgtctgtcg 19 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> hilD-R <400> 42 aaaggcagga gggttatg 18 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> yqgP/yqgF-F <400> 43 aatctattgc ccgataaggc ag 22 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> yqgP/yqgF-R <400> 44 tgaagtttct atggcgcaac c 21 <210> 45 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rsd-F <400> 45 aaatgtcccg cgtaaacaat c 21 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rsd-R <400> 46 attattgtcg ccaccgctat tc 22 <210> 47 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> yjaG-F <400> 47 agcgctgtat gaaagggtat c 21 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> yjaG-R <400> 48 ggaaatgcca gaaaagcact c 21 <210> 49 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> yjeJ/yjeK-F <400> 49 ttacccggtt tcacgaattc ac 22 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> yjeJ/yjeK-R <400> 50 tgctgtatgg cgtaagtagt c 21 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> scarF <400> 51 attccgggga tccgtcgacc t 21 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> scarR <400> 52 gtgtaggctg gagctgctcc 20 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM0028 <400> 53 aatgctgttc ttgatcgtga tagt 24 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM0289/0290/0291 <400> 54 aaaagactga ttgcaaaaat aagg 24 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM0600 <400> 55 caaagtgcaa tgagagtact tggc 24 <210> 56 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM0828 <400> 56 atcattaatg ctctgaccct gagc 24 <210> 57 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM0839 <400> 57 agtaatgtca ttgatatggc taac 24 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM1024 <400> 58 gtggttgctc gggatattgg cagt 24 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM1397 <400> 59 attccaatgc aaggtgcaac cagc 24 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM2875 <400> 60 ggacgcatga ttgttggtgg gcgc 24 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM3096 <400> 61 agccgtgaaa gtgttggcgt ccgg 24 <210> 62 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM4156 <400> 62 attggtaaaa ggcatgtgga cagc 24 <210> 63 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM4169 <400> 63 agtattgaaa ttcacaaaaa tctg 24 <210> 64 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM4332/4333 <400> 64 cgcagtggag atgatggtgt gggt 24 <210> 65 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 24-nt-STM0314 <400> 65 agggcgaacg ccagtgctgt tgcc 24 <210> 66 <211> 846 <212> DNA <213> Salmonella-bcfH-gene <400> 66 atgtattatc acgcgttaaa actttcccga ctggcgatgt tgacgttggc aggcgttgcc 60 gtatccgcct cggcaatcgc cgccgattct gccccgacgt cgcaaattgg tccgacggcg 120 gaagcctaca tcgtcagtca tccggataaa gtgggagagg tcgtggcaac gtatttggcc 180 gaacatccgg aatttttggt cgccgccagc gagacgttgc atcagcgtca gcagattgcg 240 caacaacagg cgtatgttca actggcatta cagtatcgtg ctgagttgct cagtagcagc 300 agtccttccg ttgggcccaa cgaggcaaaa gcggcggtgg tgatgttctt tgattaccag 360 tgctcgtggt gcagcaaaat ggcgcctgtg gtcgaaaacc tgattaaggc gaacccggat 420 acccggttta ttttcaaaga gtttcctatt ttttcctccc gctggccggt atccggactg 480 gcggccagag tcggcgaaca ggtatggctt acacagggcg gggcgaaata tctcgactgg 540 cataatgcgc tttatgccac agggaaggtg gaaggcgcgt taacggaaca cgatgtctac 600 accctggcgc aacattatct aacgccgacg cagctggccg ccgtaaaaga agcgcaaagc 660 agcggtgcag tacatgatgc gctcctcact aaccaggcac tggcgcagca tatggacttt 720 agcggcacgc ctgcttttgt cgtcatgcct cagacgcaag acggtgatgt aaaacgggtg 780 accgtgatcc cgggaagcac gactcaggat atgttgcaaa tggcgattca gaaagcgaag 840 gggtga 846 <210> 67 <211> 2190 <212> DNA <213> Salmonella-STM0289-gene <400> 67 atgagttttg tatccacaaa taataaatcc ggtatgggag ggctgacgac aaccacgccg 60 ccgataaccg gagaaagtgg cggtgtcacc gcagattcag tcgccggaag cgtggcagat 120 gcggcggaat ccgccgtgga acaggctgcg ggatcgctat ttggcgcatt gccggagcca 180 tcaggactgg tgaaagccgc ggtagcagcg gcgcaggctg ccgccgccgc aggtatggcg 240 caggatgcgg tatcggccat cgtctctgct gttgcaggcg ggccgggggc gcataatgtg 300 acggtcagcg gcagcgccgt accgccgggc gcattactgt tcgccagcct ggacggcggc 360 gaaacattaa gtgaactgtt cagctatgtg gtacagctaa aaacgcccga caccctgaat 420 ctgggctatg tctccccggc ggccaacctg ccgctcaaac cgatggtggg caaagatctg 480 tgcgtcaaca tcgaactgga tggtggcggt aaacgacata tcagcgggct ggtcacggcg 540 gcgcgggtgg tgggccatga agggcgttcg gttacctatg agctgcgtat ggagccgtgg 600 gtaaaactgc tgacccatac cagcgactac aaagcattcc agaataaaac cgtggtggat 660 attctggatg aggttctggc ggaatatccc tacccggtgg aaaagcggct ggtggaaagc 720 tacccggtac gcacctggca ggtgcagtac ggtgaaactg attttgattt tcttcagcga 780 ctgatgcagg agtggggcat ctactggtgg tttgagcaca gcgaggacag ccacacgctg 840 gtgctggcgg atgccatcag cgcccacaaa gcatgtccgg actcgccgct ggtcgagtgg 900 caccaggaag ggctgaagct ggacaaggag tttatccaca ctatcacggc aaacgagagc 960 ctgcggactg gacagtgggt gctggatgat ttcgatttta cgaagccacg ttcattgctg 1020 gcaaacaccg tggcaaaccc gcgtgaaacc ggtcatgcca cctacgagca ttatgagtgg 1080 ccgggagact acttcgacaa gagtgaaggc gagatgctga cgcgcattcg tatggaagcg 1140 cagcgcagcc ccggcagtcg ggtgctgggg ggagggaata tccgcacact catgaccggt 1200 tataccttca cgctggaaaa ctatcccacc gccgaagtca atcaggaata tctgctgatg 1260 cagaccttgc tgtttgtgca ggacaacgcg cagcacagcg ggcaggacca gcactttacc 1320 ttttccaccc gttttgaact gcaccccacc cgcgaggtgt tccgcccgca gcggacggtg 1380 agcaaacccc acaccaaagg gccgcagagc gccatcgtca ccggcccggc gggccaggaa 1440 atctggacgg atcagtacgg gcgggtaaag gtacagtttg gttgggatcg ctacggcaaa 1500 atggatgaaa acagctcctg ctggatacgc gtcagctacc cgtgggcggg caaaggcttc 1560 gggatgatcc agatcccgcg tatcggccag gaagtgctgg tggatttcaa aaacggcgat 1620 ccggatctgc cgatcatcgt ggggcgtacc tacaaccagg acaccatgcc gccgtgggga 1680 ctgccgggaa tggcgtcgca gagcgggatc ttcagccact cgctgtatgg cgggccaacg 1740 aacggcaaca tgctgcgttt tgacgacaaa acgggcgcgg aggaagtgaa gttccacgcg 1800 gaaaaagatc tcaacaccac ggtgaagaat aatgaaacgc atacggttat ggtggatcgc 1860 actaaaacca ttattaaaaa tgaaaccaac agtattggtg aggacagaaa caccacggta 1920 acgaagaatg acggcctttc cgtaaaactg gcgcagacga tcaatatcgg caccacttat 1980 cgtttagatg ttggcgatca attcacgctt cgctgcggca atgcggcgct tgttttacat 2040 aaggacggct ccattgagtt ttgtggcaag caactgatgt tacataccag cgatgtcatg 2100 caactgattg gtaaaggtat tgatatgaac ccggatggcg gcacagccgt aaccgccgat 2160 gatattgccc cccttctcac ctctgagtga 2190 <210> 68 <211> 447 <212> DNA <213> Salmonella-STM0290-gene <400> 68 atggatcgac cataccgcat acaggaaggg tgttttgtcc tgcctgaaac atttacggat 60 cgcagcgtca atatttttat cctggagggc aatgaacgaa catcgcccag cctgaatatt 120 tcccgcgata cgctaaaacc tgatgaagac ctgcccgcct atattgaccg ccagattgca 180 ctgatgaaaa aaaatctcgg tcagcaccgg gtattgtcgc gagcgcctgc acaggcagga 240 acgggcaatg atgcccttat gggggaacaa attgccgcca cccataaatc cgggaaaacg 300 gaagtgtacc agcgtcaggc cgggtttatt gcaacccctg gcaaggtact ggtcttcacc 360 ctgaccagtc cccgtccttt tgatgataaa gcagacctac tctggaacac ctggctggca 420 ggctttcagc cggataaaaa cgaataa 447 <210> 69 <211> 4095 <212> DNA <213> Salmonella-STM0291-gene <400> 69 atgtatgaag cagcccgtgt ggatgatcct atctaccaca ccagcgcgct cgccgggttt 60 cttatcggcg ctatcatcgg catcgccatt atcgcgcttg ccgcctttgc cttctttagc 120 tgcggttttc ttgccgggct gattctgggt tttatggccg atcaaatagc ctccggggta 180 ttgcaactgg gcgaggccat cgggcgctcc atccaccaca cggcaggaaa aatcctcacc 240 ggttcggaga atgtcagcac caacagtcgc ccggcggcgc gcgcggtact gagtacggtg 300 aaatgcgata accatatcgc agaaaaacgc atcgcccaag ggtcggaaaa tatctacatc 360 aacagccagc ccgccgcccg taaggatgac cacaccgaat gcgacgcggt gattgaagac 420 ggttcgccga atgtgtttct cggcggcggc acacagacgg tactggaaat cagttctgaa 480 attccggact ggctgcgcaa ggtggtggat gtattgtttg tcgtggcgag tctgctcggc 540 gggctggccg gggcgtggcg gcaggcggca aagctgggga cgaaatttgg cactaaatgt 600 gccgctaagt ttatcggcgg ggagcttgtc gggatggccg tgggtgaggc tatcagcggg 660 ctgttcagca atccggtgga tgtgaccacc gggcagaaaa tcctgctgcc ggaaacggac 720 ttcaccctgc ccggtcgcct gccggtcacc tgctcgcgtt tttacgccag ccacctggaa 780 actgtgggac tgttgggacg gggctggcgg ctgaactggg aaaccagcct gcgcgatgac 840 gatgaacaca tcacgctgac cggcgtacag gggcgggaac tgcgttaccc gaaaacgatg 900 ctgacgcccg gccaccagat atttgacccg gaagaacagt tatacctcag ccgcctgcat 960 gacgggcgtt acgtgctgca ttacaccgat cgcagctatt acgtatttgg tgattttgac 1020 agtgacggca tggcatacct gctgtttatg gagacgccgc accgccagcg cattgtcttc 1080 gggcacgaag gaggcagact ggtacggata gcctccagca gcgggcatca cctgttactg 1140 caccgcacac agaccccggc aggggagcgg ctgtcgcgaa ttgaactggt gcagggcggc 1200 acccgtggca atctggtgga gtaccggtat gacgataacg gtcaactgac cggcgtggtg 1260 aaccgggcgg gaacgcaggt gcgtcagttt gcttatgaaa acgggctgat gacggcgcac 1320 agcaatgcga cggggttcac ctgccgctac cgctggcagg aactcgacgg cgcgccgcgc 1380 gtgacggagc acgacaccag tgacggcgaa cattaccgct ttgactatga ttttgccgca 1440 ggcaccacca ccgtcaccgg caggcagggg gagacatggc agtggtggta cgacagggaa 1500 acgtatatca ccgcgcaccg gacgccgggc ggtggaatgt accgcttcac gtacaacgaa 1560 gaccacttcc ctgtcaacat tgagctgccc ggcggtcgca cggtggcgta tgaatatgac 1620 atccagaacc gggtggtgaa gacgacagat ccggaaggcc gggtgacgca gacgcagtgg 1680 aacggcgagt tcgacgaaat cacgcgcacg gcgctggacg atgacgctgt ctggaaaacg 1740 cagtacaacg cccacggcca gccagtgcag gagacggacc cggaagggcg ggtgacgcag 1800 tacgcttacg atgaacaggg gcagatgtgc agccggacgg atgcggcggg cggcacggtg 1860 gtgacggcgt tcgacagccg ggggcagatg acgcggtaca ccgactgttc agggcgcagc 1920 acaggatatg accacgatga ggacggcaac ctgacgcggg tgacggacgc ggaagggaag 1980 gtggtacgca tcagctacaa ccgacttggg ttgccggaga cggtaaactc accggggaaa 2040 cagcaggaca ggtatacctg gaatgcgctg gggctgatga gcagccaccg gcgcatcacg 2100 gggagcgtgg agagctggcg gtatacgccg cgcggtctgc tggcggcgca cacggatgag 2160 gagaagcgcg agacgcgctg gcagtacacg ccggaaggcc gggtggcagc gctgaccaac 2220 ggcaacgggg cgcagtaccg gttcagtcac gatgcggacg gcaggctggt gcgtgaggtt 2280 cgcccggacg gactgagccg tacttttatc ctggacgaca gcggttatct gacggcgata 2340 cagaccacgg gcacgcaggg cggcgtgcgg cgggagacgc agcagcggga tgcgctgggc 2400 cgtctgttac ggacggagaa tgaacacggc cagcggacgt tcagctacaa ccggctggac 2460 cagataacgg cagtgacgct cacgcccacg gaggcggggc aacagcagca ccggatgcag 2520 gccgacacgg tgcgttttga gtatgaccgc agcggctggc tgacggcgga gcacgcgggg 2580 aacggtagca tatgttatca gcgcgacgcg ctgggcaacc cgacggacat cacgctgccg 2640 gacgggcagc acctgacgca tctgtattac gggagcgggc atctgttaca gacggcgctg 2700 gacggcctga cggtgagcga gtatgagcgc gacagcctgc accgtcagat aatgcgcacg 2760 caggggcagc ttgcgacgta cagcggctat gacgacgacg ggctgctgag ctggcagcgc 2820 agtctggcgt ccggcagtgc ccctgttctt cctggccagc gcccggcgcg gcagggctgc 2880 gtgacgtcga gggactatta ctggaacaac cacggcgagg tgggcacgat tgacgacggc 2940 ctgcgtggca gcgtggtgta cagctatgac agaagcggtt acctgaccgg gcgctcaggt 3000 cagatgtatg accatgaccg ttattattac gataaggcgg gcaacctgct ggataacgaa 3060 gggcagggag cggtgatgag caaccggctg ccgggctgtg gtcgtgaccg ttacggctat 3120 aacgagtggg gcgagctgac cacgcggcgc gaccagcaac tggagtggaa cgcgcagggg 3180 cagctgacgc gggtcatcag cggcaacacg gagacgcact acggctacga tgcgctgggg 3240 aggcgaaccc gcaaggcgac gtacgggcgg cacacgggcc atacggcgcg gagccggacg 3300 gactttgtgt gggaggggtt caggctgttg caggagaacg tgcagcagca gggctggcgg 3360 acctatctgt acgatgcgga acagccgtac acgccggtgg cgagcgtgac ggggcgggga 3420 gaaagcaggc aggtgtggta ttaccacacg gatgtgacgg gcacgccgca ggaggtgacg 3480 gcggcggacg gaacgctggt gtgggcgggg tatatcaggg ggtttggaga gaatgcggcg 3540 gacatcagca acagcggggc gtactttcac cagccgctgc ggctgccggg gcagtatttt 3600 gacgacgaga cagggctgca ttacaatctg ttcagatatt atgcaccgga gtgtggacgg 3660 tttgtcagtc aggatccgat cgggctgagg ggcgggttaa acctttatca gtatgcgcca 3720 aatcctctca aatatataga cccacttggt ttaaccgcga ctgttgggcg atggatgggg 3780 cctgcggaat atcagcaaat gcttgatact gggacagtag tacaaagttc aacagggaca 3840 actcatgttg cctaccctgc tgatatagat gcttttggta agcaagcaaa aaatggtgct 3900 atgtatgttg aatttgatgt gcctgaaaaa tcattagtac ctacaaatga aggatgggca 3960 aaaatagtag ggccagattc tatcgaaggg cgattagcta aacgcaaagg tttgcctgtt 4020 cctgaaatgc caacagcaga aaacataact gtaaggggcg agaaaattaa tggggaagtt 4080 gaagcaaaat gctaa 4095 <210> 70 <211> 2106 <212> DNA <213> Salmonella-cstA-gene <400> 70 atgaataaat cagggaaata cctcgtctgg acagcgctct cagtattggg tgcgtttgcc 60 ctgggctata ttgcgttaaa tcgtggggaa cagatcaacg cgctatggat cgtggtggcg 120 tcggtctgtg tctatcttat tgcgtatcgt ttttatgggc tctatatcgc caaaaaagtg 180 ctggcggttg acccaacgcg tatgacgccc gcggtacgtc ataatgatgg tctggattat 240 gtcccgaccg ataaaaaagt gctgttcggt caccattttg cggccattgc tggcgcaggt 300 ccgctggtcg ggccggtact ggcggcgcag atgggctatc tgccggggat gatctggctg 360 ctggcgggcg tcgtgctggc gggagcggtg caggacttta tggtgctgtt cgtctcgacc 420 cggcgcgatg ggcgttcgct tggcgagctg gttaaagagg agatgggcgc gacggcaggg 480 gtgatcgcgc tggtggcctg ctttatgatc atggtgatca ttctggccgt cctggcgatg 540 atcgtggtga aagcgctgac ccatagcccg tggggaacgt acactgtcgc gttcactatt 600 ccactggcga tttttatggg catctacttg cgttatttgc gtccggggcg catcggcgag 660 gtgtcggtca ttgggctggt atttcttatt ttcgctatta tttccggcgg atgggtggcg 720 gcaagcccaa cctgggcgcc gtactttgat tttactggcg tgcagcttac ctggatgctg 780 gtgggttatg gttttgtcgc ggcggtactg ccggtctggc tgctgctcgc gccgcgtgat 840 tacctctcta ccttcctgaa aattggtacg attgtcggtc tggcggtcgg gattctgatt 900 atgcgtccga cgctgactat gccggcgctg accaaatttg ttgatggtac cggaccggtc 960 tggacgggcg acctgttccc gttcctgttt attaccatcg cctgcggcgc ggtctccggt 1020 ttccatgcgc tcatctcctc cggcacgacg ccgaagatgt tggccaacga aggccaggcc 1080 tgctttatcg gctacggcgg gatgttaatg gaatctttcg tcgccattat ggcgctggtc 1140 tccgcctgta ttatcgatcc gggtgtttac tttgcgatga atagcccgat ggcggtactg 1200 gcgccagcgg ggacagcgga tgtcgtagct tctgccgcgc aggtggtcag tagttggggt 1260 ttcgctatca cgccggatac gttacaccag attgccaatg aagtcggcga acaatccatt 1320 atctcccgcg caggcggagc gccaacgctg gcggtaggga tggcctacat tttacatggc 1380 gcgttgggcg gcatgatgga tgtggcgttc tggtatcact tcgccattct gtttgaagcg 1440 ctgtttattc tgacggcggt ggatgcgggc acccgtgcgg cgcgctttat gttgcaggat 1500 ttgttgggcg tagtgtcgcc agggctgaaa cgtaccgatt cgttgccagc gaacctgctt 1560 gctacggcat tgtgcgtgct ggcgtggggg tatttcctcc atcagggcgt ggtcgatccg 1620 ttgggcggta ttaacaccct gtggccgctg tttggcatcg ctaaccagat gctggcgggt 1680 atggcgctga tgctttgcgc cgtggtactg ttcaaaatga agcgtcagcg ttatgcgtgg 1740 gtcgcgctgg tgccgacggc ctggctgctg atttgtacgc tgacggcggg ttggcagaaa 1800 gcgtttagtc cggatgcgaa aatcggcttc ctggccattg ccaataagtt ccaggcgatg 1860 atcgacagcg gcaatattcc gccgcaatac accgaatcgc aactcgcgca gttggtattc 1920 aataaccgtc tggatgccgg gctaaccatc ttctttatgg tggtggtcgt ggtgctggcg 1980 gtcttctcta ttaagacggc gctggccgct ctgaagattg ataaaccgac ggcgaatgaa 2040 acgccgtatg agccgatgcc ggaaaatgtg gatgagatcg tgacgcaggc gaaaggcgcg 2100 cactaa 2106 <210> 71 <211> 723 <212> DNA <213> Salmonella-glnQ-gene <400> 71 gtgattgaat ttaaaaacgt ctccaagcac tttggcccca cccaggtgct acataacatt 60 gatttaaaca tccgtcaggg cgaagtggtt gtgattatcg gcccttccgg ttcgggtaaa 120 tccacgttat tacgctgtat caataaactg gaagagatca cctccggcga tctgattgtc 180 gatggtctga aagtcaacga tcctaaagta gacgaacggc tgattcgcca ggaagccggc 240 atggtgtttc aacagtttta tctgttcccg catctgaccg cgctcgaaaa cgtgatgttc 300 ggtcctctgc gcgtgcgcgg cgtaaagaaa gaagaagcgg aaaaacaggc gaaagctctg 360 ttagcgaaag ttggactggc ggaacgggcg caccactacc cctccgagct ttccggcggt 420 caacaacagc gcgtcgccat tgcccgagcg ctggccgtga agccgaaaat gatgctcttt 480 gacgagccaa cctccgctct ggaccctgaa ctgcgccatg aagtgctgaa agtcatgcag 540 gatctggcgg aagaaggcat gaccatggtc attgtcactc acgaaatcgg ctttgccgaa 600 aaagtcgcct cacggctgat ttttatcgat aaaggccgta ttgccgaaga tggcagtccg 660 caggcgttga tcgaaaaccc gccaagccca cgtttacagg aatttttaca gcacgtctcc 720 tga 723 <210> 72 <211> 744 <212> DNA <213> Salmonella-STM0839-gene <400> 72 ttgttgcgta attatcattc cagtatgaaa caggcaacgt gtgaacttgt ccctgaactg 60 gatttttttg gtttagcagg atggggtaag catgtaatat cgatggttgg atttaaaacg 120 ccttaccctc aggaatcaat cgaacaatgc gtcgcgccag ctcattatcc ccaggaagta 180 aaagagcaag tacgggcaac cagtgcaaat attattttat attataaggg gtatgatact 240 tcacctttag agcaatatgt tgcgttggct gtggttgcag gtgcattaag taacatgggg 300 gctgtcgctg tattaaatga atcggctcac acttcattac ctgcgggggt atttaagtct 360 caggagttgg gtaagcatag tctggaaatg ttgcgtgaag gtttcccgct gacctctcta 420 ttttgtggat ttgtgaaata tgaagttgag gatatcgaag gcgtatggat gcgtacctat 480 ggtgctgatt gctttgggct accagatttc gcagcacacg cacaaggtca tcacgaaggg 540 caaaaatatt ctgatatttt caataatgtt ctgcgttacc tgcttgaaag tggagcagaa 600 atggctgccg ggcataccat gcaagtcggt aaaacgacat ttatgaaact gcgcgatccc 660 cttgacgatg aatattactt acaggggcct ggaaccacat tagtggttga actgattgaa 720 gaagatgagt gtaatgctca ttga 744 <210> 73 <211> 126 <212> DNA <213> Salmonella-STM1024-gene <400> 73 atgaaaatgc acaacgatcc ccattcaatg gactcacaat ctatttttgc tggctcacaa 60 ttactgccaa tggaaaaaac ttctcatttg gctctgagcg tcggatttcg ctctcactta 120 gcgtga 126 <210> 74 <211> 327 <212> DNA <213> Salmonella-sseA-gene <400> 74 atgatgataa agaaaaaggc tgcgtttagt gaatatcgtg atttagagca aagttacatg 60 cagctaaatc actgtcttaa aaaatttcac caaatccggg ctaaggtgag tcaacagctt 120 gctgaaaggg cagagagccc caaaaatagc agagagacag agagtattct tcataaccta 180 tttccacaag gcgttgccgg ggttaaccag gaggccgaga aggatttaaa gaaaatagta 240 agtttgttta aacaacttga agtacgactg aaacaactta atgctcaagc cccggtggag 300 ataccgtcag gaaaaacaaa aaggtaa 327 <210> 75 <211> 930 <212> DNA <213> Salmonella-hilD-gene <400> 75 atggaaaatg taacctttgt aagtaatagt catcagcgtc ctgccgcaga taacttacag 60 aaattaaaat cacttttgac aaatacccgg cagcaaatta aaagtcagac tcagcaggtt 120 accatcaaaa atctttatgt aagcagtttc actttagttt gctttcggag cggtaaactg 180 acgattagca ataatcacga tacgatttac tgtgacgaac ctgggatgtt ggtgctcaaa 240 aaagagcagg tagttaacgt gacgcttgaa gaggtcaatg gccacatgga tttcgatata 300 ctcgagatac cgacgcaacg acttggcgct ctctatgcac ttatcccaaa cgagcagcaa 360 accaaaatgg cggtacccac agagaaagcg cagaagatct tctatacgcc tgactttcct 420 gccagaagag aggtatttga acatctgaaa acggcgttct cctgtacgaa ggatacaagc 480 aaaggttgca gtaactgtaa caacaaaagt tgtattgaaa atgaagagtt aattccttat 540 tttctgctgt tcctgcttac tgcttttctc cgactcccgg agagttatga gatcatcctt 600 agctcggctc agataacgtt aaaggagcgc gtttacaaca ttatatcttc gtcacccagt 660 agacagtgga agcttacgga tgttgccgat catatattta tgagtacgtc aacgctcaaa 720 cggaaacttg cagaagaagg taccagcttt agcgacatct acttatcggc aagaatgaat 780 caggcagcaa aacttttacg cataggcaac cataatgtta atgctgtagc attaaaatgt 840 ggttatgata gcacgtccta cttcattcaa tgtttcaaaa aatattttaa aactacgcca 900 tcgacattca taaaaatggc gaaccattaa 930 <210> 76 <211> 564 <212> DNA <213> Salmonella-yqgP-gene <400> 76 atgaatttac agcatcactt tcttattgcc atgcctgcgc tccaggaccc gattttccgc 60 cgttccgtgg tgtatatttg cgagcacaac caggacggcg ctatggggat tattgttaat 120 aagcctttgg aaaatctgca aattgaaggg attctggaaa aactaaaaat tacgccggaa 180 ccgcgcgatt cggcaattcg tcttgataaa gccgtgatgc tcggcggccc gctggcggaa 240 gatcgcggat ttattctcca tactccgccg tcacgtttcg cctccagcat tcgtatctca 300 gacaataccg tgattaccac ctcccgcgat gtgctggaaa cgttaggtac ccaacaacag 360 ccttccgatg tgctggtcgc gctgggctac gcctcctggg ataaaggcca gcttgaacaa 420 gagttgcttg ataacgcctg gcttaccgcg cccgccgatc tcaatatttt gttcaaaacg 480 cccattgccg agcgctggcg cgaagcggca aaacttattg gcattgatat tctgaccatg 540 cctggcgttg cggggcacgc ctga 564 <210> 77 <211> 417 <212> DNA <213> Salmonella-yqgF-gene <400> 77 atgagcggca ccttactggc ctttgacttc ggcacaaaaa gcatcggcgt tgcaatagga 60 caacgcatta ccggcaccgc ccgtccgctt ccggcaatca aagcacagga cggcacgccc 120 gactggacgc tcattgaacg tttgctgaaa gagtggcagc cggacgaaat tattgtcggg 180 ctaccgctca atatggatgg cactgaacag ccgctgacgg cgcgcgcacg taaattcgcc 240 aaccgtattc atgggcgttt cggggtaact gtcacgctgc acgatgaacg actcagcacc 300 gttgaagcac gctccggtct gtttgaacga ggtgggtatc gcgcgctgaa caaaggcaaa 360 gtggactcgg cctccgccgt gattatcctc gaaagctatt ttgaacaggg gtattaa 417 <210> 78 <211> 345 <212> DNA <213> Salmonella-rsd-gene <400> 78 atgttacaga aaaaaacaaa cccaatgata aaaaatttca attttgagta ttgtggattc 60 tctactttta ttacgccggt tgatggcgtt ggcgggattt tagtaaagtg gctctcaaac 120 aaacataatg taattgtccc aacgccttat acattcggtc aagaccccat tcctggcgtc 180 aatctttatc gtaatacaaa agcaaaattt gttatggcta acggtggtaa tagtcttccc 240 tgtgcgatgg caaaatataa tacaaaaact ggacaattta ttcatataac cagtgataat 300 gatttttcac caataatacg agaaacaaga gtcatgaaaa aataa 345 <210> 79 <211> 591 <212> DNA <213> Salmonella-yjaG-gene <400> 79 atgttacaaa acccgattca tttgcgtctg gagcggctgg aaagctggca gcacgttacc 60 tttatggcct gcttgtgcga gcgcatgtac ccgaactacg ccatgttttg caagcagacg 120 gaattcggcg acggacagat ctaccgtcgc attctggatc tgatctggga aaccctgacg 180 gtgaaagatg cgaaggtcaa tttcgatagc caactggaga agtttgaaga ggcgattccg 240 gcagccgacg actatgattt gtacggcgtt tacccggcga ttgatgcctg cgtcgcatta 300 agcgaattaa tgcattctcg tcttagcggc gaaacgctgg aacacgctat tgaggttagt 360 aagacttcca ttactacggt agcgatgttg gaaatgactc aggctggtcg ggaaatgacc 420 gatgaggagc tcaaaacgaa ccctgccgtt gaacaggaat gggatattca gtgggaaata 480 ttccgacttt tagccgactg cgaagaacgt gatattgaac tgataaaagg gctcagggca 540 gacctgcgcg aggctggcga gagcaatatc ggtataaatt ttcagcaatg a 591 <210> 80 <211> 858 <212> DNA <213> Salmonella-yjeJ-gene <400> 80 atggccttaa cgattaaggg actaaatacc ggcgttattc gtcacaatga taagtttatc 60 gcgctggcgc ttaaggtgaa gtcactgaga aataaagaaa cactgctttt ctttcctgtg 120 ctcgcgctgc gagacttgtt gatcggcctt gaacaccggc tttatctaca acactcgctt 180 ccggaacaag agcaggaaaa acgccagaaa gctaaaagca gtcatgtgct taaaatgcat 240 gagaatattc cggcaatact ccgtgaagag ctggaaaacg ccgatgttaa tcagcgtgtt 300 gaatctttag cgttgagcga taatacagaa aaagtattaa cctttacgtt aaagctgcac 360 aatggtagcc atcttgattt acaggtcggt gagtggcagg ttgaagttct ggtgatggct 420 attattcacg ccattaataa tgccgaaatg cgtgagctcg cattgcgtat ttcttcaatg 480 ctggactttt taccattata cgatgctgac tgcctggaaa acggtaatat cgaattcgat 540 acctataacc agcctgactg gaaacataat ctgtataacc attatttagc gctcgtttat 600 cgttatacgg atgaggcagg acaatcgcat gattgcggca ccatcattaa gacccgtagt 660 cagtcaggct ctaaagaagc tgaagcaata tcacgccgct tgctgaattt cagcccgcgt 720 cttaaaaagc tggaaggaaa accgtgtaag gtttttgtca gaacgcttgg aaccggtaaa 780 gcagcgcgtc tgacgcaaga tcaatgcatg cgcgcgttgc ataatctacg catggcatca 840 tcgcaggaaa aacgctaa 858 <210> 81 <211> 1029 <212> DNA <213> Salmonella-yjeK-gene <400> 81 atggcgcata ttgtaaccct aaatacccca ttgcgagaag attggttagc gcaacttgcc 60 gatgttgtga ccaatcccga cgaactgctg catcttttac agattgaagc tgatgaaaac 120 ctccgggcag gacaggacgc caggcgcttg tttgccctcc gcgtgccgcg cgcttttatt 180 gcgcgcatgg agaagggcaa ccctgacgat cctcttttac gtcaagtgct gacgtcccgg 240 gatgaattta ttgtcgcccc cggtttctcc accgacccgc tggaagagca acacagcgtg 300 gtgccaggat tattgcataa ataccaaaac cgggcgctat tgctggtaaa aggcggatgt 360 gcggtaaatt gccgctactg tttccgtcgt cacttcccgt atgcagagaa tcaaggcaat 420 aagcgcaact ggacagtcgc gctggagtat atcgccgcac acccggaact ggatgagatc 480 atcttttccg gcggcgatcc gctgatggcg aaagatcatg agctggactg gctgctcacg 540 caactggaag ccattaagca cgtcaagcgg ctacgcatcc acagtcggtt gcctatcgtc 600 atcccggcac gcattactga cgaactggtc gcccgctttg accagtcacg tctgcaaatt 660 ttgttggtga accatatcaa ccacgctaat gaagtggacg aggcgttcgg cctggcgatg 720 aagaaactgc gccacgtggg cgtcacgctt ctcaaccaga gcgtcctgct gcgtggcgtg 780 aatgataacg cgcgaacgct ggcgaatctg agcaacgcgc tatttgacgc cggcgtgatg 840 ccctattacc tgcatgtgct ggataaagtg cagggcgccg cgcattttat ggtcaccgat 900 gacgaagccc ggcaaatcat gcgcgaactg ctcacgctgg tatccggcta tatggtgcca 960 agactggcgc gtgaaatcgg cggcgaaccg agcaaaacac cgctggattt acagcttcgg 1020 cagtgctaa 1029 <210> 82 <211> 2235 <212> DNA <213> Salmonella-relA gene <400> 82 atggtcgcgg taagaagtgc acatattaat aaagctggtg aatttgatcc gaagaagtgg 60 atcgcaagcc tgggaatttc cagccagcag tcgtgtgagc gcttagccga aacctgggcg 120 tattgcctgc aacagacaca aggacatccg gatgcggatc tgttgctgtg gcgtggcgtg 180 gagatggtag aaattctttc cacgctgagt atggatatcg acacgctgcg ggcggcgcta 240 ctgttccctc tggccgacgc caacgtagtc agcgaagatg tactgcgcga aagcgtcggc 300 aaatctatcg ttaccctgat tcatggcgtg cgcgatatgg cggcgatccg tcagctaaac 360 gccactcata acgactctgt ttcttcggag caggttgata acgtccgtcg aatgttattg 420 gcgatggtgg atgatttccg ctgcgtggtg atcaaactgg ccgagcgaat cgctcatttg 480 cgcgaagtga aagaggcgcc ggaagatgag cgcgtgctgg cggcgaaaga atgtaccaac 540 atctatgcgc cgctcgccaa tcgtctgggc atcgggcaac tgaagtggga actggaagac 600 tactgtttcc gctacctgca tccggcggaa tacaaacgca tcgccaaact gctgcatgag 660 cgccgtctcg atcgcgaaca ttacatcgaa gagtttgttg gacatctgcg cgccgaaatg 720 aaaaacgaag gcgtgcaggc ggaggtctac ggacgaccaa aacatattta tagcatctgg 780 cgcaaaatgc agaaaaagca tctggcgttt gatgaactct ttgacgtgcg cgccgtgcgt 840 attgtcgctg aacgtctgca ggactgctac gccgcgttgg ggatagtgca tacgcactat 900 cgtcacctgc cggatgaatt cgatgattat gtcgctaacc cgaaaccgaa cggttaccag 960 tctatccaca ccgtggtcct gggaccgggc ggtaaaaccg ttgagatcca gatccgtacc 1020 aaacagatgc atgaagacgc cgaactgggc gtggcggcac actggaagta taaagaaggc 1080 gccgcgtccg gcggcgtgcg ctccggtcat gaagacagaa ttgcgtggct gcgtaagctg 1140 atcgcctggc aggaagagat ggccgattcc ggcgaaatgc tggatgaagt gcgcagccag 1200 gtgtttgacg atcgggtcta cgtttttacg ccaaaaggcg acgtggttga cttgcctgcc 1260 ggatctacgc cgctcgattt tgcttaccac atccacagcg atgttgggca ccgctgcatt 1320 ggcgctaaaa tcggcggccg tattgtgcca ttcacctatc agttgcagat gggtgatcaa 1380 attgaaatta tcactcagaa gcagccgaat cccagccgcg actggctgaa tccaaacctg 1440 ggctatgtga cgaccagccg cggacgctcg aaaattcacg cctggttccg caagcaggat 1500 cgtgacaaaa atatccaggc tggacggcag atcctcgacg atgagctggc gcatttgggg 1560 attagcctga aagaggccga aaaacatctg ctgccgcgct acaactttaa tgagctggaa 1620 gagttgctgg cggcgatagg cggcggcgat atccgtctta atcagatggt gaatttcctg 1680 caatcacagt tcaataagcc gagtgcagag gagcaggatg cagcggcgct gaaacagctt 1740 cagcaaaaaa catacgcgcc gcaaaatcgt cgtaaagacg acgggcgcgt ggtggtagaa 1800 ggcgtgggta atttgatgca ccacatcgcc cgctgctgcc agccgattcc gggggatgaa 1860 attgtcggct tcattactca agggcgaggg atttccgtgc accgggccga ctgcgaacag 1920 ctggcggaac tgcgctccca tgcgccggag cggatcgtag aggcggtatg gggcgagagc 1980 tactcggcgg gatattcgct ggtggtgcgc gtccaggcca acgatcgcag cggcttgcta 2040 cgcgatatca ccaccattct ggctaacgaa aaagtcaacg tgctgggcgt cgccagccgc 2100 agcgacatta aacagcagat cgccaccatt gatatgacca tcgagatcta caacctgcag 2160 gtgctgggcc gggtgctcgg taagctgaac caggtgccgg atgtgattga tgcacggcga 2220 ctgcacgggg ggtaa 2235 <210> 83 <211> 2112 <212> DNA <213> Salmonella-spoT gene <400> 83 ttgtatctgt ttgaaagcct gaatcaactg attcaaacct acctgccgga agaccagatt 60 aagcgtcttc ggcaggcgta tctcgttgca cgtgacgctc acgagggcca gacacgttca 120 agcggtgaac cctatatcac gcacccggtg gcggtggcct gtattctggc cgagatgaaa 180 ctcgactacg aaacgctgat ggccgctctg ctgcatgacg tgattgaaga tacccccgcc 240 acctatcagg acatggaaca gcttttcggt aaaagcgttg ccgagctggt agagggggtg 300 tcgaaacttg ataagctcaa gtttcgcgat aagaaagagg cgcaggccga aaactttcgc 360 aaaatgatta tggcgatggt gcaggatatc cgcgtcatcc tcattaagct tgctgaccgt 420 acccataaca tgcgcacgct gggctcgtta cgcccggata aacgtcgtcg tattgcccgt 480 gaaacgctgg aaatctacag tcctctggcg caccgtttag gtattcatca catcaaaacc 540 gagctggaag agctgggttt tgaagcgctg tatcccaatc gttaccgcgt catcaaagaa 600 gtggtaaaag cggcgcgcgg caaccgtaag gagatgatcc aaaaaatcct ctctgaaatc 660 gaaggacgtt tgcaagaggc gggaattccg tgtcgcgtta gcggtcgcga aaaacatctt 720 tactcgatct actgcaaaat ggtgctcaaa gagcagcgtt ttcactcgat catggacatt 780 tacgctttcc gcgtcatcgt tcatgactcc gatacctgct atcgcgtact cggccagatg 840 cacagtctct ataagccgcg tccgggacgg gtgaaagact atattgccat tcccaaagcg 900 aacggctatc agtctttgca cacctcaatg atcggcccgc acggcgttcc tgttgaagtc 960 cagatccgta ccgaagatat ggatcagatg gcggaaatgg gggtcgcggc gcactgggcg 1020 tataaagaac acggtgagac cagcaccacg gcgcagatcc gcgcccagcg ctggatgcag 1080 agcctgctgg agctacaaca gagcgccggt agttcgtttg aatttatcga aagcgtaaaa 1140 tccgatctct tcccggatga gatttacgtt ttcaccccgg aagggcgcat tgtcgaactg 1200 cccgctggcg ctacgccggt ggattttgcc tatgcagtgc ataccgacat cggccacgcc 1260 tgcgtcggcg cgcgtgtcga ccgccagcct tatccgctgt cgcagccgct tagcagcggt 1320 cagaccgtcg aaattattac cgcgccgggc gcgcgtccca acgccgcctg gctgaacttt 1380 gtcgtcagct ctaaagcgcg cgctaaaatt cgtcagttgc tgaaaaacct caaacgtgat 1440 gactccgtaa gcctgggccg tcgtctgctt aaccatgcct taggcggtag tcgtaagctg 1500 gcggaaattc cgcaggaaaa tattcagcgc gaattggatc gtatgaagct ggcaacgctt 1560 gacgatctgc tggcggaaat cggtctcggc aacgcgatga gcgtagtggt cgcgaaaaat 1620 ctgcagcaag gcgaagccgt ggtgccgacc gttgcgcaat cgaatcacgg ccacctgccg 1680 attaaaggcg cggatggcgt gcttatcacc tttgcgaagt gttgtcgtcc gatcccaggc 1740 gacccgatca tcgctcacgt cagcccaggt aaaggactgg tgatccacca cgaatcctgc 1800 cgtaatatcc gtggatacca gaaagagcca gagaaattta tggcggtcga atgggacaaa 1860 gagacggagc aggaattcat taccgaaatc aaggtggaaa tgtttaacca tcagggcgcg 1920 ctggctaacc tgacggcggc gattaatacc accacctcca atattcaaag cctgaatact 1980 gaagagaaag atggtcgcgt ctatagtacc tttattcgcc ttaccgcacg cgatcgcgta 2040 catctggcga atatcatgcg caaaatccgc gtgatgccag acgtcattaa agtcacccgt 2100 aaccgaaact ag 2112

Claims (7)

i) Salmonella- rela gene ( relA ) , a gene for producing guanosine tetraphosphate (ppGpp ) and Sporty ( Salmonella spoT gene, spoT ); And
ii) Salmonella virulence genes hildi (hilD), and this kyujiyi / Y queue jiepeu (y qgE / yqgF) or Y J. Now / Y jeyiyi K (yjeJ / yjeK) Salmonella (Salmonella) in strain, characterized in that the double deletion .
The method according to claim 1, wherein the strain of Salmonella sp. Is Salmonella-relA gene ( relA ) and Sporty (Salmonella- spoT gene, spoT) and hildi (hlilD) the deletion strain YC4803 (ΔSTM2875, Δ relA / spoT) , mozzarella A (Salmonella-relA gene, relA) and Sporty (Salmonella- spoT gene, spoT) and kyujiyi Y / Y queue jiepeu (y qgE / yqgF) a deletion of YC0844 strain (ΔSTM2875, Δ relA / spoT) , or mozzarella A (relA) and sporty (spoT) and the second wire Now / Y jeyiyi K (yjeJ / yjeK) the deletion strain YC0843 (ΔSTM4332 / 4333, Δ relA / spoT) of Salmonella (Salmonella) in strain, characterized in that.
The strain of the genus Salmonella according to claim 1, wherein the Salmonella pathogenicity gene is hildi ( hilD ).
According to claim 1, wherein said Salmonella spp is characterized in that any one selected from the group consisting of Salmonella typhimurium (Salmonella Typhimurium), the shoe device (Salmonella choleraesuis) and Salmonella entera ET display (Salmonella enteritidis) in Salmonella choleraesuis Salmonella spp.
A pharmaceutical composition for treating cancer, which comprises the Salmonella spp. Of any one of claims 1 to 4 as an active ingredient.
[Claim 6] The pharmaceutical composition for treating cancer according to claim 5, wherein the Salmonella spp. Is reduced in viability in normal tissues and inhibits cancer cell proliferation.
The method of claim 5, wherein the Salmonella (Salmonella) in strains mozzarella A (relA and sporty (spoT) and hildi (hilD) the treatment of cancer, characterized in that the deletion double mutant strain YC0843 (ΔSTM2875, Δ relA / spoT) A pharmaceutical composition.

Images