KR101656208B1 - Composition for use in the prevention or treatment of inflammatory disease - Google Patents

Abstract

The present invention as an active ingredient Lactobacillus casei LC5 (Lactobacillus casei LC5, (KCTC 12398)), Lactobacillus Planta room LP3 ((Lactobacillus plantarum LP3 (KCTC 10782)), Lactobacillus ramno Versus LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP), and Bifidobacterium lactis Annie Marlies BL3 (Bifidobacterium animali s subsp. lactis BL3 (KCTC 11904BP)), or a culture thereof.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for preventing or treating an inflammatory disease,

The present invention relates to a composition for preventing or treating an inflammatory disease, and more particularly, to a composition for preventing or treating inflammatory diseases containing multiple lactic acid bacteria useful for prevention and treatment of inflammation including four kinds of lactic acid bacteria.

In general, Inflammatory Bowel Disease ("IBD") is a condition that occurs in genetically sensitive individuals due to an abnormal immune response to intestinal antigen. It is believed that the onset of inflammatory bowel disease causes destruction of the mucosal immune system, thereby weakening the response to endogenous antigens. Inflammatory bowel disease is a series of chronic, recurrent, and tissue-destructive disorders characterized by dysfunctional, abnormal cytokine production and cellular inflammation of mucosal T-cells that ultimately cause damage to the intestinal mucosa.

Clinical symptoms of inflammatory bowel disease (IBD) include diarrhea, abdominal pain, rectal bleeding, weight loss, fatigue, occasionally fever, and the clinical progression of inflammatory bowel disease is very diverse. Patients with mild or moderate symptoms are not hospitalized Treatment can be given, but 10-15% of the patients progress to severe disease, often accompanied by surgery.

IBD is medically treated by relieving inflammation and controlling gastrointestinal symptoms. However, there is currently no medical treatment for IBD. Colonectomy can remove colon ulcers, but can reduce quality of life and increase the risk of complications. Available medical treatments include the use of drugs and immunomodulators. However, existing medicines have side effects such as diarrhea or abdominal pain, and severe side effects such as bone loss, infection, diabetes, muscle wasting and schizophrenia occur during long-term use. Immunomodulators control IBD symptoms by inhibiting the immune system, but the resulting immune-deprived condition makes the patient susceptible to various diseases. Thus, due to the recent safety issues, its application is limited in many ways. Therefore, there is a growing interest in developing new therapeutic agents for IBD.

Studies using probiotics alone or in combination with antibiotics to treat patients with inflammatory bowel disease have been conducted. For example, Korean Patent Laid-Open Publication No. 2012-0016647 discloses Lactobacillus rhamnosus LGG (ATCC 53103), Lactobacillus lambosus LC705 (DSM 7061) and / or Propionibacterium predude reiki ssp. Prophylactic compositions for alleviating, preventing and / or treating low-grade inflammation caused by diets consisting of a combination of dietary supplements such as, for example, Shermani JS (DSM 7067) or mixtures thereof.

U.S. Patent No. 7,195,906 discloses a Bifidobacterium strain isolated from human gastrointestinal tract (Bifidobacterium NCIMB 41003) for the treatment of inflammatory diseases, particularly gastrointestinal inflammation, and U.S. Patent Publication No. 2012/0269791 discloses a fermented Discloses a method of treating inflammatory bowel disease using a composition comprising a non-pathogenic microorganism such as lactose, bovine serum, cereal, and lactobacillus or bifidobacterium.

Despite the promising potential, significant improvements in the effectiveness of probiotics are required for use in the treatment of inflammatory bowel disease as well as other gastrointestinal disorders. However, since the above-mentioned compositions are not sufficient in improving the inflammatory disease, development of a composition useful for the treatment of inflammatory diseases, particularly gastrointestinal inflammation, including probiotics with more excellent effects is desired.

It is an object of the present invention to provide a composition useful for preventing or treating inflammatory diseases, including various strains of lactic acid bacteria, in order to meet the technical requirements of the technical field to which the present invention belongs.

It is a further object of the present invention to provide a foodstuff comprising a variety of probiotics or cultures thereof.

It is another object of the present invention to provide novel lactic acid bacterial strains which provide an efficacy useful for the prevention or treatment of inflammatory diseases.

One aspect of the present invention for achieving the above object is Lactobacillus casei LC5 (Lactobacillus casei LC5), Lactobacillus Planta room LP3 (Lactobacillus plantarum LP3), Bifidobacterium Annie Marlies lactis BL3 (Bifidobacterium animali s subsp. lactis BL3 (KCTC 11904BP)), it relates to a Lactobacillus person's nosu LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP ) or a composition for preventing or treating inflammatory diseases, including those of the culture.

The composition for preventing or treating an inflammatory disease comprising the complex lactic acid bacterium of the present invention may further comprise other lactic acid bacteria or a pharmaceutically acceptable carrier or adduct.

Another aspect of the present invention for achieving the above objective, Korea Research Institute of Bioscience and Biotechnology Gene Bank; as accession number KCTC 12398BP the (Korean Collection for Type Culture KCTC) international deposit with Lactobacillus casei LC5 (Lactobacillus casei LC5) on bacteria will be.

Another aspect is a Korea Research Institute of Bioscience and Biotechnology gene bank of the present invention for achieving the above objectives; the Lactobacillus Planta Room LP3 (Lactobacillus plantarum LP3) as an international deposit accession No. KCTC 10782BP the (Korean Collection for Type Culture KCTC) Lactic acid bacteria.

Since the composition of the present invention comprises four kinds of probiotic lactic acid bacteria or cultures thereof, according to the present invention, a composition useful for the treatment of inflammatory diseases, particularly intestinal inflammation, can be provided.

In addition, the composition for preventing or treating inflammatory diseases of the present invention maintains the stability of intestinal microbial cells in a patient, thereby inhibiting the infection of various intestinal pathogenic bacteria and additionally exhibiting a function of suicide action, Therefore, it can be usefully used as a pharmaceutical, a food, or a health functional food as a composition for preventing or treating an inflammatory disease.

1 is a Lactobacillus of the present invention casei LC5 (Lactobacillus casei LC5) of KCTC 12398BP strain 16S rRNA sequence, and homologous and system of the 16S rRNA sequences of the present invention, Lactobacillus casei LC5 and related Lactobacillus genus Lactobacillus species occurring And the phylogenetic relationship.
FIG. 2 shows RAPD (Random Amplified Polymorphic DNA) analysis results and PFGE (Pulse Field Gel Electrophoresis) analysis of the genomic DNA of the lactobacillus case LC5 strain of the present invention.
3 is Lactobacillus Planta room LP3 (Lactobacillus plantarum LP3) KCTC 10782BP 16S rRNA of the strains sequence and Lactobacillus Planta room LP3 strains and related Bifidobacterium homology of the 16S rRNA sequence of Solarium in species of the present invention of the present invention And phylogenetic relationships.
4 shows RAPD analysis results and PFGE analysis results of genomic DNA of Lactobacillus plantarum LP3 strain of the present invention.
Figure 5a is a photograph showing a section fixing performance test results of the Lactobacillus Planta room LP3 strain of the present invention, Figure 5b is a graph showing the sheet fixing performance test results of the Lactobacillus Planta room LP3 strain of the present invention graph.
FIG. 6 is a graph showing the results of comparison of NO (nitric oxide) production in RAW-264.7 cells in a comparative evaluation experiment according to the present invention. FIG.
FIG. 7 is a photograph showing the change in the wall thickness of the colon and an H & E staining result of the composition of the present invention for observing the lesion of the large intestine as a result of the evaluation of the effect of rectal injection on the incidence of TNBS-induced colitis.
FIG. 8 is a photograph showing the change in the wall thickness of the colon and the result of H & E staining for observing the lesion of the large intestine as a result of oral administration of the composition of the present invention on the development of TNBS-induced colitis.
FIG. 9 is a photograph showing the results of analysis of gene expression in colon tissues by administration of the composition of the present invention and analysis of the gene expression by reverse transcription polymerase chain reaction. FIG.

The term "inflammatory disease" in the present invention means a tumor necrosis factor-alpha (TNF-alpha) secreted by macrophage-like immune cells, IL-1 (inflammatory cytokines) such as interleukin-1, IL-6, prostagladin, luecotriene or nitric oxide (NO).

In the present invention, "treatment" means, unless otherwise stated, reversing, alleviating, inhibiting, or preventing an inflammatory disease or condition, or one or more symptoms of the disease or condition.

Another aspect of the present invention relates to a composition for preventing or treating an inflammatory disease, wherein the composition includes the following lactic acid bacterial strains. The lactic acid bacterial strains are selected from Korean Collection for Type Culture (KCTC) Was deposited as follows.

1) Lactobacillus casei LC5 (Lactobacillus casei LC5), KCTC 12398BP,

2) Lactobacillus planta room LP3 ( Lactobacillus plantarum LP3), KCTC 10782BP ,

3) Bifidobacterium lactis Annie Marlies BL3 (Bifidobacterium animali s subsp. Lactis BL3), KCTC 11904BP; And

4) Lactobacillus LR 5 ( L. rhamnosus LR5), KCTC 12202BP.

Lactobacillus casei LC5 (Lactobacillus casei LC5), Lactobacillus Planta Room LP3 ( Lactobacillus plantarum LP3), And Lactobacillus LR5 ( L. rhamnosus LR5) inhibits growth of most harmful bacteria in the intestines.

Bifidobacteria are gram-positive, non-motile, non-sporangial and anaerobic bacterium strains that mainly colonize the large intestine. Because they decompose carbohydrates to form short chain organic acids, especially acetic acid and lactic acid, the surrounding pH is thereby reduced thereby allowing the growth of noxious bacteria and their inhibition of activity. By inhibition of pathogenic bacteria, Bifidobacterium has protective and preventive effects on infection, in particular bacterial enteritis. Bifidobacteria inhibit pathogenic microorganisms, reduce ammonia and fat levels in the blood, restore intestinal microflora damaged by antibiotics, stimulate the immune system, and immunomodulate.

Since lactic acid bacteria belonging to Bifidobacterium are the optimal habitat for the colon, the intake of mixed lactic acid bacteria consisting of lactobacilli belonging to Lactobacillus and Bifidobacterium is considered to be a mixture of lactic acid bacteria consisting of a single species or a small number of different species It is possible to provide higher suitability. When Lactobacillus and Bifidobacterium lactic acid bacteria contained in the present composition are used singly or as a mixture, they provide an effect of inhibiting the growth of harmful bacteria and inducing the proliferation of enteric bacteria in the intestines. In addition, these strains, when used alone or in combination with inflammatory bowel disease model mice, inhibit inflammatory cytokines or chemokines, while inducing the synthesis of anti-inflammatory cytokines. Proinflammatory cytokines or chemokines include those known in the art as being associated with the upregulation of inflammatory responses. Examples include, but are not necessarily limited to, TNF-a, IL-l [beta], IL-6, and IL-18.

The composition of the present invention is effective for the treatment or prevention of inflammatory diseases, particularly inflammatory bowel disease. Examples of such inflammatory bowel diseases include Crohn's disease, ulcerative colitis, intestinal Behcet's disease, simple ulcer, radiation enteritis and ischemic enteritis , Especially for Crohn's disease or ulcerative colitis.

  The composition may contain four kinds of lactic acid bacteria in the same ratio or may contain lactic acid bacteria in the genus Lactobacillus and lactic acid bacteria in the genus Bifidobacterium in a ratio of 1: 1 to 3: 1.

The composition of the present invention contains a mixture of lactic acid bacteria strains as an active ingredient in an amount of 10 ⁸ to 10 ¹² cfu / g, or an equivalent number of live bacteria, relative to the total weight of the composition.

Salicylate composition of the present invention is Bacillus Lactobacillus other than the above-mentioned lactic acid bacteria bariwooseu (Lactobacillus salivarius), Lactobacillus brevis (Lactobacillus brevis), Lactobacillus helveticus (Lactobacillus helveticus), Lactobacillus buffer lactofermentum (Lactobacillus fermentum), Lactobacillus para Kasei ( Lactobacillus paracasei), Lactobacillus del Brewer station (Lactobacillus delbrueckii), Lactobacillus Leu Terry (Lactobacillus reuteri), Lactobacillus boots Neri (Lactobacillus buchneri), Lactobacillus biasing Li (Lactobacillus gasseri), Lactobacillus Johns Needle (Lactobacillus johonsonii), Lactobacillus Kane pireu (Lactobacillus kefir), Lactobacillus nose Syracuse lactis (Lactococcus lactis), Bifidobacterium breather bracket (Bifidobacterium breve), Bifidobacterium Infante Tees (Bifidobacterium infantis), Bifidobacterium may ronggum (Bifidobacterium pseudolongum ), Bifidobacterium thermophilus room ( Bifidobacterium themophilum , and Bifidobacterium adolescentis . The microorganism may further comprise at least one lactic acid bacterium selected from the group consisting of Bifidobacterium spp ., Bifidobacterium themophilum , and Bifidobacterium adolescentis .

The lactic acid bacterial strains are grown by a general culture method for lactic acid bacteria, recovered by a separation process such as centrifugation, and can be prepared into a prodrug form by drying, e.g., lyophilization.

The composition of the present invention may further contain a pharmaceutically acceptable carrier and / or excipient in addition to the above-mentioned effective ingredients. In addition, various other commonly used pharmaceutical additives such as binders, disintegrating agents, coating agents, Can be formulated and formulated.

The composition of the present invention may be formulated into powders, granules, tablets, capsules or liquid form by mixing the lactic acid bacteria with appropriate carriers, excipients, auxiliary active ingredients and the like. The composition of the present invention may be formulated into intramuscular or oral administration products. In addition, the composition of the present invention can be commercialized using a known method, after being passed through the stomach and reaching the small intestine so that the microorganism as the active ingredient is quickly released into the intestines.

Excipients usable in the present invention include sugars such as sucrose, lactose, mannitol, glucose and the like and starches such as corn starch, potato starch, rice starch and partially gelatinized starch. The binder may be a natural-occurring macromolecular substance such as dextrin, sodium alginate, carrageenan, guar gum, acacia, agar, etc., such as polacaccharide, tragacanth, gelatin and gluten, hydroxypropylcellulose, methylcellulose, Cellulose derivatives such as cellulose, ethyl cellulose, hydroxypropyl ethyl cellulose and carboxymethyl cellulose sodium, and cellulose derivatives such as polyvinyl pyrrolidone, polyvinyl alcohol, polyvinylacetate, polyethylene glycol, polyacrylic acid, polymethacrylic acid and vinyl acetate resin Polymer.

Examples of the decomposing agent include cellulose derivatives such as carboxymethylcellulose, carboxymethylcellulose calcium and low substituted hydroxypropylcellulose, and sodium carboxymethyl starch, hydroxypropyl starch, corn starch, potato starch, rice starch and partially pregelatinized starch Of starch can be used.

Examples of lubricants that can be used in the present invention include talc, stearic acid, calcium stearate, magnesium stearate, colloidal silica, hydrous silicon dioxide, various types of waxes and hydrogenated oils and the like.

Examples of the coating agent include dimethylaminoethyl methacrylate-methacrylic acid copolymer, polyvinyl acetal diethylaminoacetate, ethyl acrylate-methacrylic acid copolymer, ethyl acrylate-methyl methacrylate-chlorotrimethylammonium ethyl methacrylate A water-insoluble polymer such as a copolymer, a water-insoluble polymer such as ethylcellulose, a methacrylic acid-ethyl acrylate copolymer, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate succinate and the like and a thickener such as methylcellulose, hydroxypropylmethylcellulose , Polyvinyl pyrrolidone, polyethylene glycol, and the like, but are not limited thereto.

The dose of the lactic acid bacterial strain as an active ingredient in the composition for prevention or treatment of inflammatory diseases of the present invention is appropriately determined in consideration of the purpose of treatment or prevention, the type of patient to be treated or prevented, symptoms of a patient, weight, age, Can be determined. Generally, in the case of an adult patient, 1 x 10 ⁶ or more live cells, preferably 1 x 10 ⁸ to 1 x 10 ¹² live cells can be administered once or divided as needed.

Another aspect of the present invention is Lactobacillus casei LC5 (Lactobacillus casei LC5, (KCTC 12398BP)), Lactobacillus Planta Room LP3 (Lactobacillus plantarum LP3, (KCTC 10782BP)), Bifidobacterium Annie Marlies lactis BL3 (Bifidobacterium animalis subsp. lactis BL3 (KCTC 11904BP)), relates to a Lactobacillus person's nosu LR5 food containing (Lactobacillus rhamnosus LR5 (KCTC 12202BP) or a culture.

The lactic acid bacteria-containing product of the present invention can be ingested as a food or nutritional product such as milk or fermented milk fermented product, or as a food supplement or health functional food. According to one embodiment of the invention, the product may be, but is not necessarily limited to, foods such as dairy products, beverages, juices, soups or foods for children.

In the present invention, a dairy product means any liquid or semi-solid milk or liquid product having various fat contents. The milk product may be, for example, milk, goat's milk, positive milk, cream, full-fat milk, whole milk, low-fat milk or skim milk, Diafiltered milk, microfiltered milk, recombinant milk obtained from milk powder or whey through any processing, processed products such as yogurt, curd, milk, sour whole milk ), Buttermilk, other fermented milk products, for example, viili, filling of snack bars, and the like. Another important group includes milk beverages, for example, milk-containing foods such as whey drinks, fermented milk, concentrated milk, infant and baby milk, ice cream, and sweets.

Another aspect of the present invention relates to novel lactic acid bacteria strains, Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) The Lactobacillus casei LC5 (Lactobacillus casei LC5) Deposits International as an accession number of KCTC 12398BP lactic acid bacteria Korea Research Institute of Bioscience and biotechnology and gene banks; the (Korean Collection for Type Culture KCTC) accession number KCTC the Lactobacillus Planta Room LP3 (Lactobacillus plantarum LP3) as an international deposit 10782BP lactic acid bacteria.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example

1. Lactobacillus casei LC5 ( Lactobacillus casei LC5) Isolation and Identification of KCTC 12398BP Strain

(1) Summary

Isolated from the cheese dairy Lactobacillus casei LC5 (Lactobacillus casei LC5) is the L. casei ^T (ATCC 393) a biochemical method with a control group (API), and molecular biological methods (16s rDNA sequencing, RAPD, PFGE) , And it was confirmed that it was a lactic acid bacterial preparation having function of probiotics through functional (enzyme activity) and safety (antibiotic resistance). Based on these results, the isolated Lactobacillus casei LC5 was deposited with the Korea Research Institute of Bioscience and Biotechnology (KCTC) and granted the accession number KCTC 12398BP.

(2) Isolation and identification

2-1. Isolation of new microorganisms

Cheese was diluted in sterilized anaerobic water by serial dilution method and 1 ml of each dilution was poured into a solid medium of Man-Rogosa-Sharpe (MRS, BD, USA) for 3 days in anaerobic condition. The grown colonies were picked again on the solid medium supplemented with bromocresol purple (BCP) (0.17 g / L) to the MRS and cultured again for 3 days under the same conditions. The BCP indicator determines lactic acid bacteria as a colony where the color around the colonies has changed to yellow, as the lactic acid bacteria form lactic acid and change from purple to yellow when the surrounding pH is lowered. The colonies are taken for biochemical and molecular biochemical identification Respectively.

2-2. Identification of new microorganisms

1) Biochemical identification using API kit

After MRS pure culture one Lactobacillus casei strain in a broth LC5 (Lactobacillus casei LC5) was centrifuged and the supernatant discarded by taking the 1 ㎖ suspended precipitate in the solution CHL 1 ㎖ centrifuged. The precipitate was resuspended in 9 ml of CHL solution and dispensed in an appropriate amount into an API 50 CHL kit. Sterilized paraffin oil was dispensed on the wells and incubated for 3 days in a 37 ° C incubator. The result of the validity test was confirmed by inputting on the API web (https://apiweb.biomerieux.com), and the results are shown in Table 1 below. The isolated lactobacillus casei LC5 was found to utilize various sugars such as glucose, maltose, lactose, mannitol, and sorbitol.

No Carbohydrates Use No Carbohydrates Use 0  Control - 25  Esculine + One  Glycerol + 26  Salicine + 2  Erythritol - 27  Cellobiose + 3  D-Arabinose + 28  Maltose + 4  L-Arabinose + 29  Lactose + 5  Ribose + 30  Melibiose - 6  D-Xylose - 31 Saccharose + 7  L-Xylose - 32  Trehalose + 8  Adonitol + 33  Inuline - 9  β-Methyl-xyloside - 34  Melezitose - 10  Galactose + 35  D-Raffinose + 11  D-Glucose + 36  Amidon - 12  D-Fructose + 37  Glycogene - 13  D-Mannose + 38  Xylitol - 14  L-Sorbose - 39  β-Gentiobiose + 15  Rhamnose + 40  D-Turanose + 16  Dulcitol - 41  D-Lyxose + 17  Inositol + 42  D-Tagatose + 18  Mannitol + 43  D-Fucose - 19  Sorbitol + 44  L-Fucose + 20 alpha -Methyl-D-mannoside + 45  D-arabitol - 21 alpha -Methyl-D-glucoside - 46  L-Arabitol + 22  N-Acetyl glucosamine + 47  Gluconate + 23  Amygdaline + 48  2-Ceto-gluconate + 24  Arbutine + 49  5-Ceto-gluconate -

2) Identification through 16s rDNA gene sequencing

Lactobacillus casei LC5 analyzed the 16s rRNA sequence to identify the strain using molecular biology. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from cheese using Accuprep genome extraction kit (Bioneer, Korea). (MyCycler, BIO-RAD, USA) was performed using primers F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and primer R (5'-AAGGAGGTGATCCAGCC-3') in the 16s rRNA region using the extracted DNA as a template. The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / amp plate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed (see Fig. 1 (A)).

DNA sequencing was performed using the Cluster V method of the DNA star program. L. casei ^T (ATCC 393), and the identity of the nucleotide sequence with those of the highly related species. The 16s rRNA sequence of the isolated strain showed the highest 96.9% identity with L. casei ^T (ATCC 393) as shown in Figure 1 (B)

In addition, an analysis of phylogenetic relationships using the 16s rDNA nucleotide sequences revealed that Lactobacillus casei LC5 strains were bound to the same group as L. casei ^T (ATCC 393) (Fig. 1 (C) of FIG. Therefore, it was confirmed that Lactobacillus casei LC5 strain was genetically belonged to L. casei .

3) Random Amplified Polymorphic DNA (RAPD) analysis

RAPD analysis was performed to extract the genomic DNA from the Lactobacillus casei LC5 isolated from cheese and the isolated DNA as a template _{(GTG) 5 (5'-GTGGTGGTGGTGGTG} 3 ') using primers PCR-RAPD (MyCycler, BIO- RAD , USA). The final product, the PCR product, was stained with EtBr and observed with G: BOX (SYNGENE, UK) and shown in Figure 2 (a).

In addition, PFGE (pulse field gel electrophoresis) analysis was performed by preparing a plug with pure incubated Lactobacillus case LC5 at OD ₆₀₀ = 4 and then digesting the genomic DNA using various enzymes to perform electrophoresis L. casei ^T (ATCC 393), the control group. The results are shown in Fig. 2 (b).

As shown in FIG. 2 (a), the isolated strains showed different band patterns from L. casei ^T (ATCC 393) in RAPD results. In FIG. 2 (a), lane 1 is the result of L. casei ^T (ATCC 393) and lane 2 is the result of Lactobacillus case LC5. Based on the above results, it was confirmed that Lactobacillus casei LC5, a microorganism isolated from cheese, is a new strain different from L. casei ^T (ATCC 393).

Analysis of DNA fingerprint patterns by RAPD or PFGE revealed that LC5 and L. casei ^T (ATCC 393) exhibited similar fingerprint patterns in general, but each strain-specific band was present. Therefore, this molecular analysis of the type Lactobacillus casei LC5 through was confirmed that the novel strain belonging to the Lactobacillus casei species.

Lactobacillus casei was named LC5 (Lactobacillus casei LC5), from 11 April 2013 Accession of the Republic of Korea Patent strain deposited with the firm Korea Research Institute of Bioscience and Biotechnology, Microbial Resources Center (KCTC) the appropriate strains in cheese on the basis of the above results And received grant number KCTC 12398BP.

(3) Functionality and safety

3-1. Functional and Stability of New Microorganisms

1) Enzyme activity Test (API ZYM kit)

The enzymatic activity of Lactobacillus casei LC5 was determined using the API ZYM kit and is shown in Table 2 below. Lactobacillus casei LC5 showed higher enzymatic activity of Naphol-AS-BI-phosphohydrolase and α-Glucosidase than L. casei ^T (ATCC 393). It is known that Naphol-AS-BI-phosphohydrolase activates the phagocytosis of neutrophils in leukocytes and α-glucosidase is an effective enzyme for lactose dehydrogenase deficiency. As can be seen in Table 2, Lactobacillus casei LC5 isolated from dairy products shows better enzyme activity than L. casei ^T (ATCC 393).

Enzyme L. casei ^T (ATCC393) L. casei LC5 1. Control 0 0 2. Alkaline phosphatase 0 One 3. Esterase (C4) 2 2 4. Esterase Lipase (C8) 3 2 5. Lipase (C14) 0 0 6. Leucine arylamidase 5 5 7. Valine arylamidase 5 5 8. Crystine arylamidase 2 2 9. Trypsin 0 0 10. α-Chymotrypsin 0 One 11. Acid phospatase 2 4 12. Naphol-AS-BI-phosphohydrolase One 3 13. α-Galactosidase 0 One 14. β-Galactosidase 5 3 15. β-Glucuronidase 0 0 16. α-Glucosidase 0 3 17. β-Glucosidase 4 5 18. N-Acetyl-β-glucosidase 0 One 19. α-Mannosidase 0 0 20. α-Fucosidase 0 0 0, 0 nmol; 1, 5 nmol; 2, 10 nmol; 3, 20 nmol; 4, 30 nmol; 5, ≥ 40 nmol.

2) Fusing property

The measurement of intestinal fixation of Lactobacillus casei LC5 was carried out on HT-29 cell lines derived from human colon epithelial cells using L. casei ^T (ATCC 393) as a control. HT-29 cell lines treated with each strain for 1 hour, and then the number of viable cells and the number of viable cells were measured. The results are shown in Table 3 below.

L. casei ^T L. casei LC5 Control group Long-term settlement rate (%) 81.25 85.75 00.00

As a result of the measurement of the fixation property, it was confirmed that Lactobacillus casei LC5 exhibited better fixation than L. casei ^T (ATCC 393).

3-2. Stability of new microorganisms

1) Antibiotic resistance

The isolated lactobacillus casein Safety was verified by measuring antibiotic resistance of LC5. Antimicrobial resistance testing was performed using the micro-dilution method recommended by the European Food Safety Authority (EFSA). The antibiotics used in the experiment were 10 kinds of antibiotics such as ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM) Clindamycin (CLM), tetracycline (TET) and chloramphenicol (CP).

For the antibiotics except cinineride, the concentrations of the antioxidants were 512, 256, 128, 64, 32, 16, 8, 4, 2, 1, 0.5 and 0.25 ㎍ / ㎖ for juice mixed with ISO-sensitest juice 10% and MRS juice 90% Concentration, and the thinner was carried out using an E-test strip of BioMeriux.

The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, it was determined whether Lactobacillus case LC5 was resistant to each antibiotic, and the results are shown in Table 3 below.

Lactobacillus casei LC5, a novel lactic acid bacterium, was found to be below the antibiotic resistance criteria proposed by EFSA for all antibiotics used in the experiment. Resistance to vancomycin and streptomycin is not separately required data on vancomycin and streptomycin resistance of Lactobacillus casei in the because the unique characteristics EFSA having the lactic acid bacteria strain of Lactobacillus casei not by the presence of the resistance gene. Therefore, Lactobacillus casei LC5 strain was identified as a safe strain with no concern about antibiotic resistance.

Antibiotic MIC of LC5 EFSA breakpoint (mg / L) Ampicillin (AMP) 0.5 2 Vancomycin (VAN) > 512 n.r Gentamycin (GEN) 8 32 Kanamycin (KAN) 64 64 Streptomycin (ST) 32 n.r Erythromycin (ERM) 0.5 One Clindamycin (CM) 0.25 One synercid (Q / D) 0.5 4 Tetracycline (TET) One 4 Chloramphenicol (CP) One 4 n.r: not required

2. Lactobacillus planta room LP3 ( Lactobacillus plantarum LP3) Isolation and Identification of KCTC 10782BP

(1) Summary

A Lactobacillus separate from the traditional fermented food, kimchi Planta Room LP3 (Lactobacillus plantarum LP3) is L. plantarum ^T (ATCC 14917) biochemical method the control group (API), and molecular biological methods (16s rDNA sequence, RAPD, PFGE ), And it was confirmed that it was a lactic acid bacterial preparation having the function of probiotics through functional (long-term fixation) and safety (antibiotic resistance). Based on these results, Lactobacillus plantata LP3 was deposited with the Korea Research Institute of Bioscience and Biotechnology Resource Center (KCTC) to receive the accession number KCTC 10782BP.

(2) Isolation and identification

2-1. Isolation of new microorganisms

Kimchi was diluted in sterile anaerobic water by serial dilution method and 1 ml of each dilution was poured into a solid medium of Man-Rogosa-Sharpe (MRS, BD, USA) for 3 days in anaerobic condition. The grown colonies were picked again on the solid medium supplemented with bromocresol purple (BCP) (0.17 g / L) to the MRS and cultured again for 3 days under the same conditions. Since the lactic acid bacteria form lactic acid and the pH changes from purple to yellow when the peripheral pH is lowered, the colonies in which the color around the colonies are changed to yellow are judged to be lactic acid bacteria, and biochemical and molecular biochemical identification .

2-2. Identification of new microorganisms

1) Biochemical identification using API kit

1 ml of Lactobacillus plantarum LP3 cultivated pure in MRS broth was centrifuged, and the supernatant was discarded. The precipitate was suspended in 1 ml of CHL solution and centrifuged. The precipitate was resuspended in 9 mL of CHL solution and dispensed in an appropriate amount into an API 50CHL kit. Sterilized paraffin oil was dispensed on the wells and incubated for 3 days in a 37 DEG C incubator to examine the glucose utilization. The results are shown in Table 4 Respectively. It showed whether the use of sugar as having an API results Lactobacillus Planta rooms and 99.9% the same biochemical characteristics analyzed by entering the web (https://apiweb.biomerieux.com), the result is that the strain Lactobacillus This means that the strain belongs to the Bacillus planta .

No Carbohydrates Use No Carbohydrates Use 0  Control - 25  Esculine + One  Glycerol - 26  Salicine + 2  Erythritol - 27  Cellobiose + 3  D-Arabinose - 28  Maltose + 4  L-Arabinose + 29  Lactose + 5  Ribose + 30  Melibiose + 6  D-Xylose - 31 Saccharose + 7  L-Xylose - 32  Trehalose + 8  Adonitol - 33  Inuline - 9 β-Methyl-xyloside - 34  Melezitose + 10  Galactose + 35  D-Raffinose + 11  D-Glucose + 36  Amidon - 12  D-Fructose + 37  Glycogene - 13  D-Mannose + 38  Xylitol - 14  L-Sorbose - 39  β-Gentiobiose + 15  Rhamnose - 40  D-Turanose - 16  Dulcitol - 41  D-Lyxose - 17  Inositol - 42  D-Tagatose - 18  Mannitol + 43  D-Fucose - 19  Sorbitol + 44  L-Fucose - 20 alpha -Methyl-D-mannoside + 45  D-arabitol - 21 alpha -Methyl-D-glucoside - 46  L-Arabitol - 22 N-Acetyl glucosamine + 47  Gluconate + 23  Amygdaline + 48  2-Ceto-gluconate - 24  Arbutine + 49  5-Ceto-gluconate -

2) Identification through 16s rDNA gene sequencing

Genomic DNA was extracted from 1 ml of a pure culture broth of Lactobacillus plantarum LP3 strain using an Accuprep Gemomic Extraction kit (Bioneer, Korea). PCR (MyCycler, BIO-RAD, USA) was performed using the extracted DNA as a template using the primer F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and the primer R (5'-AAGGAGGTGATCCAGCC-3' . The PCR products were ligated into pGEM-T Easy vector (Promega, USA) and transformed into E. coli DH5α. Transformed transformants were plated on LB / X-gal / amp plates and cultured overnight at 37 ° C. The recombinant plasmid containing the 16s rDNA gene was isolated from the selected transformant, and the nucleotide sequence of the cloned DNA fragment was determined through DNA sequencing, as shown in FIG. 3 (A).

The determined DNA sequence was cloned into the L. plantarum ^T (ATCC 14917), and the identity of the nucleotide sequences with those of the highly related species. As a result, as shown in FIG. 3 (B), Lactobacillus plantarum LP3 strain showed the highest 99.9% identity with L. plantarum ^T (ATCC 14917).

In addition, an analysis of the evolutionary relationship using 16s rDNA gene sequences revealed that Lactobacillus plantarum LP3 strain was bound to the same group as L. plantarum ^T (ATCC 14917) )). Therefore, the Lactobacillus plantarum LP3 strain was genetically modified to contain Lactobacillus planta Were identified as belonging to the species.

3) DNA fingerprint analysis by RAPD and PFGE

PCR-RAPD (MyCycler, BIO-RAD, USA) was performed using primers (GTG) ₅ (5'-GTGGTGGTGGTGGTTG-3 ') primer with genomic DNA extracted from Lactobacillus plantarum LP3 strain. After staining with EtBr, it was observed with a UV illuminator (G: BOX, SYNGENE, UK) (Fig. 4 (a)).

PFGE analysis was performed by culturing Lactobacillus plantarum LP3 in pure medium to obtain a final absorbance (OD) of 4 to prepare a plug, and then digested with various restriction enzymes (SmaI, ApaI, XhoI). The cleaved DNA fragments were electrophoresed and compared with the control group L. plantarum ^T (ATCC 14917) (Fig. 4 (b)).

Analysis of DNA fingerprint patterns by RAPD or PFGE revealed that Lactobacillus plantarum LP3 and L. plantarum ^T (ATCC 14917) exhibited similar fingerprint patterns in general, but each strain - specific band was present. Therefore, through such molecular typing analysis, Lactobacillus plantarum LP3 reaffirmed that it is a novel strain belonging to L. plantarum species.

Based on the above results, the strain isolated from cheese was used as a lactobacillus planta LP3, and deposited with the Korea Biotechnology Research Center, Microorganism Resource Center (KCTC), a depository of the Korean patented strain, on March 21, 2005, and received the accession number KCTC 10782BP.

3. Functionality and stability

3-1. Functioning of new microorganisms

1)

Lactobacillus plantarum LP3 was determined on HT-29 cell line derived from human colon epithelial cells using L. plantarum ^T (ATCC 14917) as a control. HT-29 cell line treated with each strain for 1 hour and then stained with Gram stain and counted viable cell counts. The results are shown in Table 5 and Figs. 5a-5b.

L. plantarum ^T L. plantarum LP3 Control group Retention rate (%) 80.85 84.93 00.00

As a result of the measurement of the fixation property, Lactobacillus plantarum LP3 was found to exhibit excellent fixing ability over L. plantarum ^T (ATCC 14917).

3-2. Stability of new microorganisms

1) Antibiotic resistance

Isolated Lactobacillus planta room The safety was verified by measuring the antibiotic resistance of LP3. Antimicrobial resistance testing was performed using the micro-dilution method recommended by the European Food Safety Authority (EFSA). The antibiotics used in the experiment were 10 kinds of antibiotics such as ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM) Clindamycin (CLM), tetracycline (TET) and chloramphenicol (CP).

For the antibiotics except cinineride, the concentrations of the antioxidants were 512, 256, 128, 64, 32, 16, 8, 4, 2, 1, 0.5 and 0.25 ㎍ / ㎖ for juice mixed with ISO-sensitest juice 10% and MRS juice 90% Concentration, and the thinner was carried out using an E-test strip of BioMeriux.

The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, it was confirmed whether Lactobacillus plantarum LP3 was resistant to each antibiotic and is shown in Table 6 below.

Lactobacillus plantarum LP3, a novel lactic acid bacteria host, appeared to be below the antibiotic resistance criteria proposed by EFSA for all antibiotics used in the experiment. The resistance to vancomycin and streptomycin is not due to the presence of the resistance gene but to the lactobacillus strains of Lactobacillus plantarum . EFSA therefore requires data on vancomycin and streptomycin resistance in lactobacillus plutarium Do not. Therefore, Lactobacillus plantarum LP3 strain was found to be a safe strain with no concern about antibiotic resistance.

Antibiotic MIC of LP3 EFSA breakpoint (mg / L) Ampicillin (AMP) 2 2 Vancomycin (VAN) 256 n.r Gentamycin (GEN) 16 16 Kanamycin (KAN) 64 64 Streptomycin (ST) 256 n.r Erythromycin (ERM) One One Clindamycin (CM) One One synercid (Q / D) 0.38 4 Tetracycline (TET) 32 32 Chloramphenicol (CP) 8 8 n.r: not required

Experimental Example

1. Animal models

Six-week-old female ICR mice were purchased from Hyochang Science (Daegu, Korea) and treated according to the protocol approved by the Animal Resource Center of Inje University. Mice were housed in a polyethylene cage containing clean sawdust and ad libitum feeding rodent feed and water. Experimental animals were kept at 22 - 25 ℃ in temperature and 55% in humidity, and light and dark at 12 - hour intervals. The experimental animals were used for the experiment after a 2-week adaptation period

2. Preparation of composition for prevention / treatment of inflammatory bowel disease

(1) Lactic acid bacteria fermentation medium

The fermentation medium for the cultivation of the lactic acid bacteria strain contained in the composition of the present invention is a fermentation medium containing 1% -10% (w / v) aqueous solution of skimmed milk powder and soy protein isolate, respectively, (Delvolase; DSM, Netherlands) in the range of -1% (w / w).

After the enzyme treatment, the yeast extract in the range of 0.1% to 5% (w / v), the yeast extract in the range of 0.1% to 5% (w / v), the starch such as sucrose, Addition of ionic constituents of soymilk citrate, sodium acetate, dipotassium phosphate, magnesium sulfate, manganese sulfate, sodium chloride in the range of 5% (w / v) soy peptone, 0.01% -0.1% (w / v) And dissolved to prepare a lactic acid bacteria culture medium. The prepared culture medium for lactic acid bacteria was sterilized using a heat exchanger.

(2) Cultivation of lactic acid bacteria and production of lactic acid bacteria

The lactic acid bacterium pre-cultured on the fermentation broth of the lactic acid bacteria prepared in the step (1) was inoculated at a level of 0.1% -1% (v / v) and maintained at 37 ° C and a pH of 5.0-6.0. Followed by fermentation for 18 hours. After the cultivation of the lactic acid bacteria was completed, the lactic acid bacteria were separated and concentrated using a continuous centrifuge. The isolated lactic acid bacteria were lyophilized by adding a cryoprotectant, etc., followed by pulverizing the lactic acid bacteria using a pulverizer to have a uniform particle size and then producing lactic acid bacteria.

(3) Preparation of Lactic Acid Bacteria Composition

The lactic acid bacteria prepared in the step (2) were measured to have the following viable cell counts;

Lactobacillus casei LC5 lactic acid bacteria (1.25 x ^{10 8} CFU / g or more),

Lactobacillus plantarum LP3 lactic acid bacteria (1.25 × ^{10 8} CFU / g or more),

Bifidobacterium animaris Lactis BL3 bifidobacteria (1.25 x ^{10 9} CFU / g or more),

Lactobacillus Lambsos LR5 lactic acid bacteria (1.25 x ^{10 8} CFU / g or more).

The composition of the present invention is abbreviated as "ATP" composition. In this example, each lactic acid bacterial species was mixed with excipient and the total viable cell count was 5 × 10 ⁸ CFU.

3. In vitro anti-inflammatory activity (confirmation of suppression of NO secretion)

Nitric oxide (NO) is an important intracellular proinflammatory mediator, which reacts with a superoxide radical to produce peroxynitrite anion (ONOO-). The nitrite peroxide thus produced induces inflammatory activity and causes arthritis, ulcers It is known to cause a variety of pathological conditions such as sexually transmitted disease, sexually transmitted disease, and systemic lupus erythematosus. Therefore, the inflammatory reaction can be inhibited by a mechanism of inhibiting nitric oxide (NO) production. To investigate the effect of the composition of the present invention on the secretion amount of NO in RAW 264.7 macrophages, the following experiment was conducted.

Cell culture was collected and the amount of NO produced was measured with Griess reagent (1% sulfanilamide / 0.1% naphthylethylene diamine dihydrochloride / 2% phosphoric acid) (Griess et al., 1982). Briefly, 100 μl of each culture supernatant was mixed with the same amount of the grease reagent for 10 minutes at room temperature, and then the concentration of nitrite (indicator of nitric oxide) was measured. At this time, nitrite was measured in a medium using a color reagent based colorimetric method. The substrate for nitric oxide (NO), L-arginine, is converted to L-citrulline and nitrogen monoxide, which quickly turns into stable nitrogen dioxide, nitrite, and nitrate. The Greek reagent chemically reacts with nitrite to form a purple azo salt, which is consistent with the concentration of nitrogen monoxide, and can be determined by measuring the nitrite concentration from the concentration of the azo salt and measuring its maximum absorption at 540 nm.

In detail, RAW 264.7 macrophages were diluted in DMEM medium containing 10% FBS to make a density of 50,000 cells / well, and then they were added to a 24-well plate and cultured for 24 hours to adhere to the wall. RAW 264.7 cells were treated with the novel Lactobacillus casei LC5 strain (2.5 × 10 ⁶ CFU), Lactobacillus plantarum LP3 strain (2.5 × 10 ⁶ CFU) and the ATP composition containing them, treated with dexamethasone (Dex) was used as an anti-inflammatory control. After incubation for 1 hour with new strains and compositions, cells were treated with LPS at a concentration of 0.1 μg / ml and incubated in a 37,5% CO ₂ incubator for 15 hours. The amount of NO (NO) Respectively. Namely, absorbance of nitrite (NO ₂ -) was measured by TACS MTT analysis (R & D systems) after 100 μl of the cell culture solution was mixed with the same amount of a grease reagent. After replacing the culture supernatant in each well with fresh DMEM medium, the MTT reagent was treated until it became a purple precipitate. The absorbance was then measured at 595 nm to obtain a standard curve, and the concentration of NO was calculated.

As a result, as shown in Fig. 6, it was found that the nitrite level was reduced in a concentration-dependent manner in the example of the present invention (ATP) treated treatment as compared to the comparative example in which macrophages were treated with LPS only. In detail, the nitrite reduction was doubled in the experimental group treated with the composition of the present invention at 2 or 4 mg / ml, respectively (see 5) and 6) of FIG. 6 (A)). Thus, it was confirmed that the composition of the present invention effectively inhibited the production of nitric oxide (NO) induced by LPS in RAW 264.7 macrophages, thus having strong anti-inflammatory activity. In addition, it can be seen that Lactobacillus casei and Lactobacillus strain LC5 Planta room LP3 strain also shows an anti-inflammatory effect by inhibiting NO production.

Meanwhile, in order to confirm whether the composition of the present invention has an inhibitory effect on the viability of RAW-264.7 cells, MTT reduction assay was performed. As shown in FIG. 6 (B), there was almost no effect on the cell density . This suggests that the composition of the present invention regulates only NO production without affecting the number of cells in the culture. Thus, these results demonstrate that the composition of the present invention has antiinflammatory activity in vitro.

Lane 1) in FIG. 6 is treated only with vehicle without LPS treatment, lanes 2) and 3) are treated with vehicle and dexamethasone (Dex) before LPS treatment, and lanes 4), 5) and 6) Were the results of the experimental group treated with 1, 2, and 4 mg / ml of the composition of the present invention before LPS treatment. 7) is the result of the experimental group treated with the lactobacillus case LC5 strain of the present invention, and 8) is the result of the experimental group treated with the lactobacillus plantarum LP3 strain of the present invention. The P value was less than 0.05 compared to the LPS-treated control group as a statistically significant case.

Since NO generated by macrophages plays an important role in the immune response, NO production from LPS-treated RAW-264.7 macrophages is a good model for studying inflammation in vitro. In this Example, the anti-inflammatory activity of the compositions of the present invention comprising the lactobacillus case LC5 strain of the present invention, the lactobacillus plantarum LP3 strain, and the four kinds of probiotic strains containing them was examined, It was confirmed that the composition remarkably suppressed NO production induced by LPS in a dose-dependent manner.

4. In vivo ( in vivo ) Anti-inflammatory activity

The in vivo inflammatory activity of the composition of the present invention was evaluated using trinitrobenzene sulfonic acid (TNBS) induced colitis model mouse which is the closest model to human colitis.

TNBS, a contact sensitizing allergen, is administered enema to the large intestine with ethanol, which can cause colitis. At this time, ethanol breaks the mucosal barrier and makes TNBS enter the barrier. When TNBS enters the intestine, it causes acute allograft necrosis due to oxidative damage, acute necrosis and inflammation within a few days after enema, followed by chronic inflammation with mononuclear infiltration. These TNBS-induced colitis models are similar to those of inflammatory bowel disease in humans, because they are repetitive, can obtain an anterior wall ulcer, can induce chronic inflammation because they are immunologically mediated lesions.

2% TNBS solution (dissolved in 50% alcohol, Sigma) was used as an inflammatory bowel disease inducer. A 6-week-old male Sprague-Dawley rats fasted for 24 hours were injected with 130 μl of TNBS solution, injected with polyethylene tube to induce colitis, inverted for 30 seconds, and placed in a cage. The effects of the compositions of the present invention on TNBS induced inflammation were evaluated according to two protocols: rectal administration and oral administration.

1) Inhibitory effect of TNBS-induced intestinal inflammation by rectal injection

In the rectal administration protocol, a mixture of 2% TNBS and the composition of the present invention was injected into the large intestine and the inflammation changes after the injection were examined. In addition, inflammation after Lactobacillus casei LC5 strain and Lactobacillus Planta room anti-inflammatory effects of LP3 strain also injected into the colon a mixture of each strain 2% TNBS with these in order to confirm, and scanning included in the compositions of the present invention Changes were investigated. At this time, the animal models were divided into seven groups: injected together with the vehicle and control group injected with 50% ethanol alone, the TNBS-treated control group injected with vehicle and 2% TNBS, and the ATP composition of the present invention and 2% TNBS One of three composition treatment groups of the present invention (1 mg (5 x 10 ⁶ CFU), 2 mg (1 x 10 ⁷ CFU), and 4 mg (2 x 10 ⁷ CFU), 2% TNBS and Lactobacillus casei LC5 (2.5 × 10 ⁶ CFU) injected together with 2% TNBS and Lactobacillus plantarum LP3 strain (2.5 × 10 ⁶ CFU). All treatment groups included three or more mice.

The tissue section of the large intestine close to the anus was excised and the wall thickness of the large intestine was measured. The large intestine was dissected to examine ulcer and inflammatory lesions. The results are shown in Fig. 7 (A).

On the other hand, the resected tissue was preserved in 10% formaldehyde, and the fixed tissue was inserted into the OCT compound, which was then sectioned by the freezing section method. The 5 ㎛ sections were stained with hematoxylin and eosin, and the damage of epithelial mucosal cells and the infiltration of anti - inflammatory cells into the colon tissues were examined by light microscope. A micrograph is shown in Fig. 7 (B).

On the other hand, in the mice treated with TNBS alone, the thickness of the large intestine wall was considerably thick (2 in Fig. 7A), whereas in the mice in which TNBS and the ATP composition of the present invention were simultaneously injected with concentration, 4 and 5). Colonic wall thickness tended to decrease in mice injected with TNBS, Lactobacillus casei LC5 strain or Lactobacillus plantarum LP3 strain. These results indicate that the lactic acid bacteria composition of the present invention protects the large-walled tissue from TNBS-induced edematous changes.

7 (B), mice treated with TNBS only showed lesions similar to inflammatory bowel disease, i.e., inflammation and hemorrhage, in the area treated with TNBS, whereas mice treated with the ATP composition of the present invention and TNBS in the rectum No inflammatory changes were observed. Lactobacillus casei LC5 strain or Lactobacillus plantarum LP3 strain was injected rectally with 2% TNBS, and the mice showed almost no inflammatory reaction.

Referring to Figure 7 (B), when looking at the surface of the large wall, necrotic damage induced by TNBS is blocked when TNBS and the composition of the present invention are co-injected. The surface of the large wall of the mice injected with the composition of the present invention and TNBS into the rectum was observed in the control group without treatment with TNBS 7 (B) 1))) (4) and 5) of Fig. 7 (B). All these results indicate that the lactic acid bacteria composition of the present invention prevents TNBS-induced inflammatory changes in a dose-dependent manner.

2). Inhibition of TNBS-induced intestinal inflammation by oral administration

To determine whether the composition of the present invention changed the intestinal tissue and inhibited TNBS-induced inflammation changes, the effect of the compositions of the present invention on TNBS-induced colitis was evaluated.

The compositions of the present invention were orally administered to the mice prior to injection of TNBS into the rectum. Briefly, 4 mg (2 x < ⁷ > CFU) of the inventive composition was orally administered to mice three times a day for two consecutive days before TNBS was injected into the rectum. In this experiment, animal models were divided into five groups: a control group in which the vehicle was orally administered and 50% ethanol was injected into the rectum; TNBS-treated control group in which vehicle was orally administered and 2% TNBS was injected into the rectum; And 4 mg of the composition of the present invention were orally administered and 2% TNBS was injected into the rectum, a group treated with orally administered Lactobacillus casei LC5 strain and injected with 2% TNBS into the rectum and a group of lactobacillus < RTI ID = 0.0 > Group Lentanum LP3 was orally administered and 2% TNBS injected into the rectum. All treatment groups included three or more mice.

In order to confirm the degree of inflammatory changes in the colon tissue, comparison of the thickness of the colon wall, necrosis of the colon surface, and histological analysis of the colon tissue fragment were carried out. The results are shown in Figs. 8A-8B .

As can be seen from Figures 8a-8b, the TNBS-induced inflammatory changes were significantly inhibited in mice previously administered with the compositions of the present invention. (FIG. 8 (A) 3)) compared to the TNBS-treated control group (2 of FIG. 8 (A)) showed that the colorectal wall thickness was remarkably decreased and the TNBS- And it was close to the wall thickness of the control group (1 in Fig. 8 (A)). Lactobacillus casei LC5 strain was orally administered, 2% TNBS injected into the rectum, and Lactobacillus plantarum LP3 strain were orally administered and 2% TNBS injected into the rectum.

When the composition of the present invention was previously administered orally, the colon surface of the colon was examined to reveal no necrotic damage (FIG. 8B (B)). The surface of the intestinal tissue was very dark due to hemorrhagic necrosis of the large intestine in the TNBS-treated mouse (2 of (B) of FIG. 8B), whereas the composition of the present invention was administered orally B) 2)) did not show any necrosis on the intestinal wall surface as in the TNBS-untreated control group (1 in Fig. 8 (B)).

The composition of the present invention inhibited the ulcerative damage and eosinophil infiltration of the mucosal epithelium mucosa caused by TNBS in the oral administration as in rectal administration (Fig. 8 (C)). The epithelial tissues were completely destroyed in the mucosal epithelial mucosa of the mice treated with TNBS (Fig. 8B, (2)), but these lesions completely disappeared in the colon tissues of mice administered with the composition of the present invention (C) 3)). These results indicate that oral administration of the composition of the present invention allows the colon tissue to be controlled to block the inflammatory onset and tissue damage caused by TNBS.

In general, the known features of inflammatory bowel disease are NO production, post-colonic wall murmur, hemorrhagic necrosis, leukocyte infiltration, and epithelial mucosal cell destruction. This example demonstrates that the composition of the present invention inhibits inflammatory process progression and TNBS- Of the present invention.

Even when the compositions of the present invention were orally administered, the inflammatory changes induced by rectal injection were blocked because the antiinflammatory effect of the composition of the present invention was only due to the direct interaction between the composition of the present invention and TNBS It is not. The composition of the present invention is presumed to alter the microenvironment of the large intestine to withstand inflammatory changes.

5. Evaluation of the effect on the expression of cytokines in rectal tissues

Since cytokines and other immunomodulators are involved in the regulation of the inflammatory response in inflammatory bowel disease, we examined whether the expression of these genes is affected by the administration of the composition of the present invention. Concentrations of cytokines in the colon tissues were determined by reverse transcriptase-polymerase chain reaction (RT-PCR). 4 mg of the composition of the present invention was administered three times a day for two days, and then RNA was prepared using a cutaneous tissue section of a mouse injected with 2% TNBS into the rectum. Fillers were orally administered and RNA was also prepared from tissue sections from control mice injected with TNBS into the rectum. Total RNA was prepared using the SV Total RNA Isolation System according to the manufacturer's instructions, and cDNA was PCR amplified using primers set for mouse Fas, FasL, IL-6 and β-actin genes. PCR primer sets GGCACCAGGGTGTGATGG and ACGGTTGGCCTTAGGGTTC were selected for β-actin and sets TGCACTTGCAGAAAACAATC and TGGTCTTGGTCCTTAGCC were selected for IL-6. Primer sets CAACACAAATCTGTGGCTACCG and CCCATATCTGTCCAGTAGTGCA were synthesized for FasL and primer sets AGGAATTCGTGTGAACATGGAACCCT and AGAAGCTTCACTCCAGACATTGTCCT were selected for Fas. The PCR reaction was carried out by the following procedure. Annealing at 94 DEG C for 4 seconds, annealing at 94 DEG C for 4 seconds, annealing at 60 DEG C for 4 seconds, extension at 72 DEG C for 45 seconds, and 30 times of reaction. The final extension was performed at 72 DEG C for 10 minutes Respectively.

In this Example, the effect of the composition of the present invention on the transcription level of the pre-inflammatory or immunomodulatory cytokine gene in the colon tissue was examined. After the mice were treated with TNBS only or mixed with TNBS and the composition of the present invention, colon tissues around the injection site of TNBS were recovered to prepare RNAs, and changes in gene expression patterns were examined. The results are shown in FIG.

9, the expression of IL-6 and FasL genes was decreased in the colon tissues of the mice to which the composition of the present invention (4 mg) was orally administered (2 in FIG. 9) The expression of the gene was upregulated in mice treated with only 2% TNBS (1 in FIG. 9). The expression of Fas gene was not different.

Since IL-6 and FasL expression levels are increased in patients with inflammatory bowel disease, the down-regulation of IL-6 and FasL expression by administration of the composition of the present invention indicates that the composition of the present invention can prevent inflammation in the large intestine . Since IL-6 is a pro-inflammatory cytokine that plays an important role in the inflammation of inflammatory bowel disease, the lactic acid bacterial composition of the present invention exhibits anti-inflammatory activity by inhibiting the expression of IP-6 gene can see.

 Since FasL is responsible for cell death and is involved in the production of pro-inflammatory cytokines including IL-6, down-regulation of FasL gene expression by the composition of the present invention is also associated with inhibition of TNBS-induced inflammatory changes. Since Fas and FasL are death receptors that play a role in the T-cell mediated cytotoxic effector mechanism that their interactions play a role in tissue damage, down-regulation of FasL by the compositions of the present invention can be accomplished by TNBS Describe the protective effect against induced colon tissue damage. Assuming that FasL is involved in tissue damage through apoptosis of macrophage cells by infiltrating leukocytes, down-regulation of FasL by the composition of the present invention can be assumed to inhibit apoptotic tissue damage.

The present invention can be variously modified and changed without departing from the spirit and scope thereof, and such facts will be apparent to those skilled in the art. The specific embodiments described herein are merely illustrative of preferred embodiments of the invention and should not be construed as limiting the invention. It is intended that the scope of protection of the present invention be defined by the appended claims, and that the various modifications and variations are intended to be included within the scope of the present invention.

Korea Biotechnology Research Institute KCTC12398BP 20130411 Korea Biotechnology Research Institute KCTC10782BP 20050321 Korea Biotechnology Research Institute KCTC12202BP 20120507 Korea Biotechnology Research Institute KCTC11904BP 20120507

Claims (12)

Lactobacillus casei LC5 (Lactobacillus casei LC5, (KCTC 12398BP)), Lactobacillus Planta Room LP3 (Lactobacillus plantarum LP3, (KCTC 10782BP)), Bifidobacterium Annie Marlies lactis BL3 (Bifidobacterium animali s subsp. Lactis BL3 (KCTC 11904BP)), and Lactobacillus person's nosu LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP ) or inflammatory disease preventing or treating composition, including those of the culture.
The composition according to claim 1, wherein the composition comprises, as an active ingredient, a lactic acid bacterium mixture in a content of 10 ⁸ to 10 ¹² cfu / g, or an equivalent number of viable bacteria, relative to the total weight of the composition A composition for preventing or treating an inflammatory disease.
The composition according to claim 1, wherein the composition is useful for the prophylaxis or treatment of inflammatory bowel disease selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, and ischemic enteritis.
delete The composition for preventing or treating inflammatory diseases according to claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier or excipient.
The composition according to claim 1, wherein the composition comprises lactic acid bacteria of the genus Lactobacillus and genus Bifidobacterium bifidobacterium in a ratio of 1: 1 to 3: 1 live cells.
The composition for preventing or treating an inflammatory disease according to claim 1, wherein the composition comprises four kinds of lactic acid bacteria in the same ratio of viable cells.
The composition for preventing or treating an inflammatory disease according to claim 1, wherein the composition is prepared by lyophilizing lactic acid bacteria and bifidus bacteria in a biocide form.
A pharmaceutical product comprising a composition for preventing or treating an inflammatory disease containing lactic acid bacteria according to any one of claims 1 to 3 and 5 to 8.
Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) international deposit accession No. KCTC the Lactobacillus casei LC5 (Lactobacillus casei LC5) lactic acid as a 12398BP. Korea Research Institute of Bioscience and Biotechnology Gene Bank; the Lactobacillus Planta Room LP3 (Lactobacillus plantarum LP3) as an international deposit accession No. KCTC 10782BP the (Korean Collection for Type Culture KCTC) Lactobacillus.
Lactobacillus casei LC5 (Lactobacillus casei LC5, (KCTC 12398BP)), Lactobacillus Planta Room LP3 (Lactobacillus plantarum LP3, (KCTC 10782BP)), Bifidobacterium Annie Marlies lactis BL3 (Bifidobacterium animali s subsp. Lactis BL3 (KCTC 11904BP)), and Lactobacillus person's nosu LR5 (Lactobacillus rhamnosus LR5 (KCTC 12202BP ) or foods containing these cultures.

Images