KR101453982B1 - Composition for preventing or treating irritable bowel syndrome - Google Patents

Abstract

The present invention relates to a pharmaceutical composition comprising lactobacillus Phil also know Ruth LA1 (Lactobacillus acidophilus LA1 (KCTC 11906BP)), lactobacillus Lymphocyte LR5 ( Lactobacillus rhamnosus LR5 (KCTC 12202BP) , Bifidobacterium BP Doom BF3 (Bifidobacterium bifidum BF3 (KCTC 12199BP) , Bifidobacterium Animal Malice Lactis BL3 (Bifidobacterium animali s subsp. lactis BL3 (KCTC 11904BP), Bifidobacterium Longgum BG7 ( Bifidobacterium longum BG7 (KCTC 12200BP)), and Streptococcus Suhmophilus ST3 ( Streptococcus thermophilus ST3 (KCTC 11870BP)) or a culture thereof, which is effective for preventing or treating irritable bowel syndrome by maintaining the stability of the intestinal microbial cell.

Description

Technical Field [0001] The present invention relates to a composition for preventing or treating irritable bowel syndrome,

The present invention relates to a composition useful for the prevention and treatment of Irritable Bowel Syndrome (hereinafter, referred to as "IBS "), and more particularly to a composition useful for prevention and treatment of irritable bowel syndrome The present invention relates to a composition for preventing or treating irritable bowel syndrome containing complex lactic acid bacteria.

Irritable Bowel Syndrome (IBS) is a chronic disease with recurrent abdominal discomfort and abdominal pain, without diabetic causes, accompanied by diarrhea and constipation. Irritable bowel syndrome occurs in about 10-20% of adults and is characterized by abdominal pain, constipation, diarrhea, and abdominal bloating. Irritable bowel syndrome is not a life-threatening disease, but it damages the social and personal life of the patient and lowers the quality of life. The more severe the symptoms, the lower the quality of life, and the social cost is very high. In order to clarify the pathophysiology of this irritable bowel syndrome, a number of studies have been conducted. As a mechanism of expression of the symptoms, dysmotility, visceral hypersensitivity, abnormal brain-gut interaction, , And autonomic dysfunction. Recently, it has been suggested that changes of intestinal flora and intestinal inflammation will be involved in the pathophysiology of irritable bowel syndrome.

Although the concept of IBS has been established decades ago, there is still no fundamental remedy for IBS, and only the symptomatic treatment for the symptom relief of each type of IBS is being performed.

Recently, attempts have been made to change the natural history of IBS using probiotics. US Pat. No. 7,125,708 discloses a method for the treatment of lactobacilli Pento Versus NCIMB discloses a composition useful in the treatment of irritable bowel syndrome, including the 41 114 strains.

U.S. Patent No. 7,507,572 discloses a composition comprising (a) one or more isolated lactobacilli A tannase-producing strain of the Planta Room , and (b) a tannin, wherein the at least one isolated tannase- producing lactobacillus When the Planta room strain is Lactobacillus Plutha room strain HEAL 9 (DSM 15312), Lactobacillus Flora Room Strain HEAL 19 (DSM 15313); Lactobacillus A prostaglandin strain HEAL 99 (DSM 15316), and combinations thereof. ≪ Desc / Clms Page number 2 >

However, since the above-mentioned compositions are not sufficient to improve the irritable bowel syndrome, development of a composition useful for the treatment of irritable bowel syndrome including probiotics with more excellent effects is desired.

It is another object of the present invention to provide novel lactic acid bacterial strains which provide an efficacy for prevention and treatment of IBS.

Another object of the present invention is to provide a composition useful for prevention and treatment of IBS, including various species of lactic acid bacteria.

Another object of the present invention is to provide a composition for preventing or treating diarrhea-predominant irritable bowel syndrome, constipation-predominant irritable bowel syndrome or diarrhea-constipation mixed irritable bowel syndrome comprising various kinds of lactic acid bacteria or cultures thereof as an active ingredient .

One aspect of the present invention for achieving the above object is to provide a method for producing Lactobacillus sp. Lactobacillus (Lactobacillus sp.) Deposited with the Korean Collection for Type Culture (KCTC) under accession number KCTC 12202BP Lymphocyte LR5 ( Lactobacillus rhamnosus LR5) lactic acid bacteria.

Another aspect of the present invention for achieving the above object is to provide a method for producing Bifidobacterium (Bifidobacterium spp.) Deposited with the Korean Collection for Type Culture (KCTC) under accession number KCTC 12199BP BP Doom BF3 (Bifidobacterium bifidum BF3) lactic acid bacteria.

One aspect of the present invention for achieving the above object is to provide a method of screening for the presence of Bifidobacterium (Bifidobacterium spp.) Deposited with the Korean Collection for Type Culture (KCTC) under accession number KCTC 11904BP Animal Malt Lactis BL3 ( Bifidobacterium animali s subsp. lactis BL3) lactic acid bacteria.

Another aspect of the present invention for achieving the above object is to provide a method of screening for the presence of Bifidobacterium (Bifidobacterium tuberculosis) deposited with the Korean Collection for Type Culture (KCTC) under accession number KCTC 12200BP Longgum BG7 ( Bifidobacterium longum BG7) lactic acid bacteria.

One aspect of the present invention for achieving the above object is Lactobacillus Phil also know Ruth LA1 (Lactobacillus acidophilus LA1 (KCTC 11906BP )), Lactobacillus Ramno Seuss LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP) , Bifidobacterium BP Doom BF3 (Bifidobacterium bifidum BF3 (KCTC 12199BP )), Bifidobacterium Animal Malice Lactis ( Bifidobacterium animali s subsp. lactis BL3 (KCTC 11904BP), Bifidobacterium Longgum BG7 ( Bifidobacterium longum BG7 (KCTC 12200BP)), and Streptococcus Stormpoxus ST3 ( Streptococcus thermophilus ST3 (KCTC 11870BP)), or a culture thereof, for the prevention or treatment of irritable bowel syndrome.

The composition for preventing or treating irritable bowel syndrome comprising the complex lactic acid bacteria of the present invention may further comprise other lactic acid bacteria or a pharmaceutically acceptable carrier or adduct.

The composition of the present invention includes six kinds of probiotic lactic acid bacteria or cultures thereof that maintain the stability of intestinal microorganism guns, and therefore, according to the present invention, excellent therapeutic agents for irritable bowel syndrome or diarrhea-predominant irritable bowel syndrome, constipation- Compositions useful for the treatment of predominant irritable bowel syndrome or diarrhea-constipation mixed irritable bowel syndrome may be provided. In particular, the composition of the present invention induces a change in intestinal flora, improves intestinal symptoms such as abdominal pain and bowel movements, and increases daily life improvement rate.

In addition, the composition for preventing or treating irritable bowel syndrome of the present invention maintains the stability of intestinal microbial cells in a patient to thereby inhibit infection of various intestinal pathogenic bacteria, and additionally, Thus, the composition can be useful as a pharmaceutical, a food, or a health functional food as a composition for preventing or treating irritable bowel syndrome.

BRIEF DESCRIPTION OF THE DRAWINGS Fig.Lactobacillus Lumosus LR5 (Lactobacillus rhamnosus LR5) 16S rRNA sequence of KCTC 12202BP strain, and theLactobacillus Lumosus LR5 andLactobacillus Lumosus ^T (ATCC 7469). ≪ / RTI >
FIG. 2 is a cross-Lactobacillus Lumosus Random Amplified Polymorphic DNA (RAPD) analysis of genomic DNA of strain LR5.
FIG. 3 is a cross-Lactobacillus Lumosus LR5 (Lactobacillus rhamnosus LR5) PFGE (Pulse Field Gel Electrophoresis) analysis of the genomic DNA of KCTC 12202BP strain.
FIG. 4 is a cross-Lactobacillus Lumosus LR5 (Lactobacillus rhamnosus LR5) KCTC 12202BP.
FIG. 5 is a cross-Bifidobacterium Bifidom BF3 (Bifidobacterium bifidum BF3) 16S rRNA sequence of KCTC 12199BP strain and theBifidobacterium Bifidom BF3 strain andBifidobacterium Bifidom ^T(DSM 20456) strain 16S rRNA sequence.
FIG. 6 is a cross-Bifidobacterium Bifidom RAPD analysis of genomic DNA of BF3 strain.
FIG. 7 is a cross-Bifidobacterium Bifidom This is the result of PFGE analysis of genomic DNA of BF3 strain.
FIG. 8 is a cross-Bifidobacterium Animal Malice Lactis BL3 (Bifidobacterium animalis subsp.lactisBL3) 16S rRNA sequence of KCTC 11904BP strain andBifidobacterium Animal Malice Lactis BL3 andBifidobacterium Lactis ^T (DSM 10140). ≪ / RTI >
FIG. 9 is a cross-Bifidobacterium Animal Malice Lactis RAPD analysis of genomic DNA of BL3 strain.
FIG. 10 is a cross-Bifidobacterium Animal Malice Lactis PFGE analysis of the genomic DNA of BL3 strain.
Fig.Bifidobacterium Longong BG7 (Bifidobacterium longum BG7) 16S rRNA sequence of KCTC 12200BP strain andBifidobacterium Longong BG7 strain andBifidobacterium Longong ^T(ATCC 15707) strain 16S rRNA sequence.
Fig. 12 is a cross-Bifidobacterium Longong RGD analysis of genomic DNA of strain BG7.
FIG. 13 is a cross-Bifidobacterium Longong This is the result of PFGE analysis of genomic DNA of BG7 strain.
FIG. 4 is a cross-Bifidobacterium Longong BG7 strain.
15 is a schematic diagram for explaining a screening and random extraction procedure of a patient to test the effect of the composition for the prevention or treatment of irritable bowel syndrome according to an embodiment of the present invention.
FIG. 16 is a graph comparing the effects of the lactic acid bacterium composition (Example) and placebo (Comparative Example) of the present invention on improvement of daily life and intestinal symptoms.
17 is a graph comparing the effects of Examples and Comparative Examples with respect to improvement in abdominal discomfort and abdominal distension.
18 is a graph showing the comparison between the effects of the examples and the comparative examples on the improvement of the bowel frequency and abdominal pain frequency.
FIG. 19 is a graph showing comparison of abdominal pain symptom improvement by the lactic acid bacteria composition (Example) and placebo (Comparative Example) of the present invention.
Fig. 20 is a graph showing the change in bowel habits caused by the lactic acid bacteria composition (Example) and the placebo (Comparative Example) according to the present invention.
FIG. 21 is a graph comparing the overall effects of digestive symptom improvement by the lactic acid bacterium composition (Example) and placebo (Comparative Example) of the present invention.

As used herein, the terms "treat" and "treatment" refer to the treatment of irritable bowel syndrome, particularly diarrhea predominant irritable bowel syndrome (d-IBS), constipation predominant irritable bowel syndrome, Or diarrhea-constipation mixed type irritable bowel syndrome.

One aspect of the present invention relates to novel lactic acid bacteria strains, Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) The Lactobacillus ramno Seuss LR5 (Lactobacillus as an international deposit accession No. KCTC 12202BP the rhamnosus LR5) lactic acid bacteria and Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) as an international deposit accession No. KCTC 12199BP the Bifidobacterium BP Doom BF3 (Bifidobacterium bifidum BF3) lactic acid bacteria.

Another aspect of the present invention relates to a novel lactic acid bacterium strain, which comprises a bacterium belonging to the genus Bifidobacterium ani malalis, deposited with the Korean Collection for Type Culture (KCTC) under accession number KCTC 11904BP, Lactis and Lactobacillus BL3 Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) as an international deposit accession No. KCTC 12200BP the Bifidobacterium Longgum BG7 ( Bifidobacterium longum BG7) is a lactic acid bacterium.

Another aspect of the present invention relates to a composition for the prophylaxis or treatment of irritable bowel syndrome. Such a composition includes the following lactic acid bacterial strains. The lactic acid bacterial strains include Korean Collection for Type Culture (KCTC) Was deposited as follows.

1) Lactobacillus Assisi's also pilru LA1 ( Lactobacillus acidophilus LA1), KCTC 11906BP,

2) Lactobacillus Lymphocyte LR5 ( Lactobacillus rhamnosus LR5), KCTC 12202BP ,

3) Bifidobacterium Bifidom BF3 ( Bifidobacterium bifidum BF3), KCTC 12199BP ,

4) Bifidobacterium Animal Malice Lactis BL3 ( Bifidobacterium animali s subsp. lactis BL3), KCTC 11904BP ,

5) Bifidobacterium Longgum BG7 ( Bifidobacterium longum BG7), KCTC 12200BP , and

6) Streptococcus Stormpoxus ST3 ( Streptococcus thermophilus ST3), KCTC 11870BP

Lactobacillus Phil also know Ruth LA1 (L. acidophilus LA1) is an aerobic lactic acid bacterium that exists in the intestines of humans and all mammals and other animals and is used for the treatment of intestinal addiction. Lactobacillus Ramno Versus LR5 (L. rhamnosus) suppresses most of the harmful bacteria growing in the intestines.

Streptococcus Stormpoxus ST3 ( Streptococcus Thermophilus ST3) is the fastest growing species of lactic acid bacteria. It produces high amounts of organic acids such as lactic acid through rapid growth and lowers the acidity of the surrounding environment. It inhibits pathogenic bacteria, while other lactic acid bacteria can grow comparatively predominantly Create a condition. In general, lactobacillus is the optimal habitat for small intestine, and the lactic acid bacteria belonging to Bifidobacterium are the most suitable habitat. Therefore, lactic acid bacteria belonging to the genus Lactobacillus and Bifidobacterium Ingestion can provide higher suitability for a formulation than a mixture of lactic acid bacteria consisting of a single species or a small number of different species. When Lactobacillus and Bifidobacterium lactic acid bacteria contained in the present composition are used singly or as a mixture, they provide an effect of inhibiting the growth of harmful bacteria and inducing the proliferation of enteric bacteria in the intestines. In addition, these strains, when used alone or in combination with atopic dermatitis or inflammatory bowel disease model mice, inhibit inflammatory cytokines and induce the synthesis of anti-inflammatory cytokines . These characteristics can help improve the pathology of irritable bowel syndrome in the light of the imbalance of intestinal microbial counts and low-grade inflammation.

The composition may contain six kinds of lactic acid bacteria in the same proportion or may contain lactic acid bacteria in the genus Lactobacillus, lactic acid bacteria in the genus Bifidobacterium and lactic acid bacteria in the genus Streptococcus in a ratio of 1: 1: 1 to 2: 3: 1 .

The composition of the present invention contains a mixture of lactic acid bacteria strains as an active ingredient in an amount of 10 ⁸ to 10 ¹² cfu / g, or an equivalent number of live bacteria, relative to the total weight of the composition.

Bariwooseu (Lactobacillus salivarius) salicylate composition of the present invention is Bacillus Lactobacillus other than the above-mentioned lactic acid bacteria, Lactobacillus brevis (Lactobacillus brevis , Lactobacillus < RTI ID = 0.0 > helveticus , Lactobacillus < RTI ID = 0.0 > fermentum), Lactobacillus para Kasei (Lactobacillus paracasei , Lactobacillus < RTI ID = 0.0 > casei), Lactobacillus del Brewer station (Lactobacillus delbrueckii , Lactobacillus < RTI ID = 0.0 > reuteri , Lactobacillus < RTI ID = 0.0 > buchneri , Lactobacillus < RTI ID = 0.0 > gasseri , Lactobacillus < RTI ID = 0.0 > johonsonii , Lactobacillus < / RTI > kefir , Lactococcus lactis), Bifidobacterium breather bracket (Bifidobacterium breve), Bifidobacterium Infante Tees (Bifidobacterium infantis ), Bifidobacterium pseudolongum ), Bifidobacterium ( Bifidobacterium themophilu may comprise a m), and Bifidobacterium Adolfo sentiseu adding one or more lactic acid bacteria selected from the group consisting of (Bifidobacterium adolescentis).

The lactic acid bacterial strains are grown by a general culture method for lactic acid bacteria, recovered by a separation process such as centrifugation, and can be prepared into a prodrug form by drying, e.g., lyophilization.

The composition of the present invention may further include a conventional pharmaceutically acceptable carrier and / or excipient in addition to the above-mentioned effective ingredients. In addition, various additives commonly used in pharmaceuticals such as binders, disintegrating agents, coating agents, lubricants, ≪ / RTI >

The composition of the present invention may be formulated into powders, granules, tablets, capsules or liquid form by mixing the lactic acid bacteria with appropriate carriers, excipients, auxiliary active ingredients and the like. In addition, the composition of the present invention can be commercialized using a known method, after being passed through the stomach and reaching the small intestine so that the microorganism as the active ingredient is quickly released into the intestines.

Excipients usable in the present invention include sugars such as sucrose, lactose, mannitol, glucose and the like and starches such as corn starch, potato starch, rice starch and partially gelatinized starch. The binder may be a natural-occurring macromolecular substance such as dextrin, sodium alginate, carrageenan, guar gum, acacia, agar, etc., such as polacaccharide, tragacanth, gelatin and gluten, hydroxypropylcellulose, methylcellulose, Cellulose derivatives such as cellulose, ethyl cellulose, hydroxypropyl ethyl cellulose and carboxymethyl cellulose sodium, and cellulose derivatives such as polyvinyl pyrrolidone, polyvinyl alcohol, polyvinylacetate, polyethylene glycol, polyacrylic acid, polymethacrylic acid and vinyl acetate resin Polymer.

Examples of the decomposing agent include cellulose derivatives such as carboxymethylcellulose, carboxymethylcellulose calcium and low substituted hydroxypropylcellulose, and sodium carboxymethyl starch, hydroxypropyl starch, corn starch, potato starch, rice starch and partially pregelatinized starch Of starch can be used.

Examples of lubricants that can be used in the present invention include talc, stearic acid, calcium stearate, magnesium stearate, colloidal silica, hydrous silicon dioxide, various types of waxes and hydrogenated oils and the like.

Examples of the coating agent include dimethylaminoethyl methacrylate-methacrylic acid copolymer, polyvinyl acetal diethylaminoacetate, ethyl acrylate-methacrylic acid copolymer, ethyl acrylate-methyl methacrylate-chlorotrimethylammonium ethyl methacrylate A water-insoluble polymer such as a copolymer, a water-insoluble polymer such as ethylcellulose, a methacrylic acid-ethyl acrylate copolymer, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate succinate and the like and a thickener such as methylcellulose, hydroxypropylmethylcellulose , Polyvinyl pyrrolidone, polyethylene glycol, and the like, but are not limited thereto.

The dose of the lactic acid bacteria strain as an active ingredient in the composition for preventing or treating irritable bowel syndrome of the present invention is suitably determined in consideration of the purpose of treatment or prevention, the type of the patient to be treated or prevented, the symptom of the patient, . Generally, in the case of an adult patient, 1 x 10 ⁶ or more live cells, preferably 1 x 10 ⁸ to 1 x 10 ¹² live cells can be administered once or divided as needed.

The composition for preventing or treating irritable bowel syndrome containing lactic acid bacterium of the present invention can be administered or ingested as a medicine or food to humans or animals. The pharmaceutical composition containing the composition for preventing or treating irritable bowel syndrome of the present invention is an embodiment of the present invention, and the food containing the composition for preventing or treating irritable bowel syndrome containing the lactic acid bacterium of the present invention is also an embodiment of the present invention to be. Examples of such foods include, but are not necessarily limited to, yogurt and fermented dairy products.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example

One. Lactobacillus Lumosus LR5  ( Lactobacillus rhamnosus LR5 ) KCTC  12202 BP  Isolation of the strain Identification

1-1. Selection of strain

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into a Man-Rogosa-Sharpe (MRS, USA) solid medium and incubated for 3 days under anaerobic conditions. The resulting colonies were transferred to MRS in a lactobacillus selective medium (BL solid medium) supplemented with BCP (Bromocresol purple, 0.17 g / L) and then cultured for 3 days under the same conditions. The BCP indicator changes from purple to yellow when the lactic acid bacteria form lactic acid and the surrounding pH is lowered. The colony was transformed into a yellow color, and biochemical and molecular biochemical identification was carried out. One of the strains with the highest functionality and safety was finally selected.

1-2. Identification of selected strains

1) Usability analysis

The API 50 CHL Carbohydrate Test Kit (bioMerieux Co., France) was used to determine the sugar availability of selected strains. After culturing in a 10 ml MRS (Man-Rogosa-Sharpe) medium for 16 hours at 37 ° C, 1 ml of the culture broth was collected and washed twice with CHL solution. The cells were then collected by centrifugation (MICRO-17, Hanil, KR) and resuspended in 9 mL of CHL solution. 150 [mu] L of strain suspension was placed in each well of the API 50 CHL kit, and autoclaved paraffin oil was dispensed onto the strain suspension in the wells. After 3 days of incubation at 37 ° C, the sugar availability was compared. The use of each carbon source was observed by observing changes in color due to microbial growth for 49 carbon sources. The results of the final identification were analyzed using the identification program API web, and the results are shown in Table 1 below. As a result of identification, L. rhamnosus showed 99.9% similar biochemical characteristics.

No. Carbohydrate Utilized No. Carbohydrate Utilized 0 Control - 25 Esculine + One Glycerol + 26 Salicine + 2 Erythritol - 27 Cellobiose + 3 D-Arabinose + 28 Maltose + 4 L-Arabinose - 29 Lactose + 5 Ribose + 30 Melibiose - 6 D-Xylose - 31 Saccharose + 7 L-Xylose - 32 Trehalose + 8 Adonitol - 33 Inuline - 9 β-Methyl-xyloside - 34 Melezitose + 10 Galactose + 35 D-Raffinose - 11 D-Glucose + 36 Amidon - 12 D-Fructose + 37 Glycogene - 13 D-Mannose + 38 Xylitol - 14 L-Sorbose + 39 β-Gentiobiose + 15 Rhamnose + 40 D-Turanose - 16 Dulcitol - 41 D-Lyxose - 17 Inositol + 42 D-Tagatose + 18 Mannitol + 43 D-Fucose - 19 Sorbitol + 44 L-Fucose + 20 a-Methyl-D-mannoside - 45 D-arabitol - 21 a-Methyl-D-glucoside - 46 L-Arabitol - 22 N-Acetyl glucosamine + 47 Gluconate + 23 Amygdaline + 48 2-Ceto-gluconate - 24 Arbutine + 49 5-Ceto-gluconate -

2) 16s rRNA  Sympathy

Genomic DNA was extracted from isolated strains and analyzed for 16s rRNA sequences.

Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). PCR (MyCycler, BIO-RAD, USA) was performed using the extracted DNA as a template using a primer F (5'-AGAGTTTGATCCTGGCTCAG3 ') and a primer R (5'-AAGGAGGTGATCCAGCC 3') in a 16s rRNA region.

The PCR product was connected to the pGEM-Teasy vector (Promega, USA) E. coli The strain DH5α was transformed into LB / x-gal / ampplate and cultured overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the Cluster V method of the DNA star program to compare homology with Lactobacillus laminosus ^T (ATCC 7469). 16s rRNA base sequence of the separated strain, a, Lactobacillus As shown in Figure 1 Ramno Versus ^T (ATCC 7469) and showed a homology of 99.5%.

3) RAPD  ( Random Amplified Polymorphic DNA ) analysis

RAPD analysis was performed using PCR-RAPD (MyCycler, BIO-RAD, USA) using primers (GTG) ₅ (5'-GTGGTGGTGGTGGTG 3 ' Respectively. The final product, PCR product, was stained with EtBr (ethidium bromide) followed by G: BOX (SYNGENE, UK). As shown in FIG. 2, the strain isolated from the RAPD results showed a band pattern different from that of Lactobacillus lambatusus ^T (ATCC 7469). Therefore, it was confirmed that the strain isolated from the feces from the above results is a novel strain different from Lactobacillus lambatusus ^T (ATCC 7469). In Fig. 2, lane 2 is the result of Lactobacillus laminosus ^T (ATCC 7469), and lane 1 is the result of the test strain.

4) PFGE ( Pulse Field Come Electrophoresis analysis

In the MRS broth,Lactobacillus Lumosus LR5,L. rhamnosus ^T(ATCC 7469) andL. rhamnosusAfter measuring OD of GG (ATCC 53103), a plug was made to the final OD of 4 using 2% Low Melting Agarose. The prepared plugs were placed in 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug 6 times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand for 30 minutes at room temperature. After transferring the plug to 400 μl of the new enzyme buffer, The electrophoresis was carried out using a CHEF system (BIO-RAD, USA) at 0.5X TBE at 5.3 cm / V, 1 s to 15 s pulse time , ≪ / RTI > for 20 hours.

After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution. As a result of PFGE using NotI, Fecal Lactobacillus Lambsos LR5 is a member of L. rhamnosus ^T (ATCC 7469) and L. rhamnosus GG (ATCC 53103) with a different band pattern. Lane 1 is the result of the test strain, lane 2 is the result of Lactobacillus laminosus ^T (ATCC 7469), lane 3 is the result of L. rhamnosus GG (ATCC 53103).

5) Enzyme activity test ( API ZYM kit )

Lactobacillus In order to measure the enzymatic activity of Lambsus LR5, API ZYM kit was used to confirm differences in the productive enzymes. The results of the API ZYM measurement, Lactobacillus Ramno Versus LR5 (L. rhamnosus LR5), L. rhamnosus T (ATCC 7469) and L. rhamnosus GG (ATCC 53103) Lactobacillus rhamnosus GG ramno Versus LR5 and L. (ATCC 53103) when determine whether the enzymatic activity of the Among the 20 enzyme indicators, the enzyme activities of Naphol-AS-BI-phosphohydrolase, -galactosidase and -glucosidase were the same. The role of Naphol-AS-BI-phosphohydrolase is that neutrophils in white blood cells activate phagocytosis and the role of β-galactosidase is present in many cereals such as soybean, raffinose or stachyose , And thus it is an enzyme that produces a dressing effect in humans and animals. The role of? -glucosidase is an enzyme that degrades the pathogenic strain by degrading the glucose contained in the peptidoglycan of the cell wall of gram-negative pathogenic strain.

Lactobacillus isolated from feces Ramno Versus LR5 is seen a substantially similar activity and L. rhamnosus GG (ATCC 53103), is considered as better than the strain L. rhamnosus ^T (ATCC 7469).

6) Antibiotic resistance test

Isolated Lactobacillus To verify the safety of ramno Versus LR5 (L. rhamnosus LR5) antibiotic resistance were analyzed for. Antibiotic resistance tests were carried out using the micro-dilution method recommended by the European Food Safety Authority (EFSA). Ten antibiotics were used: ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM), cinnamic acid (Q / D), clindamycin (CLM), tetracycline (TET) and chloramphenicol (CP).

For antibiotics except for clindamycin, the concentrations of 256, 128, 64, 32, 16, 8, 4, 2, 1 and 0.5 ㎍ / ㎖ were added to broth mixed with ISO-sensitized broth 10% and MRS broth 90% Since clindamycin has an EFSA breakpoint value of less than 0.25 μg / ml in the lactobacillus group, antibiotics were added at concentrations of 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625 and 0.03125 μg / Respectively. In addition, the thinner was carried out using an E-test strip of BioMeriux.

The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, Lactobacillus Lymphocyte LR5 ( Lactobacillus rhamnosus LR5) was tested for resistance to each antibiotic, and the results are shown in Table 2 below.

Isolated Lactobacillus Lymphocyte LR5 was found to meet the safety criteria for antibiotics of EFSA because the resistance to all antibiotics used in the experiment was lower than the EFSA antibiotic resistance criteria.

Based on the above results, the strain was designated " Lactobacillus Lymphocyte LR5 ( Lactobacillus rhamnosus LR5) " and deposited on May 7, 2012 to the Microorganism Resource Center (KCTC), the depository of the Korean patented strain, and received the accession number KCTC 12202BP.

2. Bifidobacterium Bifidom BF3  ( Bifidobacterium bifidum BF3 ) KCTC  12199 BP Isolation and identification

2-1. Selection of new strains

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into Glucose Blood Liver (BL BD, USA) and incubated for 3 days in anaerobic condition. The resulting colonies were picked again on a Lactobacillus culture medium supplemented with BCP (Bromocresol purple, 0.17 g / L) in BL, and then cultured again for 3 days under the same conditions. The colony was transformed into a yellow color, and biochemical and molecular biology identification was performed. One of the strains with the best physical properties was finally selected.

2-2. Identification of new strains

1) Usability analysis

The strains isolated from human feces were tested for their glycosylation using an API CHL50 kit. The results of confirmation of the usability were entered into the API web (https://apiweb.biomerieux.com), and the results are shown in Table 3 below.

No Carbohydrates Utilized No Carbohydrates Utilized 0  Control - 25  Esculine - One  Glycerol - 26  Salicine - 2  Erythritol - 27  Cellobiose - 3  D-Arabinose - 28  Maltose - 4  L-Arabinose - 29  Lactose + 5  Ribose - 30  Melibiose - 6  D-Xylose - 31 Saccharose - 7  L-Xylose - 32  Trehalose - 8  Adonitol - 33  Inuline - 9  β-Methyl-xyloside - 34  Melezitose - 10  Galactose + 35  D-Raffinose - 11  D-Glucose + 36  Amidon - 12  D-Fructose + 37  Glycogene - 13  D-Mannose - 38  Xylitol - 14  L-Sorbose - 39 β-Gentiobiose + 15  Rhamnose - 40  D-Turanose - 16  Dulcitol - 41  D-Lyxose - 17  Inositol - 42  D-Tagatose - 18  Mannitol - 43  D-Fucose - 19  Sorbitol - 44  L-Fucose - 20  a-Methyl-D-mannoside - 45  D-arabitol - 21  a-Methyl-D-glucoside - 46  L-Arabitol - 22  N-Acetyl glucosamine + 47  Gluconate - 23  Amygdaline - 48  2-Ceto-gluconate - 24  Arbutine - 49  5-Ceto-gluconate +

2) 16s rRNA  Sympathy

In order to identify the selected strains by molecular biology, 16s rRNA sequence was analyzed. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). PCR (MyCycler, BIO-RAD, USA) was performed using the extracted DNA as a template using a primer F (5'-AGAGTTTGATCCTGGCTCAG3 ') and a primer R (5'-AAGGAGGTGATCCAGCC 3') in a 16s rRNA region. The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / ampplate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the Cluster V method of the DNA star program to compare homology with several strains of Bifidobacterium, including B. bifidum ^T ( DSM 20456). 16s rRNA nucleotide sequences of the isolated strain, as shown in Figure 5, Bifidobacterium BP was and the other ^T (DSM 20456) and homology (identity percentage scores) of 98.7%.

3) RAPD  ( Random Amplified Polymorphic DNA ) analysis

RAPD analysis showed that the Bifidobacterium The genome DNA was extracted from bifidobacteria placing BF3, was carried out to the separated DNA as a template _{(GTG) 5 (5'-GTGGTGGTGGTGGTG} 3 ') PCR-RAPD (MyCycler, BIO-RAD, USA) using primers. The final product, the PCR product, was stained with EtBr and stained with G: BOX (SYNGENE, UK).

In the RAPD results, the strains isolated showed, as shown in FIG. 6, Bifidobacterium Bifidom BF3 showed a different band pattern from B. bifidum ^T (DSM 20456). 6, lane 1 represents B. bifidum ^T (DSM 20456), lane 2 is the result of bifidobacterium It is the result of placing bipyridinium BF3 (KCTC 12199BP). Based on the above results, microorganisms isolated from the feces, Bifidobacterium BP is putting BF3 B. bifidum ^T (DSM 20456).

4) PFGE ( Pulse Field Come Electrophoresis analysis

Bifidobacterium pure cultured in BL broth A] After the fabrication of the plug (plug) aligned after measuring the OD of the bipyridinium placing BF3 using 2% Low Melting Agarose to a final OD ₆₀₀ = 4 after cutting the genomic DNA with the enzymes performing electrophoresis control group, B . bifidum ^T (DSM 20456).

The prepared plugs were put into 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug 6 times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand for 30 minutes at room temperature. After transferring the plug to 400 μl of the new enzyme buffer, The electrophoresis was carried out using a CHEF system (BIO-RAD, USA) at a rate of 6 cm / V in 0.5X TBE, 1 s to 15 s pulse time, and then incubated at 37 ° C. overnight at 37 ° C. The restriction enzyme was XbaI , ≪ / RTI > for 20 hours.

After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution. As a result of PFGE using XbaI, Fecal Bifidobacterium Bifidobacterium bifidum B. placing BF3 is ^T (DSM 20456), which is a new strain showing a different band pattern. Lane 1 in Figure 7 is the result of B. bifidum ^T (DSM 20456), lane 2 is the result of bifidobacterium It is the result of placing bipyridinium BF3 (ATCC 12199BP).

5) Evaluation of antibiotic resistance

Isolated Bifidobacterium In order to verify the safety of the BP placing BF3 (B. bifidum BF3) using a micro-dilution method recommended by the European Food Safety Authority (EFSA) analyzed the antibiotic resistance. The antibiotics used in the antibiotic resistance experiments were selected from the group consisting of ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM), clindamycin (CLM), tetracycline ), Syneride (Q / D) and chloramphenicol (CP).

For antibiotics except for clindamycin, the concentrations of 256, 128, 64, 32, 16, 8, 4, 2, 1 and 0.5 ㎍ / ㎖ were added to broth mixed with 10% ISO-sensitized broth and 90% MRS broth, Clindamycin was added at concentrations of 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625 and 0.03125 ㎍ / ㎖, respectively, since the EFSA breakpoint value of the lactobacillus group was below 0.25 ㎍ / Respectively. In addition, the thinner was carried out using an E-test strip of BioMeriux.

Isolated Bifidobacterium Bifidom BF3 is considered to comply with the safety criteria for antibiotics of EFSA (see Table 4) because all antibiotic resistance used in the experiment was lower than the EFSA antibiotic resistance criteria.

Antibiotics MIC of BF3 EFSA breakpoint (mg / L) Ampicillin (AMP) <0.5 <2 Vancomycin (VAN) <0.5 <2 Gentamycin (GEN) <8 <64 Kanamycin (KAN) <64 n.r. Streptomycin (ST) <32 <128 Erythromycin (ERM) <0.5 <0.5 Clindamycin (CM) <0.03 <0.25 synercid (Q / D) <0.50 <1 Tetracycline (TET) <8 <8 Chloramphenicol (CP) <2 <4

Based on the above results, the novel microorganisms isolated from the feces were treated with Bifidobacterium Bifidom BF3 ( Bifidobacterium bifidum BF3). On May 7, 2012, KCTC deposited microorganism resource center (KCTC), the depository of the Korean patented strain, and received KCTC 12199BP.

3. Bifidobacterium Animal Malice Lactis BL3 ( Bifidobacterium animali s subsp . lactis BL3 ) KCTC  Isolation and identification of 11904BP

3-1. Selection of new strains

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into a solid medium of Glucose Blood Liver (BL BD, USA) and incubated for 3 days in anaerobic condition. The resulting colonies were picked again on a Lactobacillus culture medium supplemented with BCP (Bromocresol purple, 0.17 g / L) in BL, and then cultured again for 3 days under the same conditions. The colony was transformed into a yellow color, and biochemical and molecular biology identification was performed. One of the strains with the best physical properties was finally selected.

3-2. Identification of selected strains

1) Usability analysis

The strains isolated from human feces were tested for their glycosylation using an API CHL50 kit. The results of the confirmation of the usability were entered into the API web (https://apiweb.biomerieux.com), and the results are shown in Table 5 below.

No Carbohydrates Utilized No Carbohydrates Utilized 0 Control - 25 Esculine + One Glycerol - 26 Salicine - 2 Erythritol - 27 Cellobiose - 3 D-Arabinose - 28 Maltose + 4 L-Arabinose w 29 Lactose + 5 Ribose + 30 Melibiose + 6 D-Xylose w 31 Saccharose + 7 L-Xylose - 32 Trehalose - 8 Adonitol - 33 Inuline - 9 β-Methyl-xyloside - 34 Melezitose - 10 Galactose - 35 D-Raffinose + 11 D-Glucose + 36 Amidon - 12 D-Fructose - 37 Glycogene - 13 D-Mannose - 38 Xylitol - 14 L-Sorbose - 39 β-Gentiobiose + 15 Rhamnose - 40 D-Turanose - 16 Dulcitol - 41 D-Lyxose - 17 Inositol - 42 D-Tagatose - 18 Mannitol + 43 D-Fucose - 19 Sorbitol - 44 L-Fucose - 20 a-Methyl-D-mannoside - 45 D-arabitol - 21 a-Methyl-D-glucoside - 46 L-Arabitol - 22 N-Acetyl glucosamine - 47 Gluconate - 23 Amygdaline + 48 2-Ceto-gluconate - 24 Arbutine - 49 5-Ceto-gluconate -   w: weak change

2) 16s rRNA  Sympathy

In order to identify the selected strains by molecular biology, 16s rRNA sequence was analyzed. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). (MyCycler, BIO-RAD, USA) was performed using primers F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and primer R (5'-AAGGAGGTGATCCAGCC-3') in the 16s rRNA region using the extracted DNA as a template. The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / ampplate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the Cluster V method of the DNA star program to compare homology with several strains of Bifidobacterium including B. lactis ^T (DSM 10140). 16s rRNA nucleotide sequences of the isolated strain, as shown in Figure 8, Bifidobacterium Showed lactis ^T (DSM 10140) and homology of 99.9%.

3) RAPD  ( Random Amplified Polymorphic DNA ) analysis

RAPD analysis showed that the Bifidobacterium Animal Malice The genome DNA was extracted from the lock teeth BL3, was carried out to the separated DNA as a template _{(GTG) 5 (5'-GTGGTGGTGGTGGTG} -3 ') PCR-RAPD (MyCycler, BIO-RAD, USA) using primers. The final product, the PCR product, was stained with EtBr and stained with G: BOX (SYNGENE, UK). In addition, PFGE analysis was performed using pure cultured Bifidobacterium Animal Malice Lactis BL3 was set to OD ₆₀₀ = 4 as a final OD, a plug was prepared, and then genomic DNA was cut out using various enzymes, followed by electrophoresis, and then the control group, B. animalis subsp. lactis ^T (DSM 10140).

In the RAPD results, the strains isolated showed, as shown in Fig. 9, Bifidobacterium Animal Malice BL3 the B. animalis lactis subsp. lactis ^T (DSM 10140), whereas B. animalis subsp. showed a different band pattern from that of animalis ^T (ATCC 25527). In FIG. 9, lane 1 represents B. animalis subsp. animalis ^T (ATCC 25527), lane 2 is the result of B. animalis subsp. lactis ^T (DSM 10140), lane 3 is the result of bifidobacterium Animal Malice Lactis BL3 results. Based on the above results, microorganisms isolated from the feces, Bifidobacterium Animal Malice BL3 are B. animalis lactis subsp. animalis ^T (ATCC 25527).

4) PFGE ( Pulse Field Come Electrophoresis analysis

Bifidobacterium pure cultured in BL broth Animal Malice After the fabrication of the plug (plug) aligned after measuring the OD of the lock teeth BL3 using 2% Low Melting Agarose to a final OD ₆₀₀ = 4 after cutting the genomic DNA with the enzymes performing electrophoresis control group B. animalis subsp. lactis ^T (DSM 10140) and B. animalis subsp. animalis ^T (ATCC 25527).

The prepared plugs were put into 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug 6 times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand for 30 minutes at room temperature. After transferring the plug to 400 μl of the new enzyme buffer, 20U) and incubated overnight at 37 ° C. The restriction enzymes were SpeI and XbaI. Electrophoresis was carried out using a CHEF system (BIO-RAD, USA) at a rate of 6 cm / V in 0.5 × TBE, 10 s to 20 s Pulse time, 20 hours.

After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution. As a result of PFGE using SpeI and XbaI, Fecal Bifidobacterium Animal Malice BL3 are B. animalis lactis subsp. lactis ^T (DSM 10140), and B. animalis subsp. animalis ^T (ATCC 25527), which is a new strain showing a different band pattern. 10, lane 1 represents B. animalis subsp. animalis ^T (ATCC 25527), lane 2 is the result of B. animalis subsp. lactis ^T (DSM 10140), lane 3 is the result of bifidobacterium Animal Malice Lactis BL3 results.

5) Evaluation of antibiotic resistance

Isolated Bifidobacterium Animal Malice Antibiotic resistance were analyzed in order to verify the safety of the lock teeth BL3. Antibiotic resistance tests were carried out using the micro-dilution method recommended by the European Food Safety Authority (EFSA). Ten antibiotics were used: ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM), cinnamic acid (Q / D), clindamycin (CLM), tetracycline (TET) and chloramphenicol (CP).

For antibiotics except for clindamycin, the concentrations of 256, 128, 64, 32, 16, 8, 4, 2, 1 and 0.5 μg / ml were added to broth mixed with ISO-sensitized broth 10% and MRS broth 90% Since clindamycin has an EFSA breakpoint value of less than 0.25 μg / ml in the lactobacillus group, antibiotics were added at concentrations of 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625 and 0.03125 μg / Respectively. In addition, the thinner was carried out using an E-test strip of BioMeriux.

The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, Bifidobacterium Animal Malice Lactis BL3 was identified to be resistant to each antibiotic and is shown in Table 6 below.

Antibiotics MIC of BL3 EFSA breakpoint (mg / L) Ampicillin (AMP) <0.5 <2 Vancomycin (VAN) <0.5 <2 Gentamycin (GEN) <16 <64 Kanamycin (KAN) <256 n.r. Streptomycin (ST) <16 <128 Erythromycin (ERM) <0.5 <0.5 Clindamycin (CM) <0.03 <0.25 synercid (Q / D) <0.19 <1 Tetracycline (TET) <8 <8 Chloramphenicol (CP) <2 <4

Isolated Bifidobacterium Bifidom BF3 is considered to comply with the safety criteria for antibiotics of EFSA because the resistance to all antibiotics used in the experiment is lower than the EFSA antibiotic resistance standard.

Based on the above results, the novel microorganisms isolated from the feces were treated with Bifidobacterium Animal Malice Lactis deposited in BL3 (Bifidobacterium animali s subsp. Lactis BL3) were named as, the Republic of Korea Patent strain deposited on May 7, 2012, Microbiological institute Resource Center (KCTC) and was given the accession number KCTC 11904.

4. Bifidobacterium Longong BG7  ( Bifidobacterium longum BG7 ) ( KCTC  12200 BP )

4-1. Selection of new strains

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into a solid medium of Glucose Blood Liver (BL BD, USA) and incubated for 3 days in anaerobic condition. The resulting colonies were picked again on a Lactobacillus culture medium supplemented with BCP (Bromocresol purple, 0.17 g / L) in BL, and then cultured again for 3 days under the same conditions. The colony was transformed into a yellow color, and biochemical and molecular biology identification was performed. One of the strains with the best physical properties was finally selected.

4-2. Identification of selected strains

1) Usability analysis

The strains isolated from human feces were tested for their glycosylation using an API CHL50 kit. The results of confirmation of the usability were entered into the API web (https://apiweb.biomerieux.com), and the results are shown in Table 7 below.

2) 16s rRNA  Sympathy

In order to identify the selected strains by molecular biology, 16s rRNA sequence was analyzed. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). PCR (MyCycler, BIO-RAD, USA) was performed using the extracted DNA as a template using a primer F (5'-AGAGTTTGATCCTGGCTCAG3 ') and a primer R (5'-AAGGAGGTGATCCAGCC 3') in a 16s rRNA region. The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / ampplate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the Cluster V method of the DNA star program to compare homology with several strains of Bifidobacterium, including B. longum ^T (ATCC 15707). The 16s rRNA sequence of the isolated strain showed 99.1% homology with B. longum ^T (ATCC 15707) as shown in Fig.

3) RAPD  ( Random Amplified Polymorphic DNA ) analysis

RAPD analysis showed that the Bifidobacterium Genomic DNA was extracted from Longgum BG7 and PCR-RAPD (MyCycler, BIO-RAD, USA) was performed using the separated DNA as a template (GTG) ₅ (5'-GTGGTGGTGGTGGTG 3 ') primer. The final product, the PCR product, was stained with EtBr and stained with G: BOX (SYNGENE, UK). In addition, PFGE analysis was performed using pure cultured Bifidobacterium Longgum BG7 was prepared with a final OD of OD ₆₀₀ = 4, and the DNA was cut out by using various enzymes, followed by electrophoresis and compared with the control group B. longum ^T (ATCC 15707).

In the RAPD results, the strains isolated showed, as shown in Fig. 12, Bifidobacterium Longgum BG7 showed a different band pattern from B. longum ^T (ATCC 15707). 12, lane 1 is B. longum ^T (ATCC 15707), lane 2 is the result of Bifidobacterium Longong BG7 results. It is separated from the fecal microorganisms based on the results of the above Bifidobacterium B. longum ^T is ronggum BG7 (ATCC 15707).

4) PFGE ( Pulse Field Come Electrophoresis analysis

Bifidobacterium pure cultured in BL broth The OD of Longgum BG7 was measured and plugs were prepared with 2% ow Melting Agarose to final OD ₆₀₀ = 4. Then, the genomic DNA was cut using various enzymes and electrophoresis was performed. The control group B. longum ^T (ATCC 15707).

The prepared plugs were put into 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug 6 times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand for 30 minutes at room temperature. After transferring the plug to 400 μl of the new enzyme buffer, 20U) and incubated overnight at 37 ° C. The restriction enzymes were XbaI and Apa I. The electrophoresis was carried out using a CHEF system (BIO-RAD, USA) at 0.5 × TBE at 5.3 cm / Pulse time, and 18 hours.

After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution. As a result of PFGE using XbaI and ApaI, Fecal Bifidobacterium Longgum BG7 is B. longum ^T (ATCC 15707), which is a new strain showing a different band pattern. 13, lane 1 is the result of B. longum ^T (ATCC 15707), lane 2 is the result of bifidobacterium It is the result of Longgum BG7.

5) Enzyme activity test

Bifidobacterium In order to measure the enzymatic activity of ronggum BG7 (B. longum BG7) confirmed the difference in the enzyme using API ZYM kit. Bifidobacterium When the enzymatic activities of Longum BG7 and B. longum ^T ( ATCC 15707) were compared, Bifidobacterium Longgum BG7 showed almost similar enzymatic activity to B. longum ^T ( ATCC 15707). In particular, Bifidobacterium Longgum BG7 exhibits β-glucosidase activity that does not exhibit enzyme activity in B. longum ^T ( ATCC 15707), which degrades the glucose contained in the peptidoglycan of the gram-negative pathogenic strain cell wall to produce a pathogenic strain It inhibits growth. In addition, the activity of β-glucuronidase, a carcinogenic enzyme, was not observed.

6) Evaluation of antibiotic resistance

Isolated Bifidobacterium Antimicrobial resistance was analyzed to verify the safety of Longgum BG7. Antibiotic resistance tests were carried out using the micro-dilution method recommended by the European Food Safety Authority (EFSA). Ten antibiotics were used: ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM), cinnamic acid (Q / D), clindamycin (CLM), tetracycline (TET) and chloramphenicol (CP). Antibiotics except clindamycin were added at concentrations of 256, 128, 64, 32, 16, 8, 4, 2, 1, and 0.5 ㎍ / ㎖ in broth containing ISO-sensitized broth 10% and MRS broth 90% , The concentrations of antibiotics were added at concentrations of 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625, and 0.03125 ㎍ / ㎖ because the EFSA breakpoint value of the lactobacillus group was less than 0.25 ㎍ / . In addition, the thinner was carried out using an E-test strip of BioMeriux.

The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, Bifidobacterium It is confirmed whether or not Longchum BG7 is resistant to each antibiotic, and it is shown in Table 9 below.

Isolated Bifidobacterium Longgum BG7 is considered to be suitable for the antibiotic safety criteria of EFSA because the resistance to all antibiotics used in the experiment is lower than the EFSA antibiotic resistance standard.

Based on the above results, the novel microorganisms isolated from the feces were treated with Bifidobacterium BG7 longum BG7). On May 7, 2012, KCTC deposited microorganism resource center (KCTC), a depository of the Korean patented strain, and received KCTC 12200BP.

5. Preparation of compositions for the prevention / treatment of irritable bowel syndrome

(1) Lactic acid bacteria fermentation medium

The fermentation medium for the cultivation of the lactic acid bacteria strain contained in the composition of the present invention is a fermentation medium containing 1% -10% (w / v) aqueous solution of skimmed milk powder and soy protein isolate, respectively, (Delvolase; DSM, Netherlands) in the range of -1% (w / w). For the Lactobacillus species of Bifidobacterium bifidum and Bifidobacterium longum, the enzyme treatment step was omitted.

After the enzyme treatment, the yeast extract in the range of 0.1% to 5% (w / v), the yeast extract in the range of 0.1% to 5% (w / v), the starch such as sucrose, Addition of ionic constituents of soymilk citrate, sodium acetate, dipotassium phosphate, magnesium sulfate, manganese sulfate, sodium chloride in the range of 5% (w / v) soy peptone, 0.01% -0.1% (w / v) And dissolved to prepare a lactic acid bacteria culture medium. The prepared culture medium for lactic acid bacteria was sterilized using a heat exchanger.

(2) Cultivation of lactic acid bacteria and production of lactic acid bacteria

The lactic acid bacterium pre-cultured on the fermentation broth of the lactic acid bacteria prepared in the step (1) was inoculated at a level of 0.1% -1% (v / v) and maintained at 37 ° C and a pH of 5.0-6.0. Followed by fermentation for 18 hours. After the cultivation of the lactic acid bacteria was completed, the lactic acid bacteria were separated and concentrated using a continuous centrifuge. The isolated lactic acid bacteria were lyophilized by adding a cryoprotectant, etc., followed by pulverizing the lactic acid bacteria using a pulverizer to have a uniform particle size and then producing lactic acid bacteria.

(3) Preparation of Lactic Acid Bacteria Composition

The lactic acid bacteria prepared in the step (2) were measured to have the following viable cell counts;

Lactobacillus Also know loose fill LA1 lactic acid (more than 1X10 ⁹ CFU / g),

Lactobacillus Lambsos LR5 lactic acid bacteria (1 x ^{10 9} CFU / g or more),

Bifidobacterium Bifidom BF3 bifidobacteria (1 x ^{10 9} CFU / g or more),

Bifidobacterium Animal Malice Lactis BL3 bifidobacteria (at least 1 x ^{10 9} CFU / g),

Bifidobacterium Longgum BG7 bifidus (5X10 ⁹ CFU / g or more),

Streptococcus Thermophilus ST3 lactic acid bacteria (1X10 ⁹ CFU / g or more).

In this Example, each lactic acid bacterial species was mixed with an excipient in the composition shown in the following Table 10 to 500 mg per capsule, and the total viable cell count was 5 × 10 ⁹ CFU / g. The hydroxypropylmethylcellulose capsule was prepared. The thus prepared composition of the present invention was administered to IBS patients for 4 weeks twice a day (1.0 × 10 ¹⁰ CFU / day) orally once a day.

Raw material name ratio (%) Streptococcus thermophilus ST3 lactic acid bacteria 2.3 Lactobacillus LRN5 Lactobacillus Lactobacillus 2.1 Lactobacillus acidophilus LA1 lactic acid bacteria 2.3 Bifidobacterium animaris Lactis BL3 2.3 Bifidobacterium bifidum BF3 bifidobacteria 2.0 Bifidobacterium longum BG7 bifidus 2.1 Maltodextrin 50.0 Corn starch 35.9 Silicon dioxide 1.0 Sum 100.0

Comparative Example

The comparative example was prepared as a placebo having the same appearance, color and size except that the active ingredient, lactic acid bacteria, only the excipients of Table 10 above.

Experimental Example

1. Subject Screening

Clinical studies were conducted under the following conditions using patients with diarrhea-predominant or constipation-predominantly irritable bowel syndrome (IBS).

Subjects: Patients with IBS according to the Rome III criteria (Longstreth GF, Thompson WG, Chey WD, Houghton LA, Mearin F, Spiller RC, Functional bowel disorders. Gastroenterology 2006; 130: 1480-91)

Number of patients : 50

Test period : 1 week screening period and 4 weeks treatment period

Referring to Figure 1, 49 of the 60 IBS patients were screened and 49 of them were randomly divided into two groups: 25 in the Example and 24 in the Comparative Example. Of the 50 men, 17 were males and 32 were females. There were no patients who did not complete the experiment in the composition administration group (Example) of the Example and the placebo administration group (Comparative Example) of the Comparative Example, and the experiment was completed for a total of 49 patients. Table 11 summarizes the characteristics of patients at baseline before treatment initiation. All values are expressed as mean ± standard deviation (SD).

Characteristic Example (n = 25) Comparative Example (n = 24) P value age 45.9 ± 13.9 43.3 ± 15.3 0.53 Sex, Male: Female 11:14 6:18 0.385 IBS type: diarrhea 17 15 0.77 IBS type: Constipation type 9 8 One VAS Average Score ± SD Symptom Example Comparative Example P  value Difficulty with normal activities 2.28 ± 1.24 4.83 ± 2.30 0.17 Difficulty with GI symptoms 4.64 ± 2.18 4.96 ± 1.90 0.59 Severity of abdominal pain 2.32 ± 0.75 2.17 + - 0.76 0.48 Severity of abdominal discomfort 2.64 ± 0.81 2.42 ± 0.78 0.33 Severity of diarrhea 2.24 ± 0.93 2.21 ± 0.83 0.90 Severity of constipation 1.92 ± 0.91 1.96 + 1.27 0.90 Abdominal bloating severity 2.72 ± 0.79 2.50 ± 1.25 0.47 Gas passing severity 3.12 ± 0.93 2.79 ± 1.18 0.28 Bowel frequency 6.88 + - 4.72 6.25 + - 4.58 0.63 Abdominal pain frequency 2.28 ± 1.24 2.50 ± 1.69 0.61

2. IBS  Symptoms and stools Parameter  Clinical evaluation

The efficacy of the composition for the prevention or treatment of irritable bowel syndrome of the present invention was evaluated by allowing the patient to evaluate and record the progress of the IBS symptoms in the form of self-questionnaires daily during the treatment period (4 weeks). The primary endpoint was the appropriate symptom relief (AR) effect on overall IBS symptoms, and the appropriate symptom relief effect on overall IBS symptoms for 4 weeks post-dose.

During the screening and treatment period, the 10 symptoms associated with the next IBS of the patients were recorded daily and the response rate to these 10 symptoms was assessed: normal activity difficulty, difficulty in intestinal symptoms, abdominal pain, abdominal discomfort, diarrhea, constipation, Abdominal bloating, gas passing, bowel frequency, and abdominal pain frequency. Each symptom was rated on a 10-cm visual analogue scale ("VAS") with a maximum score of 10 points. The frequency of bowel movement was evaluated by the number of bowel movements during the day. The degree of improvement of six symptoms related to IBS at the start and four weeks after the start of the treatment is shown in FIG. 16 to FIG. 18, and whether abdominal pain symptom improvement, bowel habit change, or overall digestive symptom improvement is shown in FIG. 19 to FIG. 21 .

16 to 18, the severity of diarrhea and constipation was significantly improved in both the examples and the comparative examples, but the severity of abdominal pain, frequency of abdominal pain, and bowel movements were significantly improved only in the case of the examples Respectively.

19 to 21, in the comparison between the group administered with the composition of the present invention and the placebo group after 4 weeks of treatment, abdominal pain (96.0% vs. 70.8%), bowel habit satisfaction rate (96% 75%) and the daily improvement rate (96% vs 75%) were higher in the group administered with the composition of the present invention ( p <0.05). From the above results, it can be confirmed that the composition of the present invention is effective for the treatment of irritable bowel syndrome irritable bowel syndrome, and particularly, it improves intestinal symptoms such as abdominal pain and bowel movements.

3. Total intestinal microorganism examination

(1) Bacterial strain and culture conditions Bacterial Strain and Growth Conditions )

All lactic acid bacterial strains were cultured in broth at 37 ℃ under anaerobic conditions for 13-18 hours. Bifidobacterium Bifidom BF3, Bifidobacterium Animal Malice Lactis BL3, Bifidobacterium Longgum BG7 strain was cultured in glucose blood liver broth (BL, Difco USA), and Lactobacillus Phil also know Ruth LA1, Lactobacillus Lambsus LR5, and streptococcus The Staphylococcus ST3 strain was cultured in ManRogosaSharpe broth (MRS, Difco).

(2) From the stool sample Genome DNA Preparation of

Stool samples were received from 33 patients (Example: 18 patients, Comparative Example: 15 patients) from 49 patients and received frozen storage. To extract genomic DNA from the stool samples of each patient, the stool collected from the patient and frozen was stored at 4 ° C overnight. After removing 200 mg from each sample, 9 ml of C-buffer (0.6% KH ₂ PO ₄ , 0.45% Na ₂ HPO ₄ , 0.05% Tween 80, and 0.05% cysteine), homogenized and passed through packed glass wool in a disposable 10 ml syringe.

The resultant was centrifuged (MICRO 17R) at 12,000 rpm for 10 minutes at 4 ° C. The pellet was washed three times with the same buffer and 10 mg of final pellet was resuspended in 200 μl of lysozyme solution (20 mM Tris-Cl, pH 8.0, 2 mM EDTA, 1.2% Triton X-100 and 20 mg / )), Followed by incubation at 37 DEG C for 1 hour. Then, whole genomic DNA was extracted using AcuuPrep genome extraction kit (Bioneer, Seoul, Korea) according to the manufacturer's instructions.

(3) Quantitative analysis of stool microbial count

In this example, the change in the composition of stool microbial mass in IBS was analyzed by real-time PCR quantitative analysis.

end. primer( Primers )

The primers used in qPCR are shown in Table 3 below. In order to exclude cross-amplification of the target strains in the feces during qPCR, the specificity of the primer set was evaluated using DNA extracted from each strain contained in the composition in the above example.

I. Real-time quantitative PCR ( Real time quantitative PCR )

Quantitative PCR analysis was performed with a total volume of 20 μl containing 1 μl of template DNA, 0.5 μl of each primer (10 μM), 10 μl of SYBR Green I Master (Roche, Germany), and 8 μl of H ₂ O Respectively. The PCR reaction was pre-incubated at 94 ° C for 4 minutes and denaturation at 94 ° C for 15 seconds, annealing at 54 ° C for 15 seconds, and extension at 72 ° C for 20 seconds with 55 cycles. Fluorescence was detected at 88 ° C for 5 seconds per cycle, and the melting curve was drawn by raising the temperature from 55 ° C to 95 ° C by 0.5 ° C.

All. Standard curve ( standard curve )

Standard curves were generated using pure cultures of each strain of the composition of the Examples. The total number of cells in 1 ml of cell culture was measured using a hematocytometer (MARIENFELD, 0.0025 mm 2, Germany). Genomic DNA was prepared from 1 ml of the cell culture as described above. The concentration of DNA was measured using e-spect (Malcom, Japan) and serially diluted 10-fold. PCR was performed using the species-specific primers shown in Table 12 below. After PCR amplification, the Cp (Cross point) value was plotted against the total number of cells of the corresponding diluent. The DNA from each of the standard strains was amplified by real-time PCR three times in order to increase the reliability, and a curve of R ² > 0.99 was obtained. The Cp value obtained by PCR on each strain was converted to a value for the total number of cells in the feces of 1 g using a standard curve.

Targeted species Primer Sequence (5'-3 ') Reference B. longum F CAGTTGATCGCATGGTCTT 1,5 R TAC CCG TCG AAG CCAC B. bifidum BiBIF-1 CCACATGATCGCATGTGATTG 2,5 BiBIF-2 CCGAAGGCTTGCTCCCAAA B. lactis F CCCTTTCCACGGGTCCC One R AAGGGAAACCGTGTCTCCAC L. acidophilus F acid IS GAAGAGCCCAAACCAAGTGATT 3 R acid IS CTTCCCAGATAATTCAACTATCGCTTA L. rhamnosus LU-5 CTAGCGGGTGCGACTTTGTT 4 RhaII GCGATGCGAATTTCTATTAT S. thermophilus ThI ACG GAA TGT ACT TGA GTT TC 6 ThII TTT GGC CTT TCG ACC TAA C

Table 13 shows changes in intestinal microbial counts before and after administration of the composition (Example) and placebo (Comparative Example) of the present invention.

As shown in Table 13, lactobacillus Lambsus LR5 , Bifidobacterium Animal Malice Lactis BL3 and Streptococcus The number of stomophilus ST3 increased significantly It is possible to confirm that it induces the change of the flour.

Also, Bifidobacterium Animal Malice The relationship between the improvement of abdominal pain and abdominal pain frequency was investigated in a 10-fold increase in lactis BL3. Table 14 below shows Bifidobacterium Annie Marlies lactis showed a table the relationship between the group and BL3 increased abdominal pain often improved, exhibited a light-opened between Lactobacillus ramno Versus LR5 increasing frequency group and abdominal pain improvement in Table 6 below.

All (N = 33) Diarrhea group (N = 23) colic
frequency
Improvement No change
(N = 22) More than 10 times increase ^*
(N = 12) P value No change
(N = 14) More than 10 times increase ^*
(N = 9) P value 45.5% (10/22) 91.9% (11/12) 0.011 57.1% (8/14) 100.0% (9/9) 0.048

More than 10 times increase ^* ; Calculated as N log10 cells / g feces

*, P < 0.05

All (N = 33) Diarrhea group (N = 23) Abdominal pain frequency improvement No change
(N = 19) More than 10 times increase ^*
(N = 15) P value No change
(N = 11) More than 10 times increase ^*
(N = 12) P value 47.4% (9/19) 80.0% (12/15) 0.079 54.5% (6/11) 91.7% (11/12) 0.069

More than 10 times increase ^* ; Calculated as N log10 cells / g feces

*, P < 0.05

As it will be confirmed by the results of Table 14, an increase in bifidobacteria populations after dosing compared to pre dosing of the composition Te gambling Solarium Animal Malice Lactis BL3, Lactobacillus Lumosus LR5 and streptococcus Book a brush Ruth ST3 of Bifidobacterium Animal Malice The incidence of abdominal pain was significantly improved in the group with increased lactis BL3, which was more pronounced in diarrhea type IBS. Also, see the results of Table 15, Lactobacillus Lumosus LR5 Similarly, increased incidence of abdominal pain can be confirmed in an increased number of bacteria.

As described above, it has been confirmed that the composition comprising six kinds of lactic acid bacteria of the present invention provides appropriate relief of symptoms of IBS, improves intestinal symptoms such as abdominal pain and bowel movements, and improves daily life. The therapeutic effect of the composition was confirmed to be related to changes in intestinal microbial counts.

The present invention can be variously modified and changed without departing from the spirit and scope thereof, and such facts will be apparent to those skilled in the art. The specific embodiments described herein are merely illustrative of preferred embodiments of the invention and should not be construed as limiting the invention. It is intended that the scope of protection of the present invention be defined by the appended claims, and that the various modifications and variations are intended to be included within the scope of the present invention.

Korea Biotechnology Research Institute KCTC11906BP 20120428 Korea Biotechnology Research Institute KCTC12202BP 20120507 Korea Biotechnology Research Institute KCTC12199BP 20120507 Korea Biotechnology Research Institute KCTC11904BP 20120507 Korea Biotechnology Research Institute KCTC12200BP 20120507 Korea Biotechnology Research Institute KCTC11870BP 20110302

Claims (14)

Korea Research Institute of Bioscience and Biotechnology Gene Bank; the Lactobacillus ramno Seuss LR5 (Lactobacillus rhamnosus LR5) as an international deposit accession No. KCTC 12202BP the (Korean Collection for Type Culture KCTC) Lactobacillus.
delete delete delete Lactobacillus Phil also know Ruth LA1 (Lactobacillus acidophilus LA1 (KCTC 11906BP)), Lactobacillus nosu people's LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP) , Bifidobacterium BP Doom BF3 (Bifidobacterium bifidum BF3 (KCTC 12199BP) , Bifidobacterium Animal Malice Lactis BL3 (Bifidobacterium animali s subsp. Lactis BL3 (KCTC 11904BP), Bifidobacterium Longgum BG7 ( Bifidobacterium longum BG7 (KCTC 12200BP)), and Streptococcus Book a brush Ruth ST3 (Streptococcus thermophilus ST3 (KCTC 11870BP)), or a culture thereof, for preventing or treating irritable bowel syndrome.
6. The composition according to claim 5, wherein the composition comprises, as the active ingredient, a lactic acid bacterium mixture in a content of 10 ⁸ to 10 ¹² cfu / g, or an equivalent number of viable bacteria, relative to the total weight of the composition A composition for the prevention or treatment of irritable bowel syndrome.
6. The method according to claim 5, wherein the composition is useful for the prevention or treatment of diarrhea-predominant irritable bowel syndrome, constipation-predominant irritable bowel syndrome, or diarrhea-constipation mixed irritable bowel syndrome Composition.
6. The composition of claim 5 wherein the composition is selected from the group consisting of Lactobacillus &lt; RTI ID = 0.0 &gt; salivarius), Lactobacillus brevis (Lactobacillus brevis , Lactobacillus helveticus , Lactobacillus &lt; RTI ID = 0.0 &gt; fermentum), Lactobacillus para Kasei (Lactobacillus paracasei , Lactobacillus &lt; RTI ID = 0.0 &gt; casei ), Lactobacillus delbrueckii , Lactobacillus leu terri ( Lactobacillus delbrueckii , reuteri , Lactobacillus &lt; RTI ID = 0.0 &gt; buchneri , Lactobacillus gasseri , Lactobacillus &lt; RTI ID = 0.0 &gt; johonsonii , Lactobacillus &lt; / RTI &gt; kefir , Lactococcus lactis), Bifidobacterium Bifidobacterium Doom (Bifidobacterium bifidum), Bifidobacterium Infante Tees (Bifidobacterium infantis ), Bifidobacterium pseudolongum), Bifidobacterium write a brush room (B ifidobacterium themophilu m), and Bifidobacterium Adolfo sentiseu (Bifidobacterium adolescentis) irritable bowel syndrome, which further comprises one or more kinds of lactic acid bacteria selected from the group consisting of prophylaxis or treatment / RTI &gt;
The composition of claim 5, wherein the composition further comprises a pharmaceutically acceptable carrier or excipient.
[Claim 5] The composition of claim 5, wherein the composition comprises lactic acid bacteria of the genus Lactobacillus, lactic acid bacteria of the genus Bifidobacterium, and lactic acid bacteria of the genus Streptococcus in a ratio of 1: 1: 1 to 2: 3: Or a pharmaceutically acceptable salt thereof.
6. The composition for preventing or treating irritable bowel syndrome according to claim 5, wherein the composition comprises six kinds of lactic acid bacteria in the same ratio.
[Claim 6] The composition for preventing or treating irritable bowel syndrome according to claim 5, wherein the composition is prepared by lyophilizing lactic acid bacteria strains in the form of a prodrug.
A pharmaceutical product comprising a composition for the prevention or treatment of irritable bowel syndrome containing lactic acid bacteria according to any one of claims 5 to 12.
Lactobacillus also know Phil Ruth LA1 (Lactobacillus acidophilus LA1 (KCTC 11906BP )), Lactobacillus nosu people's LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP ), Bifidobacterium Bifidobacterium Doom BF3 (Bifidobacterium bifidum BF3 (KCTC 12199BP)), Bifidobacterium lactis Annie Marlies BL3 (Bifidobacterium animali s subsp. Lactis BL3 (KCTC 11904BP)), Bifidobacterium ronggum BG7 (Bifidobacterium longum BG7 (KCTC 12200BP )), and Streptococcus up a brush loose ST3 (Streptococcus thermophilus ST3 (KCTC 11870BP )) or foods containing these cultures.

Images